ABCMdb

PMID: 19032367

Kim IS, Kim HG, Kim DC, Eom HS, Kong SY, Shin HJ, Hwang SH, Lee EY, Lee GW
ABCG2 Q141K polymorphism is associated with chemotherapy-induced diarrhea in patients with diffuse large B-cell lymphoma who received frontline rituximab plus cyclophosphamide/doxorubicin/vincristine/prednisone chemotherapy.
Cancer Sci. 2008 Dec;99(12):2496-501. Epub 2008 Nov 20., [PubMed]

Sentences

No. Mutations Sentence Comment

1 ABCG2 p.Gln141Lys 12 | 2496-2501 doi: 10.1111/j.1349-7006.2008.00985.x (c) 2008 Japanese Cancer Association Blackwell Publishing Asia ABCG2 Q141K polymorphism is associated with chemotherapy-induced diarrhea in patients with diffuse large B-cell lymphoma who received frontline rituximab plus cyclophosphamide/doxorubicin/ vincristine/prednisone chemotherapy In-Suk Kim,1,8 Hoon-Gu Kim,2,8 Dong Chul Kim,3 Hyeon-Seok Eom,4 Sun-Young Kong,5 Ho-Jin Shin,6 Sang-Hyun Hwang,7 Eun-Yup Lee7 and Gyeong-Won Lee2,9 1 Department of Laboratory Medicine; 2 Division of Hematology-Oncology, Department of Internal Medicine and 3 Department of Pathology, Gyeongsang National University Hospital, 90 Chilam-dong, Jinju 660-702; 4 Division of Hematology-Oncology, Department of Internal Medicine and 5 Department of Laboratory Medicine, Research Institute and Hospital, National Center, 809 Madu-dong, Ilsan-gu, Goyang-si, Gyeonggi-do 410-769; 6 Division of Hematology-Oncology, Department of Internal Medicine, and 7 Department of Laboratory Medicine, School of Medicine Pusan National University, 1-ga 10, Ami-dong, Seo-gu, Busan 602-739, Korea (Received June 27, 2008/Revised July 30, 2008; August 12, 2008/Accepted August 14, 2008/Online publication November 20, 2008) ATP-binding cassette transporter G2 (ABCG2) is the most recently described transporter of the multidrug-resistance pump and it promotes resistance to anticancer drugs such as doxorubicin, mitoxantrone, topotecan, and SN-38. Login to comment 2 ABCG2 p.Gln141Lys ABCG2 p.Val12Met Of the ABCG2 polymorphisms, V12M and Q141K alter the functional activity of the ABCG2 transporter and influence the drug response and various toxicities to chemotherapeutic agents. Login to comment 3 ABCG2 p.Gln141Lys ABCG2 p.Val12Met We therefore evaluated the impact of the ABCG2 V12M and Q141K polymorphisms on the therapeutic outcomes and toxicities of primary rituximab plus cyclophosphamide/doxorubicin/vincristine/prednisone (R-CHOP) therapy in 145 Korean patients with diffuse large B-cell lymphoma (DLBCL). Login to comment 4 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 V12M and Q141K genotyping was carried out by pyrosequencing of polymerase chain reaction products. Login to comment 5 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Val12Met The clinical characteristics, treatment outcomes, toxicities of the patients, and the predictive value of the polymorphisms on response, survival, and adverse events to R-CHOP for 145 patients were analyzed according to the ABCG2 V12M and Q141K polymorphisms. No differences were observed according to ABCG2 Q141K and V12M genotype in patient characteristics, disease characteristics, response, survival, or hematology toxicity profiles in patients with DLBCL who received frontline R-CHOP chemotherapy. Login to comment 6 ABCG2 p.Gln141Lys On multivariate analysis, grade I-IV diarrhea was statistically significant according to ABCG2 Q141K polymorphism (the QQ genotype vs the QK or KK genotypes; hazard ratio 2.835; 95% confidence interval 1.432-5.613; P = 0.003). Login to comment 7 ABCG2 p.Gln141Lys This study demonstrates that the ABCG2 Q141K polymorphism may correlate with chemotherapy-induced diarrhea in patients with DLBCL who have received frontline R-CHOP chemotherapy, and this has implications for optimizing treatment with such agents. Login to comment 15 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Val12Met (7-11) In particular, two non-synonymous polymorphisms, c.34G>A (p.Val12Met, V12M) and c.421C>A (p.Gln141Lys, Q141K), have been detected at relatively high frequencies in most ethnic groups, including Asians, Caucasians, and Africans. Login to comment 17 ABCG2 p.Gln141Lys ABCG2 p.Val12Met (15) A recently published study found that the ABCG2 V12M and Q141K polymorphisms are associated with susceptibility to and survival from DLBCL. Login to comment 18 ABCG2 p.Gln141Lys ABCG2 p.Val12Met (16) In the present study, we evaluated the impact of the ABCG2 Q141K and V12M polymorphisms on the therapeutic outcomes and adverse reactions of primary R-CHOP therapy in 145 patients with DLBCL, including treatment response, overall survival (OS) and event-free survival (EFS), hematological toxicities, and non-hematological toxicities. Login to comment 35 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Val12Met ABCG2 Q141K and V12M genotyping was carried out by pyrosequencing of the polymerase chain reaction (PCR) products from the ABCG2 gene to determine the presence of the Q141K and V12M polymorphisms. Login to comment 39 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Val12Met Patient characteristics and treatment outcomes according to the ABCG2 Q141K and V12M polymorphisms ABCG2 Q141K P-value ABCG2 V12M P-value QQ QK KK VV VM MM No. patients (%) 67 (46.2%) 69 (47.6%) 9 (6.2%) 71 (49.0%) 63 (43.4%) 11 (7.6%) Sex (no. Login to comment 43 ABCG2 p.Gln141Lys ABCG2 p.Val12Met Sequences and information of primers used for pyrosequencing Name Primer sequence (5' to 3') Size (bp) Polymerase chain reaction (Tm; °C) ABCG2 V12M F: CTCTCCAGATGTCTTCCAGTAATG 110 59 R: Biotin-TCCTTCAGTAAATGCCTTCAGGT S: TCGAAGTTTTTATCCCA ABCG2 Q141K F: Biotin-ACTGCAGGTTCATCATTAGCTAGA 238 60 R: CCGTTCGTTTTTTTCATGATTC S: CGAAGAGCTGCTGAGAA F, forward; R, reverse; S, sequencing; Tm, melting temperature. Login to comment 55 ABCG2 p.Gln141Lys ABCG2 p.Val12Met The primary objective of the current study was to correlate the ABCG2 Q141K and V12M polymorphisms with the response and survival outcomes, including OS and EFS to R-CHOP therapy. Login to comment 56 ABCG2 p.Gln141Lys ABCG2 p.Val12Met The secondary objectives were to correlate the ABCG2 Q141K and V12M polymorphisms with the hematological and non- hemtological toxicities of R-CHOP therapy. Login to comment 57 ABCG2 p.Gln141Lys ABCG2 p.Val12Met The clinical characteristics, treatment outcomes, and toxicities of the patients were compared using χ2 -tests, Fisher`s exact tests, or Mann-Whitney U-tests according to the ABCG2 Q141K and V12M polymorphisms. Login to comment 58 ABCG2 p.Gln141Lys ABCG2 p.Val12Met Logistic regression analysis was conducted to determine the predictive value of the polymorphisms on response and adverse reaction to R-CHOP for the 145 patients who had available both the ABCG2 Q141K and V12M polymorphism data. Login to comment 59 ABCG2 p.Gln141Lys ABCG2 p.Val12Met The variables included stage (stages 1 and 2 vs 3 and 4), IPI score (0-2 vs 3-5), age (<60 vs ≥60 years), performance status (Eastern Cooperative Oncology Group [ECOG] 0 and 1 vs ≥2), lactate dehydrogenase level (normal vs beyond normal range), extranodal involvement (≤1 vs ≥2 sites), B symptoms (absence vs presence), hematological toxicity (grade 0-II vs III-IV or grade 0 vs grade I-IV), non-hematological toxicity (grade 0-II vs III-IV or grade 0 vs grade I-IV), and ABCG2 Q141K (QQ, QK, and KK) and ABCG2 V12M (VV, VM, and MM) genotypes. Login to comment 66 ABCG2 p.Gln141Lys ABCG2 p.Val12Met Results Frequency of ABCG2 Q141K and V12M polymorphisms. Login to comment 67 ABCG2 p.Gln141Lys In the frontline R-CHOP therapy group, the distribution of the QQ, QK, and KK genotypes of the ABCG2 Q141K polymorphism was 46.2, 47.6, and 6.2%, respectively (Table 1). Login to comment 68 ABCG2 p.Val12Met The distribution of the VV, VM, and MM genotypes of the ABCG2 V12M polymorphism was 49.0, 43.4, and 7.6%, respectively (Table 1). Login to comment 70 ABCG2 p.Gln141Lys ABCG2 p.Val12Met Patient characteristics according to the ABCG2 Q141K and V12M polymorphisms. Login to comment 72 ABCG2 p.Gln141Lys ABCG2 p.Val12Met In brief, no differences in the patient and disease characteristics were observed according to the ABCG2 Q141K and V12M polymorphisms. Login to comment 73 ABCG2 p.Gln141Lys ABCG2 p.Val12Met Response to frontline R-CHOP therapy according to the ABCG2 Q141K and V12M polymorphisms. Login to comment 75 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Val12Met As shown in Table 1, no significant difference in the response rate or the ORR was observed according to the ABCG2 Q141K and V12M polymorphisms. No statistically significant difference in the response rate or ORR was observed according to the ABCG2 Q141K and V12M polymorphisms. Login to comment 76 ABCG2 p.Gln141Lys ABCG2 p.Val12Met Survival analysis according to the ABCG2 Q141K and V12M polymorphisms. Login to comment 79 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Val12Met When comparing OS and EFS according to the ABCG2 Q141K and V12M polymorphisms, neither the Q141K nor V12M polymorphisms had any impact on OS or EFS (Fig. 1). Login to comment 80 ABCG2 p.Gln141Lys ABCG2 p.Val12Met Side effects according to the ABCG2 Q141K and V12M polymorphisms. Login to comment 82 ABCG2 p.Gln141Lys ABCG2 p.Val12Met No significant differences of such hematological toxicities as anemia, leukocytopenia, neutropenia, and thrombocytopenia were observed according to the ABCG2 Q141K and V12M alleles. Login to comment 83 ABCG2 p.Gln141Lys Among the severe non-hematological side effects (grade III-IV), fever, mucositis, infection, and diarrhea were observed more frequently in the patients with the non-QQ alleles of the ABCG Q141K polymorphisms. Login to comment 84 ABCG2 p.Gln141Lys Of them, fever and infection were statistically significant according to the ABCG2 Q141K polymorphism (QQ vs QK or KK genotype; P = 0.037 and 0.046, respectively). Login to comment 85 ABCG2 p.Gln141Lys When considering the presence of toxicity (grade I-IV), regardless of severity, differences for fever (P = 0.007) and diarrhea (P = 0.002) in the non-hematological toxicity profiles were noted and these were statistically significant according to the ABCG2 Q141K polymorphism (Table 4). Login to comment 86 ABCG2 p.Gln141Lys On multivariate analysis, grade I-IV diarrhea was the statistically significant factor according to the ABCG2 Q141K polymorphism (HR 2.835; 95% CI 1.432-5.613; P = 0.003). Login to comment 87 ABCG2 p.Gln141Lys ABCG2 p.Val12Met Discussion Among several naturally occurring ABCG2 polymorphisms, V12M in exon 2 and Q141K in exon 5 occur in most racial groups, but they occur with a higher allellic frequency in Asians. Login to comment 88 ABCG2 p.Gln141Lys ABCG2 p.Val12Met In the present study, the frequencies of two polymorphisms, V12M and Q141K, were 0.293 and 0.300, respectively, and these values were comparable to those reported in the literature for Asians (0.230-0.241 and 0.150-0.360, respectively). Login to comment 89 ABCG2 p.Gln141Lys (8,10,16,19-21) When the frequencies of the present study were compared with those reported in the literature for Asian populations, the frequencies of Q141K in these Korean DLBCL patients and the Asian healthy controls, including Korean, Chinese, and Malaysian, were statistically insignificant using the χ2 -test (Table 5). Login to comment 90 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys (8,10,16,19) Unlike a previous study that reported that ABCG2 Q141K is a candidate susceptibility gene in Chinese DLBCL patients,(16) our findings suggest the ABCG2 Q141K polymorphism may not be associated with an increased risk of DLBCL in Koreans. Login to comment 91 ABCG2 p.Val12Met ABCG2 p.Val12Met However, the allele frequency of ABCG2 V12M in the present study was higher than that of the Korean healthy controls, and the association between ABCG2 V12M and disease susceptibility should be further investigated (Table 5). Login to comment 92 ABCG2 p.Gln141Lys ABCG2 p.Val12Met The present study demonstrated that the ABCG2 Q141K and V12M polymorphisms were not predictive of the response, OS, or EFS to R-CHOP chemotherapy in patients with DLBCL. Login to comment 93 ABCG2 p.Gln141Lys ABCG2 p.Val12Met No association of the ABCG2 Q141K and V12M polymorphisms with response and survival was noted in the present study for the following reasons: (1) the relatively small number of patients; (2) the relatively short period of follow up may not have been enough to see a significant difference in survival; and (3) other unknown chemoresistance mechanisms are probably important in the mechanism of R-CHOP action, and this would be expected to affect the response and survival of DLBCL patients. Login to comment 95 ABCG2 p.Gln141Lys Several groups have reported that the Q141K genotype is associated with altered pharmacokinetic parameters of some ABCG2 substrates. Login to comment 96 ABCG2 p.Gln141Lys (8,15,22) Notably, the Q141K genotype has the signature of recent positive selection and it is the strongest in the Asian population,(23) suggesting that there is some advantageous property for this genotype. Login to comment 97 ABCG2 p.Gln141Lys The Q141K polymorphism has been associated with lower expression and activity of ABCG2 and with higher accumulation of ABCG2 substrates. Login to comment 98 ABCG2 p.Gln141Lys (24) On univariate analysis, the present study showed statistically significant results for non-hematological toxicity such as grade I-IV diarrhea, grade I-IV fever, grade III-IV fever, and grade III-IV infection, according to ABCG2 Q141K polymorphism (QQ genotype vs non-QQ genotype, P = 0.002, 0.007, 0.037, and 0.046, respectively). Login to comment 99 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys On multivariate analysis, the present study demonstrated that the ABCG2 Q141K polymorphism was associated with grade I-IV diarrhea (P = 0.003), just like a previous report for which the ABCG2 Q141K polymorphism was associated with diarrhea in gefitinib-treated patients with non-small cell cancer. Login to comment 101 ABCG2 p.Gln141Lys Survival curve after frontline rituximab plus cyclophosphamide-doxorubicin-vincristine-prednisone (R-CHOP) therapy according to the ABCG2 Q141K genotype. Login to comment 103 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Val12Met Hematological and non-hematological toxicity outcomes according to the ABCG2 Q141K and V12M polymorphisms (grade 0-II vs grade III-IV) ABCG2 Q141K P-value ABCG2 V12M P-value QQ QK or KK VV VM or MM No. patients (%) 67 (46.2%) 78 (53.8%) 71 (49.0%) 74 (51.0%) Grade III-IV, n (%) Anemia 9 (13.4%) 9 (11.5%) 0.730 10 (14.1%) 8 (10.8%) 0.550 Leukocytopenia 29 (43.3%) 32 (41.0%) 0.784 33 (46.5%) 28 (37.8%) 0.292 Neutropenia 38 (56.7%) 39 (50.0%) 0.419 38 (53.5%) 39 (52.7%) 0.921 Thrombocytopenia 4 (6.0%) 11 (14.1%) 0.109 9 (12.7%) 6 (8.1%) 0.367 Grade III-IV, n (%) Fever 8 (11.9%) 20 (25.6%) 0.037 16 (22.5%) 12 (16.2%) 0.335 Mucostis 11 (16.4%) 22 (28.2%) 0.091 19 (26.8%) 14 (18.9%) 0.260 Infection 9 (13.4%) 21 (27.5%) 0.046 13 (18.3%) 17 (23.0%) 0.488 Nausea and vomiting 2 (3.0%) 5 (6.4%) 0.337 3 (4.2%) 4 (5.4%) 0.740 Diarrhea 2 (3.0%) 9 (11.5%) 0.052 4 (5.6%) 7 (9.5%) 0.384 Alopecia 27 (40.3%) 38 (48.7%) 0.309 32 (45.1%) 33 (44.6%) 0.954 Neurotoxicity 2 (3.0%) 4 (5.1%) 0.518 3 (4.2%) 3 (4.1%) 0.959 Bold and italic values significant at P < 0.05. Login to comment 105 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys Non-hematological toxicity outcomes according to ABCG2 Q141K genotype (grade 0 vs grade I-IV) ABCG2 Q141K P-value QQ QK or KK No. patients, n (%) 67 (46.2%) 78 (53.8%) Grade I-IV, n (%) Fever 18 (26.9%) 38 (48.7%) 0.007 Mucositis 43 (64.2%) 50 (64.1%) 0.992 Infection 24 (35.8%) 40 (51.3%) 0.062 Diarrhea 21 (31.3%) 44 (56.4%) 0.002 Bold and italic values significant at P < 0.05. is one of the most common side effects of chemotherapy. Login to comment 110 ABCG2 p.Gln141Lys Therefore, the present study demonstrates the necessity of study for determining the association between ABCG2 Q141K polymorphism and adverse reactions to chemotherapy. Login to comment 114 ABCG2 p.Gln141Lys The mechanism underlying the functional impact of the ABCG2 Q141K amino acid change is not entirely known, but it is most likely associated with reduced protein levels and altered ATPase activity. Login to comment 115 ABCG2 p.Gln141Lys (15) The association we observed between ABCG2 Q141K genotype status and observed clinical adverse reactions such as diarrhea, infection, and fever may reflect a role for this transporter in the metabolism and elimination pathways of R-CHOP, especially doxorubicin. Login to comment 116 ABCG2 p.Gln141Lys In summary, the present study demonstrates that the ABCG2 Q141K polymorphism is associated with chemotherapy-induced diarrhea in patients with DLBCL who have received frontline R-CHOP chemotherapy. Login to comment