ABCMdb

PMID: 24857923

Zhou D, Liu Y, Zhang X, Gu X, Wang H, Luo X, Zhang J, Zou H, Guan M
Functional polymorphisms of the ABCG2 gene are associated with gout disease in the Chinese Han male population.
Int J Mol Sci. 2014 May 22;15(5):9149-59. doi: 10.3390/ijms15059149., [PubMed]

Sentences

No. Mutations Sentence Comment

5 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Gln126* High-resolution melting analysis and Sanger sequencing were performed to identify the genetic polymorphisms V12M, Q141K and Q126X in the ABCG2 gene. Login to comment 7 ABCG2 p.Gln141Lys ABCG2 p.Gln126* A prediction model for gout risk using ABCG2 protein function was established based on the genotype combination of Q126X and Q141K. Login to comment 8 ABCG2 p.Gln141Lys Results: For Q141K, the A allele OPEN ACCESS frequency was 49.6% in the gout patients and 30.9% in the controls (OR 2.20, 95% confidence interval (CI): 1.77-2.74, p = 8.99 &#d7; 10-13 ). Login to comment 9 ABCG2 p.Gln126* Regarding Q126X, the T allele frequency was 4.7% in the gout patients and 1.7% in the controls (OR 2.91, 95% CI: 1.49-5.68, p = 1.57 &#d7; 10-3 ). Login to comment 10 ABCG2 p.Val12Met The A allele frequency for V12M was lower (18.3%) in the gout patients than in the controls (29%) (OR 0.55, 95% CI 0.43-0.71, p = 2.55 &#d7; 10-6 ). Login to comment 11 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Gln126* In the order of V12M, Q126X and Q141K, the GCA and GTC haplotypes indicated increased disease risk (OR = 2.30 and 2.71, respectively). Login to comment 33 ABCG2 p.Gln141Lys ABCG2 p.Gln126* Furthermore, the SNPs Q141K and Q126X in the human ABCG2 gene have recently been recognized as clinical biomarkers to assess hyperuricemia and gout. Login to comment 37 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Gln126* In the present study, we developed an HRM assay to detect three functional SNPs (Q141K, V12M and Q126X) and then assessed the genetic association of those SNPs in the ABCG2 gene with gout to investigate the association between ABCG2 dysfunction and gout risk in a Han Chinese male population. Login to comment 42 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Gln126* The results obtained from the DNA sequencing analysis confirmed the reliability of the HRM assay. The genotype and allelic frequencies of the three SNPs (Q141K, V12M and Q126X) among the cases and controls were in Hardy-Weinberg equilibrium for all of the polymorphisms analyzed. Login to comment 43 ABCG2 p.Gln141Lys For Q141K, the A allele was found on 49.6% of the chromosomes from the gout patients compared with 30.9% of the chromosomes from the controls (OR 2.20, 95% CI: 1.77-2.74, p = 8.99 &#d7; 10-13 ). Login to comment 44 ABCG2 p.Gln126* Regarding Q126X, the T allele was found on 4.7% of the chromosomes from the gout patients compared with 1.7% of the chromosomes from the controls (OR 2.91, 95% CI: 1.49-5.68, p = 1.57 &#d7; 10-3 ). Login to comment 45 ABCG2 p.Val12Met The results of the association study, shown in Table 1, demonstrate that 141K and 126X were significantly associated with an increased risk of gout, whereas the frequency of the A allele of V12M appeared to be significantly decreased in gout patients (18.3%) compared with controls (29%) (OR 0.55, 95% CI: 0.43-0.71). Login to comment 48 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Gln126* The three groups are well distinguished: (A) V12M; (B) Q126X; and (C) Q141K. Login to comment 54 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Gln126* SNP Genotype * Allele Frequency Mode Case Control p-Value p-Value OR 95% CI 1/1 1/2 2/2 MAF 1/1 1/2 2/2 MAF Q141K 84 181 87 0.496 33 150 167 0.309 1.18 &#d7; 10-11 8.99 &#d7; 10-13 2.20 1.77-2.74 Q126X 0 33 319 0.047 0 12 338 0.017 1.31 &#d7; 10-3 1.57 &#d7; 10-3 2.91 1.49-5.68 V12M 16 97 239 0.183 35 133 182 0.290 3.67 &#d7; 10-5 2.55 &#d7; 10-6 0.55 0.43-0.71 * The minor allele was referred to as allele 1, and the major allele was referred to as allele 2. Login to comment 55 ABCG2 p.Gln141Lys ABCG2 p.Gln126* Allele 1 is A and allele 2 is C in Q141K. Allele 1 is T and allele 2 is C in Q126X. Login to comment 56 ABCG2 p.Val12Met Allele 1 is A and allele 2 is G in V12M. Login to comment 58 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Gln126* Haplotype Analysis We performed a 3-SNP haplotype analysis (in the order V12M, Q126X and Q141K). Login to comment 63 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Val12Met ABCG2 p.Gln126* ABCG2 p.Gln126* Haplotype frequency analysis of V12M, Q126X and Q141K. Allele Frequency p-Value OR 95% CI V12M Q126X Q141K Gout Control G C A 0.481 0.289 1.26 &#d7; 10-13 2.30 1.84-2.87 G T C 0.044 0.017 2.97 &#d7; 10-3 2.71 1.37-5.36 G C C 0.292 0.404 8.27 &#d7; 10-6 0.60 0.48-0.75 A C C 0.165 0.271 1.53 &#d7; 10-6 0.53 0.41-0.69 2.3. Login to comment 74 ABCG2 p.Gln141Lys ABCG2 p.Gln126* Estimated Function Genotype Combination Number (%) p-Value OR 95% CI Q141K Q126X Gout Control ࣘ1/4 function C/A T/C 22 (6.2) 8 (2.3) 8.47 &#d7; 10-6 5.90 2.56-13.58 1/2 function C/C T/C 95 (27.0) 37 (10.5) 1.12 &#d7; 10-13 5.51 3.46-8.77 A/A C/C 3/4 function C/A C/C 159 (45.2) 142 (40.6) 1.00 &#d7; 10-6 2.40 1.69-3.42 Full function C/C C/C 76 (21.6) 163 (46.6) ߟ ߟ p-Value, OR and 95% CI for each ABCG2 dysfunction were obtained via comparisons with full function. Login to comment 76 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Gln126* Discussion This study is the first to examine the possible role of ABCG2 variants, which have previously been found to be associated with gout, in terms of their genetic susceptibility to gout in the Han Chinese population. We found that the Q141K, Q126X and V12M alleles were strongly associated with gout in Chinese males. Login to comment 86 ABCG2 p.Val12Met Consistent with the genetic susceptibility identified in gout patients in a cohort of Japanese individuals [18], we observed that the rare alleles of both the 141K and 126X SNPs of ABCG2 were associated with an increased risk for gout, whereas the minor A allele in V12M had a protective effect on susceptibility to gout. Login to comment 87 ABCG2 p.Gln141Lys The Q141K SNP has been extensively studied; it has been found to impair protein-nucleotide binding stability [28], which has been linked to hyperuricemia in a variety of populations [29]. Login to comment 91 ABCG2 p.Gln126* The other nonfunctional variant, Q126X, is consistently observed in certain Japanese and Korean cohorts [18,32]. Login to comment 93 ABCG2 p.Gln141Lys ABCG2 p.Gln126* These findings reflect the diversity of the Q126X and Q141K distributions in different ethnic populations, which may explain the different prevalence of gout in Chinese and Caucasian populations. Login to comment 94 ABCG2 p.Gln126* Among the 352 patients with gout, Q126X heterozygous (n = 33) mutations were found that revealed that non-functional 126X dramatically increased gout risk (OR 2.91). Login to comment 96 ABCG2 p.Gln141Lys ABCG2 p.Gln126* Matsuo et al. [16,18] reported that the genotype combination of Q126X and Q141K is a clinically important biomarker for predicting gout risk in the Japanese population. We analyzed the relationship between ABCG2 transport dysfunction and gout and found that dysfunctional ABCG2 is responsible for approximately 78.4% of gout cases. Login to comment 115 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Gln126* We selected three functional ABCG2 SNPs: V12M, Q126X and Q141K. Login to comment 124 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Gln126* SNP ID SNP Allele Sequence (5'-3') Size V12M A/G ATGGTATGGGCCATTCATTG 250 bp ATGCCTTCAGGTCATTGGAA Q141K A/C ATGTTGTGATGGGCACTCTG 158 bp CCACATTACCTTGGAGTCTG Q126X C/T GCTGCAAGGAAAGATCCAAG 163 bp CAGCCAAAGCACTTACCCAT 4.3. Login to comment 137 ABCG2 p.Gln141Lys ABCG2 p.Gln126* The recent findings on the roles of the ABCG2 Q141K and Q126X polymorphism in gout may pave the way for pharmacological chaperones targeting ABCG2 as a potential new therapeutic target for gout. Login to comment