ABCMdb

PMID: 17228519

Tamura A, Wakabayashi K, Onishi Y, Nakagawa H, Tsuji M, Matsuda Y, Ishikawa T
Genetic polymorphisms of human ABC transporter ABCG2: development of the standard method for functional validation of SNPs by using the Flp recombinase system.
J Exp Ther Oncol. 2006;6(1):1-11., [PubMed]

Sentences

No. Mutations Sentence Comment

4 ABCG2 p.Phe208Ser ABCG2 p.Ser441Asn While mRNAs of those integrated ABCG2 variants and wild type were evenly expressed in Flp-In-293 cells, the protein expression levels of F208S and S441N variants were found to be markedly low. Login to comment 48 ABCG2 p.Arg482Thr ABCG2 p.Arg482Gly ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Phe208Ser ABCG2 p.Ser441Asn ABCG2 p.Phe489Leu ABCG2 p.Phe431Leu ABCG2 p.Ser248Pro Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 3 Plasma Membrane inside outside S S S homodimer A B CH2N COOH V12M Q141K F208S S248P F431L S441N F489L R482G R482T Acquired mutation Figure 1. Login to comment 51 ABCG2 p.Arg482Thr ABCG2 p.Arg482Gly The variants R482G and R482T are acquired mutations. Login to comment 67 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Phe208Ser ABCG2 p.Ser441Asn ABCG2 p.Phe489Leu ABCG2 p.Phe431Leu ABCG2 p.Ser248Pro PCR primers and conditions for site-directed mutagenesis to create variants of ABCG2 Variant Forward/Reverse Primer sequence (5` →→ 3`) Primer length % GC Tm (ºC) (F/R) primers (bases) V12M F CGAAGTTTTTATCCCAATGTCACAAGGAAACAC 33 39 55 R GTGTTTCCTTGTGACATTGGGATAAAAACTTCG Q141K F CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT 35 42 55 R AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG F208S F TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA 35 45 55 R TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P F TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT 35 40 55 R AAACAACTTGAAGATGGGATATCGAGGCTGATGAA F431L F AGCTGGGGTTCTCCTCTTCCTGACGACC 28 60 62 R GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N F AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC 34 47 59 R GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L F GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG 46 34 62 R CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC Sites of mutagenesis are indicated by underbars. Login to comment 104 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Val12Met ABCG2 p.Phe208Ser ABCG2 p.Phe208Ser ABCG2 p.Ser441Asn ABCG2 p.Ser441Asn ABCG2 p.Phe489Leu ABCG2 p.Phe489Leu ABCG2 p.Phe431Leu ABCG2 p.Phe431Leu ABCG2 p.Ser248Pro ABCG2 p.Ser248Pro Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 0 1 2 RelativemRNAlevel Mock WT V12M Q141K mRNA A ABCG2 GAPDH Mock WT F208S S248P F431L S441N F489L ABCG2 GAPDH 0 1 2 RelativemRNAlevel mRNA B GAPDH ABCG2 Mock WT F208S S248P F431L S441N F489L Protein 0 1 2 Relativeproteinlevel * * * C DProtein GAPDH ABCG2 0 1 2 Relativeproteinlevel * * Mock WT V12M Q141K Figure 3. mRNA and protein expression levels of ABCG2 WT and variants expressed in Flp-In-293 cells. Login to comment 114 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Phe208Ser ABCG2 p.Ser441Asn ABCG2 p.Phe489Leu ABCG2 p.Phe431Leu ABCG2 p.Ser248Pro Characterization of V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells The mRNA levels of ABCG2 and GAPDH were measured by quantitative PCR, and the ratios of ABCG2 variants vs. GAPDH were plotted. Login to comment 119 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Phe208Ser ABCG2 p.Ser441Asn ABCG2 p.Phe489Leu ABCG2 p.Phe431Leu ABCG2 p.Ser248Pro Figure 3 demonstrates mRNA and protein levels of ABCG2 WT and V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells. Login to comment 121 ABCG2 p.Gln141Lys ABCG2 p.Val12Met The Q141K variant of ABCG2 stably expressed in Flp-In-293 cells had a lower expression level than did the wild-type ABCG2 or the V12M variant (Fig. 3C). Login to comment 122 ABCG2 p.Phe208Ser ABCG2 p.Ser441Asn Interestingly, expression levels of the F208S and S441N variants were markedly low (Fig. 3D). Login to comment 123 ABCG2 p.Phe208Ser ABCG2 p.Ser441Asn The immunofluorescence images of Flp-In-293/ABCG2 (F208S) and Flp-In-293/ABCG2 (S441N) cells revealed that those variant proteins were not expressed in the plasma membrane (data not shown). Login to comment 124 ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Phe489Leu ABCG2 p.Phe431Leu ABCG2 p.Ser248Pro The other variants, i.e., V12M, Q141K, S248P, F431L, and F489L, were expressed in plasma membrane as was ABCG2 WT. Login to comment 126 ABCG2 p.Phe208Ser ABCG2 p.Phe208Ser In fact, when Flp-In-293/ABCG2 (F208S) cells were treated with MG132, a proteasome inhibitor, the protein level recovered up to about 50% of the WT level, suggesting the involvement of proteasomes in degradation of the F208S variant (data not shown). Login to comment 130 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys It is important to note that IC50 values of Q141K-expressing cells toward doxorubicin and daunorubicin were greater than that of WT-expressing cells, while Q141K-expressing cells were more sensitive to SN-38 and mitoxantron as compared with WT-expressing cells. Login to comment 132 ABCG2 p.Arg482Thr ABCG2 p.Arg482Gly ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Phe208Ser ABCG2 p.Ser441Asn ABCG2 p.Phe489Leu ABCG2 p.Phe431Leu ABCG2 p.Ser248Pro Figure 4 summarizes the characteristics of those Tamura et al. 8 Journal of Experimental Therapeutics and Oncology Vol. 6 2006 Class Class Class Class WT V12M Q141K F431L S248P F489L F208S S441N R482G R482T Protein expression + + + + + + - - + + SN-38 resistance + + + + + / - - - - + + MX resistance + + + + / - - - - - + + Doxorubicin resistance - - - - - - - - + + Daunorubicin resistance - - - - - - - - + + Figure 4. Login to comment 138 ABCG2 p.Gln141Lys ABCG2 p.Val12Met WT, V12M, and Q141K form one group where protein expression and resistance to SN-38 and mitoxantrone are positive, but contribution to doxorubicin- and daurorubicin-resistance are negative. Login to comment 139 ABCG2 p.Phe489Leu ABCG2 p.Phe431Leu ABCG2 p.Ser248Pro On the other hand, S248P, F431L, and F489L appear to form the second class, where those variant proteins are expressed at normal levels but exhibit different profiles of drug resistance. Login to comment 140 ABCG2 p.Phe208Ser ABCG2 p.Ser441Asn Both F208S and S441N belong to the third class where protein expression levels were extremely low (Fig. 3D). Login to comment 142 ABCG2 p.Arg482Thr ABCG2 p.Arg482Gly ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Val12Met ABCG2 p.Val12Met ABCG2 p.Val12Met ABCG2 p.Ile206Leu ABCG2 p.Asn590Tyr ABCG2 p.Gln166Glu ABCG2 p.Asp620Asn ABCG2 p.Asp620Asn ABCG2 p.Ser441Asn ABCG2 p.Ala149Pro ABCG2 p.Pro269Ser ABCG2 p.Arg163Lys Finally, the acquired mutants R482G and R482T form another group, which is characteristic Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 9 Table 3 Remarks mRNA Protein Author Ref Host cell Vector Expression SNP expression expression Imai et al. (15) PA317 pHaL-IRES-DHFR bicistronic Stable V12M Similar to WT Similar to WT - - retrovirus vector plasmid - Q141K Similar to WT Lower than WT Mizuarai et al. (18) LLC-PK1 pcDNA3.1(+) Stable V12M Similar to WT N.D. - - - - Q141K Similar to WT N.D. Morisaki et al. (25) HEK293 pcDNA3.1 Stable V12M Vary among clones Vary among clones - - - - Q141K Vary among clones Vary among clones - - - - D620N Vary among clones Vary among clones Kondo et al. (26) LLC-PK1/ pcDNA3.1/ Stable/ V12M N.D. Similar to WT - HEK293 Adenovirus Transient Q141K N.D. 30 - 40% of WT - - - - A149P N.D. Similar to WT - - - - R163K N.D. Similar to WT - - - - Q166E N.D. Similar to WT - - - - P269S N.D. Similar to WT - - - - S441N N.D. Lower than WT Vethanayagam (27) HEK293 pcDNA3.1/myc-His(-) Stable I206L N.D. Vary among clones et al. - - - - N590Y N.D. Vary among clones - - - - D620N N.D. Vary among clones N.D.: No data Table 2. Login to comment 143 ABCG2 p.Gln141Lys ABCG2 p.Gln141Lys ABCG2 p.Val12Met ABCG2 p.Val12Met ABCG2 p.Phe208Ser ABCG2 p.Phe208Ser ABCG2 p.Ser441Asn ABCG2 p.Ser441Asn ABCG2 p.Phe489Leu ABCG2 p.Phe489Leu ABCG2 p.Phe431Leu ABCG2 p.Phe431Leu ABCG2 p.Ser248Pro ABCG2 p.Ser248Pro Resistance profile (IC50 ) of ABCG2 Compounds IC50 (nM) Mock WT V12M Q141K F208S S248P F431L S441N F489L SN-38 1.0 ± 0.2 49.9 ± 6.0 51.1 ± 13.8 17.7 ± 0.9 0.7 ± 0.0 3.6 ± 0.4 12.1 ± 1.5 0.8 ± 0.0 3.9 ± 0.4 (49.9)* (51.1)* (17.7)* (0.7) (3.6) (12.1)* (0.8) (3.9) Mitoxantorone 7.0 ± 1.1 108.0 ± 4.9 94.0 ± 18.6 46.7 ± 12.7 5.1 ± 1.0 13.4 ± 1.3 15.2 ± 1.4 5.7 ± 0.8 12.1 ± 6.2 (15.4)* (13.4)* (6.7)* (0.7) (1.9) (2.2)* (0.8) (1.7) Doxorubicin 38.8 ± 3.8 105.2 ± 24.9 123.6 ± 35.3 156.8 ± 27.5 19.9 ± 8.7 23.7 ± 6.7 43.5 ± 6.1 39.4 ± 4.1 47.6 ± 3.1 (2.7) (3.2) (4.0) (0.5) (0.6) (1.1) (1.0) (1.2) Daounorubicin 13.0 ± 0.6 32.3 ± 6.5 58.2 ± 5.0 57.7 ± 4.1 14.1 ± 2.3 22.1 ± 4.2 15.9 ± 1.2 13.3 ± 1.1 23.6 ± 1.6 (2.5) (4.5) (4.4) (1.1) (1.7) (1.2) (1.0) (1.8) Etoposide 117.1 ± 16.0 210.2 ± 18.4 297.3 ± 58.5 233.9 ± 54.2 122.9 ± 17.6 137.7 ± 14.8 139.1 ± 12.3 154.3 ± 8.5 186.9 ± 10.1 (1.8) (2.5) (2.0) (1.0) (1.2) (1.2) (1.3) (1.6) Vincristine 1.8 ± 0.2 4.3 ± 0.3 7.1 ± 1.4 5.6 ± 1.6 0.6 ± 0.0 4.3 ± 0.9 1.8 ± 0.3 0.9 ± 0.1 3.0 ± 0.7 (2.4) (3.0) (3.1) (0.3) (2.4) (1.0) (0.5) (1.7) The drug resistance profiles of ABCG2 WT and variants were obtained by incubating Flp-In-293/ABCG2 WT, V12M, Q141K, F208S, S248P, F431L, S441N, or F489L cells in the presence of SN-38, mitoxantrone, doxorubicin, daunorubicin, etoposide, or vincristine at different concentrations as described in Materials and Methods. Login to comment