ABCMdb

ABCG2 p.Gln141Lys

ClinVar:	c.421C>A , p.Gln141Lys ? , association
Predicted by SNAP2:	A: D (63%), C: D (75%), D: D (80%), E: D (59%), F: D (75%), G: D (80%), H: D (59%), I: D (66%), K: D (80%), L: D (66%), M: D (63%), N: D (66%), P: D (85%), R: D (66%), S: D (63%), T: D (63%), V: D (63%), W: D (71%), Y: D (66%),
Predicted by PROVEAN:	A: D, C: D, D: N, E: N, F: D, G: D, H: N, I: D, K: N, L: D, M: D, N: N, P: D, R: N, S: N, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] C421A polymorphism in the human breast cancer resi... Mol Cancer Ther. 2002 Jun;1(8):611-6. Imai Y, Nakane M, Kage K, Tsukahara S, Ishikawa E, Tsuruo T, Miki Y, Sugimoto Y
C421A polymorphism in the human breast cancer resistance protein gene is associated with low expression of Q141K protein and low-level drug resistance.
Mol Cancer Ther. 2002 Jun;1(8):611-6., [PMID:12479221]

Abstract [show]
Breast cancer resistance protein (BCRP) confers multidrug resistance to cancer cells against agents such as SN-38 (an active metabolite of irinotecan), mitoxantrone, and topotecan. Among 59 human tumor cell lines tested, 6 cell lines, A549, NCI-H460, KM-12, HT-29, OVCAR-5, and RPMI8226, showed high BCRP expression. BCRP cDNA was isolated from 11 cancer cell lines and three variant cDNAs [G34A substituting Met for Val-12 (V12M), C421A substituting Lys for Gln-141 (Q141K), and 944-949 deletion lacking Ala-315 and Thr-316 (delta315-6)] were identified. G34A and C421A variants were polymorphisms, and 944-949 deletion was a splicing variant. C421A BCRP-transfected PA317 cells showed markedly decreased protein expression and low-level drug resistance compared with wild-type BCRP-transfected cells when transfectants expressed similar levels of BCRP mRNA. G34A or 944-949-deleted BCRP-transfected PA317 cells showed similar or somewhat lower protein expression and drug resistance compared with wild-type BCRP-transfected cells. Of 124 healthy Japanese volunteers, 67 were wild-type, 48 were heterozygous, and 9 were homozygous for the C421A allele. These results suggest that some people possess the C421A polymorphic BCRP gene and express low amounts of Q141K BCRP. In addition to that, C376T polymorphism in exon 4 substituting stop codon for Gln-126 was found in 3 of the 124 general Japanese population. This C376T polymorphism may also have high impact because active BCRP protein will not be expressed from the C376T allele. Therefore, people with C376T and/or C421A polymorphisms may express low amounts of BCRP, and this low BCRP expression might result in hypersensitivity of normal cells to such anticancer drugs as irinotecan and mitoxantrone.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Access the articles at: E-mail alerts related to this article or journal.Sign up to receive free email-alerts Subscriptions Reprints and .pubs@aacr.orgDepartment at To order reprints of this article or to subscribe to the journal, contact the AACR Publications Permissions .permissions@aacr.orgDepartment at To request permission to re-use all or part of this article, contact the AACR Publications C421A Polymorphism in the Human Breast Cancer Resistance Protein Gene Is Associated with Low Expression of Q141K Protein and Low-Level Drug Resistance1 Yasuo Imai, Minoru Nakane, Kumie Kage, Satomi Tsukahara, Etsuko Ishikawa, Takashi Tsuruo, Yoshio Miki, and Yoshikazu Sugimoto2 Division of Molecular Biotherapy [Y. I., M. N., K. K., S. T., E. I., Y. S.] and Division of Experimental Chemotherapy [T. T.], Cancer Chemotherapy Center, and Department of Molecular Diagnosis [Y. M.], Cancer Institute, Japanese Foundation for Cancer Research, Tokyo 170-8455, and Institute of Molecular and Cellular Biosciences, University of Tokyo, Tokyo 113-0032 [T. T.], Japan Abstract Breast cancer resistance protein (BCRP) confers multidrug resistance to cancer cells against agents such as SN-38 (an active metabolite of irinotecan), mitoxantrone, and topotecan. Login to comment
5 BCRP cDNA was isolated from 11 cancer cell lines and three variant cDNAs [G34A substituting Met for Val-12 (V12M), C421A substituting Lys for Gln141 (Q141K), and 944-949 deletion lacking Ala-315 and Thr-316 (⌬315-6)] were identified. Login to comment
10 These results suggest that some people possess the C421A polymorphic BCRP gene and express low amounts of Q141K BCRP. Login to comment
60 PA317 cells transfected with wild-type, G34A, C421A, and 944-949-deleted BCRP cDNAs were designated PA/WT, PA/V12M, PA/Q141K, and PA/⌬315-6 cells, respectively. Login to comment
92 Western blotting of mutant BCRP-transfected PA317 cells demonstrated markedly low expression of Q141K BCRP in PA/Q141K cells compared with other BCRP-transfected cells. Login to comment
96 In contrast, Northern blotting demonstrated similar levels of BCRP mRNA in PA/WT, PA/V12M, PA/ Q141K, and PA/⌬315-6 cells (Fig. 3B). Login to comment
97 These results suggest that Q141K BCRP is unstable when expressed in mammalian cells. Login to comment
104 Table 1 BCRP cDNA variants identified in this study Variant Amino acid change Cell line G34A Val-12 to Met MCF-7a C421A Gln-141 to Lys MDA-MB-231a A549a HCT-116a Deletion of 944-949 Deletion of Ala-315 and Thr-316 MCF-7 A549 HT-29 SK-OV-3 a Heterozygous allele. Login to comment
118 In contrast, PA/Q141K cells showed a 12-fold greater resistance to SN-38 and a 4-fold greater resistance to mitoxantrone (Table 2; Fig. 4A). Login to comment
119 This means that PA/Q141K cells are 2-3 times more sensitive to these drugs compared with PA/WT cells. Login to comment
120 These results support the low expression of BCRP in PA/Q141K cells. Login to comment
126 Increases of mean fluorescence channel number in PA/ WT, PA/V12M, and PA/⌬315-6 cells were 1.5-, 1.6-, and 1.5-fold in the presence of topotecan, respectively. Login to comment
127 There was a stronger peak shift to the right in PA/Q141K cells than PA/WT cells, showing that topotecan uptake in PA/Q141K cells was higher than that in PA/WT cells, and the increase of mean fluorescence channel number in PA/Q141K cells was 2.1-fold in the presence of topotecan (Fig. 5). Login to comment
128 This suggests that the topotecan efflux activity of exogenous BCRP is low in PA/Q141K cells. Login to comment
137 PA317 cells transfected with wild-type, G34A, C421A, and 944-949-deleted BCRP cDNAs were termed PA/WT, PA/V12M, PA/Q141K, and PA/⌬315-6, respectively. Login to comment
145 Table 2 IC50 a (ng/ml) of BCRP-transfected PA317 cells PA317 PA/WT PA/V12M PA/Q141K PA/⌬315-6 SN-38 2.5 98 98 30 55 Mitoxantrone 0.060 0.58 0.63 0.25 0.42 Topotecan 17 Ͼ200 Ͼ200 100 190 a IC50s (drug dose causing 50% inhibition of cell growth) were determined from cell growth curves in each experiment. Login to comment
148 PA317 cells transfected with wild-type, G34A, C421A, and 944-949- deleted BCRP cDNAs were termed PA/WT, PA/V12M, PA/Q141K, and PA/⌬315-6, respectively. Login to comment
149 A, sensitivity to SN-38 (A-1), mitoxantrone (A-2), and topotecan (A-3) of PA317, PA/WT, PA/V12M, and PA/Q141K cells. Login to comment
151 F, PA317; E, PA/WT; ‚, PA/V12M; Ⅺ, PA/Q141K; ᭛, PA/⌬315-6. Login to comment
163 PA/Q141K cells were significantly more sensitive to anticancer agents than the other BCRP transfectants. Login to comment
164 Intracellular topotecan accumulation of PA/Q141K was higher than that in the other BCRP transfectants. Login to comment
165 By Western blotting, BCRP expression in PA/Q141K cells was markedly lower than that in the other BCRP transfectants. Login to comment
166 Another transfection experiment of mutant BCRP cDNAs in KB-3-1 human epidermoid carcinoma cells also revealed markedly lower expression of Q141K BCRP compared with wild-type and V12M BCRP (data not shown). Login to comment
168 In the transfection experiment, the expression of C421A BCRP mRNA was identical to those of mRNAs from wild-type, G34A, and 944-949-deleted BCRP by Northern blotting. Login to comment
169 Therefore, the increased sensitivity was considered to be a result of instability of Q141K BCRP. Login to comment
186 PA317 cells transfected with wild-type, G34A, C421A, and 944-949- deleted BCRP cDNAs were termed PA/WT, PA/V12M, PA/Q141K, and PA/⌬315-6, respectively. Login to comment
188 In parental PA317 cells, a fluorescence peak shift to the right after the incubation with topotecan indicates cellular uptake of topotecan, whereas only marginal shifts occurred in PA/WT, PA/V12M, and PA/⌬315-6 cells. Login to comment
189 There was a stronger fluorescence peak shift to the right in PA/Q141K cells than the other transfectants (arrow). Login to comment
2 Access the articles at: E-mail alerts related to this article or journal.Sign up to receive free email-alerts Subscriptions Reprints and .pubs@aacr.orgDepartment at To order reprints of this article or to subscribe to the journal, contact the AACR Publications Permissions .permissions@aacr.orgDepartment at To request permission to re-use all or part of this article, contact the AACR Publications C421A Polymorphism in the Human Breast Cancer Resistance Protein Gene Is Associated with Low Expression of Q141K Protein and Low-Level Drug Resistance1 Yasuo Imai, Minoru Nakane, Kumie Kage, Satomi Tsukahara, Etsuko Ishikawa, Takashi Tsuruo, Yoshio Miki, and Yoshikazu Sugimoto2 Division of Molecular Biotherapy [Y. I., M. N., K. K., S. T., E. I., Y. S.] and Division of Experimental Chemotherapy [T. T.], Cancer Chemotherapy Center, and Department of Molecular Diagnosis [Y. M.], Cancer Institute, Japanese Foundation for Cancer Research, Tokyo 170-8455, and Institute of Molecular and Cellular Biosciences, University of Tokyo, Tokyo 113-0032 [T. T.], Japan Abstract Breast cancer resistance protein (BCRP) confers multidrug resistance to cancer cells against agents such as SN-38 (an active metabolite of irinotecan), mitoxantrone, and topotecan. Login to comment
4 BCRP cDNA was isolated from 11 cancer cell lines and three variant cDNAs [G34A substituting Met for Val-12 (V12M), C421A substituting Lys for Gln-141 (Q141K), and 944-949 deletion lacking Ala-315 and Thr-316 (⌬315-6)] were identified. Login to comment
9 These results suggest that some people possess the C421A polymorphic BCRP gene and express low amounts of Q141K BCRP. Login to comment
59 PA317 cells transfected with wild-type, G34A, C421A, and 944-949-deleted BCRP cDNAs were designated PA/WT, PA/V12M, PA/Q141K, and PA/⌬315-6 cells, respectively. Login to comment
91 Western blotting of mutant BCRP-transfected PA317 cells demonstrated markedly low expression of Q141K BCRP in PA/Q141K cells compared with other BCRP-transfected cells. Login to comment
95 In contrast, Northern blotting demonstrated similar levels of BCRP mRNA in PA/WT, PA/V12M, PA/ Q141K, and PA/⌬315-6 cells (Fig. 3B). Login to comment
103 Table 1 BCRP cDNA variants identified in this study Variant Amino acid change Cell line G34A Val-12 to Met MCF-7a C421A Gln-141 to Lys MDA-MB-231a A549a HCT-116a Deletion of 944-949 Deletion of Ala-315 and Thr-316 MCF-7 A549 HT-29 SK-OV-3 a Heterozygous allele. Login to comment
117 In contrast, PA/Q141K cells showed a 12-fold greater resistance to SN-38 and a 4-fold greater resistance to mitoxantrone (Table 2; Fig. 4A). Login to comment
136 PA317 cells transfected with wild-type, G34A, C421A, and 944-949-deleted BCRP cDNAs were termed PA/WT, PA/V12M, PA/Q141K, and PA/⌬315-6, respectively. Login to comment
144 Table 2 IC50 a (ng/ml) of BCRP-transfected PA317 cells PA317 PA/WT PA/V12M PA/Q141K PA/⌬315-6 SN-38 2.5 98 98 30 55 Mitoxantrone 0.060 0.58 0.63 0.25 0.42 Topotecan 17 Ͼ200 Ͼ200 100 190 a IC50s (drug dose causing 50% inhibition of cell growth) were determined from cell growth curves in each experiment. Login to comment
147 PA317 cells transfected with wild-type, G34A, C421A, and 944-949- deleted BCRP cDNAs were termed PA/WT, PA/V12M, PA/Q141K, and PA/⌬315-6, respectively. Login to comment
150 F, PA317; E, PA/WT; ‚, PA/V12M; Ⅺ, PA/Q141K; ᭛, PA/⌬315-6. Login to comment
162 PA/Q141K cells were significantly more sensitive to anticancer agents than the other BCRP transfectants. Login to comment
185 PA317 cells transfected with wild-type, G34A, C421A, and 944-949- deleted BCRP cDNAs were termed PA/WT, PA/V12M, PA/Q141K, and PA/⌬315-6, respectively. Login to comment

[hide] Natural allelic variants of breast cancer resistan... Pharmacogenetics. 2003 Jan;13(1):19-28. Zamber CP, Lamba JK, Yasuda K, Farnum J, Thummel K, Schuetz JD, Schuetz EG
Natural allelic variants of breast cancer resistance protein (BCRP) and their relationship to BCRP expression in human intestine.
Pharmacogenetics. 2003 Jan;13(1):19-28., [PMID:12544509]

Abstract [show]
The aim of this study was to identify the extent of genetic variability in breast cancer resistance protein (BCRP) in humans. We first analysed the sequence of BCRP cDNA from human livers and from human intestines phenotyped for expression of intestinal BCRP. We then determined the frequency of all known coding single nucleotide polymorphisms (cSNPs) using DNA from individuals representing 11 different ethnic populations. Nine SNPs including four non-synonymous and three synonymous cSNPs and two intronic SNPs were identified. Of the missense mutations, exon 2 SNP (G34A) resulted in a V12M change; exon 5 SNP (C421A) resulted in a Q141K substitution; exon 6 SNP (A616C) resulted in an I206L amino acid substitution; and exon 15 SNP (A1768T) resulted in a N590Y change in the BCRP protein. The two most frequent polymorphisms identified in the human population studied were the G34A and C421A transitions. There was marked variation in BCRP genotypes and allele frequencies in the different populations. BCRP mRNA was phenotyped in human small bowel intestinal samples by real-time polymerase chain reaction and BCRP protein was analysed on immunoblots of tissue from the same individuals. There was a 78-fold variation in expression of BCRP mRNA and significant variation in BCRP protein expression in human intestine. Expression of intestinal BCRP mRNA and protein was not different between persons expressing the common Gln141 allele compared to the Lys141 allele. Thus, common natural allelic variants of BCRP have been identified, and did not influence interindividual variation in expression of BCRP mRNA in human intestine, but remain to be tested for their effect on BCRP function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 Of the missense mutations, exon 2 SNP (G34A) resulted in a V12M change; exon 5 SNP (C421A) resulted in a Q141K substitution; exon 6 SNP (A616C) resulted in an I206L amino acid substitution; and exon 15 SNP (A1768T) resulted in a N590Y change in the BCRP protein. Login to comment
95 Exon 5 One SNP, a C421A transversion, results in a Gln141 Lys change. Login to comment
119 Table 1 Frequencies of BCRP alleles in different ethnic groups Position in gene AC084732Ã Position in mRNA XM_032424Ã Sequence Region Caucasians African-Americans Japanese (n ¼ 20) Chinese (n ¼ 20) SE Asians (not Chinese or Japanese) (n ¼ 20) Pacific Islanders (n ¼ 14) À18398 À29 gctct(A/G)ttaag Exon 1 0.02 (1.5%)a 0 (0%)e ND ND ND ND 34 34 tccca(G/A)tgtca Exon 2 (V12M) 0.02 (4.7%)b 0.04 (8.3%)f 0.15 (30%) 0.20 (40%) 0.45 (70%) 0.64 (85.7%) 114 114 ttaag(T/C)tttca Exon 2 0.01 (1.2%)b 0 (0%)f 0 (0%) 0 (0%) 0 (0%) 0 (0%) 239 tttta (A/G)tttac Intron 2 0.03 (5.9%)c 0.05 (9.5%)g 0.15 (30%) 0.20 (40%) 0.45 (70%) 0.64 (85.7%) 8184 369 ggtta(C/T)gtggt Exon 4 0 (0%)a 0.07 (13.3%)e ND ND ND ND 8825 421 actta(C/A)agttc Exon 5 (Q141K) 0.14 (25.9%)d 0 (8%)f 0.35 (50%) 0.35 (60%) 0.15 (20%) 0.14 (28.6%) 18186 attat(A/G)atatt Intron 5 0 (0%)c 0 (8%)g 0 (0%) 0.05 (10%) 0 (0%) 0 (0%) 18286 616 cttcc(A/C)tcttg Exon 6 (I206L) 0 (0%)a 0 (8%)e 0 (0%) 0 (0%) 0 (0%) 0 (0%) 45073 1768 gacaa(A/T)acttc Exon 15 (N590Y) 0.01 (1.5%)a 0 (8%)e ND ND ND ND Position in gene AC084732Ã Position in mRNA XM_032424Ã Sequence Region Mexican-Indians (n ¼ 10) Mexicans (n ¼ 20) Hispanic Livers (n ¼ 10) Middle Eastern (n ¼ 40) Ashkenazi Jewish (n ¼ 20) Africans North of Sahara (n ¼ 14) À18398 À29 gctct(A/G)ttaag Exon 1 ND ND ND ND ND ND 34 34 tccca(G/A)tgtca Exon 2 (V12M) 0.90 (100%) 0.10 (20%) 0.40 (60%) 0.05 (10%) 0.10 (20%) 0.14 (14.3%) 114 114 ttaag(T/C)tttca Exon 2 0 (0%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 0 (0%) 239 tttta(A/G)tttac Intron 2 0.90 (100%) 0.10 (20%) 0.40 (60%) 0.05 (10%) 0.10 (20%) 0.14 (14.3%) 8184 369 ggtta(C/T)gtggt Exon 4 ND ND ND ND ND ND 8825 421 actta(C/A)agttc Exon 5 (Q141K) 0.10 (20%) 0.05 (10%) 0.10 (20%) 0.13 (25%) 0.05 (10%) 0 (0%) 18186 attat(A/G)atatt Intron 5 0 (0%) 0.10 (20%) 0 (0%) 0 (0%) 0.05 (10%) 0.07 (14.3%) 18286 616 cttcc(A/C)tcttg Exon 6 (I206L) 0 (0%) 0 (0%) 0.10 (20%) 0 (0%) 0 (0%) 0 (0%) 45073 1768 gacaa(A/T)acttc Exon 15 (N590Y) ND ND ND ND ND ND Data reported as: allele frequency (% individuals with at least one variant allele). Login to comment
125 Unauthorized reproduction of this article is prohibited. G34A V12M Exon 2 C71T1 A24V Exon 2 623C1 F208S Exon 6 A616C I206L Exon 6 C496G1 Q166E Exon 5 C421A Q141K Exon 5 A1444G2 R482G Exon 12 G1445C3 R482T Exon 12 A1768T N590Y Exon 15 Walker A motif: amino acids 80-89 Walker B motif: amino acids 206-210 SNPs found in human samples in this study Reported in ABCP1 Drug selected variants, MXR2 and BCRP3 MXR BCRP Fig. 1 BCRP protein topology and the positions of the identified SNPs resulting in missense mutations. Login to comment
127 BCRP mRNA was compared to BCRP SNP C421A; Gln141 Lys. Login to comment
135 However, 16 individuals were heterozygous for the 421C.A transversion, leading to the Gln141 Lys change. Login to comment
146 Unauthorized reproduction of this article is prohibited. 400.0 300.0 200.0 100.0 0.0 BCRPmRNA(%ofHI11as100%) (a) CC CA Q141K 400.0 300.0 200.0 100.0 0.0BCRPmRNA(%ofHI11as100%) (b) Female Male CC - Gln141 CA - Lys141 Fig. 3 Comparison of BCRP genotype and BCRP phenotype in human intestines. Login to comment
147 The BCRP SNP C421A; Gln141 Lys was compared to the (a) amount of BCRP mRNA transcript in all human intestines. Login to comment
173 The Val12 Met and the Gln141 Lys were the most frequent allelic variants. Login to comment
176 The Gln141 Lys was the most prevalent allele in both the Japanese and Chinese populations with an allelic frequency of 35%. Login to comment
189 The most commonly observed SNP detected in these samples was the exon 5 C421A (Gln141 to Lys) with an allelic frequency of 19%. Login to comment

[hide] Single-nucleotide polymorphism (SNP) analysis in t... Cancer Biol Ther. 2002 Nov-Dec;1(6):696-702. Honjo Y, Morisaki K, Huff LM, Robey RW, Hung J, Dean M, Bates SE
Single-nucleotide polymorphism (SNP) analysis in the ABC half-transporter ABCG2 (MXR/BCRP/ABCP1).
Cancer Biol Ther. 2002 Nov-Dec;1(6):696-702., [PMID:12642696]

Abstract [show]
Variations in the amino acid sequence of ABC transporters have been shown to impact substrate specificity. We identified two acquired mutations in ABCG2, the ABC half-transporter overexpressed in mitoxantrone-resistant cell lines. These mutations confer differences in substrate specificity and suggest that naturally occurring variants could also affect substrate specificity. To search for the existence of single nucleotide polymorphisms (SNPs) in ABCG2, we sequenced 90 ethnically diverse DNAs from the Single Nucleotide Polymorphism Discovery Resource representing the spectrum of human genotypes. We identified 3 noncoding SNPs in the untranslated regions, 3 nonsynonymous and 2 synonymous SNPs in the coding region and 7 SNPs in the intron sequences adjacent to the sixteen ABCG2 exons. Nonsynonymous SNPs at nucleotide 238 (V12M; exon 2) and nucleotide 625 (Q141K; exon 5) showed a greater frequency of heterozygosity (22.2% and 10%) than the SNP at 2062 (D620N; exon 16). Heterozygous changes at nucleotide 238 are in linkage disequilibrium with an SNP observed 36 bases downstream from the end of exon 2. No polymorphism at amino acid 482 was identified to correspond to the R to G or R to T mutations previously found in two drug resistant cell lines. Among 23 drug resistant sublines for which sequence at position 482 was determined, no additional mutations were found. Heterozygosity at amino acid 12 allowed us to identify overexpression of a single allele in a subset of drug resistant cell lines, a feature that could be exploited clinically in evaluating the significance of ABCG2 expression in malignancy. We conclude that ABCG2 is well conserved and that described amino acid polymorphisms seem unlikely to alter transporter stability or function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Nonsynonymous SNPs at nucleotide 238 (V12M; exon 2) and nucleotide 625 (Q141K; exon 5) showed a greater frequency of heterozygosity (22.2% and 10%) than the SNP at 2062 (D620N; exon 16). Login to comment
104 Amplification in the MCF-7 SINGLE-NUCLEOTIDE POLYMORPHISM (SNP) ANALYSIS IN THE ABC HALF-TRANSPORTER ABCG2 (MXR/BCRP/ABCP1) www.landesbioscience.com Cancer Biology & Therapy 699 Table 2 PRIMERS USED IN SEQUENCING 90 DNA SAMPLES Forward Primer (5`-> 3`) Reverse Primer (5`-> 3`) Exon 1 TGCCCACTCAAAAGGTTC CCAACCCACACTTAACACAC Exon 2 TGTCACCTAGTGTTTGCAATC GCCAGTTTCTTGGAAATAGCC Exon 3 AATCCTGCTTTGGTCTCC TCTCCCATTCTTTTTCCTC Exon 4 AGCATGTGTTGGAGGGAAAA ATCAGCCAAAGCACTTACCC Exon 5 GCAGGCTTTGCAGACATCTA TGCTGATCATGATGCTTTCA Exon 6 TCTTACAGGACTGGCACACG CCCCAAGAATATCTGGGACA Exon 7 TCAGGCTGAACTAGAGCAAACA CAAACAGCACTCCTGCAGAC Exon 8 CATGGGAAGAAGAGAGAAAG GTTGACTGGTATCAGAAGAC Exon 9 ACTCCTGACCTCGTAATCC GAAGCAGATGATAACAGAACC Exon 10 TCTAATTGAAACTCTTCCCC AGTTCGAAGCCAGTCTAGC Exon 11 TGAGTTGACTGCGGTGATTT GTAATCCTCCGGATCCCATC Exon 12 GTCTAGCCCTGAGGATGTGG TGCAAAATGGACAGGTGTTT Exon 13 CAGACACAACATTGGAGAC TAAGGGCAAAGAGGAAAG Exon 14 CTGCATGAAATTACTCAAGC CCATCCTCTCATTTACTTCC Exon 15 AAACTGTTTACCTTGCCC GCACCTCACTTCAATCTC Exon 16 GAGTAACATTTGACGGATG CTCTACTCTACCCACAGTTC Table 3 RESULTS OF SNP ANALYSIS OF 16 EXONS ENCODING ABCG2* Wild-type Frequency Frequency Frequency Amino Acid Exon Nucleotide+ allele SNP Wt/Wt Wt/Var Var/Var aa# 1 91 C T 98.9% 1.1% Noncoding 175 A G 97.8% 2.2% Noncoding 2 238 G A 76.7% 22.2% 1.1% 12 Val to Met 5 625 C A 88.9% 10% 1.1% 141 Gln to Lys 9 1302 G A 97.8% 2.2% 366 Glu to Glu 12 1629 A G 98.9% 1.1% 475 Leu to Leu 16 2062 G A 98.9% 1.1% 620 Asp to Asn 2597 C A 98.9% 1.1% Noncoding Intronic Variants 2 +36** A G 76.7% 22.2% 1.1% 6 -16 A G 88.9% 8.9% 2.2% 7 -20 T A 98.9% 1.1% +18 A G 93.3% 5.6% 1.1% 11 +20 A G 63.3% 27.8% 8.9% 12 +49 G T 75.6% 22.2% 2.2% 14 -21 C T 67.8% 28.9% 3.3% *Identified SNPs are recorded in the table with all 16 exons sequenced in 90 DNA samples. Login to comment

[hide] Genetic variation in the ATP-binding cassette tran... Eur J Pharm Sci. 2003 Apr;18(5):359-64. Backstrom G, Taipalensuu J, Melhus H, Brandstrom H, Svensson AC, Artursson P, Kindmark A
Genetic variation in the ATP-binding cassette transporter gene ABCG2 (BCRP) in a Swedish population.
Eur J Pharm Sci. 2003 Apr;18(5):359-64., [PMID:12694888]

Abstract [show]
The ATP-binding cassette transporter ABCG2 (also named breast cancer resistance protein, BCRP) functions as a drug efflux transporter and is expressed at high levels in the human small intestine. The aim of this study was to screen the human ABCG2 gene for genetic variation. The regions of the gene most likely to affect function, namely the coding parts, exon/intron boundaries, 5' untranslated region and 3' untranslated region and the proposed promoter region, were included in the screening. DNA was obtained from 60 Swedish individuals. The screening was performed using a polymerase chain reaction-denaturing high-performance liquid chromatography approach followed by sequence analysis. Eight sites of genetic variation were identified. The sequence variations considered to be most likely to affect transcription level or transport function were a CTCA deletion in the 5' flanking region, a single nucleotide polymorphism (SNP) in a 5' flanking CpG island, two non-synonymous SNPs, changing valine at amino acid position 12 to methionine and glutamine at position 141 to lysine, respectively. Genotyping of these sequence variations revealed linkage between the CTCA deletion and the SNP changing glutamine 141 for lysine. This information forms the basis for future association studies to investigate the genetic basis of differences of drug disposition due to sequence variation in the ABCG2 gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 The sequence variations considered to be most likely to affect transcription level or transport function were a CTCA deletion in the 59 flanking region, a single nucleotide polymorphism (SNP) in a 59 flanking CpG island, two non-synonymous SNPs, changing valine at amino acid position 12 to methionine and glutamine at position 141 to lysine, respectively. Login to comment
7 Genotyping of these sequence variations revealed linkage between the CTCA deletion and the SNP changing glutamine 141 for lysine. Login to comment
62 Because To determine allele frequencies for the sequence varia- of the highly repetitive sequences surrounding exon 10, Table 2 Sequence variation in the human ABCG2 gene identified in the present study Sequence variant Nucleotide sequence (59 to 39) Affected Effect Identity to a ID DHPLC dbSNP b c Reference sequence Alteration pools g.-19572-19569 actcaCTCAcaaag actca caaag 15 59 Flanking deletion ss 4480605 ]] ]]]]d delCTCA g.-19202G.C gtactGatcag gtactCatcag 5 CpG island SNP rs 2231134 ] ] g.-18845T.C tgagcTcgtcc tgagcCcgtcc 8 59 UTR SNP rs 2231135 ] ] g.-18604delA cggcaAggagg cggca ggagg 1 59 UTR deletion ss 4480606 ] ]d g.34G.A tcccaGtgtca tcccaAtgtca 2 Missense SNP rs 2231137 ] ] Val12Met g.8007G.A ttggaGggaaa ttggaAggaaa 3 Intronic SNP ss 4480607 ] ]d g.8825C.A acttaCagttc acttaAagttc 4 Missense SNP rs 2231142 ] ] Gln141Lys d g.44997G.A ttcttAaaatt ttcttGaaatt 9 Intronic SNP rs 2231164 ] ] a Sequence variant ID in accordance with the nomenclature for sequence variation described at http://www.dmd.nl/mutnomen.html. Login to comment
78 The deletion (g.-19572-19569delCTCA) was identified in the g.8825C.A SNP (Gln141Lys) occurred at a frequency of 59 flanking region. Login to comment
86 A one-base deletion (g.-18604delA) and 1 disequilibrium was observed over the region between SNP (g.-18845T.C) were detected in the untranslated g.-19572-19569delCTCA and g.8825C.A (Gln141Lys) exon 1. Login to comment
115 We also report the allele fre- g.8825C.A and low expression of the Gln141Lys ABCG2 quencies for four identified sequence variations, and the protein (Imai et al., 2002), suggested to be due to the degree of linkage disequilibrium over the region studied. Login to comment
208 Influence of CYP2C9 of Q141K protein and low-level drug resistance. Login to comment

[hide] Multidrug resistance mediated by the breast cancer... Oncogene. 2003 Oct 20;22(47):7340-58. Doyle LA, Ross DD
Multidrug resistance mediated by the breast cancer resistance protein BCRP (ABCG2).
Oncogene. 2003 Oct 20;22(47):7340-58., 2003-10-20 [PMID:14576842]

Abstract [show]
Observations of functional adenosine triphosphate (ATP)-dependent drug efflux in certain multidrug-resistant cancer cell lines without overexpression of P-glycoprotein or multidrug resistance protein (MRP) family members suggested the existence of another ATP-binding cassette (ABC) transporter capable of causing cancer drug resistance. In one such cell line (MCF-7/AdrVp), the overexpression of a novel member of the G subfamily of ABC transporters was found. The new transporter was termed the breast cancer resistance protein (BCRP), because of its identification in MCF-7 human breast carcinoma cells. BCRP is a 655 amino-acid polypeptide, formally designated as ABCG2. Like all members of the ABC G (white) subfamily, BCRP is a half transporter. Transfection and enforced overexpression of BCRP in drug-sensitive MCF-7 or MDA-MB-231 cells recapitulates the drug-resistance phenotype of MCF-7/AdrVp cells, consistent with current evidence suggesting that functional BCRP is a homodimer. BCRP maps to chromosome 4q22, downstream from a TATA-less promoter. The spectrum of anticancer drugs effluxed by BCRP includes mitoxantrone, camptothecin-derived and indolocarbazole topoisomerase I inhibitors, methotrexate, flavopiridol, and quinazoline ErbB1 inhibitors. Transport of anthracyclines is variable and appears to depend on the presence of a BCRP mutation at codon 482. Potent and specific inhibitors of BCRP are now being developed, opening the door to clinical applications of BCRP inhibition. Owing to tissue localization in the placenta, bile canaliculi, colon, small bowel, and brain microvessel endothelium, BCRP may play a role in protecting the organism from potentially harmful xenobiotics. BCRP expression has also been demonstrated in pluripotential "side population" stem cells, responsible for the characteristic ability of these cells to exclude Hoechst 33342 dye, and possibly for the maintenance of the stem cell phenotype. Studies are emerging on the role of BCRP expression in drug resistance in clinical cancers. More prospective studies are needed, preferably combining BCRP protein or mRNA quantification with functional assays, in order to determine the contribution of BCRP to drug resistance in human cancers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 Allelic variation as a result of SNPs results in alterations of the BCRP protein at amino acids 12 (V12M), 141 (Q141K), 206 (I206L), and 590 (N590Y), with the most frequent polymorphisms being the exon 2 SNP (G34A) and the exon 5 SNP (C421A), which produce changes in amino acids 12 and 141 (Honjo et al., 2002; Imai et al., 2002a; Zamber et al., 2003). Login to comment
129 The effect of these polymorphisms on BCRP function remains to be determined, although one study suggested that the C421A/Q141K variant may result in Structure of the Human BCRP (ABCG2) Gene and Promoter (Chromosome 4q22) BCRP Gene Walker A Walker B TM 1,2 TM 3,4 TM 5,6 ABC Signature 1 2 3 4 5 6 7 8 9 10 11121314 15 16 NH2 COOHBCRP Protein -450 -400 -350 -300 -250 -200 -150 - -50 0 50 100 150 BCRP 5` Upstream Region (Promoter) Sp1 Sp1 5` AP1 Predicted Promoter CCAAT box CpG Island >66 kb / 2.4 kb 655 aa 100 (Chromosome 4q22) BCRP Gene Walker A Walker B TM 3,4 TM 5,6 ABC Signature 1 2 3 4 5 6 7 8 9 10 11121314 15 16 COOHBCRP Protein - - - - - BCRP 5` Upstream Region (Promoter) Sp1 Sp1AP1 Predicted Promoter CCAAT box CpG Island >66 kb / 2.4 kb 655 aa Figure 3 Structure of BCRP gene and promoter. Login to comment

[hide] Single nucleotide polymorphisms result in impaired... Int J Cancer. 2004 Mar 20;109(2):238-46. Mizuarai S, Aozasa N, Kotani H
Single nucleotide polymorphisms result in impaired membrane localization and reduced atpase activity in multidrug transporter ABCG2.
Int J Cancer. 2004 Mar 20;109(2):238-46., 2004-03-20 [PMID:14750175]

Abstract [show]
ABCG2/MXR/ABCP1/BCRP is a member of the ATP-binding cassette membrane transporter, which consists of six transmembrane regions and one ATP-binding cassette. The transporter is known to be involved in the efflux of various anticancer compounds such as mitoxantrone, doxorubicin and topoisomerase I inhibitor. In this study, we analyzed the effects of polymorphisms in ABCG2, V12M and Q141K on transporter function. When polarized LLC-PK1 cells were transfected with variant ABCG2, drug-resistance to topoisomerase I inhibitor of cells expressing V12M or Q141K was less than 1/10 that of wild-type ABCG2 transfected cells, and was accompanied by increased drug accumulation and decreased drug efflux in the variant ABCG2-expressing cells. We further elucidated the molecular mechanisms of the transport dysfunction by investigating membrane localization and ATPase activity. Confocal microscopic analysis revealed that apical plasma membrane localization of V12M was disturbed, while the localization of wild-type transporters occurred specifically in the apical plasma membrane of polarized LLC-PK1 cells. Also, ATPase activities measured in the membrane of SF9 cells infected with variant ABCG2 showed that Q141K decreased activity by 1.3 below that of wild-type ABCG2. In addition, kinetic analysis of ATPase activity showed that the K(m) value in Q141K was 1.4-fold higher than that of wild-type ABCG2. These results indicated that naturally occurring SNPs alter transport functions of ABCG2 transporter and analysis of SNPs in ABCG2 may hold great importance in understanding the response/metabolism of chemotherapy compounds that act as substrates for ABCG2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 In this study, we analyzed the effects of polymorphisms in ABCG2, V12M and Q141K on transporter function. Login to comment
3 When polarized LLC-PK1 cells were transfected with variant ABCG2, drug-resistance to topoisomerase I inhibitor of cells expressing V12M or Q141K was less than 1/10 that of wild-type ABCG2 transfected cells, and was accompanied by increased drug accumulation and decreased drug efflux in the variant ABCG2-expressing cells. Login to comment
6 Also, ATPase activities measured in the membrane of SF9 cells infected with variant ABCG2 showed that Q141K decreased activity by 1.3 below that of wild-type ABCG2. Login to comment
7 In addition, kinetic analysis of ATPase activity showed that the Km value in Q141K was 1.4-fold higher than that of wild-type ABCG2. Login to comment
15 Homozygous CC patients expressed lower P-gp in the intestine compared to TT patients, resulting in increased digoxin plasma concentration after orally administered digoxin.21 Another report showed that a naturally occurring mutation of R433S in MRP1 caused increased organic anion transport and decreased doxorubicin resistance.22 Several groups have reported naturally occurring ABCG2 SNPs in various ethnic populations, including Caucasian, Asian and African.23-27 In those reports, polymorphisms at V12M and Q141K occurred at high frequency in most of the ethnic populations. Login to comment
17 For example, Q141K polymorphism has been reported to reduce protein expression level compared to wild-type ABCG2 in vitro;24 however, this observation was not confirmed by in vivo analysis using intestinal samples.25 Mutations at R482 have been well characterized by several groups including our previous studies,17,28-30 demonstrating that they affect drug resistance and are considered mutations acquired during drug selection and not naturally occurring polymorphisms. Login to comment
21 The previously reported polymorphisms,V12M and Q141K, had high frequencies of 10.3% and 9.0%, respectively. Login to comment
22 Drug resistance to the ABCG2 substrate, indolocarbazole topoisomerase I inhibitor, was reduced more than 10-fold in polarized cells that expressed variant ABCG2 with either V12M or Q141K compared Abbreviations: ABC, ATP-binding cassette; ABCP1, placenta-specific ABC transporter; BCRP, breast cancer-resistant protein; GFP, green fluorescent protein; in; HRP, horse radish peroxidase; MDR, multidrug resistance protein; MRP, multidrug resistance-associated prote; MXR, mitoxantrone resistance protein; P-gp, P-glycoprotein; PVDF, polyvinylidene difluoride; Sf9 cells, Spodoptera frugiperda ovarian cells; SNPs, single nucleotide polymorphisms. Login to comment
28 We concluded that the functional impairment of these 2 variants were due to disturbance of apical plasma membrane localization for V12M and reduced ATPase activity for Q141K, indicating ABCG2 gene SNPs may greatly influence resistance to ABCG2 substrate. Login to comment
43 Establishment of LLC-PK1 cells expressing wild-type and mutant ABCG2 Wild-type ABCG2 and mutated ABCG2 genes (G34A for V12M and C421A for Q141K), the point mutations of which were introduced by PCR mutagenesis, were cloned into HindIII and XhoI sites of pcDNA3.1(ϩ) (Invitrogen). Login to comment
61 Drug efflux assay LLC-PK1 cells were incubated with the indicated concentration of indolocarbazole compound for 120 min under energy-depleted TABLE I - SINGLE NUCLEOTIDE POLYMORPHISMS IN ABCG21 SNP Effect Region Domain Frequency in 30 cell lines Frequency in 150 clinical samples Hetero Home Hetero Homo Allele (%) G34A V12M Exon2 N-terminal 5 (16.7%) 0 27 (18.0%) 2 (1.3%) 10.3 Aϩ10G Intron3 ND ND 21 (14.0%) 4 (2.7%) 9.7 C369T Wobble Exon4 ABC 0 0 1 (0.67%) 0 0.3 C376T Q126Term Exon4 ABC 0 1 (3.3%) 0 0 0.0 C421A Q141K Exon5 ABC 5 (16.7%) 1 (3.3%) 22 (15.3%) 2 (1.3%) 9.0 C458T T153M Exon5 ABC 1 (3.3%) 0 0 0 0.0 C474T Wobble Exon5 ABC 0 0 1 (0.67%) 0 0.3 Aϩ20G Intron11 ND ND 34 (22.7%) 10 (6.7%) 18.0 A1444G R482G Exon12 TM3 0 0 0 0 0.0 G1445C R482T Exon12 TM3 0 0 0 0 0.0 C-21T Intron13 ND ND 32 (21.3%) 4 (2.7%) 13.3 A1768T N590Y Exon15 EC3 0 0 1 (0.67%) 0 0.3 G2237T Exon16 3ЈUTR 1 (3.3%) 0 0 0 0.0 G2393T Exon16 3ЈUTR 1 (3.3%) 0 0 0 0.0 The positions of the polymorphisms correspond to that of the ABCG2 cDNA (GenBank accession number AB051855) with the first base of the ATG start codon set to 1. Login to comment
89 Samples of 7 ␮g RNA extracted from HeLa, control C4, WT, V12M and Q141K cells (lanes 1, 2, 3, 4 and 5 respectively) were subjected to Northern hybridization and the blots were probed with a cDNA fragment of ABCG2. Login to comment
92 Vector transformant C4 (a) and stable clones expressing wild-type (b), V12M (c) and Q141K (d) were stained with monoclonal antibody BXP-34. Login to comment
102 Two polymorphisms, V12M and Q141K, had high frequency rates of 10.3% and 9.0%, respectively, in the 150 Caucasian subjects. Login to comment
103 V12M was located at the N-terminal intracellular region and Q141K at the ATP-binding cassette region. Login to comment
108 LLC-PK1 cells expressing WT, V12M and Q141K were incubated with opti-MEM with 50 ␮M (A) or 0.5 ␮M (B) of radiolabeled topoisomerase inhibitor for 180 min. Login to comment
119 TABLE II - RESISTANT PROFILE (IC50) OF ABCG2 TO ANTI-CANCER COMPOUNDS Anti-cancer compound IC50 (␮M)1 Control C4 Wild type V12M Q141K TopoI inhibitor2 0.12 Ͼ50 (420) 0.94 (7.8) 5.9 (49) Mitoxantrone 0.0015 0.029 (19) 0.00093 (0.62) 0.0053 (3.5) Topotecan 0.098 2.1 (22) 0.16 (1.7) 0.48 (4.9) Doxorubicin 0.010 0.039 (3.9) 0.0073 (0.73) 0.014 (1.4) Vincristine 0.0034 0.0053 (1.6) 0.0021 (0.62) 0.0058 (1.7) Camptothecin 0.0087 0.021 (2.4) 0.012 (1.4) 0.027 (3.1) 1 Relative resistances to control cells are described in parentheses.-2 TopoI inhibitor, Indolocarbazole topoisomerase I inhibitor. Login to comment
120 Resistance profile of variant ABCG2 transporters to anticancer compounds Among the polymorphisms detected, V12M and Q141K had a high frequency of amino acid substitutions. Login to comment
123 Northern blotting and immunocytochemical analysis with a monoclonal antibody revealed that approximately equal levels of ABCG2 were expressed in V12M and Q141K clones compared to the expression in the wild-type (WT) clone (Fig. 1). Login to comment
125 Wild-type cells conferred greater than 420-fold higher resistance to an indolocarbazole I topoisomerase inhibitor compared to that of control C4 cells as previously reported.10 In contrast, IC50 values of variant ABCG2 clones, V12M and Q141K, were less than 1/10 that of WT cells. Login to comment
127 The IC50 values of WT cells to mitoxantrone and topotecan increased 19- and 22-fold, respectively, over C4 cells, whereas in the variant V12M and Q141K cells, IC50 values to mitoxantrone and topotecan decreased as observed with the indolocarbazole compound. Login to comment
130 Accumulation and efflux assay of topoisomerase I inhibitor in ABCG2 variant-expressing cells Increased sensitivities of V12M and Q141K cells are thought to arise from changes in the intracellular drug concentration of topoisomerase I inhibitor. Login to comment
134 However, significantly higher indolocarbazole topoisomerase I inhibitor accumulation was observed in both V12M and Q141K cells compared to that in WT cells (2.7and 1.8-fold higher, respectively). Login to comment
135 A drug accumulation assay performed at a low dose (0.5 ␮M) of the compound confirmed that compound accumulations increased in variant cell lines (3.1and 2.8-fold increase for V12M and Q141K, respectively). Login to comment
141 Compared to WT cells, Vmax of V12M and Q141K cells decreased 2.5-and 1.8-fold, respectively, indicating that the increased drug accumulation and consequent reduction in drug resistance were due to the decreased efflux velocity. Login to comment
145 Vmax values of V12M and Q141K decreased 2.2- and 1.7-fold, respectively, which agrees well with the results of drug efflux assays using cell lines. Login to comment
153 In Q141K cells, ABCG2 staining was detected in the apical side, similar to WT cells (Fig. 3d). Login to comment
163 (A) Control C4 cells; (B) and E, WT cells; (C,F), V12M cells; (D,G), Q141K cells. Login to comment
167 In WT and Q141K cells, apical membrane staining of ABCG2 was detected (Fig. 3E,G). Login to comment
170 The expected pattern of apical staining with anti-ABCG2 antibody was observed in wild-type and Q141K variant expressing cell lines, whereas dispersed staining was confirmed in V12M cells (data not shown). Login to comment
172 ATPase activity of variant ABCG2 Since Q141K was mapped in the ATP-binding cassette region, ATPase activity of the variant transporters was measured. Login to comment
177 However, the ATPase activity of Q141K was reduced by about 1.3-fold compared to that of wild-type ABCG2. Login to comment
182 We concluded that Q141K and V12M polymorphisms did not restore drug stimulation, which was observed in R482 mutant. Login to comment
184 In the Q141K membrane, the Vmax value of ATPase activity decreased 1.3-fold in accordance with the values of Figure 4A. Login to comment
185 Unexpectedly, the Km value of Q141K also increased 1.4-fold compared to that of WT (0.64 mM; WT, 0.64 mM; V12M, 0.91 mM; Q141K). Login to comment
188 DISCUSSION In our study, we confirmed the locations and frequencies of SNPs in ABCG2 using 30 cancer cell lines and 150 Caucasian clinical samples, and then characterized the functional effects of the major SNPs, V12M and Q141K (Fig. 5). Login to comment
192 Membrane fractions isolated from Sf9 cells expressing wild-type, V12M and Q141K ABCG2 transporters were subjected to Western blotting with BXP-21 monoclonal antibody. Login to comment
203 the impaired function of ABCG2, membrane localization of transporter for V12M and ATPase activity for Q141K. Login to comment
210 The other variant, Q141K, also reduced drug resistance against previously known ABCG2 substrates when it was expressed in LLC-PK1 cells. Login to comment
212 Several mutagenesis studies on ABC transporters have shown that introduced mutations in the ABC domain completely disrupted ATPase activity.30,38,39 For example, an induced mutation in ABCG2 prevented K86M from transporting ABCG2 substrates due to the loss of ATPase activity.30 When measured in the Sf9 membrane containing ABCG2 transporters, ATPase activity of Q141K was 1.3-fold lower than that of wild-type ABCG2, although the effect on ATPase activity was relatively moderate compared to that of the introduced mutation at K86M. Login to comment
213 While K86M was located at the walker catalytic region in the ABC domain, Q141K was located between the walkerA and walkerB regions. Login to comment
214 In addition to the changes in ATPase activity of Q141K, the Km value of Q141K was different from that of WT by a factor of 1.4. Login to comment
215 The change in Km value infers that the difference in ATPase activity of Q141K and WT might be larger than 1.3-fold at the physiological concentration of ATP. Login to comment
216 Previously, the effects of Q141K on protein and mRNA expression were investigated in an ABCG2-overexpressing murine cell line24 or human clinical intestinal samples.25 The initial report showed that murine PA317 cells expressing Q141K increased intracellular drug accumulation compared to cells expressing WT ABCG2, coupled with reduced protein levels with similar mRNA expression, suggesting that the translation efficiency of ABCG2 was the cause of this phenomenon. Login to comment
217 In contrast, a second study involving 32 human intestinal samples demonstrated no correlation between the amount of ABCG2 protein and Q141K polymorphism. Login to comment
218 Our study, using polarized LLC-PK1, agreed with the latter study in that Q141K did not affect ABCG2 protein expression; instead, it showed impaired Q141K transporting function. Login to comment
219 We also confirmed this observation using Sf9 membranes containing a similar amount of ABCG2 protein, in which WTand Q141K-expressing cells exhibited altered ATPase activity. Login to comment
224 Three identified variants, which affect transporter function, were designated as V12M (1), Q126Term (2) and Q141K (3). Login to comment

[hide] Multidrug resistance in cancer chemotherapy and xe... Curr Med Chem Anticancer Agents. 2004 Jan;4(1):31-42. Han B, Zhang JT
Multidrug resistance in cancer chemotherapy and xenobiotic protection mediated by the half ATP-binding cassette transporter ABCG2.
Curr Med Chem Anticancer Agents. 2004 Jan;4(1):31-42., [PMID:14754410]

Abstract [show]
ABCG2, also termed BCRP/MXR/ABCP, is a half ATP-binding cassette (ABC) transporter expressed on plasma membranes. ABCG2 was independently cloned from placenta as well as cell lines selected for resistance to mitoxantrone or anthracyclines. ABCG2 consists of a nucleotide-binding domain (NBD) at the amino terminus and a transmembrane domain (TMD) at the carboxyl terminus and it is postulated to form a homodimer to perform its biological functions. Over-expression of ABCG2 in cell lines confers resistance on a wide variety of anticancer drugs including mitoxantrone, daunorubicin, doxorubicin, topotecan and epirubicin. The expression of ABCG2 has been implicated in multidrug resistance (MDR) of acute myeloid leukemia and some solid tumors. In addition, ABCG2 can transport several fluorescent dyes or toxins. ABCG2 is found to be expressed in epithelial cells of intestine and colon, liver canaliculi, and renal tubules, where it serves to eliminate the plasma level of orally administered anticancer drugs as well as ingested toxins. ABCG2 is found to be highly expressed in placenta and the luminal surface of microvessel endothelium blood-brain barrier where it may play a role in limiting the penetration of drugs, such as topotecan from the maternal plasma into the fetus and from blood to brain. A variety of inhibitors for ABCG2 including GF120918 may prove useful for sensitizing cancer cells to chemotherapy or altering the distribution of orally administered drug substrates of ABCG2. Interestingly, ABCG2 is also expressed highly in hematopoietic stem cells. However, the function of ABCG2 in stem cells is currently unknown, although it may provide protection to stem cells from a variety of xenobiotics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 Nonsynonymous SNPs at nucleotide 238 (Val12 Met; exon 2) and nucleotide 625 (Gln141 Lys; exon 5) showed a greater frequency of heterozygosity (22.2% and 10%, respectively) than the SNP at 2062 (Asp620 Asn; exon 16). Login to comment
113 Two non-synonymous SNPs, Val12 Met and Gln141 Lys, were also identified, which are consistent with the study by Honjo et al. [25]. Login to comment
115 Genotyping of these sequence variations revealed linkage between the CTCA deletion and the SNP of Gln141 Lys. Login to comment

[hide] ABC transporters and the blood-brain barrier. Curr Pharm Des. 2004;10(12):1295-312. Begley DJ
ABC transporters and the blood-brain barrier.
Curr Pharm Des. 2004;10(12):1295-312., [PMID:15134482]

Abstract [show]
The blood-brain barrier (BBB) and the blood-cerebrospinal fluid barrier (BCSFB) form a very effective barrier to the free diffusion of many polar solutes into the brain. Many metabolites that are polar have their brain entry facilitated by specific inwardly-directed transport mechanisms. In general the more lipid soluble a molecule or drug is, the more readily it will tend to partition into brain tissue. However, a very significant number of lipid soluble molecules, among them many useful therapeutic drugs have lower brain permeability than would be predicted from a determination of their lipid solubility. These molecules are substrates for the ABC efflux transporters which are present in the BBB and BCSB and the activity of these transporters very efficiently removes the drug from the CNS, thus limiting brain uptake. P-glycoprotein (Pgp) was the first of these ABC transporters to be described, followed by the multidrug resistance-associated proteins (MRP) and more recently breast cancer resistance protein (BCRP). All are expressed in the BBB and BCSFB and combine to reduce the brain penetration of many drugs. This phenomenon of "multidrug resistance" is a major hurdle when it comes to the delivery of therapeutics to the brain, not to mention the problem of cancer chemotherapy in general. Therefore, the development of strategies for bypassing the influence of these ABC transporters and for the design of effective drugs that are not substrates and the development of inhibitors for the ABC transporters becomes a high imperative for the pharmaceutical industry.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
294 Also a C421A polymorphism has been reported which substitutes lysine for glutamine at position 141 of the transporter. Login to comment

[hide] ABCG2 -- a transporter for all seasons. FEBS Lett. 2004 Jun 1;567(1):116-20. Sarkadi B, Ozvegy-Laczka C, Nemet K, Varadi A
ABCG2 -- a transporter for all seasons.
FEBS Lett. 2004 Jun 1;567(1):116-20., 2004-06-01 [PMID:15165903]

Abstract [show]
The human ABCG2 (ABCP/MXR/BCRP) protein is a recently recognized ABC half-transporter, which forms homodimers in the plasma membrane and actively extrudes a wide variety of chemically unrelated compounds from the cells. This protein protects our cells and tissues against various xenobiotics, with a crucial role in the intestine, liver, placenta, and the blood-brain barrier. Moreover, ABCG2 seems to have a key function in stem cell protection/regulation, and also in hypoxic defense mechanisms. Widely occurring single nucleotide polymorphisms in ABCG2 may affect absorption and distribution, altering the effectiveness and toxicity of drugs in large populations. At the clinics, overexpression of ABCG2 in tumor cells confers cancer multidrug resistance to a variety of newly developed anticancer agents. On the other hand, specific substrate mutants of ABCG2 are advocated for use as selectable markers in stem-cell based gene therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 These SNPs yield ABCG2 variants containing V12M and Q141K. Login to comment

[hide] Novel camptothecin analogues that circumvent ABCG2... Int J Cancer. 2004 Jul 20;110(6):921-7. Yoshikawa M, Ikegami Y, Hayasaka S, Ishii K, Ito A, Sano K, Suzuki T, Togawa T, Yoshida H, Soda H, Oka M, Kohno S, Sawada S, Ishikawa T, Tanabe S
Novel camptothecin analogues that circumvent ABCG2-associated drug resistance in human tumor cells.
Int J Cancer. 2004 Jul 20;110(6):921-7., 2004-07-20 [PMID:15170677]

Abstract [show]
Irinotecan (7-ethyl-10-[4-(1-piperidino)-1-piperidino]-carbonyloxycamptothecin; CPT-11) is a widely used potent antitumor drug that inhibits mammalian DNA topoisomerase I (Topo I); however, overexpression of ABCG2 (BCRP/MXR/ABCP) can confer cancer cell resistance to SN-38, the active form of CPT-11. We have recently demonstrated that plasma membrane vesicles prepared from ABCG2-overexpressing PC-6/SN2-5H cells transported SN-38 and its glucuronide conjugate in an ATP-dependent manner (Nakatomi et al., Biochem Biophys Res Commun 2001;288:827-32). In the present study, we have characterized a total of 14 new camptothecin (CPT) analogues with respect to both the inhibition of Topo I and the substrate specificity of ABCG2. All of the tested CPT analogues, which have different substitutions at positions 10 and 11, strongly inhibited the Topo I activity in a cell-free system, as did SN-38. Their antitumor activities in the SN-38-resistant PC-6/SN2-5H2 cell line greatly varied, however, being correlated with intracellular accumulation levels. We have examined ATP-dependent transport of those CPT analogues by using plasma membrane vesicles prepared from both PC-6/SN2-5H2 cells and ABCG2-transfected HEK-293 cells. Based on the substrate specificity of ABCG2 thus evaluated, it is strongly suggested that CPT analogues with high polarity are good substrates for ABCG2 and are therefore effectively extruded from cancer cells. In this context, to circumvent ABCG2-associated drug resistance, low-polarity CPT analogues are considered to be potent lead compounds. The present study provides a practical approach to discover new CPT-based drugs for the chemotherapy of drug-resistant human cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
169 This type of variation (Gln141Lys) has hitherto been reported as a naturally occurring SNP of ABCG2. Login to comment
170 The Gln141Lys polymorphism has recently been identified in healthy Japanese volunteers as well.29 We investigated the effects of this SNP on the substrate specificity of ABCG2, using ABCG2-transfected cells with Gln at amino acid 141. Login to comment

[hide] Diflomotecan pharmacokinetics in relation to ABCG2... Clin Pharmacol Ther. 2004 Jul;76(1):38-44. Sparreboom A, Gelderblom H, Marsh S, Ahluwalia R, Obach R, Principe P, Twelves C, Verweij J, McLeod HL
Diflomotecan pharmacokinetics in relation to ABCG2 421C>A genotype.
Clin Pharmacol Ther. 2004 Jul;76(1):38-44., [PMID:15229462]

Abstract [show]
OBJECTIVE: The adenosine triphosphate-binding cassette transporter ABCG2 (breast cancer resistance protein [BCRP]) functions as an efflux transporter for many drugs, including the topoisomerase I inhibitor diflomotecan, and is expressed at high levels in the intestine and liver. We performed an exploratory analysis to evaluate the effects of the natural allelic variant ABCG2 421C>A on the pharmacokinetics of diflomotecan. METHODS: The drug was administered to 22 adult white patients with cancer as a 20-minute infusion (dose, 0.10-0.27 mg), followed 2 weeks later by an oral solution (dose, 0.10-0.35 mg). RESULTS: The ABCG2 421C>A genotype significantly affected the pharmacokinetics of diflomotecan; in 5 patients heterozygous for this allele, plasma levels after intravenous drug administration were 299% (P =.015) of those in 15 patients with wild-type alleles, at mean values of 138 ng x h/mL x mg(-1) (95% confidence interval, 11.3-264 ng x h/mL x mg(-1)) versus 46.1 ng x h/mL x mg(-1) (95% confidence interval, 25.6-66.7 ng x h/mL x mg(-1)), respectively. Diflomotecan levels were not significantly influenced by 11 known variants in the ABCB1, ABCC2, cytochrome P450 (CYP) 3A4, and CYP3A5 genes. CONCLUSION: These findings provide the first evidence linking variant ABCG2 alleles to altered drug exposure and suggest that interindividual variability in substrate drug effects might be influenced, in part, by ABCG2 genotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Frequencies for studied variant genes and genotype-phenotype relationships Polymorphism and nomenclature Effect Allele frequencies Ratio (q/p) for intravenous AUC Ratio (q/p) for oral AUC p q Value† P value Value† P value ABCG2 421CϾA Q141K 0.88 0.12 2.98 .015 1.15 .74 ABCC2-24CϾT 5'-UTR 0.89 0.11 0.868 .82 0.890 .78 ABCC2 1249GϾA V417I 0.86 0.14 1.06 .92 2.10 .063 ABCC2 156231AϾG Intron 3 1.00 0.00 NA NA NA NA ABCB1 1236CϾT‡ (ABCB1*8§) G411G 0.40 0.60 0.877 .82 0.585 .31 ABCB1 2677GϾA/T࿣ (ABCB1*7§) A893S/T 0.63 0.34/0.03 0.784 .61 1.27 .55 ABCB1 3435CϾT‡ (ABCB1*6§) I1145I 0.45 0.55 0.978 .97 0.955 .93 CYP3A4 -392AϾG (CYP3A4*1B) Promotor 0.91 0.09 0.731 .63 0.834 .75 CYP3A4 15713TϾC‡ (CYP3A4*2) S222P 1.00 0.00 NA NA NA NA CYP3A4 23172TϾC (CYP3A4*3) M445T 1.00 0.00 NA NA NA NA CYP3A5 22893GϾA‡ (CYP3A5*3) Splice Variant 0.86 0.14 0.808 .77 0.813 .76 CYP3A5 30597GϾA (CYP3A5*6) Splice Variant 1.00 0.00 NA NA NA NA AUC, Area under plasma concentration-time curve normalized to dose (ie, observed AUC/dose in milligrams); NA, not available. Login to comment
78 Plasma concentration-time profiles of diflomotecan as a function of ABCG2 421CϾA (Q141K) genotype (in which open symbols are homozygous wild-type patients [n ϭ 15] and solid symbols are heterozygous variant patients [n ϭ 5] receiving a 20-minute intravenous infusion of diflomotecan at a dose of 0.1-0.27 mg). Login to comment
87 The studied variant in ABCG2 is a single nucleotide polymorphism causing a nonsynonymous change in the protein sequence, in which a 421C to A transition at exon 5 leads to a lysine to glutamine amino acid substitution at codon 141 (Q141K). Login to comment
91 Area under curve (AUC) of diflomotecan as a function of ABCG2 421CϾA (Q141K) genotype. Login to comment

[hide] ABCG2 pharmacogenetics: ethnic differences in alle... Clin Cancer Res. 2004 Sep 1;10(17):5889-94. de Jong FA, Marsh S, Mathijssen RH, King C, Verweij J, Sparreboom A, McLeod HL
ABCG2 pharmacogenetics: ethnic differences in allele frequency and assessment of influence on irinotecan disposition.
Clin Cancer Res. 2004 Sep 1;10(17):5889-94., 2004-09-01 [PMID:15355921]

Abstract [show]
PURPOSE: The ATP-binding cassette transporter ABCG2 (breast cancer resistance protein) is an efflux protein that plays a role in host detoxification of various xenobiotic substrates, including the irinotecan metabolite 7- ethyl-10-hydroxycamptothecin (SN-38). The ABCG2 421C>A polymorphism has been associated with reduced protein expression and altered function in vitro. The aim of this study was to evaluate the ethnic distribution and potential functional consequence of the ABCG2 421C>A genotype in cancer patients treated with irinotecan. EXPERIMENTAL DESIGN: ABCG2 genotyping was performed using Pyrosequencing on DNA from 88 American Caucasians, 94 African Americans, 938 Africans, and 95 Han Chinese, as well as in 84 European Caucasian patients treated with irinotecan undergoing additional blood sampling for pharmacokinetic studies. RESULTS: Significant differences in allele frequencies were observed between the given world populations (P < 0.001), the variant allele being most common in the Han Chinese population with a frequency as high as 34%. The mean area under the curve of irinotecan and SN-38 were 19,851 and 639 ng x hour/mL, respectively. The frequency of the variant allele (10.7%) was in line with results in American Caucasians. No significant changes in irinotecan pharmacokinetics were observed in relation to the ABCG2 421C>A genotype, although one of two homozygous variant allele carriers showed extensive accumulation of SN-38 and SN-38 glucuronide. CONCLUSIONS: The ABCG2 421C>A polymorphism appears to play a limited role in the disposition of irinotecan in European Caucasians. It is likely that the contribution of this genetic variant is obscured by a functional role of other polymorphic proteins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 In particular, a single nucleotide polymorphism in exon 5 of the ABCG2 gene has been described in which a 421CϾA transversion results in an amino acid change of glutamine to lysine at codon 141 (14-16). Login to comment
108 However, the low frequency of ABCG2 421A (Ͻ 1%) in this population is in line with earlier observations in Africans north of the Fig. 1 Boxplot of dose-normalized AUC of irinotecan (A), SN-38 (B), and SN-38G (C) as a function of the ABCG2 421CϾA (Q141K) genotype. Login to comment

[hide] Functional assessment of ABCG2 (BCRP) gene polymor... Drug Metab Dispos. 2005 Jan;33(1):94-101. Epub 2004 Oct 8. Kobayashi D, Ieiri I, Hirota T, Takane H, Maegawa S, Kigawa J, Suzuki H, Nanba E, Oshimura M, Terakawa N, Otsubo K, Mine K, Sugiyama Y
Functional assessment of ABCG2 (BCRP) gene polymorphisms to protein expression in human placenta.
Drug Metab Dispos. 2005 Jan;33(1):94-101. Epub 2004 Oct 8., [PMID:15475413]

Abstract [show]
The aim of the present study was to assess the contribution of polymorphisms in the breast cancer resistance protein/ATP-binding cassette transporter G2 (BCRP/ABCG2) gene to the placental expression from a new perspective, allelic imbalance. Polymorphisms were screened by polymerase chain reaction (PCR)-single-strand conformation polymorphism analysis followed by sequencing with DNA extracted from 100 placentas. To examine whether polymorphisms of the BCRP gene correlate with the placental BCRP expression, we determined mRNA and protein levels by quantitative real-time PCR and Western blotting, respectively. In placentas, G34A (Val(12)Met) and C421A (Gln(141)Lys) were frequently observed (18-36%), but C376T, which creates a stop codon (Gln(126) stop codon), was found with an allelic frequency of 1%. The mean of the BCRP protein level was significantly lower (p < 0.05) in homozygotes for the A421 allele than in those for the C421 allele, and heterozygotes had an intermediate value. To evaluate whether the C421A polymorphism acts as a cis-element in BCRP transcription, allelic imbalance was determined using informative lymphoblasts and 56 samples of placental cDNA. In most of the placental samples we tested, the difference in expression levels between the two alleles was small, and only two samples indicated a monoallelic expression (i.e., preferential expression of one allele). These results suggest that 1) the predominant allelic expression pattern of BCRP in placental samples is biallelic, and 2) the mutation C421A is not a genetic variant acting in cis, but is considered to influence the translation efficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 In placentas, G34A (Val12 Met) and C421A (Gln141 Lys) were frequently observed (18-36%), but C376T, which creates a stop codon (Gln126 stop codon), was found with an allelic frequency of 1%. Login to comment
110 Of these, five SNPs resulted in the following amino acid substitutions: G34A (Val12Met), C376T (Gln126stop), C421A (Gln141Lys), G1322A (Ser441Asn), and T1465C (Phe489Leu). Login to comment
112 C376T, which is associated with an amino acid substitution from Gln to a stop codon at codon 126 (Gln126stop), was detected in only two placental samples (1.0%) as TABLE 1 Genetic polymorphism in the BCRP gene in Japanese placentas (n ϭ 100) Location Positiona Reference Alleleb Variant Allele Amino Acid Substitution Genotype Frequency of Variant Allele R/R R/V V/V 5Ј-Flanking region -20445 gtctCctcc gtctTctcc 98 2 0 0.010 -20296 agctAttaa agctGttaa 80 18 2 0.110 -19781 aaaaAttat aaaaGttat 99 1 0 -19572_-19569 ctcaCTCAcaaa ctca--caaa 60 33 7 0.235 Exon 2 34 cccaGtgtc cccaAtgtc Val12Met 70 24 6 0.180 Intron 2 203 ϩ 16 tttaAttta tttaGttta 70 24 6 0.180 Intron 3 263 ϩ 10 tataAgaga tataGgaga 85 14 1 0.080 263 ϩ 72 ttttGtgtg ttttTGtgtg 99 1 0 0.005 Exon 4 376 ggtaCaagt ggtaTaagt Gln126stop 98 2 0 0.010 Exon 5 421 cttaCagtt cttaAagtt Gln141Lys 42 45 13 0.355 Intron 5 532-16 ttatAatat ttatGatat 99 1 0 0.005 Exon 9 1098 aggaGatca aggaAatca Synonymous 98 2 0 0.010 Intron 10 1277 ϩ 95 atagTgtaa atagAgtaa 97 3 0 0.015 Exon 11 1322 agcaGtgtt agcaAtgtt Ser441Asn 99 1 0 0.005 Intron 11 1367 ϩ 20 ttctAggaa ttctGggaa 71 25 4 0.165 Exon 12 1465 tataTttac tataCttac Phe489Leu 99 1 0 0.005 Intron 12 1492 ϩ 49 ctatGggtg ctatCggtg 44 45 11 0.335 Exon 13 1515 atgcCttct atgc-ttct Phe506Ser 99 1 0 0.005 Phe507Leu Val508Leu Met509stop Intron 13 1648-42 tgaaAttac tgaaTttac 99 1 0 0.005 1648-21 gactCttag gactTttag 71 25 4 0.165 Intron 14 1738-46 tcttAaaat tcttGaaat 24 52 24 0.500 3Ј-UTR 2332 cttcAgtct cttcTAgtct 86 14 0 0.070 2364 tgccAttat tgccCttat 99 1 0 0.005 2512 agaaCttac agaaTttac 99 1 0 0.005 R, reference allele; V, variant allele. Login to comment
148 SNP Amino Acid Change Population Genotypes Frequency of Variant Allele R/R R/V V/V G34A Val12Met Japanese (n ϭ 120) 81 37 2 0.17 (0.12-0.22) Caucasian (n ϭ 150) 139 11 0 0.04 (0.02-0.06) African American (n ϭ 150) 132 17 1 0.06 (0.04-0.09) C376T Gln126stop Japanese (n ϭ 120) 118 2 0 0.01 (0.00-0.02) Caucasian (n ϭ 150) 150 0 0 0.00 African American (n ϭ 150) 150 0 0 0.00 C421A Gln141Lys Japanese (n ϭ 120) 61 45 14 0.30 (0.25-0.36) Caucasian (n ϭ 150) 121 25 4 0.11 (0.08-0.15) African American (n ϭ 150) 144 5 1 0.02 (0.01-0.04) R, reference allele; V, variant allele. Login to comment
169 Among the nonsynonymous polymorphisms, G34A (Val12Met) and C421A (Gln141Lys) appeared commonly in Japanese subjects, and allelic frequencies of these polymorphisms were in keeping with those of a previous report (Imai et al., 2002). Login to comment

[hide] Functional analysis of SNPs variants of BCRP/ABCG2... Pharm Res. 2004 Oct;21(10):1895-903. Kondo C, Suzuki H, Itoda M, Ozawa S, Sawada J, Kobayashi D, Ieiri I, Mine K, Ohtsubo K, Sugiyama Y
Functional analysis of SNPs variants of BCRP/ABCG2.
Pharm Res. 2004 Oct;21(10):1895-903., [PMID:15553238]

Abstract [show]
PURPOSE: The aim of the current study was to identify the effect of single nucleotide polymorphisms (SNPs) in breast cancer resistance protein (BCRP/ABCG2) on its localization, expression level, and transport activity. METHODS: The cellular localization was identified using the wild type and seven different SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP) after transfection of their cDNAs in plasmid vector to LLC-PK1 cells. Their expression levels and transport activities were determined using the membrane vesicles from HEK293 cells infected with the recombinant adenoviruses containing these kinds of BCRP cDNAs. RESULTS: Wild type and six different SNP variants of BCRP other than S441N BCRP were expressed on the apical membrane, whereas S441N BCRP showed intracellular localization. The expression levels of Q141K and S441N BCRP proteins were significantly lower compared with the wild type and the other five variants. Furthermore, the transport activity of E1S, DHEAS, MTX, and PAH normalized by the expression level of BCRP protein was almost the same for the wild type, V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP. CONCLUSIONS: These results suggest that Q141K SNPs may associate with a lower expression level, and S441N SNPs may affect both the expression level and cellular localization. It is possible that subjects with these polymorphisms may have lower expression level of BCRP protein and, consequently, a reduced ability to export these substrates.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 The cellular localization was identified using the wild type and seven different SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP) after transfection of their cDNAs in plasmid vector to LLC-PK1 cells. Login to comment
7 The expression levels of Q141K and S441N BCRP proteins were significantly lower compared with the wild type and the other five variants. Login to comment
8 Furthermore, the transport activity of E1S, DHEAS, MTX, and PAH normalized by the expression level of BCRP protein was almost the same for the wild type, V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP. Login to comment
10 These results suggest that Q141K SNPs may associate with a lower expression level, and S441N SNPs may affect both the expression level and cellular localization. Login to comment
26 On analyzing the specimens from the 100 Japanese volunteers, 7 kinds of SNPs were identified for the BCRP gene: G34A (V12M), C376T (Q376Stop), C421A (Q141K), G1098A (E366E), G1322A (S441N), T1465C (F489L), and C1515- (AFFVM505-509ASSL Stop). Login to comment
27 The allele frequencies of these SNPs are 18, 1, 36, 1, 0.5, 0.5, and 0.5%, respectively. In the 84 cell lines, 7 kinds of SNPs were identified and their frequency for G34A (V12M), C376T (Q126Stop), C421A (Q141K), G445C (A149P), G488A (R163K), C805T (P269S), and G1098A (E366E) are 22, 3, 29, 1, 0.6, 0.6 and 2%, respectively. Login to comment
29 We constructed expression systems for the wild type and SNPs variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, S441N BCRP) and examined whether these SNPs variants of BCRP alter its localization, expression level, and transport activity. Login to comment
42 Using site-directed mutagenesis, SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S and S441N BCRP) were constructed on pcDNA3.1 vector (SNPs type BCRP/pcDNA3.1). Login to comment
44 Q141K BCRP was amplified with 5Ј-CGGTGAGAGAAAACT- TAAAGTTCTCAGCAG-3Ј and `-GCTGCTGAGAACTT- TAAGTTTTCTCTCACCG-3Ј. Login to comment
52 For SNPs type BCRPs, viruses were prepared in the same way, resulting in the production of pAd-SNPs BCRP (pAd-V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP). Login to comment
97 Except for two BCRP variants (Q141K and S441N BCRP), the expression levels of each BCRP SNPs were approximately the same as that of the wild-type BCRP (Fig. 2). Login to comment
98 The expression level of Q141K BCRP was approximately 30-40% of the wild-type BCRP, whereas that of S441N BCRP was much lower, and could not be determined with any accuracy (Fig. 2). Login to comment
110 Except for two SNP variants of BCRP (Q141K and S441N BCRP), the ATP-dependent uptakes per mg membrane protein of SNP variants (V12M, A149P, R163K, Q166E, P269S BCRP) were similar to that of the wild-type BCRP (Fig. 3a). Login to comment
111 The uptake activity of Q141K BCRP per mg membrane protein was approximately 30-40% of the wild-type BCRP, and that of S441N was almost the same as that of the GFP-infected control cells. Login to comment
114 As shown in Fig. 3b, the transport activity of other SNP variants of BCRP (V12M, Q141K, A149P, R163K, Q166E, and P269S BCRP) was almost identical to that of the wild-type BCRP. Login to comment
115 As far as V12M and Q141K BCRP were concerned, these have a high allele frequency in Japanese and we determined the kinetic parameters for the transport of [3 H]E1S. Login to comment
116 As shown in Fig. 4, the ATP-dependent uptake of [3 H]E1S was saturable, and the Km values were 11.6 ± 4.79, 9.07 ± 1.52, and 14.0 ± 7.27 ␮M, and the Vmax values were 13.3 ± 3.3, 13.5 ± 1.29, and 4.57 ± 1.58 nmol min-1 mg-1 protein, for the wild type, V12M, and Q141K BCRP, respectively. In addition to [3 H]E1S, the transport of other BCRP substrates was examined. Login to comment
120 Figure 5a shows the ATP-dependent uptake of DHEAS, PAH, and MTX per mg membrane protein for the wild-type and SNPs BCRP (V12M, Q141K, A149P, R163K, Q166E, P269S, and S441N BCRP). Login to comment
121 Although Q141K BCRP exhibited a lower activity than wild type BCRP, no significant transport was observed for S441N BCRP (Fig. 5a). Login to comment
133 Q141K BCRP showed a lower expression level, which is approximately 30-40% of that of the wild type. Login to comment
134 This result is consistent with the previous report that the transfection of Q141K BCRP cDNA to PA317 cells and KB-3-1 human cells also resulted in lower expression levels (19). Login to comment
137 Although more detailed analysis is required to clarify the mechanism governing the reduced protein expression of Q141K BCRP, immunohistochemical staining revealed that this variant is expressed on the plasma membrane and, therefore, the altered cellular localization may not be related to the reduced protein level. Login to comment
139 In addition, in the human intestine, the expression of BCRP mRNA was similar in subjects with wild type and Q141K BCRP genes, whereas there was no significant correlation between the protein and mRNA levels for BCRP (20). Login to comment
140 It has also been suggested that linkage disequilibrium is present between a CTCA deletion in the 5Ј-flanking region (g-19572-19569) and Q141K in Swedish subjects (21). Login to comment
162 For these compounds, our results indicated that the transport activity per BCRP molecule for 6 kinds of SNP variants (V12M, A149P, R163K, Q166E, P269S, and also Q141K BCRP) is almost the same as that of the wild type BCRP (Figs. Login to comment
173 Saturation of [3 H]E1S transport was determined for the wild-type, V12M, and Q141K BCRP. Login to comment
180 Furthermore, the Km values for E1S were similar between the wild type, V12M and Q141K BCRP (Fig. 4). Login to comment
181 It has been reported that there is a marked ethnic difference in the frequency of Q141K SNPs, and this is the prevalent allele in the Japanese population (19,21). Login to comment
183 In particular, the frequency of the Q141K variant was 29-36% in the Japanese, whereas the frequency in 26 Caucasians subjects was only 8%. Login to comment
188 Since pheophorbide a is also transported by human BCRP (10), it is likely that Q141K and S441N SNPs may be involved in the phototoxicity and protoporphyria induced by the intake of chlorophyll. Login to comment
190 These data suggest that the ability to protect stem cells from some genotoxic xenobiotics might be lower in subjects who have Q141K and S441N SNPs in BCRP gene. Login to comment
197 Since BCRP also transports SN-38 (28), it is possible that subjects who have Q141K or S441N SNPs variants of BCRP are more sensitive to SN-38. Login to comment
198 In conclusion, we have shown that two kinds of SNP variants of BCRP (Q141K and S441N BCRP) are associated with the reduced expression. Login to comment
200 Since the allele frequency of Q141K in Japanese subjects is as high as 29-36%, it is possible that the interindividual variations in in vivo disposition of BCRP substrates may result from the genotype of BCRP. Login to comment

[hide] Linkage disequilibrium and haplotype architecture ... Ann Hum Genet. 2004 Nov;68(Pt 6):563-73. Wang H, Hao B, Zhou K, Chen X, Wu S, Zhou G, Zhu Y, He F
Linkage disequilibrium and haplotype architecture for two ABC transporter genes (ABCC1 and ABCG2) in Chinese population: implications for pharmacogenomic association studies.
Ann Hum Genet. 2004 Nov;68(Pt 6):563-73., [PMID:15598215]

Abstract [show]
Information about linkage disequilibrium (LD) patterns and haplotype structures for candidate genes is instructive for the design and analysis of genetic association studies for complex diseases and drug response. ABCC1 and ABCG2 are genes coding for two multidrug resistance (MDR) associated transporters; they are also related to some pathophysiological traits. To pinpoint the LD profiles of these MDR genes in Chinese, we systemically screened 27 unrelated individuals for single nucleotide polymorphisms (SNPs) in the coding and regulatory regions of these genes, and thereby characterized their haplotype structures. Despite marked variations in haplotype diversity, LD pattern and intragenic recombination intensity between the two genes, both loci could be partitioned into several LD blocks, in which a modest number of haplotypes accounted for a high fraction of the sampled chromosomes. We concluded that each locus has its own genomic LD profile, but that they still share a common segmental LD architecture with low haplotype diversity. Our data will benefit genetic association studies of complex traits and drug response possibly related to these genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 SNP Nucleotide sequence Minor allele dbSNP ID effect position (major/minor) frequency (%) ABCC1 1 5`FR/-1862 gacccG/Aggcca 44.4 2 5`FR/-1830 atcctA/Gtctac 1.9 3 5`FR/-1680 gaggaG/Aaaaag 1.9 4 5`FR/-471 cggatA/Gctgtc 7.4 5 E2/218 caaaaC/Tcaaaa 3.7 Thr73Ile 6 I2/-26 gttgtG/Aggggg 1.9 rs8187842 7 I3/-66 ctgggT/Cgacaa 37.0 rs4148337 8 I7/+54 ccactC/Actgtg 9.3 rs903880 9 I7/+64 ggcctC/Gaatcc 48.1 rs246232 10 E8/816 cagccG/Agtgaa 1.9 wobble 11 E8/825 aaggtT/Cgtgta 38.9 rs246221 wobble 12 E9/1062 gtgaaT/Cgacac 35.2 rs35587 wobble 13 I9/+8 aggggA/Gcgctg 37.0 rs35588 14 I12/-37 cactcA/Ggggca 20.4 rs35604 15 E13/1684 tggccT/Ctgtgc 20.4 rs35605 wobble 16 I13/+105 ccggtC/Tgggct 20.4 rs35606 17 I14/+105 ccagcC/Tgcttg 1.9 18 I15/+627 gctgtA/Gtttta 25.8 rs35628 19 I15/+669 aatctG/Ttagaa 7.4* rs4148353 20 I15/-967 ctttcT/Ggctgt 37.0 rs152029 21 E16/2007 atcccC/Tgaagg 3.7 rs2301666 wobble 22 E17/2168 tctccG/Aagaaa 5.6 rs4148356 Arg723Gln 23 I18/-30 gcactG/Cacgtg 16.7 rs2074087 24 I22/+62 aattaT/Ctccct 27.8 rs3887893 25 I22/-43 gtcagC/Ttccct 3.7 26 E27/3915 gaggaC/Tctgga 1.9 wobble 27 E28/4002 aagtcG/Atccct 11.1 rs2239330 wobble 28 I28/-35 tcagcA/Gtgaca 27.8 rs212087 29 I30/+30 gcacaG/Atggcc 29.6 rs212088 30 3`UTR/+801 accccC/Gactcc 33.3 rs129081 noncoding 31 3`UTR/+866 tactgT/Atccca 14.8 rs212090 noncoding 32 3`FR/+1513 gttctT/Ctaagg 27.8 ABCG2 1 5`UTR/-407 cgcagC/Tgcctc 1.9 2 5`UTR/-376 ggggaG/Acgctc 1.9 3 E2/34 tcccaG/Atgtca 20.4 rs2231137 Val12Met 4 I2/+36 ttttaA/Gtttac 25.9 rs4148152 5 I3/+10 gtataA/Ggagag 20.4 rs2231138 6 E5/421 acttaC/Agttct 22.2 rs2231142 Gln141Lys 7 E7/805 acgggC/Tctgct 3.7 Pro269Ser 8 I9/-126 agccaT/Gtgagt 7.4 9 I11/+20 gttctA/Gggaac 31.5 rs2231153 10 I12/+49 cctatG/Tggtga 16.7 rs2231156 11 I13/+40 tgtttT/Ctttcc 24.1 rs2231157 12 I13/-21 tgactC/Tttagt 29.6 rs2231162 13 I14/-46 ttcttG/Aaaatt 48.1 rs2725267 SNPs in specific regions, i.e. 5`flanking region (5`FR), 5`untranslated region (5`UTR), intron (I), exon (E), 3`UTR, and 3`FR, are presented as region/+(-): for 5`FR and 5`UTR, n nucleotides upstream (-) from the translation initiation site; for 3`UTR and 3`FR, n nt downstream (+) from the third base of stop codon; for coding regions, n corresponds to positions of their cDNA with the first base of start codon set to 1; and for introns, n nt upstream (-) from 3` site or downstream (+) from 5` site of introns. Login to comment

[hide] Eight novel single nucleotide polymorphisms in ABC... Drug Metab Pharmacokinet. 2003;18(3):212-7. Itoda M, Saito Y, Shirao K, Minami H, Ohtsu A, Yoshida T, Saijo N, Suzuki H, Sugiyama Y, Ozawa S, Sawada J
Eight novel single nucleotide polymorphisms in ABCG2/BCRP in Japanese cancer patients administered irinotacan.
Drug Metab Pharmacokinet. 2003;18(3):212-7., [PMID:15618737]

Abstract [show]
Eight novel single nucleotide polymorphisms (SNPs) were found in the gene encoding the ATP-binding cassette transporter, ABCG2/BCRP, from 60 Japanese individuals administered the anti-cancer drug irinotecan. The detected SNPs were as follows: 1) SNP, MPJ6_AG2005 (IVS2-93T>C); Gene Name, ABCG2; Accession Number, NT_006204; 2) SNP, MPJ6_AG2007 (IVS3+71_72 insT); Gene Name, ABCG2; Accession Number, NT_006204; 3) SNP, MPJ6_AG2012 (IVS6-204C>T); Gene Name, ABCG2; Accession Number, NT_006204; 4) SNP, MPJ6_AG2015 (at nucleotide 1098G>A (exon 9) from the A of the translation initiation codon); Gene Name, ABCG2; Accession Number, NT_006204; 5) SNP, MPJ6_AG2017 (1291T>C (exon 11)); Gene Name, ABCG2; Accession Number, NT_006204; 6) SNP, MPJ6_AG2019 (IVS11-135G>A); Gene Name, ABCG2; Accession Number, NT_006204; 7) SNP, MPJ6_AG2020 (1465T>C (exon 12)); Gene Name, ABCG2; Accession Number, NT_006204; 8) SNP, MPJ6_AG2023 (IVS13+65T>G); Gene Name, ABCG2; Accession Number, NT_006204.MPJ6_AG2015 was a synonymous SNP (E366E). MPJ6_AG2017 and MPJ6_AG2020 resulted in amino acid alterations, F431L and F489L, respectively.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Information on ABCG2WBCRP single nucleotide polymorphisms (SNPs) has been published.8-10) Five naturally occurring nonsynonymous SNPs have been reported in Japanese and Caucasians: V12M, Q126Stop, Q141K, I206L, and N590Y.8-10) SNP Q126Stop was found in 3 out of 124 healthy Japanese subjects.9) Since it may be possible that ABCG2WBCRP polymorphisms are associated with the eŠectiveness and adverse eŠects of irinotecan, ABCG2WBCRP exons and their ‰anking regions were sequenced to identify Japanese speciˆc SNPs. Login to comment
126 Masaya ITODA, et al.SNP18 (216) Novel ABCG2 SNPs SNP19 (217) tion of ABCG2WBCRP haplotypes in conjunction with other frequently found SNPs, including non-synonymous ones (34GÀA (V12M, SNP frequency 19z) and 421CÀA (Q141K, SNP frequency 33z)) in the Japanese population. Login to comment
128 MPJ6äAG2012 was closely associated with the known SNP, IVS1-99GÀA (rs1584481, ssj0001922), but not with the SNPs, 34GÀA (V12M) and 421CÀA (Q141K). Login to comment

[hide] ABCG2-mediated transport of photosensitizers: pote... Cancer Biol Ther. 2005 Feb;4(2):187-94. Epub 2005 Feb 8. Robey RW, Steadman K, Polgar O, Bates SE
ABCG2-mediated transport of photosensitizers: potential impact on photodynamic therapy.
Cancer Biol Ther. 2005 Feb;4(2):187-94. Epub 2005 Feb 8., [PMID:15684613]

Abstract [show]
In photodynamic therapy (PDT), a tumor-selective photosensitizer is administered followed by activation of the photosensitizer by exposure to a light source of a given wavelength. This, in turn, generates reactive oxygen species that induce cellular apoptosis and necrosis in tumor tissue. Based on our earlier finding that the photosensitizer pheophorbide a is an ABCG2 substrate, we explored the ability of ABCG2 to transport photosensitizers with a structure similar to that of pheophorbide a. ABCG2-overexpressing NCI-H1650 MX50 bronchoalveolar carcinoma cells were found to have reduced intracellular accumulation of pyropheophorbide a methyl ester and chlorin e6 compared to parental cells as measured by flow cytometry. The ABCG2 inhibitor fumitremorgin C was found to abrogate ABCG2-mediated transport. Intracellular fluorescence of hematoporphyrin IX, meso-tetra(3-hydroxyphenyl)porphyrin, and meso-tetra(3-hydroxyphenyl)chlorin was not substantially affected by ABCG2. ABCG2-overexpressing cells also displayed decreased intracellular fluorescence of protoporphyrin IX generated by exogenous application of 5-aminolevulinic acid. Mutations at amino acid 482 in the ABCG2 protein known to affect substrate specificity were not found to impact transport of the photosensitizers. In cytotoxicity assays, ABCG2-transfected HEK-293 cells were 11-fold, 30-fold, 4-fold, and >7-fold resistant to PDT with pheophorbide a, pyropheophorbide a methyl ester, chlorin e6, and 5-aminolevulinic acid, respectively. ABCG2-transfected cells were not resistant to PDT with meso-tetra(3-hydroxyphenyl) chlorin. Neither multidrug resistance-associated protein 1 expression nor P-glycoprotein expression appreciably decreased the intracellular fluorescence of any of the photosensitizers examined as determined by flow cytometry. The results presented here implicate ABCG2 as a possible cause for cellular resistance to photodynamic therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
148 We and others described a 421C>A nonsynonymous single nucleotide polymorphism (glutamine to lysine, Q141K, amino acid change) that impairs the transport activity of the protein.40-42 Cells expressing Q141K ABCG2 were shown to be more sensitive to the ABCG2 substrate drugs mitoxantrone, SN-38, topotecan and diflomotecan compared to cells expressing comparable cell surface levels of wild-type protein.42 Expression of the Q141K SNP has also been linked to higher serum levels of diflomotecan in patients receiving the drug orally, suggesting the Q141K polymorphism may affect the pharmacokinetics of ABCG2 substrate drugs.43 In light of the affect of the Q141K polymoprhism on the disposition of ABCG2 substrate drugs, it is tempting to speculate that the Q141K polymorphism may play a role in this observed extended sensitivity due to decreased transporter activity of the resulting ABCG2 protein. Login to comment
154 These results suggest that PDT with photosensitizers that are ABCG2 substrates may be rendered less effective in ABCG2 expressing cancers and that the Q141K polymorphism in ABCG2 may explain increases in the duration of photosensitivity in some patients. Login to comment

[hide] Functional analysis of the human variants of breas... Drug Metab Dispos. 2005 Jun;33(6):697-705. Epub 2005 Mar 2. Vethanayagam RR, Wang H, Gupta A, Zhang Y, Lewis F, Unadkat JD, Mao Q
Functional analysis of the human variants of breast cancer resistance protein: I206L, N590Y, and D620N.
Drug Metab Dispos. 2005 Jun;33(6):697-705. Epub 2005 Mar 2., [PMID:15743976]

Abstract [show]
Previous studies have shown that the V12M and Q141K variants of breast cancer resistance protein (BCRP) can affect expression and function of the transporter. In this study, the effects of the I206L, N590Y, and D620N variants on protein expression, plasma membrane localization, and transport activity of BCRP were investigated. Wild-type BCRP and the three variants were stably expressed in human embryonic kidney (HEK) cells. Confocal microscopy analysis showed that the three variants were predominantly routed to the plasma membrane of HEK cells. The expression level of I206L in the plasma membrane was approximately 45% of that of wild-type protein, whereas the N590Y and D620N levels were increased approximately 3.6-fold and 2.4-fold, respectively, as determined by immunoblotting. All three variants transported mitoxantrone, pheophorbide a, and BODIPY FL-prazosin. After normalization for differences in BCRP expression, I206L, N590Y, and D620N exhibited approximately 2-fold, 0.3-fold, and 0.5-fold wild-type efflux activities, respectively. The variants also conferred resistance to mitoxantrone and topotecan. Mitoxantrone and topotecan resistance by I206L and N590Y was approximately 2-fold and 0.3-fold of the wild-type BCRP resistance levels, respectively. Although D620N conferred a topotecan resistance similar to that of the wild-type protein, its level of mitoxantrone resistance was decreased by 50%. After normalization to BCRP expression levels, ATPase activities of I206L were not significantly different from those of wild-type protein, whereas N590Y and D620N exhibited approximately 30% and 50% of wild-type ATPase activities, respectively. These results suggest that I206L has the lowest protein expression and the highest activity, whereas N590Y and D620N display higher expression and lower activity, relative to wild-type BCRP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Two variants, V12M and Q141K, occurred at particularly high allele frequencies in Chinese and Japanese populations (30-60%) and at relatively lower allele frequencies in white people and African-Americans (5-26%) (Zamber et al., 2003). Login to comment
28 6 Copyright (c) 2005 by The American Society for Pharmacology and Experimental Therapeutics 3657/3131752 DMD 33:697-705, 2005 Printed in U.S.A. 697 Q141K seems to be associated with reduced protein expression compared with wild-type BCRP in mammalian expression systems (Imai et al., 2002; Kondo et al., 2004). Login to comment
207 Imai et al. (2002) demonstrated that Q141K was expressed at a lower level in transfected murine fibroblast PA317 cells and conferred lower levels of drug resistance compared with wild-type BCRP, whereas V12M exhibited an expression level and drug resistance profiles very similar to those of wild-type protein (Imai et al., 2002). Login to comment
208 Another study (Mizuarai et al., 2004) showed that V12M and Q141K were expressed in the polarized LLC-PK1 porcine kidney cells at levels comparable to that of wild-type protein; however, both V12M and Q141K conferred significantly lower drug resistance than wild-type protein, accompanied with increased drug accumulation and decreased drug efflux. Login to comment
209 Further analysis of the mechanism of transport dysfunction revealed that the apical membrane localization of V12M was disrupted, whereas the expression and apical membrane localization of Q141K were not affected; however, the ATPase activity of Q141K was decreased. Login to comment
210 A recent study illustrated that V12M was expressed in HEK cells at levels similar to that of wild-type BCRP, whereas the Q141K level was significantly decreased compared with wild-type protein; however, the transport activity normalized by the BCRP expression was almost the same for V12M, Q141K and wild-type BCRP (Kondo et al., 2004). Login to comment
212 However, the lower Q141K expression appears to be consistent with in vivo data. Login to comment
213 When 99 Japanese placental samples were analyzed, the subjects who were homozygous for Q141K were found to express significantly lower amounts of BCRP (Kobayashi et al., 2005). Login to comment
214 The lower protein expression and/or transport dysfunction of Q141K could affect drug disposition. Login to comment
215 A recent clinical study has shown that Q141K is associated with significant changes in pharmacokinetics of diflomotecan (Sparreboom et al., 2004). Login to comment
216 In five patients heterozygous for Q141K, the plasma levels of diflomotecan after intravenous administration were 299% of those in 15 patients expressing wild-type BCRP. Login to comment
269 These data suggest that, whereas ATPase activities of BCRP could be affected by mutations in the NBD (e.g., Q141K and I206L), mutations in other regions including the TM segments (e.g., G406L/G410L) and extracellular loops (e.g., N590Y and D620N) can also influence ATP hydrolysis. Login to comment

[hide] Multidrug transporter ABCG2 prevents tumor cell de... Cancer Res. 2005 Mar 1;65(5):1770-7. Elkind NB, Szentpetery Z, Apati A, Ozvegy-Laczka C, Varady G, Ujhelly O, Szabo K, Homolya L, Varadi A, Buday L, Keri G, Nemet K, Sarkadi B
Multidrug transporter ABCG2 prevents tumor cell death induced by the epidermal growth factor receptor inhibitor Iressa (ZD1839, Gefitinib).
Cancer Res. 2005 Mar 1;65(5):1770-7., 2005-03-01 [PMID:15753373]

Abstract [show]
Iressa (ZD1839, Gefitinib), used in clinics to treat non-small cell lung cancer patients, is a tyrosine kinase receptor inhibitor that leads to specific decoupling of epidermal growth factor receptor (EGFR) signaling. Recent data indicate that Iressa is especially effective in tumors with certain EGFR mutations; however, a subset of these tumors does not respond to Iressa. In addition, certain populations have an elevated risk of side effects during Iressa treatment. The human ABCG2 (BCRP/MXR/ABCP) transporter causes cancer drug resistance by actively extruding a variety of cytotoxic drugs, and it functions physiologically to protect our tissues from xenobiotics. Importantly, ABCG2 modifies absorption, distribution, and toxicity of several pharmacologic agents. Previously, we showed that ABCG2 displays a high-affinity interaction with several tyrosine kinase receptor inhibitors, including Iressa. Here, we show that the expression of ABCG2, but not its nonfunctional mutant, protects the EGFR signaling-dependent A431 tumor cells from death on exposure to Iressa. This protection is reversed by the ABCG2-specific inhibitor, Ko143. These data, reinforced with cell biology and biochemical experiments, strongly suggest that ABCG2 can actively pump Iressa. Therefore, variable expression and polymorphisms of ABCG2 may significantly modify the antitumor effect as well as the absorption and tissue distribution of Iressa.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
320 Imai Y, Nakane M, Kage K, et al. C421A polymorphism in the human breast cancer resistance protein gene is associated with low expression of Q141K protein and low-level drug resistance. Login to comment
317 Imai Y, Nakane M, Kage K, et al. C421A polymorphism in the human breast cancer resistance protein gene is associated with low expression of Q141K protein and low-level drug resistance. Login to comment

[hide] Pharmacogenetic profiling across the irinotecan pa... Br J Clin Pharmacol. 2005 Apr;59(4):415-24. Zhou Q, Sparreboom A, Tan EH, Cheung YB, Lee A, Poon D, Lee EJ, Chowbay B
Pharmacogenetic profiling across the irinotecan pathway in Asian patients with cancer.
Br J Clin Pharmacol. 2005 Apr;59(4):415-24., [PMID:15801936]

Abstract [show]
AIMS: The aim of this exploratory study was to investigate associations between irinotecan pharmacokinetic parameters and allelic variants in genes encoding for drug transporters and drug metabolizing enzymes that are involved in irinotecan disposition in Asian patients with cancer. METHODS: Irinotecan was administered at 100 mg m(-2) over 90 min on a weekly schedule to 29 nasopharyngeal carcinoma patients and pharmacokinetic analysis was performed during the first cycle. All patients were genotyped for allelic variants in genes encoding drug metabolizing enzymes (CYP3A4, CYP3A5, UGT1A1) and drug transporters (ABCB1, ABCC2 and ABCG2) that are involved in irinotecan disposition. RESULTS: Of the six candidate genes that were analyzed, 11 genetic variants were found. Significant genotypic-phenotypic associations were apparent only for transporter genes. The C(max) of irinotecan was significantly lower in patients carrying the CC genotype at exon 26 of the ABCB1 gene compared with those harbouring at least one variant allele (P = 0.047). Patients harbouring the wild type ABCG2 CTCA genotype were associated with significantly higher values for relative extent of conversion (REC) of irinotecan to SN-38 compared with patients carrying at least one deletion CTCA allele (P = 0.019). CONCLUSIONS: The present exploratory study shows that genetic polymorphisms in drug transporter genes, particularly in ABCB1 and ABCG2 genes, may be important in influencing the pharmacokinetics of irinotecan and its metabolites. The predictive value of the identified allelic variants in the ABCG2 and ABCB1 genes on irinotecan disposition should be further investigated in a larger patient population as well as in other ethnic populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
236 29 Imai Y, Nakane M, Kage K, et al. C421A polymorphism in the human breast cancer resistance protein gene is associated with low expression of Q141K protein and low level drug resistance. Login to comment

[hide] Single nucleotide polymorphisms modify the transpo... Cancer Chemother Pharmacol. 2005 Aug;56(2):161-72. Epub 2005 Apr 19. Morisaki K, Robey RW, Ozvegy-Laczka C, Honjo Y, Polgar O, Steadman K, Sarkadi B, Bates SE
Single nucleotide polymorphisms modify the transporter activity of ABCG2.
Cancer Chemother Pharmacol. 2005 Aug;56(2):161-72. Epub 2005 Apr 19., [PMID:15838659]

Abstract [show]
Single nucleotide polymorphism (SNP) analyses of the ABCG2 gene have revealed three nonsynonymous SNPs resulting in the amino acid changes at V12M, Q141K and D620N. To determine whether the SNPs have an effect on drug transport, human embryonic kidney cells (HEK-293) were stably transfected with full length ABCG2 coding wild-type or SNP variants of ABCG2. In 4-day cytotoxicity assays with mitoxantrone, topotecan, SN-38 or diflomotecan, cells transfected with wild-type R482 ABCG2 showed IC50 values up to 1.2-fold to 5-fold higher than cells expressing comparable levels of Q141K ABCG2, suggesting that the Q141K SNP affects drug transport. FTC-inhibitable mitoxantrone efflux normalized to ABCG2 surface expression as assayed by the anti-ABCG2 antibody 5D3 was significantly lower in cells transfected with Q141K ABCG2 than in those transfected with wild-type R482 ABCG2 (P = 0.0048). Values for V12M and D620N ABCG2 were comparable to those for wild-type R482 ABCG2. The vanadate-sensitive ATPase activity of ABCG2 was assayed in Sf9 insect cells infected with wild-type or SNP variants of ABCG2. Basal ATPase activity in cells transfected with Q141K ABCG2 was 1.8-fold lower than in cells transfected with wild-type ABCG2, but was comparable among cells expressing wild-type, V12M or D620N ABCG2. Confocal studies of ABCG2 localization revealed higher intracellular staining in the Q141K transfectants than in cells transfected with wild-type or V12M ABCG2. Decreased transport of Hoechst 33342 was observed in Sf9 cells expressing V12M ABCG2; however, this was not true in HEK-293 cells expressing V12M ABCG2. These results suggest that the Q141K SNP affects the transport efficiency of ABCG2 and may result in altered pharmacokinetics or drug-resistance profiles in clinical oncology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 ORIGINAL ARTICLE Kuniaki Morisaki Æ Robert W. Robey Csilla O¨ zvegy-Laczka Æ Yasumasa Honjo Orsolya Polgar Æ Kenneth Steadman Bala´ zs Sarkadi Æ Susan E. Bates Single nucleotide polymorphisms modify the transporter activity of ABCG2 Received: 21 July 2004 / Accepted: 1 October 2004 / Published online: 19 April 2005 Ó Springer-Verlag 2005 Abstract Single nucleotide polymorphism (SNP) analyses of the ABCG2 gene have revealed three nonsynonymous SNPs resulting in the amino acid changes at V12M, Q141K and D620N. Login to comment
2 In 4-day cytotoxicity assays with mitoxantrone, topotecan, SN-38 or diflomotecan, cells transfected with wild-type R482 ABCG2 showed IC50 values up to 1.2-fold to 5-fold higher than cells expressing comparable levels of Q141K ABCG2, suggesting that the Q141K SNP affects drug transport. Login to comment
3 FTC-inhibitable mitoxantrone efflux normalized to ABCG2 surface expression as assayed by the anti-ABCG2 antibody 5D3 was significantly lower in cells transfected with Q141K ABCG2 than in those transfected with wild-type R482 ABCG2 (P=0.0048). Login to comment
6 Basal ATPase activity in cells transfected with Q141K ABCG2 was 1.8-fold lower than in cells transfected with wild-type ABCG2, but was comparable among cells expressing wild-type, V12M or D620N ABCG2. Login to comment
7 Confocal studies of ABCG2 localization revealed higher intracellular staining in the Q141K transfectants than in cells transfected with wild-type or V12M ABCG2. Login to comment
9 These results suggest that the Q141K SNP affects the transport efficiency of ABCG2 and may result in altered pharmacokinetics or drug-resistance profiles in clinical oncology. Login to comment
30 We previously sequenced the ABCG2 gene in 90 genomic DNA samples representing a global genetic diversity and identified three nonsynonymous SNPs -34G fi A, substituting a valine for methionine (V12M); 421C fi A, substituting a glutamine for lysine (Q141K); and 1858C fi A, substituting an aspartic acid for asparagine (D620N)-in the coding region of ABCG2 [18]. Login to comment
33 In a study of SNPs in ABCG2 in the general Japanese population, the V12M and Q141K SNPs were observed at higher allelic frequencies (17.2% and 26.6%, respectively) [19]. Login to comment
34 Similarly, in other studies, the V12M and Q141K SNPs have also been found to be the most frequent polymorphisms in various ethnic and racial groups including Caucasian, Asian, and Swedish populations [3, 48]. Login to comment
37 containing full-length ABCG2 encoding wild-type (R482), mutant (R482T, R482G), or SNP variants (V12M, Q141K, or D620N) of ABCG2. Login to comment
98 Clones were initially screened using the anti-ABCG2 antibody 5D3 and, from the positive clones obtained, 12 clones transfected with V12M, Q141K, D620N, or 1_11delV12M were selected for further study: V12M-12, -13 and -14; Q141K-5, -8, -13 and -16; D620N-2, -3 and -23; and 1_11delV12M-2 and -8. Login to comment
101 Although Northern blot analysis demonstrated higher expression of ABCG2 mRNA in wild-type (482R) ABCG2-transfected clones than in V12M-13 and Q141K-8 clones, immunoblot analysis showed generally comparable (within two- to threefold) ABCG2 protein expression in 482R, V12M-13, and Q141K-8 transfectants. Login to comment
103 Differential resistance among cells transfected with wild-type, V12M and Q141K ABCG2 To determine whether the SNPs affected the transport activity of ABCG2, 4-day cytotoxicity assays were performed with the ABCG2 substrates mitoxantrone, topotecan, SN-38, and diflomotecan (BN80915) on ABCG2-transfected HEK-293 cells expressing comparable amounts of ABCG2. Login to comment
105 Comparable surface expression of ABCG2 in the 482R-2, Q141K-5, Q141K-8 and V12M-13 clones was confirmed using the 5D3 antibody, as shown in Fig. 2a. Login to comment
108 a Northern blot analysis of ABCG2 expression in representative HEK-293 cells transfected with wild-type, V12M, Q141K, or D620N ABCG2. Login to comment
114 Except for the Q141K-5 clone with diflomotecan, P values for this comparison were <0.05. Login to comment
116 The V12M-13 and 482R-2 clones were comparably resistant to mitoxantrone, topotecan, SN-38 and diflomotecan, whereas the Q141K-5 and -8 clones had IC50 values that were 3-fold to 5-fold lower for mitoxantrone and topotecan, 2-fold to 3.4-fold lower for SN-38, and 1.2-fold to 2.3-fold lower for diflomotecan. Login to comment
118 These results suggest that the Q141K SNP has functional consequences in the resulting ABCG2 protein. Login to comment
119 Correlation between FTC-inhibitable mitoxantrone efflux and surface expression in ABCG2 transfectants To confirm the impaired transport of mitoxantrone in cells expressing Q141K ABCG2, we selected two to six Fig. 2 Impact of SNPs on ABCG2-mediated resistance. Login to comment
121 b Cytotoxicity assays were performed with mitoxantrone, topotecan, SN-38, or diflomotecan on HEK-293 cells transfected with empty vector (filled circles), or the 482R-2 (open circles), V12M-13 (filled triangles), Q141K-5 (open squares), and Q141K-8 (hatched squares) clones from a. Login to comment
122 Representative results are shown clones each of ABCG2-transfected cells expressing R482, R482T, R482G, V12M, Q141K or D620N ABCG2. Login to comment
133 Efflux and expression values for cells transfected with V12M and D620N ABCG2 fell close to the line, while values for cells transfected with Q141K ABCG2 fell predominantly below the line. Login to comment
135 Among the transfectants, Q141K variants showed significantly lower values compared to the transfectants with wild-type ABCG2 and the other SNP variants, V12M and D620N (P=0.0048, 0.0005, and 0.0126, respectively), suggesting that Q141K ABCG2 transports mitoxantrone less efficiently than wild-type ABCG2. Login to comment
140 We next examined the ATPase activity of V12M, Q141K, and D620N variants using this system. Login to comment
143 Despite similar levels of ABCG2 expression, the basal ATPase activity was significantly lower in the case of the Q141K variant than in wild-type ABCG2, whereas in the other SNP variants, the ATPase activity was similar to that observed in wild-type ABCG2 (Fig. 5b). Login to comment
146 The lower basal ATPase activity in the Q141K variant persisted in the presence of mitoxantrone (Fig. 5b). Login to comment
148 At 1 lM Clone Mitoxantrone Topotecan SN-38 Diflomotecan IC50 RR IC50 RR IC50 RR IC50 RR pcDNA3-10 0.6±0.3 - 8.7±1.2 - 1.2±0.7 - 0.3±0.2 - 482R-2 34±5.4 57 275±150 32 123±68 103 1.4±0.6 5 V12M-13 44±15 73 250±71 29 100±1 83 1±0.1 3 Q141K-5 7.4±1.8 12 55±7 6 36±11 30 0.6±0.07 2 Q141K-8 10.8±5.3 18 90±14 10 66±11 55 0.9±0.1 3 Table 1 Relative resistance (RR) of ABCG2-transfected cells to ABCG2 substrates. Login to comment
151 In all cases P<0.05 except for the Q141K-5 clone with diflomotecan where P=0.09 (IC50 values are in nanomoles) Ko143, ATPase activity in membrane protein from cells expressing any of the ABCG2 proteins was almost completely abrogated. Login to comment
157 Effect of SNPs on cellular localization of ABCG2 To determine if the SNPs affected membrane localization of ABCG2, we performed immunofluorescence studies on HEK-293 cells stably transfected with wild-type, V12M or Q141K ABCG2. Login to comment
160 In contrast, HEK-293 cells expressing Q141K ABCG2 demonstrated high intracellular staining with the BXP-21 antibody, as well as cell surface staining (Fig. 6c). Login to comment
161 These results, despite the selection of clones expressing comparable levels of cell surface ABCG2, suggest impaired membrane trafficking or incorrect membrane insertion of Q141K ABCG2. Login to comment
163 To examine whether the nonsynonymous SNPs in ABCG2 affect the transport of this compound, Hoechst 33342 dye transport was measured in intact Sf9 cells expressing wild-type, V12M, Q141K, or D620N ABCG2, as well as the nonfunctional mutant, R482G/K86M. Login to comment
164 Immunoblot analysis of protein obtained from the infected cells is shown in Fig. 7a. Hoechst 33342 transport was comparable in cells expressing wild-type, Q141K or D620N ABCG2. Login to comment
172 Representative histograms for 482R-9, 482G-1, V12M-13, D620N-2, Q141K-5, and 1_11delV12M-8 are shown substrate-free medium for 60 min continuing with or without FTC. Login to comment
174 No significant difference in FTC-inhibitable Hoechst efflux was observed between cells expressing wild-type (R482), V12M or Q141K ABCG2 (Fig. 7c, right column). Login to comment
178 Discussion We and others have recently identified several polymorphisms in ABCG2, including three nonsynonymous SNPs resulting in amino acid substitution in the coding region of ABCG2: V12M, Q141K, D620N [4, 19, 20, 50]. Login to comment
180 Our results suggest that the Q141K SNP affects the transport efficiency of ABCG2. Login to comment
189 Values from the experiment in a were obtained for ABCG2-transfected HEK-293 clones expressing varying levels of 482R, R482G, R482T, V12M, Q141K, and D620N ABCG2 and a box plot was generated. Login to comment
199 Imai et al. have previously reported that the Q141K variant is associated with decreased protein expression in transfected cells and therefore results in increased sensitivity to chemotherapeutic agents [20]. Login to comment
200 In contrast, we did not observe decreased expression of ABCG2 in HEK-293 cells transfected with Q141K ABCG2. Login to comment
201 Supporting our findings, Zamber et al. have found no correlation between the Q141K SNP and level of expression of ABCG2 protein [50]. Login to comment
202 The Q141K SNP does not appear to prevent expression of the protein on the cell surface. Login to comment
204 Four-day cytotoxicity assays demonstrated that, among HEK-293 cells transfected with wild-type, V12M, or Q141K ABCG2, those expressing Q141K ABCG2 had IC50 values for mitoxantrone, topotecan, SN-38 and diflomotecan that were as much as fivefold lower than those for cells expressing comparable levels Fig. 5 ATPase activity in Sf9 insect cells infected with ABCG2-bearing baculovirus. Login to comment
205 a Immunoblot detection of human wild-type, D620N, Q141K and V12M ABCG2 expressed in Sf9 insect cells. Login to comment
206 Membranes of Sf9 cells (1.5 lg total protein from V12M/Sf9, Q141K/Sf9 and D620N/Sf9, 1.0 lg from wild-type ABCG2/Sf9, and 1.2 lg from b-galactosidase/Sf9) dissolved in disaggregation buffer were subjected to electrophoresis on 7.5% Laemmli-type gels and blotted onto PVDF membranes, followed by immunodetection with the BXP-21 antibody. b ATPase activity measured in membranes of Sf9 cells expressing the wild-type, V12M, Q141K, and D620N variants of human ABCG2. Login to comment
210 HEK-293 cells transfected with wild-type (482R-2) (a), V12M (V12M-13) (b), or Q141K (Q141K-8) (c) ABCG2 were fixed, permeabilized, and then incubated with the mouse monoclonal anti-ABCG2 antibody, BXP-21. Login to comment
212 When surface ABCG2 expression was used to normalize the FTC-inhibitable mitoxantrone efflux, we found that HEK-293 cells expressing Q141K ABCG2 transported mitoxantrone less efficiently than cells expressing wild-type, V12M or D620N ABCG2. Login to comment
213 These findings are in agreement with those of Mizuarai et al., who found that polarized LLC/ PK1 cells transfected with Q141K ABCG2 are more sensitive to mitoxantrone, topotecan and an indolocarbazole topoisomerase I inhibitor, all of which are known ABCG2 substrates [30]. Login to comment
221 The Q141K SNP has also recently been shown to significantly affect the pharmacokinetics of diflomotecan. Login to comment
223 Despite the relatively poor transport of diflomotecan by ABCG2, Sparreboom et al. have reported that, in patients heterozygous for the Q141K SNP, plasma diflomotecan levels are approximately threefold higher than in patients expressing the wild-type allele [44]. Login to comment
225 These results suggest that the Q141K SNP may alter the pharmacokinetic profile of other ABCG2 substrate drugs. Login to comment
226 Basal ATPase activity was determined to be 1.8-fold lower in membrane protein isolated from Sf9 insect cells infected with recombinant baculoviruses containing full-length Q141K ABCG2 compared to protein from cells expressing wild-type or the other SNP variant ABCG2 forms. Login to comment
227 Our results are in agreement with those of Mizuarai et al. who reported that the ATPase activity of Q141K ABCG2 is 1.3-fold lower than wild-type in the Sf9 system [30]. Login to comment
241 Consistent with other reports, we found that the Q141K polymorphism impaired the activity of the ABCG2 protein. Login to comment
244 Taken together, the results presented here support the hypothesis that the Q141K variant has the potential to alter the pharmacokinetics of ABCG2 substrates. Login to comment
245 Whether the presence of the Q141K polymorphism in clinical tumors could promote chemosensitivity is unknown, but remains a question for further study. Login to comment

[hide] Mechanisms of resistance to anticancer drugs: the ... Pharmacogenomics. 2005 Mar;6(2):115-38. Lepper ER, Nooter K, Verweij J, Acharya MR, Figg WD, Sparreboom A
Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2.
Pharmacogenomics. 2005 Mar;6(2):115-38., [PMID:15882131]

Abstract [show]
ATP-binding cassette (ABC) genes play a role in the resistance of malignant cells to anticancer agents. The ABC gene products, including ABCB1 (P-glycoprotein) and ABCG2 (breast cancer-resistance protein [BCRP], mitoxantrone-resistance protein [MXR], or ABC transporter in placenta [ABCP]), are also known to influence oral absorption and disposition of a wide variety of drugs. As a result, the expression levels of these proteins in humans have important consequences for an individual's susceptibility to certain drug-induced side effects, interactions, and treatment efficacy. Naturally occurring variants in ABC transporter genes have been identified that might affect the function and expression of the protein. This review focuses on recent advances in the pharmacogenetics of the ABC transporters ABCB1 and ABCG2, and discusses potential implications of genetic variants for the chemotherapeutic treatment of cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
122 The common ABCG2 C421A variant in exon 5, in which the C to A transversion results in an amino acid change of Gln to Lys at codon 141, has been associated with low ABCG2 expression levels [50,85,91-93]. Login to comment
157 Position in gene* Nucleotide‡ Region Wild-type allele Variant allele Amino acid Change -19572 to -19569 5`-Flanking region CTCA - CTCA deletion -19202 5` UTR G C -18845 5` UTR T C -18604 5` UTR A - Deletion -18482 -113 Exon 1 C T Non-coding -18398 -29 Exon 1 A G Non-coding 34 34 Exon 2 G A 12 Val to Met 71 71 Exon 2 C T 24 Ala to Val 114 114 Exon 2 T C 38 Synonymous 239 Intron 2 A G 7268 Intron 2 T C 7420 Intron 3 - T Insertion 8007 Intron 3 G A 8184 369 Exon 4 C T 123 Synonymous 8191 376 Exon 4 C T 126 Gln to Term 8825 421 Exon 5 C A 141 Gln to Lys 8862 458 Exon 5 C T 153 Thr to Met 8878 474 Exon 5 C T 158 Synonymous 8900 496 Exon 5 C G 166 Gln to Glu 18186 Intron 5 A G 18286 616 Exon 6 A C 206 Ile to Leu 18293 623 Exon 6 T C 208 Phe to Ser 21530 Intron 6 C T 21718 Intron 6 A G 21903 Intron 7 A G 24618 Intron 7 T A 26297 1098 Exon 9 G A 366 Synonymous 38389 1291 Exon 11 T C 431 Phe to Leu 38485 Intron 11 A G 40111 Intron 11 G A 40303 1425 Exon 12 A G 475 Synonymous 40322 1444 Exon 12 A G 482 Arg to Gly 40323 1445 Exon 12 G C 482 Arg to Thr 40343 1465 Exon 12 T C 489 Phe to Leu 40419 Intron 12 G T 42314 Intron 13 T G 44997 Intron 14 A G 45022 Intron 14 C T 45073 1768 Exon 15 A T 590 Asn to Tyr 47355 1858 Exon 16 G A 620 Asp to Asn 47734 2237 Exon 16 G T Non-coding 47890 2393 Exon 16 G T Non-coding 47891 2394 Exon 16 C A Non-coding ABC: ATP-binding cassette; UTR: Untranslated region. Login to comment
524 85. Imai Y, Nakane M, Kage K et al.: C421A polymorphism in the human breast cancer resistance protein gene is associated with low expression of Q141K protein and low-level drug resistance. Login to comment
553 Morisaki K, Robey RW, Nadjem T et al.: The Q141K single-nucleotide polymorphism impacts the transporter activity of ABCG2. Login to comment

[hide] Association of the BCRP C421A polymorphism with no... Int J Cancer. 2005 Nov 10;117(3):431-4. Korenaga Y, Naito K, Okayama N, Hirata H, Suehiro Y, Hamanaka Y, Matsuyama H, Hinoda Y
Association of the BCRP C421A polymorphism with nonpapillary renal cell carcinoma.
Int J Cancer. 2005 Nov 10;117(3):431-4., 2005-11-10 [PMID:15906349]

Abstract [show]
Breast cancer resistance protein (BCRP), the second member of the ATP-binding cassette membrane transporter family, has a single nucleotide polymorphism, C421A (resulting in Q141K), that is of functional importance. Our aim was to explore the relationship between this polymorphism of the BCRP gene and the risk of renal cell carcinoma (RCC) development. For a case-control study, DNA samples from 200 nonpapillary RCC patients and 200 healthy control subjects were analyzed using the TaqMan technique. The genotypic frequencies of the BCRP C421A polymorphism were compared between RCC patients and control subjects. The frequency of the C/C genotype was significantly higher in RCC patients than in control subjects (age- and gender-adjusted OR = 1.96, 95% CI 1.32-2.93). No associations were observed between the BCRP C421A polymorphism and clinicopathologic or epidemiologic factors, including age, gender, tumor grade, stage, cigarette smoking, family history of cancer and body mass index. Carriers with the C/C genotype of the BCRP C421A polymorphism are at risk of developing nonpapillary RCC. These data suggest that BCRP is a candidate RCC susceptibility gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Association of the BCRP C421A polymorphism with nonpapillary renal cell carcinoma Yoshihito Korenaga1 , Katsusuke Naito1*, Naoko Okayama2 , Hiroshi Hirata1 , Yutaka Suehiro2 , Yuichiro Hamanaka2 , Hideyasu Matsuyama1 and Yuji Hinoda2 1 Department of Urology, Yamaguchi University School of Medicine, Yamaguchi, Japan 2 Department of Clinical Laboratory Science, Yamaguchi University School of Medicine, Yamaguchi, Japan Breast cancer resistance protein (BCRP), the second member of the ATP-binding cassette membrane transporter family, has a single nucleotide polymorphism, C421A (resulting in Q141K), that is of functional importance. Login to comment
33 SNP analysis of the BCRP gene We used the TaqMan technique, which combines DNA amplification and genotype detection in a single assay.17 The primer set used to amplify the exon 5 SNP (C421A), which results in Q141K, was GGCACTGACGGTGAGA (forward) and CATAGTTGTTGCAAGCCGAAGAG (reverse). Login to comment
65 Our data demonstrated that the frequency of the C/C genotype of C421A (resulting in Q141K) was significantly higher in RCC patients than in controls. Login to comment

[hide] Effect of ABCG2 genotype on the oral bioavailabili... Cancer Biol Ther. 2005 Jun;4(6):650-8. Epub 2005 Jun 11. Sparreboom A, Loos WJ, Burger H, Sissung TM, Verweij J, Figg WD, Nooter K, Gelderblom H
Effect of ABCG2 genotype on the oral bioavailability of topotecan.
Cancer Biol Ther. 2005 Jun;4(6):650-8. Epub 2005 Jun 11., [PMID:15908806]

Abstract [show]
ABCG2 (BCRP/MXR/ABCP) functions as an efflux transporter for many agents, including topotecan, and the protein is expressed at high levels in the human intestine. Some individuals possess a nonsynonymous variant in the ABCG2 gene at nucleotide 421, substituting lysine for glutamine on position 141 at exon 5. The present pilot study indicates that this genotype results in a 30% reduced efflux transport of topotecan in vitro compared to the wild-type. In a preliminary fashion, the heterozygous CA allele observed in two patients was associated with a 1.34-fold increased oral bioavailability of topotecan compared to the bioavailability in ten patients with the wild-type allele (42.0% versus 31.4%; p = 0.037). It is suggested that the high frequency of the A allele in certain ethnic groups may have therapeutic implications for individuals treated with topotecan or other ABCG2 substrates.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 In recent years, various naturally occurring variants in ABCG2 have been identified that affect the function and/or expression of its encoded protein.4-6 In the present pilot study, we prospectively evaluated the potential functional significance of a common single-nucleotide polymorphism (SNP) in ABCG2 (421C>A; Q141K) in a cohort of cancer patients treated with topotecan. Login to comment
41 Human embryonic kidney cells (HEK293) cells transfected with pcDNA3 (HEK293/Neo, control cells), wild-type ABCG2 (HEK293/R) and an ABCG2 Q141K clone (HEK293/5)10 were provided by Dr. Susan E. Bates (National Cancer Institute, Bethesda, MD). Login to comment
75 The studied variant in ABCG2 is a SNP causing a nonsynonymous change in the protein sequence, in which a 421C to A transition at exon 5 leads to a Glutamine to Lysine amino acid substitution at codon 141 (Q141K). Login to comment
80 In vitro transport studies presented here in HEK293 cells transfected with the Q141K variant showed an increase of 30% in the intracellular accumulation of topotecan relative to wild-type ABCG2. Login to comment
84 (A) Intracellular accumulation of topotecan in human embryonic kidney cells (HEK293) transfected with pcDNA3 (HEK293/Neo, Control), wild-type ABCG2 (HEK293/R) and an ABCG2 Q141K clone (HEK293/5, Q141K-5). Login to comment
86 (B) Western blot data for ABCG2 expression in control, wild-type ABCG2 and the ABCG2 Q141K clone. Login to comment
87 A B www.landesbioscience.com Cancer Biology & Therapy e Topotecan Pharmacogenetics In support of this theory, Mizuarai6 described recently that the ATPase activity of the Q141K variant, which is localized in the ATP-binding cassette region, was reduced approximately 1.3-fold compared to the activity of the wild type ABCG2. Login to comment
89 However, our finding is not entirely conclusive as the sole contributing factor, since the increased accumulation in the Q141K variant compared to the wild type was not statistically significant (P = 0.16). Login to comment
90 Support for additional mechanisms that might be of relevance, including altered protein expression, comes from the presently performed analysis of the duodenal mucosa biopsies; these preliminary data show that the ABCG2 421C>A genotype is possibly related with reduced mRNA expression of ABCG2 and ABCB1 in intestinal enterocytes, although this seems to contradict earlier findings.22 Nonetheless, earlier data obtained in PA317 cells transfected with the Q141K mutant have indicated that intracellular topotecan accumulation was higher than that in cells with wild-type ABCG2, and this was also ascribed in that case to markedly reduced protein expression levels.23 These authors have speculated that substitution of Glutamine for Lysine at amino acid position 141 might alter the tertiary structure of ABCG2, and lead to increased susceptibility to degradation.23 Clearly, further investigation is required to resolve this issue. Login to comment

[hide] Tyrosine kinase inhibitor resistance in cancer: ro... Drug Resist Updat. 2005 Feb-Apr;8(1-2):15-26. Ozvegy-Laczka C, Cserepes J, Elkind NB, Sarkadi B
Tyrosine kinase inhibitor resistance in cancer: role of ABC multidrug transporters.
Drug Resist Updat. 2005 Feb-Apr;8(1-2):15-26., [PMID:15939339]

Abstract [show]
Recent antitumor drug research has seen the development of a large variety of tyrosine kinase inhibitors (TKIs) with increasing specificity and selectivity. These are highly promising agents for specific inhibition of malignant cell growth and metastasis. However, their therapeutic potential also depends on access to their intracellular targets, which may be significantly affected by certain ABC membrane transporters. It has been recently shown that several human multidrug transporter ABC proteins interact with specific TKIs, and the ABCG2 transporter has an especially high affinity for some of these kinase inhibitors. These results indicate that multidrug resistance protein modulation by TKIs may be an important factor in the treatment of cancer patients; moreover, the extrusion of TKIs by multidrug transporters may result in tumor cell TKI resistance. Interaction with multidrug resistance ABC transporters may also significantly modify the pharmacokinetics and toxicity of TKIs in patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
215 Of special interest is the ABCG2 variant Q141K (glutamine to lysine replacement). Login to comment

[hide] Involvement of BCRP (ABCG2) in the biliary excreti... Mol Pharmacol. 2005 Sep;68(3):800-7. Epub 2005 Jun 13. Hirano M, Maeda K, Matsushima S, Nozaki Y, Kusuhara H, Sugiyama Y
Involvement of BCRP (ABCG2) in the biliary excretion of pitavastatin.
Mol Pharmacol. 2005 Sep;68(3):800-7. Epub 2005 Jun 13., [PMID:15955871]

Abstract [show]
Pitavastatin, a novel potent 3-hydroxymethylglutaryl coenzyme A reductase inhibitor, is distributed selectively to the liver and excreted into bile in unchanged form in rats. We reported previously that the hepatic uptake is mainly mediated by organic anion transporting polypeptide (OATP) 1B1, whereas the biliary excretion mechanism remains to be clarified. In the present study, we investigated the role of breast cancer resistance protein (BCRP) in the biliary excretion of pitavastatin. The ATP-dependent uptake of pitavastatin by human and mouse BCRP-expressing membrane vesicles was significantly higher compared with that by control vesicles with Km values of 5.73 and 4.77 microM, respectively. The biliary excretion clearance of pitavastatin in Bcrp1-/- mice was decreased to one-tenth of that in control mice. The biliary excretion of pitavastatin was unchanged between control and Eisai hyperbilirubinemic rats, indicating a minor contribution of multidrug resistance-associated protein (Mrp) 2. This observation differs radically from that for a more hydrophilic statin, pravastatin, of which biliary excretion is largely mediated by Mrp2. These data suggest that the biliary clearance of pitavastatin can be largely accounted for by BCRP in mice. In the case of humans, transcellular transport of pitavastatin was determined in the Madin-Darby canine kidney II cells expressing OATP1B1 and human canalicular efflux transporters. A significant basal-to-apical transport of pitavastatin was observed in OATP1B1/MDR1 and OATP1B1/MRP2 double transfectants as well as OATP1B1/BCRP double transfectants, implying the involvement of multiple transporters in the biliary excretion of pitavastatin in humans. This is in contrast to a previous belief that the biliary excretion of statins is mediated mainly by MRP2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
224 The elimination of diflomotecan from plasma has been found to be delayed in patients with frequently observed SNP in BCRP (C421A/Q141K) (Sparreboom et al., 2004). Login to comment

[hide] Breast cancer resistance protein-mediated efflux o... Cancer Res. 2005 Aug 1;65(15):6640-50. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ
Breast cancer resistance protein-mediated efflux of androgen in putative benign and malignant prostate stem cells.
Cancer Res. 2005 Aug 1;65(15):6640-50., 2005-08-01 [PMID:16061644]

Abstract [show]
Malignantly transformed stem cells represent a potential common nidus for the primary cancer and the recurrent cancer that arises after treatment failure. Putative prostate stem cells and prostate tumor stem cells in benign and malignant human prostate tissue, in primary human prostate xenografts, and in the transgenic adenocarcinoma of the mouse prostate (TRAMP) mouse model of prostate cancer, are defined by expression of breast cancer resistance protein (BCRP), a marker of pluripotent hematopoietic, muscle, and neural stem cells, and by an absence of androgen receptor (AR) protein. Inhibition of BCRP-mediated efflux of dihydrotestosterone by novobiocin or fumitremorgin C in a rat prostate progenitor cell line that expresses BCRP and AR mRNAs, but minimal AR protein, results in stabilization and nuclear translocation of AR protein, providing a mechanism for lack of AR protein in BCRP-expressing stem cells. In both benign and malignant human prostate tissue, the rare epithelial cells that express BCRP and lack AR protein are localized in the basal cell compartment, survive androgen deprivation, and maintain proliferative potential in the hypoxic, androgen-deprived prostate. Putative prostate tumor stem cells that express BCRP but not AR protein in TRAMP are the source of a BCRP-negative and AR-negative, Foxa2- and SV40Tag-expressing, transit amplifying compartment that progresses to the poorly differentiated carcinomas that arise rapidly after castration. Therefore, BCRP expression isolates prostate stem/tumor stem cells from the prostate tissue microenvironment through constitutive efflux of androgen, protecting the putative tumor stem cells from androgen deprivation, hypoxia, or adjuvant chemotherapy, and providing the nidus for recurrent prostate cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
371 Clin Cancer Res 2004;10:440-8. 51. Imai Y, Nakane M, Kage K, et al. C421A polymorphism in the human breast cancer resistance protein gene is associated with low expression of Q141K protein and low-level drug resistance. Login to comment
366 Clin Cancer Res 2004;10:440-8. 51. Imai Y, Nakane M, Kage K, et al. C421A polymorphism in the human breast cancer resistance protein gene is associated with low expression of Q141K protein and low-level drug resistance. Login to comment

[hide] Breast cancer resistance protein: molecular target... Cancer Sci. 2005 Aug;96(8):457-65. Sugimoto Y, Tsukahara S, Ishikawa E, Mitsuhashi J
Breast cancer resistance protein: molecular target for anticancer drug resistance and pharmacokinetics/pharmacodynamics.
Cancer Sci. 2005 Aug;96(8):457-65., [PMID:16108826]

Abstract [show]
Breast cancer resistance protein (BCRP) is a half-molecule ATP-binding cassette transporter that forms a functional homodimer and pumps out various anticancer agents, such as 7-ethyl-10-hydroxycamptothecin, topotecan, mitoxantrone and flavopiridol, from cells. Estrogens, such as estrone and 17beta-estradiol, have been found to restore drug sensitivity levels in BCRP-transduced cells by increasing the cellular accumulation of such agents. Furthermore, synthetic estrogens, tamoxifen derivatives and phytoestrogens/flavonoids have now been identified that can effectively circumvent BCRP-mediated drug resistance. Transcellular transport experiments have shown that BCRP transports sulfated estrogens and various sulfated steroidal compounds, but not free estrogens. The kinase inhibitor gefitinib inhibited the transporter function of BCRP and reversed BCRP-mediated drug resistance both in vitro and in vivo. BCRP-transduced human epidermoid carcinoma A431 (A431/BCRP) and BCRP-transduced human non-small cell lung cancer PC-9 (PC-9/BCRP) cells showed gefitinib resistance. Physiological concentrations of estrogens (10-100 pM) reduced BCRP protein expression without affecting its mRNA levels. Two functional polymorphisms of the BCRP gene have been identified. The C376T (Q126Stop) polymorphism has a dramatic phenotype as active BCRP protein cannot be expressed from a C376T allele. The C421A (Q141K) polymorphism is also significant as Q141K-BCRP-transfected cells show markedly low protein expression levels and low-level drug resistance. Hence, individuals with C376T or C421A polymorphisms may express low levels of BCRP or none at all, resulting in hypersensitivity of normal cells to BCRP-substrate anticancer agents. In summary, both modulators of BCRP and functional single nucleotide polymorphisms within the BCRP gene affect the transporter function of the protein and thus can modulate drug sensitivity and substrate pharmacokinetics and pharmacodynamics in affected cells and individuals.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
12 The C421A (Q141K) polymorphism is also significant as Q141K-BCRP-transfected cells show markedly low protein expression levels and low-level drug resistance. Login to comment
165 From these analyses, we identified three BCRP coding SNP, G34A (V12M), C376T (Q126Stop) and C421A (Q141K), and a splicing variant, ∆315-6, that lacked nucleotides 944-949 (deletion of A315 and T316) (Fig. Login to comment
174 In addition, Q141K-BCRP-transfected PA317 cells showed markedly lower levels of both BCRP protein expression and drug resistance than wild-type BCRP-transfected cells (Fig. 4a). Login to comment
175 It was noteworthy in this case that Q141K-BCRP-transfectants and wild-type BCRP-transfectants expressed similar levels of BCRP transcripts (Fig. 4a). Login to comment
178 (42) Low expression levels of the Q141K BCRP protein have been confirmed using various experimental systems. Login to comment
179 (43-45) These results suggest that some individuals harbor a C421A polymorphic BCRP gene and express low amounts of Q141K BCRP (Fig. 4b). Login to comment
208 We have identified two important functioning BCRP SNP, C376T (Q126Stop) and C421A (Q141K), that greatly diminish the expression of this protein. Login to comment
210 Furthermore, cells transfected with Q141K-BCRP cDNA express low amounts of BCRP protein and show only low levels of drug resistance. Login to comment
214 Effect of C376T (Q126Stop) and C421A (Q141K) single nucleotide polymorphisms in the breast cancer resistance protein (BCRP) gene on protein expression. Login to comment
216 PA317 cells transfected with wild-type, G34A, C421A and ∆944-949 BCRP cDNAs were termed PA/WT, PA/V12M, PA/Q141K and PA/∆315-6, respectively. Login to comment

[hide] The ATP-binding cassette transporter ABCG2 (BCRP),... J Histochem Cytochem. 2006 Feb;54(2):215-21. Epub 2005 Aug 22. Meissner K, Heydrich B, Jedlitschky G, Meyer Zu Schwabedissen H, Mosyagin I, Dazert P, Eckel L, Vogelgesang S, Warzok RW, Bohm M, Lehmann C, Wendt M, Cascorbi I, Kroemer HK
The ATP-binding cassette transporter ABCG2 (BCRP), a marker for side population stem cells, is expressed in human heart.
J Histochem Cytochem. 2006 Feb;54(2):215-21. Epub 2005 Aug 22., [PMID:16116030]

Abstract [show]
Efforts to improve severely impaired myocardial function include transplantation of autologous hematopoietic side population (SP) stem cells. The transmembrane ABC-type (ATP binding cassette) half-transporter ABCG2 (BCRP) serves as a marker protein for SP cell selection. We have recently shown that other ABC transport proteins such as ABCB1 and ABCC5 are differentially expressed in normal and diseased human heart. Here we investigated localization and individual ABCG2 expression in 15 ventricular (including 10 cardiomyopathic) and 51 auricular heart tissue samples using immunohistochemistry, confocal laser scanning fluorescence microscopy, and real-time RT-PCR. Individual genotypes were assigned using PCR-restriction fragment length polymorphism (RFLP) analysis and subsequently correlated to ABCG2 mRNA levels. ABCG2 was localized in endothelial cells of capillaries and arterioles of all samples. Ventricular samples from cardiomyopathic hearts exhibited significantly increased levels of ABCG2 mRNA (ABCG2/18S rRNA: 1.08 +/- 0.30 x 10(-7); p=0.028 (dilative cardiomyopathy) and 1.16 +/- 0.46 x 10(-7); p=0.009 (ischemic cardiomyopathy) compared with 0.44 +/- 0.26 x 10(-7) in nonfailing hearts). The individual haplotypes were not associated with altered mRNA expression. ABCG2 is variably expressed in endothelial cells of human heart, where it may function as a protective barrier against cardiotoxic drugs such as anthracyclines or mitoxantrone. ABCG2 expression is induced in dilative and ischemic cardiomyopathies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
126 Among the four identified naturally occurring single nucleotide polymorphisms, 34G.A (V12M) and 421C.A (Q141K) were most common in diverse populations of different ethnic origin in North America (Zamber et al. 2003). Login to comment
127 Among the four identified naturally occurring single nucleotide polymorphisms, 34G.A (V12M) and 421C.A (Q141K) were most common in diverse populations of different ethnic origin in North America (Zamber et al. 2003). Login to comment

[hide] Role of the breast cancer resistance protein (ABCG... AAPS J. 2005 May 11;7(1):E118-33. Mao Q, Unadkat JD
Role of the breast cancer resistance protein (ABCG2) in drug transport.
AAPS J. 2005 May 11;7(1):E118-33., [PMID:16146333]

Abstract [show]
The 72-kDa breast cancer resistance protein (BCRP) is the second member of the subfamily G of the human ATP binding cassette (ABC) transporter superfamily and thus also designated as ABCG2. Unlike P-glycoprotein and MRP1, which are arranged in 2 repeated halves, BCRP is a half-transporter consisting of only 1 nucleotide binding domain followed by 1 membrane-spanning domain. Current experimental evidence suggests that BCRP may function as a homodimer or homotetramer. Overexpression of BCRP is associated with high levels of resistance to a variety of anticancer agents, including anthracyclines, mitoxantrone, and the camptothecins, by enhancing drug efflux. BCRP expression has been detected in a large number of hematological malignancies and solid tumors, indicating that this transporter may play an important role in clinical drug resistance of cancers. In addition to its role to confer resistance against chemotherapeutic agents, BCRP actively transports structurally diverse organic molecules, conjugated or unconjugated, such as estrone-3-sulfate, 17beta-estradiol 17-(beta-D-glucuronide), and methotrexate. BCRP is highly expressed in the placental syncytiotrophoblasts, in the apical membrane of the epithelium in the small intestine, in the liver canalicular membrane, and at the luminal surface of the endothelial cells of human brain microvessels. This strategic and substantial tissue localization indicates that BCRP also plays an important role in absorption, distribution, and elimination of drugs that are BCRP substrates. This review summarizes current knowledge of BCRP and its relevance to multidrug resistance and drug disposition.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
160 A variety of naturally occurring variants of BCRP have been identified in DNA samples of ethnically diverse origins.95-98 Notably, the alterations of BCRP protein at position 12 (V12M) and 141 (Q141K) occur frequently in Asia populations (~30%-60%) and relatively low frequencies in Caucasians and African-Americans (~5%-10%). Login to comment
161 For example, in a Japanese population studied, 39% to 50% are heterozygous and 7% are homozygous for the variant Q141K.95,96 In a Chinese population, 60% are heterozygous for Q141K.95 Several other variants such as I206L, N590Y, and D620N are much less frequent with allele frequencies of ~1%.95,97 For instance, N590Y is present in ~1.5% of Caucasians.95 I206L is found only in Hispanic populations so far.95 D620N is detected in 1.1% of all DNA samples examined with unknown genetic origin.97 In addition, a polymorphism in exon 4 that results in a substitution of stop codon for Gln at position 126 has also been identified.96 Amino acid changes at position 482 that were found in some drug-selected resistant cell lines have so far not been identified in normal populations or in DNA samples from cancer patients.49 In vitro functional characterization of the variants V12M and Q141K produced contradicting results. Login to comment
162 One study reported that Q141K was expressed at lower levels in transfected cells and therefore conferred lower drug resistance compared with the wild-type protein.96 The variant V12M displayed expression levels and drug-resistance properties similar to the wild-type protein.96 Another study reported that V12M and Q141K were expressed at levels comparable to the wild-type protein; however, both V12M and Q141K conferred significantly lower levels of drug resistance relative to the wild-type protein as compared with increased drug accumulation and decreased drug efflux.98 Further analysis of the mechanism of the transport dysfunction revealed that the apical membrane localization of V12M was disrupted and that ATPase activity of Q141K was decreased.98 A recent clinical study by Sparreboom et al73 has shown that the Q141K polymorphism is associated with significant changes of pharmacokinetic properties of diflomotecan, a substrate of BCRP. Login to comment

[hide] The ABC transporter Abcg2/Bcrp: role in hypoxia me... Biometals. 2005 Aug;18(4):349-58. Krishnamurthy P, Schuetz JD
The ABC transporter Abcg2/Bcrp: role in hypoxia mediated survival.
Biometals. 2005 Aug;18(4):349-58., [PMID:16158227]

Abstract [show]
ABC (ATP-binding cassette) transporters have diverse roles in many cellular processes. These diverse roles require the presence of conserved membrane spanning domains and nucleotide binding domains. Bcrp (Abcg2) is a member of the ATP binding cassette family of plasma membrane transporters that was originally discovered for its ability to confer drug resistance in tumor cells. Subsequent studies showed Bcrp expression in normal tissues and high expression in primitive stem cells. Bcrp expression is induced under low oxygen conditions consistent with its high expression in tissues exposed to low oxygen environments. Moreover, Bcrp interacts with heme and other porphyrins. This finding and its regulation by hypoxia suggests it may play a role in protecting cells/tissue from protoporphyrin accumulation under hypoxia. These observations are strengthened by the fact that porphyrins accumulate in tissues of the Bcrp knockout mouse. It is possible that humans with loss of function Bcrp alleles may be more susceptible to porphyrin-induced phototoxicity. We propose that Bcrp plays a role in porphyrin homoeostasis and regulates survival under low oxygen conditions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 The SNPs in Bcrp that produce non-synonymous changes (i.e., amino acid substitutions) are at amino acids 12 (V12M), 141 (Q141K), 206 (I206L), and 590 (N590Y). Login to comment
128 The most frequent polymorphisms being the exon 2 SNP (G34A/ V12M) and the exon 5 SNP (C421A/Q141K), which produce changes in amino acids 12 and 141 (Imai et al. 2002; Mizuarai et al. 2004). Login to comment

[hide] Pharmacogenomics of the human ABC transporter ABCG... Naturwissenschaften. 2005 Oct;92(10):451-63. Ishikawa T, Tamura A, Saito H, Wakabayashi K, Nakagawa H
Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design.
Naturwissenschaften. 2005 Oct;92(10):451-63., [PMID:16160819]

Abstract [show]
In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Non-synonymous SNPs are located at nucleotides 238 (exon 2) and 625, resulting in amino acid substitutions: V12M and Q141K. Login to comment
94 The Q141K polymorphism located in exon 5 (c.421C>A) leads to the replacement of the negatively charged glutamic acid residue with a positively charged lysine residue. Login to comment
96 The Q141K variant was also detected in all ethnic groups tested: the allele frequency ranged between 0% and 35%, (the Africans in north of Sahara, the Africans sub-Saharan, the African American subjects with low, and the Japanese and Chinese populations with high allele frequencies) (Imai et al. 2002; Zamber et al. 2003; de Jong et al. 2004; Kobayashi et al. 2005). Login to comment
97 Imai et al. (2002) have demonstrated that the ABCG2 Q141K variant-transfected PA317 cells showed a low-level of drug resistance associated with decreased protein expression. Login to comment
99 The SNP (Q141K) was postulated to cause increased sensitivity of normal cells to anticancer agents that are ABCG2 substrates such as topotecan, diflomotecan, and SN-38. Login to comment
100 An investigation of the expression level of ABCG2 in 99 Japanese placenta samples revealed that individuals homozygous for the Q141K variant showed significantly lower expression levels of this transporter protein, while the heterozygous samples displayed an intermediate expression level (Kobayashi et al. 2005). Login to comment
102 Based on these observations, it is assumed that the protein stability of the Q141K variant is significantly reduced without significant changes in its mRNA levels. Login to comment
109 Imai et al. (2002) reported that the Q141K variant of ABCG2, stably expressed in PA317 cells, had a markedly lower expression level than the wild-type ABCG2 or the V12M variant. Login to comment
110 In their study, the Q141K variant-transfected PA317 cells exhibited a low-level drug resistance compared with the wild-type ABCG2-transfected cells. Login to comment
111 On the other hand, Mizuarai et al. (2004) expressed ABCG2 in polarized LLC-PK1 cells, and by using confocal microscopy demonstrated that the wild-type and the Q141K variant of ABCG2 mainly showed apical staining, while the V12M variant showed intracellular localization. Login to comment
112 However, Kondo et al. (2004) demonstrated that both V12M and Q141K variants were localized at the apical membrane in LLC-PK1 cells. Login to comment
113 These contradictory expression and localization data for ABCG2 variants indicate that differences in transfection conditions (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably Table 2 Frequencies of ABCG2 alleles in different ethnic groups Position Ethnic group Variant allele Allele Reference Amino acid cDNA N Hetero Homo Frequency (%) V12M c.34G>A Japanese 29 9 1 19.0 Imai et al. (2002) Japanese 10 - - 15.0 Zamber et al. (2003) Japanese 220 61 8 17.5 Kobayashi et al. (2005) Chinese 10 - - 20.0 Zamber et al. (2003) Southeast Asians 10 - - 45.0 Zamber et al. (2003) Pacific Islanders 7 - - 64.0 Zamber et al. (2003) Swedish 60 2 0 1.7 B¨ackstr¨om et al. (2003) Dutch 100 11 1 6.5 Bosch et al. (2005) Caucasian 86 - - 2.0 Zamber et al. (2003) Caucasian 150 27 2 10.3 Mizuarai et al. (2004) Caucasian 150 11 0 3.7 Kobayashi et al. (2005) Ashkenazi Jewish 10 - - 10.0 Zamber et al. (2003) Middle Eastern 20 - - 5.0 Zamber et al. (2003) Africans North of Sahara 7 - - 14.0 Zamber et al. (2003) African American 150 17 1 6.3 Kobayashi et al. (2005) Mexicans 10 - - 10.0 Zamber et al. (2003) Hispanic Livers 5 - - 40.0 Zamber et al. (2003) Mexican Indians 5 - - 90.0 Zamber et al. (2003) Q126Stop c.376C>T Japanese 124 3 0 1.2 Imai et al. (2002) Japanese 60 2 0 1.7 Itoda et al. (2003) Japanese 220 4 0 0.9 Kobayashi et al. (2005) Caucasian 150 0 0 0.0 Mizuarai et al. (2004) Caucasian 150 0 0 0.0 Kobayashi et al. (2005) African American 150 0 0 0.0 Kobayashi et al. (2005) Q141K c.421C>A Japanese 124 48 9 26.6 Imai et al. (2002) Japanese 10 - - 35.0 Zamber et al. (2003) Japanese 220 90 27 32.7 Kobayashi et al. (2005) Chinese 95 43 11 34.2 de Jong et al. (2004) Chinese 10 - - 35.0 Zamber et al. (2003) Southeast Asians 10 - - 15.0 Zamber et al. (2003) Pacific Islanders 7 - - 14.0 Zamber et al. (2003) Swedish 60 10 1 10.0 B¨ackstr¨om et al. (2003) Dutch 100 20 2 12.0 Bosch et al. (2005) Caucasian 85 - - 14.0 Zamber et al. (2003) Caucasian 172 33 3 11.3 de Jong et al. (2004) Caucasian 150 22 2 8.7 Mizuarai et al. (2004) Caucasian 150 25 4 11.0 Kobayashi et al. (2005) Ashkenazi Jewish 10 - - 5.0 Zamber et al. (2003) Middle Eastern 20 - - 13.0 Zamber et al. (2003) Africans North of Sahara 7 - - 0.0 Zamber et al. (2003) African, Sub-Saharan 938 14 1 0.9 de Jong et al. (2004) African American 24 - - 0.0 Zamber et al. (2003) African American 150 5 1 2.3 Kobayashi et al. (2005) African American 94 8 1 5.3 de Jong et al. (2004) Mexicans 10 - - 5.0 Zamber et al. (2003) Hispanic Livers 5 - - 10.0 Zamber et al. (2003) Mexican Indians 5 - - 10.0 Zamber et al. (2003) R160Q c.479G>A Dutch 100 1 0 0.5 Bosch et al. (2005) I206L c.616A>C Japanese 10 - - 0.0 Zamber et al. (2003) Chinese 10 - - 0.0 Zamber et al. (2003) Southeast Asians 10 - - 0.0 Zamber et al. (2003) Pacific Islanders 7 - - 0.0 Zamber et al. (2003) Caucasian 65 - - 0.0 Zamber et al. (2003) Table 2 Continued Position Ethnic group Variant allele Allele Reference Amino acid cDNA N Hetero Homo Frequency (%) Ashkenazi Jewish 10 - - 0.0 Zamber et al. (2003) Middle Eastern 20 - - 0.0 Zamber et al. (2003) Africans North of Sahara 7 - - 0.0 Zamber et al. (2003) African American 15 - - 0.0 Zamber et al. (2003) Mexicans 10 - - 0.0 Zamber et al. (2003) Hispanic Livers 5 - - 10.0 Zamber et al. (2003) Mexican Indians 5 - - 0.0 Zamber et al. (2003) F431L c.1291T>C Japanese 60 1 0 0.8 Itoda et al. (2003) S441N c.1322G>A Japanese 100 1 0 0.5 Kobayashi et al. (2005) F489L c.1465T>C Japanese 60 1 0 0.8 Itoda et al. (2003) Japanese 100 1 0 0.5 Kobayashi et al. (2005) R575Stop c.1723C>T Dutch 100 1 0 0.5 Bosch et al. (2005) N590Y c.1768A>T Caucasian 65 - - 1.0 Zamber et al. (2003) Caucasian 150 1 0 0.3 Mizuarai et al. (2004) African Americans 15 - - 0.0 Zamber et al. (2003) D620N c.1858G>A Dutch 100 1 0 0.5 Bosch et al. (2005) affect the cellular processing and sorting of these proteins. Login to comment
114 Detailed studies are needed to clarify the mechanism of a reduced protein expression for Q141K and the altered cellular localization of V12M and Q141K variants. Login to comment
118 For this purpose, we have created variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) by site-directed mutagenesis. Login to comment
131 Interestingly, the MTX transport activity of the Q141K variant was even higher than the wild type. Login to comment
211 However, one of the two homozygous individuals showed increased accumulation of SN-38 and SN-38 glucuronide, indicating that the Q141K homodimer may have an im- Fig. 5 Molecular structures of newly synthesized CPT analogues and their anticancer activity in ABCG2-transfected HEK293 (HEK293/ABCG2) cells. Login to comment

[hide] Membrane transporters and channels in chemoresista... Cancer Lett. 2006 Aug 8;239(2):168-82. Epub 2005 Oct 5. Huang Y, Sadee W
Membrane transporters and channels in chemoresistance and -sensitivity of tumor cells.
Cancer Lett. 2006 Aug 8;239(2):168-82. Epub 2005 Oct 5., 2006-08-08 [PMID:16169662]

Abstract [show]
Membrane transporters play important roles in mediating chemosensitivity and -resistance of tumor cells. ABC transporters, such as ABCB1/MDR1, ABCC1/MRP1 and ABCG2/BCRP, are frequently associated with decreased cellular accumulation of anticancer drugs and multidrug resistance of tumors. SLC transporters, such as folate, nucleoside, and amino acid transporters, commonly increase chemosensitivity by mediating the cellular uptake of hydrophilic drugs. Ion channels and pumps variably affect sensitivity to anticancer therapy by modulating viability of tumor cells. A pharmacogenomic approach, using correlations between drug potency and transporter gene expression in multiple cancer cell lines, has shown promise for identifying potential drug-transporter relationships and predicting anticancer drug response, in an effort to optimize chemotherapy for individual patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 Two additional SNPs, i.e. V12M and Q141K, also affect substrate specificity and transport capacity of ABCG2 [26]. Login to comment

[hide] Genetic polymorphisms of ATP-binding cassette tran... Expert Opin Pharmacother. 2005 Nov;6(14):2455-73. Sakurai A, Tamura A, Onishi Y, Ishikawa T
Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications.
Expert Opin Pharmacother. 2005 Nov;6(14):2455-73., [PMID:16259577]

Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters, as well as drug metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and their overall pharmacological effects. There is an increasing number of reports addressing genetic polymorphisms of drug transporters. However, information regarding the functional impact of genetic polymorphisms in drug transporter genes is still limited. Detailed functional analysis in vitro may provide clear insight into the biochemical and therapeutic significance of genetic polymorphisms. This review addresses functional aspects of the genetic polymorphisms of human ATP-binding cassette transporters, ABCB1 and ABCG2, which are critically involved in the pharmacokinetics of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
210 In different ethnic groups, seven naturally-occurring non-synonymous SNPs have been reported: V12M, Q126Stop, Q141K, I206L, F431L, S441N, F489L, N590Y and D620N. Login to comment
211 Among the above variations, two alterations (c.34G > A [V12M], c.421C > A [Q141K]) affecting the protein structure have been reported to be polymorphic in several populations. Login to comment
215 Non-synonymous SNPs are located at nucleotides 238 (exon 2) and 625 (exon 5), resulting in the amino acid substitutions V12M and Q141K. Login to comment
221 The Q141K polymorphism located in exon 5 (c.421C > A) leads to the replacement of the negatively charged glutamic acid residue with a positively charged lysine residue. Login to comment
223 The Q141K variant was also detected in all ethnic groups tested: the allele frequency was 1 - 35% (the African and African-American subjects had low allele frequencies, whereas those of the Table 4. Login to comment
225 Location Position Allele Amino acid Allele frequency in Caucasian populations Allele frequency in Japanese populatins Allele frequency in African populations n % n % n % Exon 2 34 G A 12 Val 12 Met 546 94.4 5.6 259 82.4 17.6 181 93.7 6.3 Exon 4 376 C T 126 Gln 126 stop 300 100 0 404 98.9 1.1 150 100 0 Exon 5 421 C A 141 Gln 141 Lys 717 89.0 11.0 354 69.4 30.6 1213 98.6 1.4 Exon 5 479 G A 160 Arg 160 Gln 100 99.5 0.5 ND ND ND ND ND ND Exon 11 1291 T C 431 Phe 431 Leu ND ND ND 60 99.2 0.8 ND ND ND Exon 11 1322 G A 441 Ser 441 Asn ND ND ND 100 99.5 0.5 ND ND ND Exon 12 1465 T C 489 Phe 489 Leu ND ND ND 160 99.4 0.6 ND ND ND Exon 14 1723 C T 575 Arg 575 stop 100 99.5 0.5 ND ND ND ND ND ND Exon 15 1768 A T 590 Asn 590 Tyr 215 99.5 0.5 ND ND ND 15 100 0 Exon 16 1858 T A 620 Asp 620 Asp 100 99.5 0.5 ND ND ND ND ND ND Data are from [129-135,137]. Login to comment
229 Imai et al. [129] have demonstrated that the ABCG2 Q141K variant-transfected PA317 cells showed a low-level of drug resistance associated with decreased protein expression. Login to comment
231 The SNP (Q141K) was postulated to cause increased sensitivity of normal cells to anticancer agents that are ABCG2 substrates, such as topotecan, diflomotecan and SN-38. Login to comment
232 An investigation of the expression level of ABCG2 in 99 Japanese placenta samples revealed that individuals homozygous for the Q141K variant showed significantly lower expression levels of this transporter protein, and the heterozygous samples displayed an intermediate expression level [134]. Login to comment
235 It is assumed that the protein stability of the Q141K variant is reduced without significant changes in its mRNA levels. Login to comment
237 It has been postulated that the 376C > T SNP may have higher impact than the 421C > A polymorphism causing Q141K because active ABCG2 protein will not be synthesised from the variant allele. Login to comment
242 Imai et al. [129] reported that the Q141K variant of ABCG2 stably expressed in PA317 cells had a markedly lower expression level than the wild-type ABCG2 or the V12M variant. Login to comment
243 In their study, the Q141K variant-transfected PA317 cells exhibited a low-level drug resistance compared with that of wild-type ABCG2-transfected cells. Login to comment
244 On the other hand, Mizuarai et al. [135] expressed ABCG2 in polarised LLC-PK1 cells, and by using confocal microscopy demonstrated that the wild-type and the Q141K variant of ABCG2 showed mainly apical staining, and the V12M variant showed intracellular localisation. Login to comment
245 However, Kondo et al. [138] demonstrated that both V12M and Q141K variants were localised at the apical membrane in LLC-PK1 cells. Login to comment
250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins. Login to comment
251 Detailed studies are needed to clarify the mechanism of a reduced protein expression for Q141K and the altered cellular localisation of V12M and Q141K variants. Login to comment
255 For this purpose, variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G and R482T) were created by site-directed mutagenesis (Figure 3). Login to comment
268 Interestingly, the MTX transport activity of the Q141K variant was even higher than the wild type. Login to comment
768 IMAI Y, NAKANE M, KAGE K et al.: C421A polymorphism in the human breast cancer resistance protein gene is associated with low expression of Q141K protein and low-level drug resistance. Mol. Cancer Ther. (2002) 1(8):611-616. Login to comment
651 IMAI Y, NAKANE M, KAGE K et al.: C421A polymorphism in the human breast cancer resistance protein gene is associated with low expression of Q141K protein and low-level drug resistance. Mol. Cancer Ther. (2002) 1(8):611-616. 130. Login to comment

[hide] Pharmacogenetics of irinotecan metabolism and tran... Toxicol In Vitro. 2006 Mar;20(2):163-75. Epub 2005 Nov 3. Smith NF, Figg WD, Sparreboom A
Pharmacogenetics of irinotecan metabolism and transport: an update.
Toxicol In Vitro. 2006 Mar;20(2):163-75. Epub 2005 Nov 3., [PMID:16271446]

Abstract [show]
The anticancer agent irinotecan (CPT-11) is converted to SN-38, which is approximately 100 to 1,000-fold more cytotoxic than the parent drug. The pharmacokinetics of irinotecan are extremely complex and have been the subject of intensive investigation in recent years. Irinotecan is subject to extensive metabolism by various polymorphic enzymes, including CES2 to form SN-38, members of the UGT1A subfamily, and CYP3A4 and CYP3A5, which form several pharmacologically inactive oxidation products. Elimination of irinotecan is also dependent on drug-transporting proteins, notably ABCB1 (P-glycoprotein), ABCC2 (cMOAT) and ABCG2 (BCRP), present on the bile canalicular membrane. The various processes mediating drug elimination, either through metabolic breakdown or excretion, likely impact substantially on interindividual variability in drug handling. This report provides an update on current strategies to individualize irinotecan chemotherapy based on each patient's genetic constitution, which may ultimately lead to more selective use of this agent.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
998 Of these, the most extensively studied is the 421C > A transversion, which results in an amino acid change of glutamine to lysine at codon 141 (Q141K). Login to comment

[hide] Functional SNPs of the breast cancer resistance pr... Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21. Yanase K, Tsukahara S, Mitsuhashi J, Sugimoto Y
Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development.
Cancer Lett. 2006 Mar 8;234(1):73-80. Epub 2005 Nov 21., 2006-03-08 [PMID:16303243]

Abstract [show]
Breast cancer resistance protein (BCRP) is a half-molecule ATP-binding cassette transporter that pumps out various anticancer agents such as 7-ethyl-10-hydroxycamptothecin, topotecan and mitoxantrone. We have previously identified three polymorphisms within the BCRP gene, G34A (substituting Met for Val-12), C376T (substituting a stop codon for Gln-126) and C421A (substituting Lys for Gln-141). C421A BCRP-transfected murine fibroblast PA317 cells showed markedly decreased protein expression and low-level drug resistance when compared with wild-type BCRP-transfected cells. In contrast, G34A BCRP-transfected PA317 cells showed a similar protein expression and drug resistance profile to wild-type. The C376T polymorphism would be expected to have a considerable impact as active BCRP protein will not be expressed from a T376 allele. Hence, people with C376T and/or C421A polymorphisms may express low levels of BCRP, resulting in hypersensitivity of normal cells to BCRP-substrate anticancer agents. Estrogens, estrone and 17beta-estradiol, were previously found to restore drug sensitivity levels in BCRP-transduced cells by increasing the cellular accumulation of anticancer agents. BCRP transports sulfated estrogens but not free estrogens and in a series of screening experiments for synthesized and natural estrogenic compounds, several tamoxifen derivatives and phytoestrogens/flavonoids were identified that effectively circumvent BCRP-mediated drug resistance. The kinase inhibitors gefitinib and imatinib mesylate also interact with BCRP. Gefitinib, an inhibitor of epidermal growth factor receptor-tyrosine kinase, inhibits its transporter function and reverses BCRP-mediated drug resistance both in vitro and in vivo. BCRP-transfected human epidermoid carcinoma A431 cells and BCRP-transfected human non-small cell lung cancer PC-9 cells show gefitinib resistance. Imatinib, an inhibitor of BCR-ABL tyrosine kinase, also inhibits BCRP-mediated drug transport. Hence, both functional SNPs and inhibitors of BCRP reduce its transporter function and thus modulate substrate pharmacokinetics and pharmacodynamics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 We have previously identified three polymorphisms within the BCRP gene, G34A (substituting Met for Val-12), C376T (substituting a stop codon for Gln-126) and C421A (substituting Lys for Gln-141). Login to comment
42 C421A (Q141K) BCRP SNP We have previously identified three variant BCRP cDNAs, containing the substitutions G34A (V12M), C421A (Q141K) and a 944-949 deletion lacking Ala-315 and Thr-316 (D315-6) [23]. Login to comment
44 We have subsequently found that C421A BCRP-transfected murine fibroblast PA317 (PA/Q141K) cells show markedly decreased exogenous protein expression and also a low-level of drug resistance when normalized to wild-type BCRP-transfected (PA/WT) cells (Fig. 1 and Table 1). Login to comment
46 We had already shown in our previous study that the intracellular topotecan accumulation in PA/Q141K cells was higher than in other BCRP transfectants [23]. Login to comment
47 Kondo et al. have also reported low Q141K-BCRP protein expression levels using adenovirus-mediated gene transfection [24]. Login to comment
56 This may be associated with a greater susceptibility ofthe resultingBCRP protein (Q141K) to degradation [23]. Login to comment
58 We previously examined the frequency of the C421A SNP in a normal Japanese population and found that 57/124 samples carried the A421 allele and that nine of these were homozygous for this polymorphism [23], indicating that some individuals possess the C421A polymorphic BCRP gene and express low amounts of the Q141K BCRP. Login to comment
74 However, in our Table 1 Drug sensitivities of BCRP-transfected PA317 cells Cells IC50 (ng/ml) SN-38 Topotecan MXR PA317 2.5 0.060 17 PA/WT 98 0.58 O200 PA/V12M 98 0.63 O200 PA/Q141K 30 0.25 100 PA/D315-6 55 0.42 190 Cells were cultured for 5 days in the absence or presence of increasing concentrations of the indicated anticancer agents. Login to comment
92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment
187 [23] Y. Imai, M. Nakane, K. Kage, S. Tsukahara, E. Ishikawa, T. Tsuruo, et al., C421A polymorphism in the human breast cancer resistance protein gene is associated with low expression of Q141K protein and low-level drug resistance, Mol. Cancer Ther. 1 (2002) 611-616. Login to comment

[hide] Molecular modeling of new camptothecin analogues t... Cancer Lett. 2006 Mar 8;234(1):81-9. Epub 2005 Nov 23. Nakagawa H, Saito H, Ikegami Y, Aida-Hyugaji S, Sawada S, Ishikawa T
Molecular modeling of new camptothecin analogues to circumvent ABCG2-mediated drug resistance in cancer.
Cancer Lett. 2006 Mar 8;234(1):81-9. Epub 2005 Nov 23., 2006-03-08 [PMID:16309825]

Abstract [show]
Irinotecan (CPT-11) is a widely used potent antitumor drug that inhibits mammalian DNA topoisomerase I (Topo I). However, overexpression of ABCG2 (BCRP/MXR/ABCP) reportedly confers cancer cells resistance to SN-38, the active form of CPT-11. To circumvent the ABCG2-associated drug resistance, the structure-activity-relationship (SAR) of 14 new camptothecin (CPT) analogues has been studied with respect to the substrate specificity of ABCG2. While the lactone E ring is a prerequisite for anticancer activity, modifications of the A or B rings do not significantly affect Topo I inhibition. Based on the substrate specificity of ABCG2, it is strongly suggested that CPT analogues with a hydroxyl group at position 10 or 11 of the A ring are recognized by ABCG2 and are thereby effectively extruded from cancer cells. To develop a platform for the molecular modeling to circumvent anticancer drug resistance, we have carried out quantum chemical calculations and neural network SAR analysis. Electrostatic potential iso-surfaces generated by ab initio MO calculations using restricted Hartree-Fock method have revealed that negative potential localized at positions 10 or 11 in the A ring is important for recognition by ABCG2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 However, one of the two homozygous individuals showed increased accumulation of SN-38 and SN-38 glucuronide, indicating that the Q141K homodimer may have an impaired function. Login to comment

[hide] The role of the human ABCG2 multidrug transporter ... Cancer Lett. 2006 Mar 8;234(1):62-72. Epub 2005 Dec 7. Cervenak J, Andrikovics H, Ozvegy-Laczka C, Tordai A, Nemet K, Varadi A, Sarkadi B
The role of the human ABCG2 multidrug transporter and its variants in cancer therapy and toxicology.
Cancer Lett. 2006 Mar 8;234(1):62-72. Epub 2005 Dec 7., 2006-03-08 [PMID:16337740]

Abstract [show]
The human multidrug resistance ABC transporters provide a protective function in our body against a large number of toxic compounds. These proteins, residing in the plasma membrane, perform an active, ATP-dependent extrusion of such xenobiotics. However, the same proteins are also used by the tumor cells to fight various anticancer agents. ABCG2 is an important member of the multidrug resistance proteins, an 'ABC half transporter', which functions as a homodimer in the cell membrane. In this review, we provide a basic overview of ABCG2 function in physiology and drug metabolism, but concentrate on the discussion of mutations and polymorphisms discovered in this protein. Interestingly, a single nucleotide mutation, changing amino acid 482 from arginine to threonine or glycine in ABCG2, results in a major increase in the catalytic activity and a wider drug recognition by this protein. Still, this mutation proved to be an in vitro artifact, produced only in heavily drug-selected cell lines. In contrast, at least two, but possibly more polymorphic variants of ABCG2 were found to be present in large human populations with different ethnic background. However, currently available experimental data regarding the cellular expression, localization and function of these ABCG2 variants are strongly contradictory. Since, the proteins produced by these variant alleles may differently modulate cancer treatment, general drug absorption and toxicity, may represent risk factors in fetal toxicity, or alter the differentiation of stem cells, their exact characterization is a major challenge in this field.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 To date, altogether eight non-synonymous (V12M, Q141K, I206L, F431L, S441N, F489L, N590Y, D620N), five synonymous (silent) (c.114TOC, c.369COT, c.474COT, c.1098GOA, c.1425AOG) missense mutations, one nonsense (Q126X), and one frameshift (c.1515delC) mutations were identified in the coding region of ABCG2 in healthy individuals or in patients [43-46,49,63-65]. Login to comment
110 Among the above variations, affecting the protein structure, two alterations [c.34GOA (V12M), c.421CO A (Q141K)] have been reported to be polymorphic in several populations. Login to comment
119 The Q141K polymorphism located in exon 5 (c.421COA) leads to the replacement of the negatively charged glutamic acid residue with a positively charged lysine residue. Login to comment
121 The Q141K variant was also detected in all ethnic groups tested: the allele frequency ranged between 1 and 35%, (the African and African-American subjects with low, while the Japanese and Chinese populations with high allele frequencies) [46,63]. Login to comment
123 On the basis of definitive molecular haplotype analyses (PCR-RFLP) for the three major variants [c.34GOA (V12M), c.376COT (Q126X), c.421COA (Q141K)] in a Japanese population, four haplotypes were identified G-C-C (V-Q-Q), G-C-A (V-Q-K), A-CC (M-Q-Q), and G-T-C (V-X-Q). Login to comment
127 The above results collectively suggest that the V12M, Q126X, and Q141K variants are likely to occur on separate chromosomes. Login to comment
130 Mainly the two major non-synonymous polymorphisms, V12M and Q141K, were investigated. Login to comment
132 Imai et al. [64] and Morisaki et al. [66] in stable mammalian expression systems found that in PA317 or HEK-293 cells the expressed Q141K ABCG2 protein had a lower expression level than the wild-type ABCG2, or the V12M variant. Login to comment
133 Morisaki et al. demonstrated that both the V12M and Q141K ABCG2 could reach the plasma membrane in the HEK-293 cells, while a significant portion of Table 1 Summary of population genetics data on naturally occurring sequence variations, affecting the coding region of the human ABCG2 gene Position in the ABCG2 genea Position in the ABCG2 cDNAb Amino acid substitution Population n C/K C/C AF (%G 95%CI) Ref. Login to comment
134 g.34GOA (exon 2) c.34GOA V12M Caucasian 150 27 2 10.3G3.5 [47] Caucasian 150 11 0 3.7G2.2 [46] Caucasian 86 n.a n.a 2.0Gn.a [49] Swedish 60 2 0 1.7G2.3 [43] Total Caucasian 360 40 2 6.1G1.8 Japanese 220 61 8 17.5G3.6 [46] Japanese 29 9 1 19.0G10.3 [64] Total Japanese 249 70 9 17.7G3.4 African-American 150 17 1 6.3G2.8 [46] g.8191COT (exon 4) c.376COT Q126X Caucasian 150 0 0 0.0 [46] Caucasian 150 0 0 0.0 [47] Total Caucasian 300 0 0 0.0 Japanese 220 4 0 0.9G0.9 [46] Japanese 124 3 0 1.2G1.4 [64] Japanese 60 2 0 1.7G2.3 [45] Total Japanese 404 9 0 1.1G0.7 African-American 150 0 0 0.0 [46] g.8825CO A (exon 5) c.421COA Q141K Caucasian 172 33 3 11.3G3.4 [63] Caucasian 150 25 4 11.0G3.6 [46] Caucasian 150 22 2 8.7G3.2 [47] Caucasian 85 n.a n.a 14.0Gn.a [49] Swedish 60 10 1 10.0G5.5 [43] Total Caucasian 532 90 10 10.3G1.9 Japanese 220 90 27 32.7G4.5 [46] Japanese 124 48 9 26.6G5.6 [64] Chinese 95 43 11 34.2G6.9 [63] Total Asian 439 181 47 31.3G3.1 African, Sub-Saharan 938 14 1 0.9G0.4 [63] African-American 150 5 1 2.3G1.7 [46] African-American 94 8 1 5.3G3.3 [63] Total Africanc 1182 27 3 1.4G0.5 g.40645AO T (exon 12) c.1465TOC F489L Japanese 100 1 0 0.5G1.0 [46] Japanese 60 1 0 0.8G1.7 [45] Total Japanese 160 2 0 0.6G0.9 g.45367AO T (exon 15) c.1768AOT N590Y Caucasian 150 1 0 0.3G0.7 [47] Caucasian 65 1 0 0.8G1.5 [49] Total Caucasian 215 2 0 0.5G0.7 Only those cDNA SNPs were listed that were detected in at least two independent studies. Login to comment
142 J. Cervenak et al. / Cancer Letters 234 (2006) 62-72 67 Q141K (though having a lower expression level), remained intracellular [66]. Login to comment
143 According to other studies, a 30-40% reduction in cell surface expression of the Q141K variant, although having a similar mRNA level than the wild-type ABCG2, was observed [55,64]. Login to comment
144 Recent investigation of the expression level of ABCG2 in 99 Japanese placenta samples revealed that individuals homozygous for the Q141K variant showed significantly lower expression levels of this transporter protein, while the heterozygous samples displayed an intermediate expression level [46]. Login to comment
146 Mizuarai et al. expressed ABCG2 in polarized LLC-PKI cells, and by using confocal microscopy demonstrated that the wtABCG2 and Q141K showed mainly apical staining, while the V12M variant showed intracellular localization [47]. Login to comment
147 In a recent study, similarly LLC-PKI cells where used to express the V12M and Q141K variants and additionally five other polymorphisms (A149P, R163K, Q166E, P269S and S441N [55]). Login to comment
148 Interestingly, they found that all polymorphisms, including V12M and Q141K, had an apical localization, and only the S441N variant showed intracellular staining. Login to comment
151 Clearly, more detailed studies are required to clarify the mechanism of a reduced protein expression for Q141K, and the altered cellular localization found for the V12M and Q141K variants under certain conditions. Login to comment
153 When the functions of the ABCG2 variants were examined in cytotoxicity assays, a 10-fold decrease in drug resistance, as compared to the wild-type ABCG2, was reported by Mizuarai et al., when the V12M or Q141K-transfected LLC-PKI cells were challenged by mitoxantrone, topotecan, or an indolocarbazole topoisomerase I inhibitor [47]. Login to comment
154 In contrast, Morisaki et al. found that only the Q141K variant had a moderately lower level resistance against mitoxantrone, topotecan or SN-38, as compared to the wild-type ABCG2-transfected cells [66]. Login to comment
161 Q141K is mapped in the functionally important ATP-binding cassette region of ABCG2 (Fig. 1) between the Walker A and the signature motifs, therefore, it is possible that the ATPase activity of this variant is altered. Login to comment
162 Two studies compared the vanadate-sensitive ATPase activity of ABCG2 V12M and Q141K variants, using Sf9 (Spodoptera frugiperda) cell membranes [47,66]. Login to comment
163 A reduced, 1.3 and 1.8-fold lower basal ATPase activity was observed by Mizuarai et al. and Morisaki et al., respectively, for the Q141K than for wild-type ABCG2. Login to comment
182 A recent investigation performed an exploratory, retrospective evaluation of the functional consequence of the ABCG2 421COA (Q141K) variant in 20 adult white patients, treated with diflomotecan [72]. Login to comment
185 This observation is in harmony with studies indicating a reduced protein expression and function for the Q141K variant, while seems to contradict the results of de Jong et al. As mentioned above, the allele frequency of ABCG2 421COA (Q141K) varies in diverse populations (Table 1), and in Japan and China this polymorphism appears to be common, with an overall allele frequency of 31.3G3.1%. Login to comment

[hide] Role of pharmacogenetics in irinotecan therapy. Cancer Lett. 2006 Mar 8;234(1):90-106. Epub 2005 Dec 15. de Jong FA, de Jonge MJ, Verweij J, Mathijssen RH
Role of pharmacogenetics in irinotecan therapy.
Cancer Lett. 2006 Mar 8;234(1):90-106. Epub 2005 Dec 15., 2006-03-08 [PMID:16343744]

Abstract [show]
In the treatment of advanced colorectal cancer, irinotecan has become one of the most important drugs, despite its sometimes unpredictable adverse effects. To understand why some patients experience severe adverse effects (diarrhea and neutropenia), while others do not, the metabolic pathways of this drug have to be unraveled in detail. Individual variation in expression of several phase I and phase II metabolizing enzymes and ABC-transporters involved in irinotecan metabolism and excretion, at least partly explains the observed pharmacokinetic interpatient variability. Although the difference in expression-level of these proteins to a certain amount is explained by physiologic and environmental factors, the presence of specific genetic determinants also does influence their expression and function. In this review, the role of genetic polymorphisms in the main enzyme-systems (carboxylesterase, cytochrome P450 3A, and uridine diphosphate-glucuronosyltransferase) and ABC-transporters (ABCB1, ABCC2, and ABCG2) involved in irinotecan metabolism, are discussed. Since at this moment the field of pharmacogenetics and pharmacogenomics is rapidly expanding and simultaneously more rapid and cost-effective screening methods are emerging, a wealth of future data is expected to enrich our knowledge of the genetic basis of irinotecan metabolism. Eventually, this may help to truly individualize the dosing of this (and other) anti-cancer agent(s), using a personal genetic profile of the most relevant enzymes for every patient.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
202 This ABCG2 421COA transversion results in an amino acid change of glutamine to lysine at codon 141 [151-153], and leads to altered substrate specificity and function of the mutant protein [151,154]. Login to comment

[hide] High-speed screening of human ATP-binding cassette... Methods Enzymol. 2005;400:485-510. Ishikawa T, Sakurai A, Kanamori Y, Nagakura M, Hirano H, Takarada Y, Yamada K, Fukushima K, Kitajima M
High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics.
Methods Enzymol. 2005;400:485-510., [PMID:16399366]

Abstract [show]
Drug transporters represent an important mechanism in cellular uptake and efflux of drugs and their metabolites. Hitherto a variety of drug transporter genes have been cloned and classified into either solute carriers or ATP-binding cassette (ABC) transporters. Such drug transporters are expressed in various tissues such as the intestine, brain, liver, kidney, and, importantly, cancer cells, where they play critical roles in the absorption, distribution, and excretion of drugs. We developed high-speed functional screening and quantitative structure-activity relationship analysis methods to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. Furthermore, we demonstrate a new "SNP array" method to detect genetic polymorphisms of ABC transporters in human samples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
115 For this purpose, variant forms (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, E334stop, N590Y, D620N, R482G, and R482T) have been created by site‐ directed mutagenesis with the QuikChange site‐directed mutagensis kit (Stratagene, La Jolla, CA). Login to comment
233 Figure 13 shows the result of SNP array detection where nonsynonymous polymorphisms of ABCG2, that is, Q126stop and Q141K, were analyzed. Login to comment
235 Imai et al. (2002) identified three allelic variants in the ABCG2 gene, of which two were nonsynonymous SNPs (V12M and Q141K) and the third was a splice variant with deletion of nucleotides 944-949 that lacks Ala‐315 and Thr‐316 (Á315‐6). Login to comment
236 Compared with wild‐type transfected cells, ABCG2 Q141K variant‐transfected cells showed a low level of drug resistance that is associated with decreased protein expression. Login to comment
237 The SNP (Q141K) was postulated to cause increased sensitivity of normal cells to anticancer agents that are ABCG2 substrates such as SN‐38. Login to comment
242 It has been postulated that the 376C>T SNP may have a higher impact than the 421C>A polymorphism causing Q141K because active ABCG2 protein will not be synthesized from the variant allele. Login to comment
249 Detection of nonsynonymous polymorphisms (Q126stop and Q141K) of ABCG2 with the SNP array. Login to comment

[hide] Role of ABCG2/BCRP in biology and medicine. Annu Rev Pharmacol Toxicol. 2006;46:381-410. Krishnamurthy P, Schuetz JD
Role of ABCG2/BCRP in biology and medicine.
Annu Rev Pharmacol Toxicol. 2006;46:381-410., [PMID:16402910]

Abstract [show]
The protein variously named ABCG2/BCRP/MXR/ABCP is a recently described ATP-binding cassette (ABC) transporter originally identified by its ability to confer drug resistance that is independent of Mrp1 (multidrug-resistance protein 1) and Pgp (P-glycoprotein). Unlike Mrp1 and Pgp, ABCG2 is a half-transporter that must homodimerize to acquire transport activity. ABCG2 is found in a variety of stem cells and may protect them from exogenous and endogenous toxins. ABCG2 expression is upregulated under low-oxygen conditions, consistent with its high expression in tissues exposed to low-oxygen environments. ABCG2 interacts with heme and other porphyrins and protects cells and/or tissues from protoporphyrin accumulation under hypoxic conditions. Individuals who carry ABCG2 alleles that have impaired function may be more susceptible to porphyrin-induced toxicity. Abcg2 knock-out models have allowed in vivo studies of Abcg2 function in host and cellular defense. In combination with immunohistochemical analyses, these studies have revealed how ABCG2 influences the absorption, distribution, and excretion of drugs and cytotoxins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
296 The two SNPs most frequently identified were in exon 2 (G34A, resulting in a V12M change) and exon 5 (C421A, resulting in a Q141K substitution). Login to comment

[hide] Topotecan is a substrate for multidrug resistance ... Curr Drug Metab. 2006 Jan;7(1):105-18. Tian Q, Zhang J, Chan SY, Tan TM, Duan W, Huang M, Zhu YZ, Chan E, Yu Q, Nie YQ, Ho PC, Li Q, Ng KY, Yang HY, Wei H, Bian JS, Zhou SF
Topotecan is a substrate for multidrug resistance associated protein 4.
Curr Drug Metab. 2006 Jan;7(1):105-18., [PMID:16454695]

Abstract [show]
Topotecan (TPT) is a semisynthetic water-soluble derivative of camptothecin (CPT) used as second-line therapy in patients with metastatic ovarian carcinoma, small cell lung cancer, and other malignancies. However, both dose-limiting toxicity and tumor resistance hinder the clinical use of TPT. The mechanisms for resistance to TPT are not fully defined, but increased efflux of the drug by multiple drug transporters including P-glycoprotein (PgP), multidrug resistance associated protein 1 (MRP1) and breast cancer resistance protein (BCRP) from tumor cells has been highly implicated. This study aimed to investigate whether overexpression of human MRP4 rendered resistance to TPT by examining the cytotoxicity profiles using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazonium bromide (MTT) assay and cellular accumulation of TPT in HepG2 cells stably overexpressing MRP4. Two kinds of cell lines, HepG2 with insertion of an empty vector plasmid (V/HepG2), HepG2 cells stably expressing MRP4 (MRP4/HepG2), were exposed to TPT for 4 or 48 hr in the absence or presence of various MRP4 inhibitors including DL-buthionine-(S,R)-sulphoximine (BSO), diclofenac, celecoxib, or MK-571. The intracellular accumulation of TPT and paclitaxel (a PgP substrate) by V/HepG2 and MRP4/HepG2 cells was determined by incubation of TPT with the cells and the amounts of the drug in cells were determined by validated HPLC methods. The study demonstrated that MRP4 conferred a 12.03- and 6.86-fold resistance to TPT in the 4- and 48-hr drug-exposure MTT assay, respectively. BSO, MK-571, celecoxib, or diclofenac sensitised MRP4/HepG2 cells to TPT cytotoxicity and partially reversed MRP4-mediated resistance to TPT. In addition, the accumulation of TPT was significantly reduced in MRP4/HepG2 cells compared to V/HepG2 cells, and one-binding site model was found the best fit for the MRP4-mediated efflux of TPT, with an estimated K(m) of 1.66 microM and V(max) of 0.341 ng/min/106 cells. Preincubation of MRP4/HepG2 cells with BSO (200 microM) for 24 hr, celecoxib (50 microM), or MK-571 (100 microM) for 2 hr significantly increased the accumulation of TPT over 10 min in MRP4/HepG2 cells by 28.0%, 37.3% and 32.5% (P < 0.05), respectively. By contrast, there was no significant difference in intracellular accumulation of paclitaxel in V/HepG2 and MRP4/HepG2 cells over 120 min. MRP4 also rendered resistance to adefovir dipivoxil (bis-POM-PMEA) and methotrexate, two reported MRP4 substrates. MRP4 did not exhibit any significant resistance to other model drugs including vinblastine, vincristine, etoposide, carboplatin, cyclosporine and paclitaxel in both long (48 hr) and short (4 hr) drug-exposure MTT assays. These findings indicate that MRP4 confers resistance to TPT and TPT is the substrate for MRP4. Further studies are needed to explore the role of MRP4 in resistance to, toxicity and pharmacokinetics of TPT in cancer patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 However, resistance levels of TPT are inconsistent in different BCRP overexpressing cell lines [51-59], probably due to the existence of three mutant variants of BCRP resulting in the amino acid changes at V12M, Q141K and D620N [63-67]. Login to comment

[hide] Inhibitors of cancer cell multidrug resistance med... Anticancer Drugs. 2006 Mar;17(3):239-43. Ahmed-Belkacem A, Pozza A, Macalou S, Perez-Victoria JM, Boumendjel A, Di Pietro A
Inhibitors of cancer cell multidrug resistance mediated by breast cancer resistance protein (BCRP/ABCG2).
Anticancer Drugs. 2006 Mar;17(3):239-43., [PMID:16520651]

Abstract [show]
Breast cancer resistance protein (BCRP/ABCG2) belongs to the ATP-binding cassette (ABC) transporter superfamily. It is able to efflux a broad range of anti-cancer drugs through the cellular membrane, thus limiting their anti-proliferative effects. Due to its relatively recent discovery in 1998, and in contrast to the other ABC transporters P-glycoprotein (MDR1/ABCB1) and multidrug resistance-associated protein (MRP1/ABCC1), only a few BCRP inhibitors have been reported. This review summarizes the known classes of inhibitors that are either specific for BCRP or also inhibit the other multidrug resistance ABC transporters. Information is presented on structure-activity relationship aspects and how modulators may interact with BCRP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Iressa transport/binding appears to be dependent on natural ABCG2 polymorphisms such as Q141K [36]. Login to comment

[hide] Functional validation of the genetic polymorphisms... Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11. Tamura A, Watanabe M, Saito H, Nakagawa H, Kamachi T, Okura I, Ishikawa T
Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport.
Mol Pharmacol. 2006 Jul;70(1):287-96. Epub 2006 Apr 11., [PMID:16608919]

Abstract [show]
The ATP-binding cassette (ABC) transporter ABCG2 has been implicated to play a significant role in the response of patients to medication and/or the risk of diseases. To clarify the possible physiological or pathological relevance of ABCG2 polymorphisms, we have functionally validated single nucleotide polymorphisms (SNP) of ABCG2. In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Because porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the porphyrin transport activity of those variant forms in vitro. We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type. Furthermore, Flp-In-293 cells expressing those variants were photosensitive. Thus, among those genetic polymorphisms of ABCG2, at least the hitherto validated alleles of Q126stop, S441N, and F489L are suggested to be of clinical importance related to the potential risk of porphyria.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan). Login to comment
144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis. Login to comment
214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
219 The frequencies of the Q126stop, S441N, and F489L alleles are relatively low (less than 2%) compared with those of the V12M and Q141K alleles. Login to comment
224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein. Login to comment

[hide] Genetic variation and haplotype structure of the A... Drug Metab Pharmacokinet. 2006 Apr;21(2):109-21. Maekawa K, Itoda M, Sai K, Saito Y, Kaniwa N, Shirao K, Hamaguchi T, Kunitoh H, Yamamoto N, Tamura T, Minami H, Kubota K, Ohtsu A, Yoshida T, Saijo N, Kamatani N, Ozawa S, Sawada J
Genetic variation and haplotype structure of the ABC transporter gene ABCG2 in a Japanese population.
Drug Metab Pharmacokinet. 2006 Apr;21(2):109-21., [PMID:16702730]

Abstract [show]
The ATP-binding cassette transporter, ABCG2, which is expressed at high levels in the intestine and liver, functions as an efflux transporter for many drugs, including clinically used anticancer agents such as topotecan and the active metabolite of irinotecan (SN-38). In this study, to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCG2, we have comprehensively searched for genetic variations in the putative promoter region, all the exons, and their flanking introns of ABCG2 from 177 Japanese cancer patients treated with irinotecan. Forty-three genetic variations, including 11 novel ones, were found: 5 in the 5'-flanking region, 13 in the coding exons, and 25 in the introns. In addition to 9 previously reported nonsynonymous single nucleotide polymorphisms (SNPs), 2 novel nonsynonymous SNPs, 38C>T (Ser13Leu) and 1060G>A (Gly354Arg), were found with minor allele frequencies of 0.3%. Based on the LD profiles between the SNPs and the estimated past recombination events, the region analyzed was divided into three blocks (Block -1, 1, and 2), each of which spans at least 0.2 kb, 46 kb, and 13 kb and contains 2, 24, and 17 variations, respectively. The two, eight, and five common haplotypes detected in 10 or more patients accounted for most (>90%) of the haplotypes inferred in Block -1, Block 1, and Block 2, respectively. The SNP and haplotype distributions in Japanese were different from those reported previously in Caucasians. This study provides fundamental information for the pharmacogenetic studies investigating the relationship between the genetic variations in ABCG2 and pharmacokinetic/pharmacodynamic parameters.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
17 In vitro studies have also indicated that a number of anticancer drugs are good substrates for ABCG2: e.g. topotecan, an irinotecan metabolite, 7-ethyl-10-hydroxycamptothecin (SN-38), and its glucuronide conjugate, SN-38G.810) Indeed, inhibition of the murine ABCG2 homologue, Bcrp 1, increases the bioavailability of topotecan when orally administered to mdr1aW1b- decient mice.11) In a clinical study, coadministration of topotecan with GF120918, a dual inhibitor for ABCG2 and P-glycoprotein, was shown to markedly increase the bioavailability and systemic exposure of topotecan.12) The cloning of ABCG2 from drug-selected cell lines revealed that acquired amino acid substitutions at residue 482 (Arg482Gly and Arg482Thr) of ABCG2 resulted in marked alterations in substrate recognition and transport ability.13) Thereafter, naturally occurring genetic variations in ABCG2 have been extensively examined in various ethnic populations1421) because they were expected to explain interindividual dierences in oral bioavailability and clearance of ABCG2 substrate drugs.22) Two nonsynonymous polymorphisms, 34GÀA (Val12Met) and 421CÀA (Gln141Lys), were detected at relatively high frequencies in most ethnic groups including Caucasians, Asians, and Africans.1416,1821,23) Both polymorphisms were reported to be associated with reduced protein expression in vitro andWor the increased sensitivity of the expressed cells toward several anticancer drugs although conicting data were also reported.16,2426) The expression of ABCG2 protein in placenta was signicantly lower in homozygotes with the 421A alleles than in those with the 421C alleles, while 34GÀA (Val12Met) did not aect ABCG2 protein expression.23) However, in intestinal samples, no association was found between the ABCG2 protein levels and the 421CÀA (Gln141Lys) genotype.18) A pharmacokinetic study showed that 421A (Gln141Lys) was unlikely to inuence the in vivo disposition of irinotecan in European Caucasian cancer patients.27) On the other hand, diomotecan pharmacokinetics were signicantly aected by the 421A genotype.28) To explain these inconsistencies, the elucidation of the haplotype structure of ABCG2 would be helpful; however, only limited information is available for the linkage disequilibrium (LD) prole and haplotype structure of this gene.20,21) Also, to facilitate future pharmacogenetic studies on ABCG2 genetic variations, haplotype analysis using its high-density SNPs found in a large number of samples is warranted. Login to comment
80 However, marked ethnic dierences in the allele frequencies were observed with |1203ä |1200delCTCA, 34GÀA (Val12Met), 421CÀA (Gln141Lys), and some intronic variations. Login to comment
85 115Haplotype Structure in Human ABCG2 (from |1836 to |1175 bp upstream of the translational start site) of the basal promoter,30) and was suggested to inuence irinotecan pharmacokinetics.31) The frequencies of two well-known nonsynonymous SNPs, 34GÀA (Val12Met) and 421CÀA (Gln141Lys), were 0.192 and 0.319 in our study, which were comparable to those in Chinese (0.204 and 0.2220.350, respectively).20,27) However, the frequencies were much higher than those in Caucasians (0.020.065 and 0.080.15), African-Americans (00.09 and 00.05), and a Swedish population (0.02 and 0.1).18,19,21,23,27) Of other relatively rare nonsynonymous SNPs, 376CÀT (Gln126X), 1291TÀC (Phe431Leu), 1322GÀA (Ser441Asn), 1465TÀC (Phe489Leu), and 1515delC (Phe506SerfsX4) were already detected in a Japanese population by Itoda et al.17) andWor Kobayashi et al.,23) but not found in other ethnic groups. Login to comment
101 Strong LDs (r2 À0.7) were observed between |262CÀT and 1098GÀA (Glu366Glu) (r2 0.798), between 421CÀA (Gln141Lys) and IVS12{49GÀT (r2 0.709), and among IVS11{20AÀG, IVS1321CÀT, and IVS15{110CÀT (r2 À0.720). Login to comment
115 No close associations were observed (r2 º0.70) between the variations across the blocks except for one pair of SNPs, 421CÀA (Gln141Lys) and IVS12{49GÀT, Fig. . Login to comment
130 In Block 1, seven haplotype groups (*1 to *7) were inferred, and the groups of *2 to *7 harbored non-synonymous SNPs, 421CÀA (Gln141Lys) (*2), 34GÀA (Val12Met) (*3), 376CÀT (Gln126X) (*4), 38CÀT (Ser13Leu) (*5), 479GÀA (Arg160Gln) (*6), and 1060GÀA (Gly354Arg) (*7). Login to comment
134 The haplotype-tagging SNPs (htSNPs) that were able to resolve the 8 common haplotypes were the following 7 variations: IVS199GÀA, 34GÀA (Val12Met), IVS293TÀC, 376CÀT (Gln126X), 421CÀA (Gln141Lys), IVS6217AÀG, and IVS6204CÀT. Login to comment
154 Mizuarai et al. showed that 34GÀA (Val12Met) was associated with reduced drug resistance in polarized LLC-PK1 cells, which might be caused by its impaired apical membrane localization.25) In contrast, several groups did not nd any signicant eects of Val12Met on the protein expression levels as well as drug resistance using stable and transient mammalian expression systems.16,24,26) According to Imai et al. and Kondo et al.,16,24) the Gln141Lys substitution resulted in decreased protein expression and reduced drug resistance. Login to comment
162 Except for Val12Met, Gln126X, and Gln141Lys, the allele frequencies of eight nonsynonymous SNPs were less than 0.01, and these low frequency variations do not largely contribute to the overall heterozygosity of ABCG2; however, they might have clinical importance. Login to comment
174 Nevertheless, the frequency (31.9z) of the haplotype *2a in Block 1 harboring 421CÀA (Gln141Lys) was comparable to their counterpart (20.4z). Login to comment
176 Therefore, the substitution itself of Gln141 to Lys is likely to be responsible for the reduced expression of ABCG2 protein in placenta as demonstrated by Kobayashi et al.23) Furthermore, Chinese and Japanese share several common Block 2 haplotypes, *1a, *1b, *1c, and *1dW *1e. Login to comment

[hide] Role of pharmacogenetics of ATP-binding cassette t... Pharmacol Ther. 2006 Nov;112(2):457-73. Cascorbi I
Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs.
Pharmacol Ther. 2006 Nov;112(2):457-73., [PMID:16766035]

Abstract [show]
Interindividual differences of drug response are an important cause of treatment failures and adverse drug reactions. The identification of polymorphisms explaining distinct phenotypes of drug metabolizing enzymes contributed in part to the understanding of individual variations of drug plasma levels. However, bioavailability also depends on a major extent from the expression and activity of drug transport across biomembranes. In particular efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (P-glycoprotein, P-gp), the ABCC (multidrug resistance-related protein, MRP) family and ABCG2 (breast cancer resistance protein, BCRP) have been identified as major determinants of chemoresistance in tumor cells. They are expressed in the apical membranes of many barrier tissue such as the intestine, liver, blood-brain barrier, kidney, placenta, testis and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics and clinical outcome of a variety of drugs. This review focuses on the functional significance of single nucleotide polymorphisms (SNP) of ABCB1, ABCC1, ABCC2, and ABCG2 in in vitro systems, in vivo tissues and drug disposition, as well as on the clinical outcome of major indications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
901 Both identified 34G>A (V12M) and 421C>A (Q141K). Login to comment
909 5.3. Association to activity and drug bioavailability HEK-293 cells, transfected with wild-type or V12N, ABCG2 showed apical staining with an ABCG2 antibody, but high intracellular staining in case of Q141K, suggesting impaired membrane trafficking or incorrect membrane insertion. Login to comment
917 0.005 Exon 4 c. 376 C>T Q126stop 0.01 Lack of function 0.00a 0.00b Exon 5 c. 421 C>A Q141K 0.35 Reduced activity (Mizuarai et al., 2004; Kobayashi et al., 2005; Sparreboom et al., 2005) 0.11a 0.02b IVS 5-16 A>G ? Login to comment

[hide] Role of BCRP 421C>A polymorphism on rosuvastatin p... Clin Chim Acta. 2006 Nov;373(1-2):99-103. Epub 2006 May 13. Zhang W, Yu BN, He YJ, Fan L, Li Q, Liu ZQ, Wang A, Liu YL, Tan ZR, Fen-Jiang, Huang YF, Zhou HH
Role of BCRP 421C>A polymorphism on rosuvastatin pharmacokinetics in healthy Chinese males.
Clin Chim Acta. 2006 Nov;373(1-2):99-103. Epub 2006 May 13., [PMID:16784736]

Abstract [show]
BACKGROUND: Rosuvastatin, a novel potent HMG-CoA reductase inhibitor, is excreted into bile mediated by breast cancer resistance protein (BCRP). Our objective was to determine the association between the most frequent single nucleotide polymorphisms (SNPs) of the BCRP (421C>A) and the pharmacokinetics of rosuvastatin. METHOD: Pre-screening of SLCO1B1 521TC and CYP2C9*1/*3 were performed before this pharmacokinetic study. Fourteen healthy volunteers who are SLCO1B1 521TT and CYP2C9*1/*1 wild-type homozygotes were selected to participate in this study. Seven were 421CC wild-type of BCRP, the others were carriers with at least one 421C>A mutant allele (five subjects had a genotype of 421CA and two were homozygotes of 421AA). Each was given a single oral dose of 20 mg rosuvastatin. The plasma concentrations of rosuvastatin were measured for up to 72 h by LC-MS. RESULTS: The pharmacokinetic parameters of rosuvastatin showed a significantly difference between the two genotyped groups. The AUC(0-72) and AUC(0-infinity) of rosuvastatin were lower in the 421CC group than in the 421CA+421AA group (33.8+/-11.4 vs. 59.6+/-22.2 ng.h/ml, P=0.018; 34.9+/-11.9 vs. 62.2+/-23.5 ng.h/ml, P=0.018), respectively. The C(max) value was higher in the 421CA+421AA group than that in the 421CC group (9.9+/-5.4 vs. 5.1+/-2.4 ng/ml, P=0.048). The CL/F value was lower in the 421CA+421AA group than that in the 421CC group (384.7+/-161.2 vs. 674.0+/-297.6 l/h, P=0.043). The T(1/2) and T(max) values showed no difference between these groups. CONCLUSIONS: The BCRP 421C>A polymorphism may play an important role in the pharmacokinetics of rosuvastatin in healthy Chinese males after the exclusion of impact of SLCO1B1 and CYP2C9 genetic polymorphism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
91 In most of the ethnic populations, the 421C>A (Q141K) polymorphism occurred at high frequency. Login to comment
93 It is concluded that the functional impairment of 421C>A variant was due to reduced ATPase activity for Q141K [11]. Login to comment

[hide] The livestock photosensitizer, phytoporphyrin (phy... Res Vet Sci. 2006 Dec;81(3):345-9. Epub 2006 Jun 30. Robey RW, Fetsch PA, Polgar O, Dean M, Bates SE
The livestock photosensitizer, phytoporphyrin (phylloerythrin), is a substrate of the ATP-binding cassette transporter ABCG2.
Res Vet Sci. 2006 Dec;81(3):345-9. Epub 2006 Jun 30., [PMID:16808938]

Abstract [show]
Hepatogenous photosensitization occurs in livestock following damage to the liver or biliary apparatus that results in impaired excretion of phytoporphyrin (phylloerythrin), a photosensitizer. Based on earlier observations that porphyrin-based photosensitizers are substrates of the ATP-binding cassette transporter ABCG2, we examined the ability of the hepatic transporters ABCB1 (P-glycoprotein) and ABCG2 to transport phytoporphyrin. Transport of phytoporphyrin was blocked by the ABCG2-specific inhibitor fumitremorgin C (FTC) in human embryonic kidney cells transfected with full length human ABCG2, while no transport by cells transfected with human ABCB1 was noted. FTC-inhibited transport of phytoporphyrin was also demonstrated in ABCG2-expressing LLC-PK1 pig kidney cells, consistent with the idea that the pig orthologue, like human ABCG2, transports the photosensitizer. ABCG2 expression was confirmed by immunohistochemistry in the hepatocytes of cow, pig and sheep livers. We conclude that phytoporphyrin is a substrate for ABCG2 and that the transporter is likely responsible for its biliary excretion.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 A non-synonymous single nucleotide polymorphism in the human ABCG2 gene resulting in a glutamine to lysine change at amino acid 141 (Q141K) of the protein has been shown to result in impaired transport of substrate drugs and decreased ATPase activity compared to wild-type protein (Mizuarai et al., 2004; Morisaki et al., 2005). Login to comment

[hide] Multidrug resistance: retrospect and prospects in ... Curr Med Chem. 2006;13(16):1859-76. Perez-Tomas R
Multidrug resistance: retrospect and prospects in anti-cancer drug treatment.
Curr Med Chem. 2006;13(16):1859-76., [PMID:16842198]

Abstract [show]
Conventional cancer chemotherapy is seriously limited by the multidrug resistance (MDR) commonly exhibited by tumour cells. One mechanism by which a living cell can achieve multiple resistances is via the active efflux of a broad range of anticancer drugs through the cellular membrane by MDR proteins. Such drugs are exported in both ATP-dependent and -independent manners, and can occur despite considerable concentration gradients. To the ATP-dependent group belongs the ATP-binding cassette (ABC) transporter family, which includes P-gp, MRP, BCRP, etc. Another protein related to MDR, though not belonging to the ABC transporter family, is lung resistance-related protein (LRP). All of these proteins are involved in diverse physiological processes, and are responsible for the uptake and efflux of a multitude of substances from cancer cells. Many inhibitors of MDR transporters have been identified over the years. Firstly, MDR drugs were not specifically developed for inhibiting MDR; in fact, they had other pharmacological properties, as well as a relatively low affinity for MDR transporters. They included compounds of diverse structure and function, such as verapamil and cyclosporine, and caused side effects. Secondly, the new drugs were more inhibitor-specific, in terms of MDR transport, and were designed to reduce such side effects (e.g., R-verapamil, dexniguldipine, etc.). Unfortunately, they displayed poor response in clinical studies. Recently, new compounds obtained from drug development programs conducted by the pharmaceutical industry are characterized by a high affinity to MDR transporters and are efficient at nanomolar concentrations. Some of these compounds (e.g., MS-209) are currently under clinical trials for specific forms of advanced cancers. We aim to provide an overview of the properties associated with those mammalian MDR transporters known to mediate significant transport of relevant drugs in cancer treatments. We also summarize recent advances concerning resistance to cancer drug therapies with respect to the function and overexpression of ABC and LRP multidrug transporters.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
219 The results showed three BCRP-coding SNPs [G34A (V12M), C376T (Q126stop) and C421A (Q141K)] (Fig. 6). Login to comment
220 The V12M and the Q141K SNPs greatly Fig. (6). Login to comment
223 In addition, cells transfected with Q141K-BCRP cDNA expressed low amounts of this protein and showed low levels of drug resistance than did wild-type BCRP-transfected cells. Login to comment

[hide] Breast cancer resistance protein in pharmacokineti... Expert Opin Drug Metab Toxicol. 2005 Dec;1(4):595-611. Xia CQ, Yang JJ, Gan LS
Breast cancer resistance protein in pharmacokinetics and drug-drug interactions.
Expert Opin Drug Metab Toxicol. 2005 Dec;1(4):595-611., [PMID:16863427]

Abstract [show]
Breast cancer resistance protein (BCRP), also known as ABCG2, ABCP and MXR, is a member of the ATP-binding cassette transporter G family. BCRP functions as a biological barrier that extrudes xenobiotics out of cells. The broad substrate specificity and tissue distributions of BCRP in the body make this transporter one of the major efflux transporters in chemotherapy. Recent studies have demonstrated that BCRP exerts a great impact on drug absorption and disposition. This review focuses on the role of BCRP in pharmacokinetics as well as in vitro and in vivo strategies to evaluate hepatic/intestinal BCRP-mediated drug transports and drug-drug interactions. The impacts of polymorphism and gender difference of BCRP are also discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
173 The mutation C421A at exon 5, with an amino acid change of Gln to Lys at codon 141, has been reported with a reduced BCRP protein level, but not mRNA level in PA-317 cells, and a decreased BCRP efflux function in transfected LLC-PK and HEK-283 cells [73,74,76]. Login to comment
511 Pharmacogenetics (2003) 13:19-28. 73. IMAI Y, NAKANE M, KAGE K et al.: C421A polymorphism in the human breast cancer resistance protein gene is associated with low expression of Q141K protein and low-level drug resistance. Login to comment

[hide] Human ABC transporter ABCG2 in xenobiotic protecti... Drug Metab Rev. 2006;38(3):371-91. Wakabayashi K, Tamura A, Saito H, Onishi Y, Ishikawa T
Human ABC transporter ABCG2 in xenobiotic protection and redox biology.
Drug Metab Rev. 2006;38(3):371-91., [PMID:16877258]

Abstract [show]
Human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR/ABCP) is regarded as a member of the phase III system of xenobiotic metabolism. This efflux pump is suggested to be responsible for protecting the body from toxic xenobiotics and for removing toxic metabolites. The aim of this review article is to address new aspects of ABCG2 related to redox biology, namely the posttranslational modification (intra- and intermolecular disulfide bond formation) of ABCG2 protein and the transport of porphyrin and chlorophyll metabolites, as well as the high-speed screening and QSAR analysis method to evaluate ABCG2-drug interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells. Login to comment

[hide] Association of enzyme and transporter genotypes wi... Clin Pharmacol Ther. 2006 Aug;80(2):192-201. Gardner ER, Burger H, van Schaik RH, van Oosterom AT, de Bruijn EA, Guetens G, Prenen H, de Jong FA, Baker SD, Bates SE, Figg WD, Verweij J, Sparreboom A, Nooter K
Association of enzyme and transporter genotypes with the pharmacokinetics of imatinib.
Clin Pharmacol Ther. 2006 Aug;80(2):192-201., [PMID:16890580]

Abstract [show]
OBJECTIVE: Our objective was to explore the relationships between imatinib pharmacokinetics and 9 allelic variants in 7 genes coding for adenosine triphosphate-binding cassette transporters (ABCB1 and ABCG2) and enzymes (cytochrome P450 [CYP] 2C9, CYP2C19, CYP2D6, CYP3A4, and CYP3A5) of putative relevance for imatinib. METHODS: Imatinib transport in vitro was studied by use of human embryonic kidney 293 cells transfected with wild-type ABCG2 and an ABCG2 Q141K clone. Steady-state pharmacokinetics of imatinib was obtained in 82 patients with gastrointestinal stromal tumors treated with oral imatinib at doses ranging from 100 to 1000 mg/d. Genotyping was carried out via direct sequencing or restriction fragment length polymorphism-based techniques. RESULTS: Human embryonic kidney 293 cells transfected with ABCG2 Q141K exhibited greater drug accumulation in vitro in comparison with cells expressing wild-type ABCG2 (P = .028). However, pharmacokinetic parameters of imatinib in vivo were not statistically significantly different in 16 patients who were heterozygous for ABCG2 421C>A compared with 66 patients carrying the wild-type sequence (P = .479). The apparent oral clearance of imatinib was potentially reduced in individuals with at least 1 CYP2D6*4 allele (median, 7.78 versus 10.6 L/h; P = .0695). Pharmacokinetic parameters were not related to any of the other multiple-variant genotypes (P >or= .230), possibly because of the low allele frequencies. CONCLUSIONS: This study indicates that common genetic variants in the evaluated genes have only a limited impact on the pharmacokinetics of imatinib. Further investigation is required to quantitatively assess the clinical significance of homozygous variant ABCG2 and CYP2D6 genotypes in patients treated with imatinib.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 Methods: Imatinib transport in vitro was studied by use of human embryonic kidney 293 cells transfected with wild-type ABCG2 and an ABCG2 Q141K clone. Login to comment
4 Results: Human embryonic kidney 293 cells transfected with ABCG2 Q141K exhibited greater drug accumulation in vitro in comparison with cells expressing wild-type ABCG2 (P ‫؍‬ .028). Login to comment
26 In particular, a functional single-nucleotide polymorphism (SNP) has been identified in exon 5 of the ABCG2 gene, in which a CϾA nucleotide transition at position 421 (ABCG2 421CϾA) results in a nonsynonymous variant protein with a glutamine-to-lysine amino acid substitution at codon 141 (Q141K).5 In this study we tested the hypothesis that the extensive interindividual variability in the pharmacokinetics of imatinib is associated with the ABCG2 421CϾA polymorphism in a cohort of patients with gastrointestinal stromal tumors. Login to comment
29 Human embryonic kidney cells (HEK293) transfected with pcDNA3, wild-type ABCG2, or an ABCG2 Q141K clone were generated as described previously.8 Cells were maintained in N-[2-hydroxyethyl]piperazine-NЈ-[2-ethanesulfonic acid] (HEPES)-buffered RPMI-1640 medium (Gibco BRL, Paisley, United Kingdom) supplemented with 10% (vol/vol) fetal calf serum. Login to comment
82 To investigate the potential effect of the ABCG2 421CϾA variant on the protein`s ability to transport imatinib, human embryonic kidney cells (HEK293) transfected with pcDNA3, wild-type ABCG2, or an ABCG2 Q141K clone were exposed to 14 C-labeled imatinib for 2 hours, and the intracellular concentration was determined. Login to comment
84 The cells homozygous for the studied variant exhibited significantly greater drug accumulation than the cells expressing wild-type ABCG2 (P ϭ .028), suggesting impaired outward-directed transport of imatinib by the ABCG2 Q141K variant (Fig 1). Login to comment
102 Top, Comparative intracellular accumulation of 14 C-labeled imatinib in human embryonic kidney cells (HEK293) transfected with wild-type ABCG2 (HEK293/R) and ABCG2 Q141K clone (HEK293/K-5). Login to comment
117 The studied variant in ABCG2 is an SNP causing a nonsynonymous change in the protein sequence, in which a 421C-to-A transition in exon 5 leads to a glutamine-to-lysine amino acid substitution at codon 141 (Q141K). Login to comment
119 Although our own current in vitro transport studies in HEK293 cells transfected with the homozygous Q141K variant show Table I. Login to comment
120 Genotype and allele frequencies for studied variant genes Variant† Effect‡ Activity§ Genotype frequency [No. of patients (%)]࿣ Allele frequency¶ Wt Het Var p q Enzyme genotypes CYP2C9*2 (430CϾT) R144C (exon 3) Decreased 60 (85.7) 9 (12.9) 1 (1.43) 0.921 0.0786 CYP2C9*3 (1075AϾC) I359L (exon 7) Decreased 60 (85.7) 10 (14.3) 0 (0) 0.929 0.0714 CYP2C19*2 (681GϾA) Splice defect (exon 4) None 40 (57.1) 27 (38.6) 3 (4.29) 0.764 0.236 CYP2C19*3 (636GϾA) W212X (exon 5) None 70 (100) 0 (0) 0 (0) 1.000 0.000 CYP2D6*4 (1846GϾA) Splice defect (exon 4) None 42 (62.7) 24 (35.8) 1 (1.49) 0.806 0.194 CYP3A4*1B (-392AϾG) Promoter Normal/ increased 64 (91.4) 6 (8.57) 0 (0) 0.957 0.0429 CYP3A5*3C (6986AϾG) Splice defect (intron 3) Severely decreased 0 (0) 13 (18.6) 57 (81.4) 0.0929 0.907 Transporter genotypes ABCB1 3435CϾT I1145I (exon 26) Reduced 21 (25.6) 41 (50.0) 20 (24.4) 0.506 0.494 ABCG2 421CϾA Q141K (exon 5) Reduced 66 (80.5) 16 (19.5) 0 (0) 0.902 0.0976 Wt, Homozygous wild-type patient; Het, heterozygous patient; Var, homozygous variant patient; p, frequency for wild-type allele; q, frequency for variant allele. Login to comment

[hide] Expression and function of multidrug resistance tr... Expert Opin Drug Metab Toxicol. 2005 Aug;1(2):233-46. Scherrmann JM
Expression and function of multidrug resistance transporters at the blood-brain barriers.
Expert Opin Drug Metab Toxicol. 2005 Aug;1(2):233-46., [PMID:16922639]

Abstract [show]
The presence of active carrier-mediated transport of substrates from the brain to the blood is a major feature of the barrier properties of the blood-brain barrier (BBB). These proteins lie in the luminal or abluminal membranes of the endothelial cells that form the BBB. Some are ATP-binding cassette proteins (ABC) and many amphipathic cationic drugs are carried by P-glycoprotein (ABCB1) or ABCG2, which lie at the luminal pole of the BBB. Several multidrug resistance-associated proteins (MRPs, ABCCs) are also present on the membranes of brain microvessels; these are mainly involved in the efflux of anionic compounds. All these ABC proteins help to protect the brain and form a critical target for CNS pharmaceuticals, influencing the clinical variability of responses to, and the design of, these drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
505 IMAI Y, NAKANE M, KAGE K et al.: C421A polymorphism in the human breast cancer resistance protein gene is associated with low expression of Q141K protein and low-level drug resistance. Login to comment

[hide] Human multidrug resistance ABCB and ABCG transport... Physiol Rev. 2006 Oct;86(4):1179-236. Sarkadi B, Homolya L, Szakacs G, Varadi A
Human multidrug resistance ABCB and ABCG transporters: participation in a chemoimmunity defense system.
Physiol Rev. 2006 Oct;86(4):1179-236., [PMID:17015488]

Abstract [show]
In this review we give an overview of the physiological functions of a group of ATP binding cassette (ABC) transporter proteins, which were discovered, and still referred to, as multidrug resistance (MDR) transporters. Although they indeed play an important role in cancer drug resistance, their major physiological function is to provide general protection against hydrophobic xenobiotics. With a highly conserved structure, membrane topology, and mechanism of action, these essential transporters are preserved throughout all living systems, from bacteria to human. We describe the general structural and mechanistic features of the human MDR-ABC transporters and introduce some of the basic methods that can be applied for the analysis of their expression, function, regulation, and modulation. We treat in detail the biochemistry, cell biology, and physiology of the ABCB1 (MDR1/P-glycoprotein) and the ABCG2 (MXR/BCRP) proteins and describe emerging information related to additional ABCB- and ABCG-type transporters with a potential role in drug and xenobiotic resistance. Throughout this review we demonstrate and emphasize the general network characteristics of the MDR-ABC transporters, functioning at the cellular and physiological tissue barriers. In addition, we suggest that multidrug transporters are essential parts of an innate defense system, the "chemoimmunity" network, which has a number of features reminiscent of classical immunology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
997 In healthy individuals or patients, altogether eight nonsynonymous (V12M, Q141K, I206L, F431L, S441N, F489L, N590Y, D620N), five synonymous (silent) (c. Login to comment
1006 From these numerous reported alterations, two protein variants, V12M, and Q141K, were found in relatively high frequencies, with significant differences in allele frequencies in different areas of the world (Fig. 11). Login to comment
1010 The Q141K polymorphism leads to the replacement of the uncharged glutamine residue with a positively charged lysine within the ATP-binding domain, between the Walker A motif (amino acids 83-89) and the signature region (amino acids 186-189). Login to comment
1011 The Q141K variant was also detected in all ethnic groups tested: the allele frequency ranged between 1 and 35% (the African and African-American subjects with low, while the Japanese and Chinese populations with high allele frequencies; see Refs. 45, 74, 185). Login to comment
1016 (251), by using stable mammalian expression systems, found that in PA317 or HEK-293 cells the expressed Q141K ABCG2 protein had a lower expression level than the wild-type ABCG2, or the V12M variant. Login to comment
1018 (251) demonstrated that both the V12M and Q141K ABCG2 could reach the plasma membrane in the HEK-293 cells, while a significant portion of Q141K remained intracellular. Login to comment
1019 Other studies found a 30-40% reduction in cell surface expression of the Q141K variant, despite a similar mRNA level than the wild-type ABCG2 (145, 188). Login to comment
1020 Recent investigation of 99 Japanese placenta samples revealed that individuals homozygous for the Q141K variant showed significantly lower expression levels of this transporter protein, while the heterozygous samples displayed an intermediate expression level (185). Login to comment
1023 (247) expressed ABCG2 in polarized LLC-PK1 cells, and by using confocal microscopy, the authors observed that the wild-type ABCG2 and Q141K showed mainly apical staining, while the V12M variant 1210 SARKADI, HOMOLYA, SZAKA´ CS, AND VA´ RADI Physiol Rev • VOL 86 • OCTOBER 2006 • www.prv.org showed mostly intracellular localization. Login to comment
1025 (188) also used LLC-PK1 cells to express the V12M and Q141K variants and found that all polymorphisms, including V12M and Q141K, had an apical localization. Login to comment
1028 (247), when the V12M or Q141K-transfected LLC-PK1 cells were challenged by mitoxantrone, topotecan, or an indolocarbazole topoisomerase I inhibitor. Login to comment
1030 (251) found that only the Q141K variant had a moderately lower level resistance against mitoxantrone, topotecan, or SN-38, compared with the wild-type ABCG2-transfected cells. Login to comment
1032 Q141K is mapped to a functionally important ABC region of ABCG2; therefore, it is possible that the ATPase activity of this variant is altered. Login to comment
1033 Two studies compared the vanadate-sensitive ATPase activity of ABCG2 V12M and Q141K variants, using Sf9 (Spodoptera frugiperda) cell membranes (247, 251). Login to comment
1034 A reduced basal ATPase activity was observed by both groups for the Q141K variant. Login to comment
1038 Clearly, more detailed studies are required to clarify the mechanism of a reduced protein expression for Q141K, and the altered cellular localization found for the V12M and Q141K variants under certain conditions. Login to comment
1047 A recent investigation performed an exploratory, retrospective evaluation of the functional consequence of the ABCG2 Q141K variant in 20 adult patients, treated with diflomotecan, a synthetic derivative of camptothecin (350). Login to comment
1050 This observation is in harmony with studies indicating a reduced protein expression and function for the Q141K variant, while it seems to contradict the results of De Jong et al. Login to comment
1052 As mentioned above, the allele frequency of Q141K varies in diverse populations, and in Japan and China, this polymorphism appears to be common, with an overall allele frequency of ϳ30%. Login to comment

[hide] Towards understanding the mechanism of action of t... J Mol Graph Model. 2007 Mar;25(6):837-51. Epub 2006 Aug 30. Li YF, Polgar O, Okada M, Esser L, Bates SE, Xia D
Towards understanding the mechanism of action of the multidrug resistance-linked half-ABC transporter ABCG2: a molecular modeling study.
J Mol Graph Model. 2007 Mar;25(6):837-51. Epub 2006 Aug 30., [PMID:17027309]

Abstract [show]
The ATP-binding cassette protein ABCG2 is a member of a broad family of ABC transporters with potential clinical importance as a mediator of multidrug resistance. We carried out a homology and knowledge-based, and mutationally improved molecular modeling study to establish a much needed structural framework for the protein, which could serve as guidance for further genetic, biochemical, and structural analyses. Based on homology with known structures of both full-length and nucleotide-binding domains (NBD) of ABC transporters and structural knowledge of integral membrane proteins, an initial model of ABCG2 was established. Subsequent refinement to conform to the lipophilic index distributions in the transmembrane domain (TMD) and to the results of site-directed mutagenesis experiments led to an improved model. The complete ABCG2 model consists of two identical subunits facing each other in a closed conformation. The dimeric interface in the nucleotide-binding domain (NBD) involves a characteristic nucleotide sandwich and the interface in the TMD consists of the TM helices 1-3 of one subunit and the helices 5 and 6 of the other. The interface between the NBD and the TMD is bridged by the conserved structural motif between TM2 and TM3, the intracellular domain 1 (ICD1), and the terminal beta-strand (S6) of the central beta-sheet in the NBD. The apparent flexibility of the ICD1 may play a role in transmitting conformational changes from the NBD to the TMD or from the TMD to the NBD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 Q141K, a SNP [22,23], is located on the surface of the small sub-domain near the conserved H3 helix Y.-F Li et al. / Journal of Molecular Graphics and Modelling 25 (2007) 837-851 841 Table 1 Sequence identity and similarity in the NBD and TMD between ABCG2 and selected ABC transporters ABC transporter NBD domain (%)a ABC transporter TM domain (%)b Identity Similarityc Identity Similarity ABCG2 100.0 (234)d 100.0 (234) ABCG2 100.0 (295) 100.0 (295) EcMalK 26.5 (62) 42.7 (100) VcMsbA 9.5 (28) 19.5 (56) TlMalK 22.6 (53) 42.3 (99) EcMsbA 6.4 (19) 18.3 (54) His-P 18.4 (43) 40.6 (95) LcLmrA 8.5 (25) 21.0 (62) MJ1267 17.5 (41) 38.0 (89) Pgp-n 6.1 (18) 19.7 (58) LMR-A 20.9 (49) 40.2 (94) Pgp-c 6.1 (18) 15.6 (46) CFTR-N1 20.5 (48) 34.6 (81) Dro-Wht 22.0 (65) 40.3 (119) TAP1 17.1 (40) 42.7 (100) Pgp-n-reve (16) (30) a Sequence identities and similarities are based on alignments in Fig. 2. b Sequence identities and similarities are based on alignments in Fig. 4. c Similarity is defined for amino acid residues in the alignment, which share common physical or chemical properties such as size, hydrophobicity or charge. Login to comment
123 Patients carrying the Q141K SNP were shown to have elevated drug levels in plasma when treated with topotecan or diflomotecan [22,44-49]. Login to comment
124 From its location in the molecule, the Q141K polymorphism should not disrupt the folding of the subunit; rather it introduces an additional positive charge in an already very positively charged surface (residues R137, R147, K157, R160, and R163 are in close proximity). Login to comment
174 Subsequently, a symmetric dimer Y.-F Li et al. / Journal of Molecular Graphics and Modelling 25 (2007) 837-851844 Table 4 Locations of mutations as predicted by the ABCG2 model and functional correlation Mutation Position in ABCG2 Phenotype Reference V12M N-terminal Membrane localization, SNP, and somewhat lower expression and lower resistance [22] S25Pa N-terminal Low drug resistance for the cell line due to lower expression at cell surface [42] T82Aa NBD, Walker A Low drug resistance for the cell line due to lower expression at cell surface [42] K86M NBD, Walker A No expression at cell surface, retained in the Golgi [43] K86I NBD, Walker A No expressed at cell surface [43] Q141K NBD SNP with lower protein expression and low drug resistance [22,23] T237V NBD Fully functional b I239K,R NBD Loss of expression may be due to structural disruption b R309G Linkerc Low drug resistance [42] D315-6 Linker Deletion mutant for A315 and T316. Login to comment

[hide] Hoosier Oncology Group randomized phase II study o... Clin Cancer Res. 2006 Oct 15;12(20 Pt 1):6094-9. Hahn NM, Marsh S, Fisher W, Langdon R, Zon R, Browning M, Johnson CS, Scott-Horton TJ, Li L, McLeod HL, Sweeney CJ
Hoosier Oncology Group randomized phase II study of docetaxel, vinorelbine, and estramustine in combination in hormone-refractory prostate cancer with pharmacogenetic survival analysis.
Clin Cancer Res. 2006 Oct 15;12(20 Pt 1):6094-9., 2006-10-15 [PMID:17062685]

Abstract [show]
PURPOSE: To determine the safety and efficacy of two docetaxel doublets in hormone-refractory prostate cancer (HRPC) patients and to examine the prognostic role of polymorphisms in host genes important to docetaxel metabolism and transport. EXPERIMENTAL DESIGN: Sixty-four chemotherapy-naive patients with HRPC were randomized to docetaxel and vinorelbine (D, 20 mg/m2 i.v. days 1 and 8; V, 25 mg/m2 i.v. days 1 and 8) or docetaxel and estramustine phosphate (D, 60-70 mg/m2 i.v. day 1; E, 280 mg oral thrice daily days 1-5) administered q21d. Primary end point was clinically significant toxicity. A pharmacogenetic analysis of host genes was done in patients who received at least one cycle of docetaxel therapy. RESULTS: Grade 3/4 toxicity occurred in 15.6% of DV patients and in 28.6% DE patients. Neither arm exceeded the threshold of clinically significant toxicity. In the DV arm, objective response rate was 33%, prostate-specific antigen response rate was 20%, and median survival was 16.2 months. In the DE arm, objective response rate was 67%, prostate-specific antigen response rate was 43%, and median survival was 19.7 months. Pharmacogenetic analyses showed a significant association between survival beyond 15 months and the ABCG2 421 C > A (Q141K) polymorphism compared with the wild-type (C/C) genotype (66% versus 27%; P = 0.05). CONCLUSIONS: DV and DE doublets are active with a tolerable toxicity profile in patients with HRPC; however, efficacy does not seem superior to standard single-agent docetaxel. The ABCG2 421 C > A (Q141K) polymorphism may be an important predictor of response and survival in HRPC patients treated with docetaxel-based chemotherapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 Conclusions: DV and DE doublets are active with a tolerable toxicity profile in patients with HRPC; however, efficacy does not seem superior to standard single-agent docetaxel.The ABCG2 421C>A (Q141K) polymorphism may be an important predictor of response and survival in HRPC patients treated with docetaxel-based chemotherapy. Login to comment
121 In this pilot analysis, it was noted that 4 of 6 (66%) patients with the ABCG2 421 C>A (Q141K) polymorphism were alive past 15 months compared with only 12 of 44 (27%) patients with wild-type (C/C; P = 0.05). Login to comment

[hide] Involvement of breast cancer resistance protein (B... Drug Metab Dispos. 2007 Feb;35(2):209-14. Epub 2006 Nov 8. Enokizono J, Kusuhara H, Sugiyama Y
Involvement of breast cancer resistance protein (BCRP/ABCG2) in the biliary excretion and intestinal efflux of troglitazone sulfate, the major metabolite of troglitazone with a cholestatic effect.
Drug Metab Dispos. 2007 Feb;35(2):209-14. Epub 2006 Nov 8., [PMID:17093005]

Abstract [show]
Troglitazone sulfate (TGZS) is the major metabolite of troglitazone (TGZ), an antidiabetic agent, and thought to be a cause of the cholestasis induced by TGZ. The aim of the present study is to elucidate the involvement of breast cancer resistance protein (BCRP/ABCG2) in the hepatic disposition of TGZS. The basal-to-apical transport of TGZS was enhanced in organic anion transporting polypeptide 1B1-expressing Madin-Darby canine kidney II cells by infection of recombinant adenovirus harboring human BCRP and mouse Bcrp cDNA. TGZS was given to wild-type and Bcrp (-/-) mice by constant infusion. Biliary excretion is the predominant elimination pathway of TGZS in wild-type mice, and the biliary excretion clearance of TGZS with regard to the hepatic concentration was reduced to 30% of the control in Bcrp (-/-) mice. However, plasma and hepatic concentrations were unchanged, suggesting induction of compensatory mechanisms in Bcrp (-/-) mice for the elimination of TGZS. Involvement of BCRP in the intestinal efflux transport of TGZS was examined using everted sacs. The mucosal efflux clearan