PMID: 24476385

Dalbeth N, House ME, Gamble GD, Pool B, Horne A, Purvis L, Stewart A, Merriman M, Cadzow M, Phipps-Green A, Merriman TR
Influence of the ABCG2 gout risk 141 K allele on urate metabolism during a fructose challenge.
Arthritis Res Ther. 2014 Jan 30;16(1):R34. doi: 10.1186/ar4463., [PubMed]
Sentences
No. Mutations Sentence Comment
54 ABCG2 p.Gln126*
X
ABCG2 p.Gln126* 24476385:54:4
status: NEW
view ABCG2 p.Gln126* details
 The Q126X SNP rs72552713 was also genotyped using the Taqman assay as described above (the context sequence for rs72552713 (assay ID C__98388180_20) is [VIC/ FAM] AATGCAAACCCACTAATACTTACTT[G/A]TAC CACGTAACCTGAATTACATTTG). Login to comment 139 ABCG2 p.Gln141Lys
X
ABCG2 p.Gln141Lys 24476385:139:41
status: NEW
view ABCG2 p.Gln141Lys details
 This could be related to an influence of Q141K on hepatic conversion of fructose to glucose, estimated to occur at a rate up to 60% depending on sex and health status [18]. Login to comment 197 ABCG2 p.Gln141Lys
X
ABCG2 p.Gln141Lys 24476385:197:133
status: NEW
view ABCG2 p.Gln141Lys details
 5. Woodward OM, Tukaye DN, Cui J, Greenwell P, Constantoulakis LM, Parker BS, Rao A, Kottgen M, Maloney PC, Guggino WB: Gout-causing Q141K mutation in ABCG2 leads to instability of the nucleotide-binding domain and can be corrected with small molecules. Login to comment