ABCMdb

PMID: 17237154

Lee SS, Jeong HE, Yi JM, Jung HJ, Jang JE, Kim EY, Lee SJ, Shin JG
Identification and functional assessment of BCRP polymorphisms in a Korean population.
Drug Metab Dispos. 2007 Apr;35(4):623-32. Epub 2007 Jan 19., [PubMed]

Sentences

No. Mutations Sentence Comment

3 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Pro269Ser BCRP V12M, Q141K, P269S, and Q126Stop were detected at frequencies of 23, 28, 0.2, and 1.9%, respectively. These four coding variants were also screened in Chinese and Vietnamese subjects; the allelic frequencies among the three populations were compared; and predictions were made as to the potential frequency of each variant. Login to comment 4 ABCG2 p.Pro269Ser In vitro functional analyses of the P269S protein and the promoter SNP -19031C>T (mutated in the hypoxia-inducible factor-1␣ binding site) were performed and compared with those of the wild type. Login to comment 5 ABCG2 p.Pro269Ser P269S exhibited a 35 to 40% decrease in vesicular uptake of [3 H]estrone-3-sulfate and [3 H]methotrexate compared with the wild type. Login to comment 7 ABCG2 p.Pro269Ser Our results suggest that the P269S variant could be a functionally altered variant. Login to comment 23 ABCG2 p.Gln141Lys ABCG2 p.Val12Met According to the current literature, the most frequent BCRP polymorphisms detected among different ethnic groups are 34GϾA, which codes for V12M, and 421CϾA, which codes for Q141K (Zamber et al., 2003). Login to comment 24 ABCG2 p.Gln141Lys The BCRP Q141K SNP has been associated with decreased expression of the BCRP protein in that this genotype produces a reduced transporter activity phenotype (Imai et al., 2002; Kondo et al., 2004). Login to comment 25 ABCG2 p.Val12Met The BCRP V12M SNP has been reported as having similar activity to the wild type in terms of dehydroepiandro- This study was supported by the Ministry of Science and Technology (National Research Laboratory Program) and Korea Health 21 R&D Project, Ministry of Health and Welfare, Korea (03-PJ10-PG13-GD01-0002). Login to comment 31 ABCG2 p.Val12Met However, Mizuarai et al. (2004) have shown disrupted membrane localization of the V12M variant, which results in decreased transport activity. Login to comment 33 ABCG2 p.Pro269Ser Therefore, we investigated, for the first time, genetic polymorphisms of the BCRP gene in a Korean population and performed in vitro functional characterization of a novel regulatory SNP and a coding SNP (P269S). Login to comment 34 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Pro269Ser ABCG2 p.Pro269Ser The functional capability of the P269S variant to take up [3 H]estrone-3-sulfate (ES) and [3 H]MTX has been reported as being comparable with that of the wild-type protein TABLE 1 Primer sequences used for the amplification of the BCRP gene fragment and the annealing temperatures used in the PCR Name Region Primer Sequence (5Ј33Ј) Size PCR Condition base pair Tm; °C BCRP1P Promoter F: AACCCAGCTAGGTCAGACGA 557 60.0 R: TTTGAGTGGGCACAGCAC BCRP2P Promoter F: TTCCTAGGGTAGATGCAGCAG 509 60.0 R: CAGGGACAAGCCAAACACTC BCRP3P Promoter F: GTAGAGGCAGGGTTTCACCA 559 60.0 R: AAGTGATTGCGCATGTTCAG BCRP4P Promoter F: CGTGCCTGGCCTCTATGTAT 572 60.0 R: CTGACGCAGGCAGATCACT BCRP5P Promoter F: GCCACCACACCCAGTGTAAT 518 64.7 R: TGCAAAGTAAAAACAAATCAAAACC BCRP1E Exon 1 F: AGCTCGTCCCCTGGATGT 516 54.0 R: CCACCAACCTTTCCAGACAC BCRP2E Exon 2 F: CTGCTCATTGCCACACATTT 400 54.0 R: GCCAAAACCTGTGAGGTTCA BCRP3E Exon 3 F: GTCTCAAACTCCTGGCCTCA 403 54.0 R: GCGTTGCAAATGCTCAATAA BCRP4E Exon 4 F: TGGATTCAAAGTAGCCATGAGA 402 54.0 R: ATTCTCCCTGCCTTTTCACA BCRP5E Exon 5 F: GGTTCATCATTAGCTAGAACTTTACC 403 54.0 R: TGGAAAGCAACCATTTTTGA BCRP6E Exon 6 F: TCTTACAGGACTGGCACACG 426 54.0 R: CCTTCCCTACATTCTTACCTGCT BCRP7E Exon 7 F: TCAGGCTGAACTAGAGCAAACA 387 60.0 R: AGCACCAAATGGAACAAACA BCRP8E Exon 8 F: CATGGGAAGAAGAGAGAAAGAAA 412 60.0 R: CAAAAACACCAACAGCACTCA BCRP9E Exon 9 F: GGTGTTAGGGAAGCATCCAA 413 54.0 R: TGAAGCAGATGATAACAGAACCA BCRP10E Exon 10 F: GCCAAGCCATTGAGTGTTTA 386 60.0 R: TGGGCAACAGAGCATGAC BCRP11E Exon 11 F: CCACAACAATCCAAGACTGTG 423 60.0 R: GTAATCCTCCGGATCCCATC BCRP12E Exon 12 F: GGTCTAGCCCTGAGGATGTG 403 64.7 R: GAGTGCAAAATGGACAGGTG BCRP13E Exon 13 F: AGGGTGGTTGGAGAGTGGAT 412 60.0 R: AGCAGAGCCCCATTTACAGA BCRP14E Exon 14 F: TGAGTGTCTTGAGTAAGTGGAGAGA 420 54.0 R: GACTCCCCAGCCTTGTGTTA BCRP15E Exon 15 F: TCTTGATTGCCAGGGAAAAT 404 60.0 R: CGCGCACAACTCACTTTATG BCRP16E Exon 16 F: TGACGGATGCTAGGAATGAA 430 64.7 R: CCCATGGTTACTGTCTGAGGA TABLE 2 Primer sequences used for the pyrosequencing-based genotyping of functional BCRP variants SNPa Variant Primer Sequence (5Ј33Ј) Size PCR Condition base pair Tm; °C 34GϾA V12M 5Ј-Biotin-CTCTCCAGATGTCTTCCAGTAATG-3Ј 278 54.0 5Ј-GCCAAAACCTGTGAGGTTCA-3Ј For sequencing: 5Ј-AGTGTTCCTTTGTGGTTAC-3Ј 8191CϾT Q126Stop 5Ј-Biotin-ACTATCAGCCAAAGCACTTACCC-3Ј 174 54.5 5Ј-GTCTTAGCTGCAAGGAAAGATCCA-3Ј For sequencing: 5Ј-AATGTAATTCAGGTTACGTG-3Ј 8825CϾA Q141K 5Ј-Biotin-GTTGCAAGCCGAAGAGCTG-3Ј 69 54.0 5Ј-TGATGTTGTGATGGGCACTC-3Ј For sequencing: 5Ј-GACGGTGAGAGAAAACTT-3Ј 21850CϾT P269S 5Ј-Biotin-TAGCACCAAATGGAACAAACAC-3Ј 236 54.0 5Ј- TGTTTGATAGCCTCACCTTATTGG-3Ј For sequencing: 5Ј-GAAGACTTATGTTCCACG-3Ј a Position is indicated with respect to the start codon (ATG) of the BCRP gene; the A in the ATG triplet is designated as ϩ1, and the next base toward the 5Ј-end is designated as -1. Login to comment 36 ABCG2 p.Pro269Ser However, in the present study, BCRP P269S from human blood samples (not from cell lines) was used for the first time. Login to comment 37 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Pro269Ser Functional information on P269S is sparse, as compared with the amount of information that has been collected for other coding variants, such as V12M, Q141K, and the null allele Q126Stop. Login to comment 38 ABCG2 p.Pro269Ser Because proline is known to be a helix breaker, the three-dimensional structure of the BCRP protein may be affected in the P269S variant. Login to comment 39 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Pro269Ser ABCG2 p.Pro269Ser Therefore, we performed a functional study of the P269S variant among the four variants identified in the study (V12M, Q141K, P269S, and Q126Stop). Login to comment 65 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Pro269Ser All the subjects were screened for BCRP V12M, Q126Stop, Q141K, and P269S. Login to comment 83 ABCG2 p.Pro269Ser ABCG2 p.Pro269Ser The BCRP R482-P269S and G482-P269S variants were generated by an overlap extension procedure using specific primers that introduced amino acid substitutions: 5Ј-AGGCCTCCT- GAGCAGACCCGTGGAACATAAG-3Ј and 5Ј-CTTATGTTCCACGGGTC- TGCTCAGGAGGCCT-3Ј. Login to comment 105 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Pro269Ser SNP and Positionb Position Relative to Transcription Start Site Location Effect N Allelic Frequency % 1 -20296AϾG -1379 Promoter 92 13 2 -19855CϾT -938 Promoter 92 0.5 3 -19605AϾG -688 Promoter 92 0.5 4 -19031CϾT -114 Promoter 92 1.6 5 -18631CϾT ϩ286 5ЈUTR 92 2.2 6 34GϾA Exon 2 V12M 275 23 7 238AϾG Intron 2 92 25 8 7430AϾG Intron 3 92 9.8 9 8191CϾT Exon 4 Q126Stop 375 1.9 10 8825CϾA Exon 5 Q141K 275 28 11 21850CϾT Exon 7 P269S 674 0.2 12 26297GϾA Exon 9 92 1.1 13 38485AϾG Intron 11 92 24 14 40086insA Intron 12 92 0.5 15 40110GϾT Intron 12 92 22 16 42288CϾT Intron 13 92 67.4 17 42313TϾG Intron 13 92 2.2 18 44072CϾT Intron 13 92 23.4 19 44997AϾG Intron 14 92 49.5 20 45235CϾT Intron 15 92 20.1 a The reference sequence used has GenBank accession no. Login to comment 149 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Pro269Ser The four coding SNP were 34GϾA coding for V12M, 8191CϾT coding for Q126Stop, 8825CϾA coding for Q141K, and 21850CϾT coding for P269S. Login to comment 150 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Pro269Ser For more extensive evaluation of the allelic frequencies of the four BCRP variants found in the Korean population, the remaining 183 subjects were screened by pyrosequencing for the presence of V12M, Q126Stop, Q141K, and P269S. Login to comment 152 ABCG2 p.Gln141Lys ABCG2 p.Val12Met V12M and Q141K were found in 23 and 28% of Koreans, respectively. Login to comment 153 ABCG2 p.Pro269Ser Q126Stop and P269S were found in 1.9 and 0.2% of Koreans, respectively. Login to comment 155 ABCG2 p.Gln166Glu ABCG2 p.Ser441Asn ABCG2 p.Ala149Pro ABCG2 p.Pro269Ser ABCG2 p.Arg163Lys Recently, Kondo et al. (2004) reported the identification of several BCRP variants, which include A149P, R163K, Q166E, P269S, and S441N, in human cell lines. Login to comment 156 ABCG2 p.Pro269Ser With the exception of the BCRP P269S variant, these variants were not observed in this study. Login to comment 163 ABCG2 p.Pro269Ser The BCRP haplotypes for 11 common SNP with frequencies Ͼ5% were analyzed )A( WT P269S Mock 0 05 001 051 002 052 003 053 [3 H]MTXuptake(pmol/min/mgprotein) TW S962P * [3 H]ESuptake(pmol/min/mgprotein) )B( )C( 0 52 05 57 001 521 TW S962P * FIG. 3. Login to comment 164 ABCG2 p.Pro269Ser In vitro functional characterization of the BCRP P269S variant. Login to comment 165 ABCG2 p.Pro269Ser A, vesicular uptake of [3 H]MTX in membranes obtained from Sf9 cells that express the wild-type BCRP protein or the BCRP P269S variant protein. Login to comment 167 ABCG2 p.Pro269Ser BCRP P269S exhibited significantly decreased activity compared with the wild type in a two-tailed Student`s t test; ‫,ء‬ p Ͻ 0.05. Login to comment 168 ABCG2 p.Pro269Ser B, vesicular uptake of [3 H]ES membranes obtained from Sf9 cells that express the wild-type BCRP protein or the BCRP P269S variant protein. Login to comment 175 ABCG2 p.Gln141Lys The most frequent allele was the wild type (26%), followed by the Q141K variant. Login to comment 176 ABCG2 p.Gln141Lys ABCG2 p.Val12Met The haplotype analysis suggests that none of the Q141K-containing haplotypes are linked to the V12M variant. Login to comment 177 ABCG2 p.Gln141Lys ABCG2 p.Val12Met To support this strong linkage, the V12M and Q141K variations were assigned to the same haplotype block among two discrete haplotype blocks of the BCRP gene (Fig. 1B). Login to comment 190 ABCG2 p.Pro269Ser Transporter Activity of the P269S Variant. Login to comment 191 ABCG2 p.Pro269Ser Two different comparisons of the wild-type and P269S variant proteins were performed. Login to comment 192 ABCG2 p.Pro269Ser Vesicular uptake of [3 H]MTX and [3 H]ES into the microsomal fraction was measured for the BCRP wild-type and P269S proteins expressed in Sf9 cells. Login to comment 193 ABCG2 p.Pro269Ser BCRP P269S-expressing microsomes showed about 35 to 40% decrease in [3 H]MTX and [3 H]ES uptake compared with microsomes that expressed the wild-type BCRP (Fig. 3, A and B). Login to comment 194 ABCG2 p.Pro269Ser The expression levels of the wild-type and P269S BCRP proteins were similar, as confirmed by immunoblotting (Fig. 3C). Login to comment 195 ABCG2 p.Pro269Ser ABCG2 p.Pro269Ser To investigate whether the decreased functionality of BCRP P269S was derived from the modulation of substrate-dependent ATPase activity, prazosin-induced ATPase activity was measured in the wild-type and P269S-expressing microsomes from Sf9 cells. Login to comment 197 ABCG2 p.Pro269Ser ABCG2 p.Pro269Ser The BCRP ATPase activity in the presence of prazosin of the P269S variant was also the same as that of the wild-type protein, which indicates that the decreased activity of P269S is not related to ATPase activity. Login to comment 200 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Pro269Ser From the screening of four nonsynonymous variants in other ethnic groups, the allelic frequencies of V12M, Q126Stop, Q141K, and P269S were obtained (Table 4). Login to comment 201 ABCG2 p.Gln141Lys ABCG2 p.Val12Met The frequency of V12M was 10 to 13% higher in Chinese and Vietnamese subjects than in Koreans, whereas Q141K showed no significant differences among the three Asian ethnic groups. Login to comment 203 ABCG2 p.Pro269Ser The P269S variant was not observed in 100 Caucasians and 100 African-Americans, which suggests that this variant is a rare variant that is found only in Asians. Login to comment 207 ABCG2 p.Gln141Lys For example, the BCRP Q141K variant has been implicated in the altered pharmacokinetics of diflomotecan (Sparreboom et al., 2004). Login to comment 209 ABCG2 p.Pro269Ser Prazosin-dependent ATPase activity of the BCRP P269S variant. Login to comment 210 ABCG2 p.Pro269Ser A, ATPase activities of Sf9 cells that express the wild-type BCRP protein or the BCRP P269S variant protein. Login to comment 219 ABCG2 p.Val12Met Among the BCRP coding variants, V12M and Q14lK were the most common in Koreans, with allelic frequencies of 23 and 28%, respectively. These variants are also found frequently in other ethnic groups, such as Caucasians, Japanese, and Chinese (Zamber et al., 2003; Kobayashi et al., 2005). Login to comment 220 ABCG2 p.Gln141Lys The Q141K variant was the most prevalent coding variant in Caucasians (14%), Japanese (35%), and Chinese (35%), as well as in Koreans (28%), whereas it was not detected in African-Americans or in subjects from Africa north of the Sahara (Zamber et al., 2003). Login to comment 221 ABCG2 p.Val12Met The allelic frequency of V12M in Koreans (23%) is much lower than that reported for Southeast Asians (45%), Pacific Islander (64%), Mexican-Indian (90%), and Hispanic (40%) subjects (Zamber et al., 2003). Login to comment 223 ABCG2 p.Pro269Ser P269S was observed exclusively in Koreans and Vietnamese and not in the Caucasian, African-American, and Chinese populations. Login to comment 230 ABCG2 p.Val12Met Haplotypes 4, 8, and 11 indicate that a single promoter SNP (20296AϾG) and the 238AϾG change accompany the V12M nonsynonymous change in Koreans (Table 3). Login to comment 231 ABCG2 p.Gln141Lys In haplotypes 2, 7, and 13, Q141K (8825CϾA) variation is accompanied by 42288CϾT and 44997AϾG. Login to comment 234 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Pro269Ser Our results on BCRP haplotypes in the Korean population TABLE 4 Haplotype distribution of BCRP gene in Koreans PNS 69202- G>A 43 A>G 832 G>A 0347 G>A 5288 A>C 58483 G>A 01104 T>G 88224 T>C 27044 T>C 79944 G>A 53254 T>C ycneuqerF )%( egnahcAA K141QM21V 4.621 2 9.91 3 8.7 4 6.7 5 4.7 6 9.5 7 7.4 8 9.2 9 5.2 01 8.1 11 7.1 21 4.1 31 1.1 Haplotype 41 1.1 TABLE 5 Expected allelic frequencies of BCRP V12M, Q126Stop, Q141K, and P269S variants in different Asian populations Population No. Login to comment 235 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Val12Met ABCG2 p.Pro269Ser ABCG2 p.Pro269Ser of Subjects Allelic Frequency (95% CI) V12M Q126Stop Q141K P269S % % % % Korean 275-674a 23 (19.6-26.6) 1.9 (0.9-2.9) 28 (23.8-31.2) 0.2 (0-0.4) Chinese 191 33b (28.5-37.9) 0.5 (0-1.2) 29 (24.3-33.3) 0 (0-0.1) Vietnamese 140 36b (30.8-42.0) 0.4 (0-1.1) 31 (25.7-36.5) 0.7 (0-1.7) a The numbers of subjects genotyped for the V12M, Q126Stop, Q141K, and P269S variants were 275, 375, 275, and 674, respectively. Login to comment 238 ABCG2 p.Gln141Lys In the case of BCRP, the 421CϾA variation (encodes Q141K) has been reported to play important roles in determining the expression level of the protein (Imai et al., 2002; Kobayashi et al., 2005), drug resistance, and ATPase activity (Mizuarai et al., 2004). Login to comment 239 ABCG2 p.Val12Met The V12M SNP has been reported to be associated with membrane localization (Mizuarai et al., 2004). Login to comment 250 ABCG2 p.Pro269Ser In the present study, we have described the allele frequencies for BCRP variants in a Korean population and analyzed the function of the P269S coding variant. Login to comment 251 ABCG2 p.Pro269Ser Kondo et al. (2004) have reported that the P269S variant has activity similar to that of the wild-type protein. Login to comment 252 ABCG2 p.Pro269Ser However, in at least three repeated experiments, we showed that P269S shows altered ES and MTX uptake as compared with the wild type. Login to comment 253 ABCG2 p.Pro269Ser Both the previous study and our current study show similar protein levels of P269S variant and wild-type protein expression in the systems used. Login to comment 257 ABCG2 p.Pro269Ser Therefore, the possibility that P269S variation may not change the BCRP activity in mammalian cells cannot be ruled out. Login to comment 259 ABCG2 p.Val12Met Similarly, BCRP V12M has been reported to exhibit the same transport function as the wild type (Kondo et al., 2004), whereas another study has shown decreased activity caused by disrupted membrane localization (Mizuarai et al., 2004). Login to comment