ABCMdb

PMID: 25910067

Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PubMed]

Sentences

No. Mutations Sentence Comment

53 ABCC7 p.Gly576Ala The controversial complex allele [1249-8A>G; G576A;R668C] (c. Login to comment 54 ABCC7 p.Gly1069Arg ABCC7 p.Gly1069Arg ABCC7 p.Asp614Gly ABCC7 p.Asp614Gly ABCC7 p.Ser42Phe ABCC7 p.Ser42Phe ABCC7 p.Ser912Leu ABCC7 p.Ser912Leu [1117-8A>G;1727G>C; 2002C>T]) and mutations G1069R (p.Gly1069Arg), D614G (p.Asp614Gly), S42F (p.Ser42Phe) and S912L (p.Ser912Leu) should also be considered as part of this extension, even if not found in CF-PI but studied up to the DEL step because they are found in genotypes with an unknown allele. Login to comment 86 ABCC7 p.Arg334Trp ABCC7 p.Arg334Trp (A) Frequencies of mutated alleles, with a prevalence ࣙ0.006 in the CF (PI + PS) population, are reported in frequency decreasing order according to CF (PI + PS); the last mutation with a prevalence = 0.008 in the CF (PI + PS) population is the R334W (p.Arg334Trp). Login to comment 141 ABCC7 p.Glu479* ABCC7 p.Glu479* The E479X (p.Glu479*) mutation was found in a novel complex allele [E479X;V754M] (p. Login to comment 142 ABCC7 p.Glu479* [Glu479*;Val754Met]) in a CF-PI male patient, enrolled at 1.5 years of age on the basis of symptoms, with a F508del/[E479X;V754M] (p. Login to comment 146 ABCC7 p.Lys442* ABCC7 p.Lys442* The K442X (p.Lys442*) mutation was found in a CF-PI male patient with a F508del/K442X (p. Login to comment 151 ABCC7 p.Asp529Asn ABCC7 p.Asp529Asn ABCC7 p.Asp529Asn The D529N (p.Asp529Asn) mutation was found in a CF-PI female patient with a F508del/D529N (p. Login to comment 152 ABCC7 p.Asp529Asn [Phe508del];[Asp529Asn]) genotype. Login to comment 156 ABCC7 p.Trp1282* ABCC7 p.Thr465Asn ABCC7 p.Thr465Asn ABCC7 p.Thr465Asn The T465N (p.Thr465Asn) mutation was found in a CF-PI male patient with a W1282X/T465N (p. Login to comment 157 ABCC7 p.Thr465Asn [Trp1282*];[Thr465Asn]) genotype. Login to comment 163 ABCC7 p.Asp110His ABCC7 p.Asp110His (A) Frequencies of mutated genotypes, with a prevalence ࣙ0.006 in the CF (PI + PS) population, are reported in frequency decreasing order according to CF (PI + PS); the last genotype with a prevalence = 0.008 in the CF (PI + PS) population is the F508del/D110H (p.[Phe508del];[Asp110His]). Login to comment 167 ABCC7 p.Gly542* The W19X(TAG) (p.Trp19*) mutation was found in a CF-PI male patient with a G542X/W19X(TAG) (p. Login to comment 173 ABCC7 p.His1375Pro ABCC7 p.His1375Pro ABCC7 p.His1375Pro The H1375P (p.His1375Pro) mutation was found in 3 CF-PS patients (a brother and sister and a third unrelated male patient) with the same 2789+5G>A/H1375P (c. Login to comment 181 ABCC7 p.Gly1247Arg ABCC7 p.Thr465Asn ABCC7 p.Thr465Asn ABCC7 p.Gly1244Arg ABCC7 p.Gly1244Arg ABCC7 p.Glu479* ABCC7 p.Lys442* ABCC7 p.Asp529Asn ABCC7 p.Asp529Asn ABCC7 p.His1375Pro ABCC7 p.His1375Pro ABCC7 p.Gln779* ABCC7 p.Glu56Gly ABCC7 p.Glu56Gly Old nomenclature (legacy name) New nomenclature (HGVS name) Nucleotidic Aminoacidic Nucleotidic Aminoacidic Position notation notation Position notation notation Exon 10 1567G>T E479X exon 11 c.1435G>T p.Glu479* Exon 9 1456A>T K442X exon 10 c.1324A>T p.Lys442* Exon 11 1717G>A D529N exon 12 c.1585G>A p.Asp529Asn Exon 10 1526C>A T465N exon 11 c.1394C>A p.Thr465Asn Exon 2 188G>A W19X(TAG) exon 2 c.56G>A p.Trp19*(TAG) Exon 22 4256A>C H1375P exon 25 c.4124A>C p.His1375Pro Exon 13 2467C>T Q779X exon14 c.2335C>T p.Gln779* Exon 20 3871G>C G1247R(G>C) exon 23 c.3739G>C p.Gly1247Arg Exon 20 3862G>A G1244R exon 23 c.3730G>A p.Gly1244Arg Intron 7 1249-8A>G - intron 8 c.1117-8A>G - Exon 3 299A>G E56G exon 3 c.167A>G p.Glu56Gly Table 2. Login to comment 183 ABCC7 p.Glu479* Average sweat test Genotypea valueb Semen Patient Legacy name HGVS name Gender (mEq/L) analysis Cause of enrollment Diagnosis 1 F508del/[E479X;V754M] c. Login to comment 185 ABCC7 p.Lys442* [Phe508del];[Glu479*;Val754Met] 2 F508del/K442X c. Login to comment 187 ABCC7 p.Asp529Asn [Phe508del];[Lys442*] 3 F508del/D529N c. Login to comment 189 ABCC7 p.Trp1282* ABCC7 p.Thr465Asn ABCC7 p.Asp529Asn [Phe508del];[Asp529Asn] 4 W1282X/T465N c. Login to comment 191 ABCC7 p.Gly542* ABCC7 p.Thr465Asn [Trp1282*];[Thr465Asn] 5 G542X/W19X(TAG) c. Login to comment 193 ABCC7 p.His1375Pro [Gly542*];[Trp19*] 6c 2789+5G>A/H1375P c. Login to comment 194 ABCC7 p.His1375Pro [2657+5G>A];[4124A>C] F 91 &#b1; 8 - Familiarity CF-PS 7c 2789+5G>A/H1375P c. Login to comment 195 ABCC7 p.His1375Pro [2657+5G>A];[4124A>C] M 76 &#b1; 9 OA Symptoms CF-PS 8 2789+5G>A/H1375P c. Login to comment 196 ABCC7 p.Gln779* [2657+5G>A];[4124A>C] M 63 &#b1; 2 OA Symptoms CF-PS 9d [(TG)11T5;V562I;A1006E]/Q779X c. Login to comment 197 ABCC7 p.Gln779* [1210-14TG[11];1210-12T[5];1684G>A;3017C>A];[2335C>T] M 70 &#b1; 15 Too young Neonatal screening CF-PS 10 d [(TG)11T5;V562I;A1006E]/Q779X c. Login to comment 198 ABCC7 p.Trp1282* [1210-14TG[11];1210-12T[5];1684G>A;3017C>A];[2335C>T] F 62 &#b1; 17 - Neonatal screening,familiarity CF-PS 11 W1282X/G1247R(G>C) c. Login to comment 200 ABCC7 p.Gly1247Arg ABCC7 p.Gly1244Arg [Trp1282*];[Gly1247Arg] 12e 3849+10kbC>T/G1244R c. Login to comment 202 ABCC7 p.Glu56Gly ];[1117-8A>G;1727G>C;2002C>T] F 72 &#b1; 4 - Symptoms CF-PS 14 F508del/E56G c. Login to comment 204 ABCC7 p.Glu56Gly [Phe508del];[Glu56Gly] OA, Obstructive azoospermia; -, not applicable because female; nd, not determined. Login to comment 215 ABCC7 p.Ala1006Glu ABCC7 p.Val562Ile ABCC7 p.Gln779* ABCC7 p.Gln779* The Q779X (p.Gln779*) mutation was found in a CF-PS brother and sister with a [(TG)11T5; V562I; A1006E]/Q779X (c. Login to comment 223 ABCC7 p.Trp1282* ABCC7 p.Gly1247Arg The G1247R(G>C) (p.Gly1247Arg) mutation was found in a CF-PS female patient with a W1282X/G1247R(G>C) (p. Login to comment 224 ABCC7 p.Gly1247Arg [Trp1282*];[Gly1247Arg]) genotype. Login to comment 228 ABCC7 p.Gly1244Arg ABCC7 p.Gly1244Arg The G1244R (p.Gly1244Arg) mutation was already published by us (24) when the patient was 7 years old; here we provide a further 7-year follow-up report following that description. Login to comment 229 ABCC7 p.Gly1244Arg ABCC7 p.Gly1244Arg ABCC7 p.Gly1244Arg The G1244R (p.Gly1244Arg) mutation was found in a CF-PS male patient, diagnosed at 14 months of age on the basis of symptoms, with a 3849+10kbC>T/G1244R 2 6 4 | L U C A R E L L I E T A L . Login to comment 258 ABCC7 p.Glu56Gly ABCC7 p.Glu56Gly ABCC7 p.Glu56Gly The E56G (p.Glu56Gly) mutation was found in a CBAVD male subject with a F508del/E56G (p. Login to comment 259 ABCC7 p.Glu56Gly [Phe508del];[Glu56Gly]) genotype. Login to comment 264 ABCC7 p.Glu479* The [E479X;V754M] (p. Login to comment 265 ABCC7 p.Val754Met [Glu479*; Val754Met]) novel complex allele was found once in a CF-PI patient with a F508del (p.Phe508del) mutation on the other allele and an average sweat test of 106 &#b1; 13 mEq/L. Login to comment 266 ABCC7 p.Glu479* The E479X (p.Glu479*) is a novel mutation (described above and in Tables 1-3) found exclusively in this novel complex allele. Login to comment 267 ABCC7 p.Leu24Phe The [L24F;296+2T>G] (c. Login to comment 270 ABCC7 p.Met348Lys The [M348K;S912X] (p. Login to comment 271 ABCC7 p.Met348Lys [Met348Lys; Ser912*]) complex allele was found in 2 patients (1 CF-PI and 1 CBAVD). Login to comment 275 ABCC7 p.Arg1070Gln [Ser466*; Arg1070Gln]) complex allele was found in 3 patients (2 CF-PI and 1 CF-PS). Login to comment 276 ABCC7 p.Gly542* These patients had the following mutations on the other allele: F508del (p.Phe508del) (1 CF-PI), G542X (p.Gly542*) (1 CF-PI), 2789+5G>A (c.2657+5G>A) (1 CF-PS). Login to comment 278 ABCC7 p.Arg74Trp The [R74W;V201M;D1270N] (p. Login to comment 279 ABCC7 p.Arg74Trp ABCC7 p.Val201Met [Arg74Trp; Val201Met;Asp1270Asn]) complex allele was found in 2 patients (1 CF-PS and 1 CBAVD). Login to comment 280 ABCC7 p.Asp1152His ABCC7 p.Asp1152His ABCC7 p.Ser1206* These patients had the following mutations on the other allele: S1206X (p.Ser1206*) (1 CF-PS), D1152H (p.Asp1152His) (1 CBAVD). Login to comment 286 ABCC7 p.Trp1282* ABCC7 p.Asp110His ABCC7 p.Asp110His ABCC7 p.Asp614Gly ABCC7 p.Asp614Gly ABCC7 p.Gln779* These patients had the following mutations on the other allele: F508del (p.Phe508del) (3 CF-PS and 1 CFTR-RD), W1282X (p.Trp1282*) (2 CF-PS), Q779X (p.Gln779*) (2 CF-PS siblings), D110H (p.Asp110His) (1 CF-PS), D614G (p.Asp614Gly) (1 CF-PS), unknown (1 CBAVD). Login to comment 288 ABCC7 p.Ala1006Glu ABCC7 p.Ala1006Glu ABCC7 p.Val562Ile ABCC7 p.Val562Ile The V562I (p.Val562Ile) and the A1006E (p.Ala1006Glu) were only found within the complex allele. Login to comment 290 ABCC7 p.Asp110His ABCC7 p.Asp110His [1210-14TG[11];1210-12T[5]]), with no other mutations in cis, was found in 1 CFTR-RD patient and 1 CBAVD patient with, respectively, the 3849+10kbC>T (c.3717+12191C>T) and the D110H (p.Asp110His) mutations on the other allele. Login to comment 294 ABCC7 p.Arg117Leu The [R117L;L997F] (p. Login to comment 295 ABCC7 p.Arg117Leu ABCC7 p.Leu997Phe [Arg117Leu; Leu997Phe]) complex allele (28) was found in 6 patients (1 CF-PI and 5 CF-PS). Login to comment 296 ABCC7 p.Trp1282* ABCC7 p.Arg334Trp ABCC7 p.Arg334Trp ABCC7 p.Gly85Glu ABCC7 p.Gly85Glu These patients had the following mutations on the other allele: F508del (p.Phe508del) (1 CF-PI), G85E (p.Gly85Glu) (1 CF-PS), R334W (p.Arg334Trp) (2 CF-PS siblings) and W1282X (p.Trp1282*) (2 CF-PS). Login to comment 298 ABCC7 p.Arg117Leu ABCC7 p.Arg117Leu The R117L (p.Arg117Leu) was only found in the complex allele. Login to comment 299 ABCC7 p.Arg117Leu ABCC7 p.Arg117Leu ABCC7 p.Leu997Phe ABCC7 p.Leu997Phe The L997F (p.Leu997Phe), with no R117L (p.Arg117Leu) in cis, was found in 13 patients (2 CF-PS, 8 CFTR-RD and 3 CBAVD). Login to comment 300 ABCC7 p.Trp1282* ABCC7 p.Ser549Arg ABCC7 p.Gly85Glu ABCC7 p.Gly85Glu ABCC7 p.Leu320Val ABCC7 p.Leu320Val These patients had the following mutations on the other allele: F508del (p.Phe508del) (1 CF-PS, 4 CFTR-RD and 1 CBAVD, including 2 siblings), G85E (p.Gly85Glu) (1 CF-PS), W1282X (p.Trp1282*) (2 CFTR-RD siblings), L320V (p.Leu320Val) (1 CFTR-RD), S549R(A>C) (p.Ser549Arg) (1 CFTR-RD), 711+5G>A (c.579+5G>A) (1 CBAVD) and unknown (1 CBAVD). Login to comment 308 ABCC7 p.Gly576Ala The complex allele [G576A;R668C] (p. Login to comment 309 ABCC7 p.Ser1235Arg ABCC7 p.Ser1235Arg ABCC7 p.Gly576Ala [Gly576Ala;Arg668Cys]) (without the first mutation in cis) was found in two CFTR-RD patients with F508del (p.Phe508del) and S1235R (p.Ser1235Arg) on the other allele, with sweat tests, respectively, of 19 &#b1; 2 and 17 &#b1; 1 mEq/L (average 18 &#b1; 1 mEq/L). Login to comment 318 ABCC7 p.Trp1282* ABCC7 p.Asn1303Lys ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Arg1162* ABCC7 p.Ser549Arg ABCC7 p.Tyr849* These patients had the following mutations on the other allele: F508del (p.Phe508del) (3 CF-PS, 5 CFTR-RD and 10 CBAVD), N1303K (p.Asn1303Lys) (1 CF-PS, 3 CFTR-RD and 1 CBAVD), 1717-1G>A (c.1585-1G>A) (3 CF-PS and 1 CFTR-RD), W1282X (p.Trp1282*) (3 CFTR-RD), G542X (p.Gly542*) (1 CF-PS, 1 CFTR-RD and 1 CBAVD), Y849X (p.Tyr849*) (1 CFTR-RD), 3849+10kbC>T (c.3717+12191C>T) (1 CFTR-RD), R1162X (p.Arg1162*) (1 CBAVD), S549R(A>C) (p.Ser549Arg) (1 CFTR-RD) and unknown (1 CF-PS and 3 CBAVD). Login to comment 362 ABCC7 p.Pro5Leu ABCC7 p.Leu24Phe ABCC7 p.Met1Val Allele legacy name Allele HGVS name Clinical classification CFTR2 M1V c.1A>G CF-PI CF-causing p.Met1Val P5L c.14C>T CF-PS,CFTR-RD nd p.Pro5Leu ex2,3del c.54-5940_273+10250del21080 CF-PI CF-causing ex2del c.54-1161_164+1603del2875 CF-PI nd W19X(TAG) c.56G>A CF-PI nd p.Trp19* [L24F;296+2T>G] c. Login to comment 363 ABCC7 p.Arg74Trp ABCC7 p.Arg31Cys ABCC7 p.Arg31Cys ABCC7 p.Ser42Phe ABCC7 p.Ser42Phe ABCC7 p.Glu56Lys ABCC7 p.Glu56Gly ABCC7 p.Leu24Phe [72G>C;164+2T>G] uncertain: CF-PI and/or CF-PS L24F nd; 296+2T>G nd R31C c.91C>T CFTR-RD non CF-causing p.Arg31Cys S42F c.125C>T uncertain: found only with an unknown allele in trans nd p.Ser42Phe E56G c.167G>A CBAVD nd p.Glu56Lys [R74W;V201M;D1270N] c. Login to comment 364 ABCC7 p.Arg74Trp ABCC7 p.Val201Met [220C>T;601G>A;3808G>A] uncertain: CF-PS and/or CFTR-RD and/or CBAVD R74W varying clinical consequence; V201M nd; p. Login to comment 365 ABCC7 p.Asp1270Asn ABCC7 p.Arg74Trp [Arg74Trp;Val201Met;Asp1270Asn] D1270N varying clinical consequence [359insT;(TG)12T5] c. Login to comment 366 ABCC7 p.Arg117His ABCC7 p.Arg117His ABCC7 p.Gly85Glu ABCC7 p.Gly85Glu ABCC7 p.Arg117Leu ABCC7 p.Arg117Cys ABCC7 p.Arg117Cys ABCC7 p.Asp110His ABCC7 p.Asp110His [227_228insT;1210-14TG[12];1210-12T[5]] uncertain: CF-PI and/or CF-PS and/or CFTR-RD 359insT nd; T5 varying clinical consequence G85E c.254G>A CF-PI,CF-PS CF-causing p.Gly85Glu D110H c.328G>C CF-PS CF-causing p.Asp110His R117C c.349C>T CF-PS CF-causing p.Arg117Cys R117H c.350G>A CFTR-RD varying clinical consequence p.Arg117His [R117L;L997F] c. Login to comment 367 ABCC7 p.Arg117Leu ABCC7 p.Leu997Phe [350G>T;2991G>C] CF-PI,CF-PS R117L nd; L997F non CF-causing p. Login to comment 368 ABCC7 p.Leu206Trp ABCC7 p.Leu206Trp ABCC7 p.Arg117Leu ABCC7 p.Gln220* ABCC7 p.Gly126Asp ABCC7 p.Gly126Asp ABCC7 p.Gly178Arg ABCC7 p.Gly178Arg ABCC7 p.Glu193Lys ABCC7 p.Glu193Lys ABCC7 p.Cys276* ABCC7 p.Asp192Gly ABCC7 p.Asp192Gly ABCC7 p.His199Arg ABCC7 p.His199Arg ABCC7 p.His139Arg ABCC7 p.His139Arg [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment 370 ABCC7 p.Arg334Trp ABCC7 p.Arg334Trp ABCC7 p.Arg347Pro ABCC7 p.Arg347Pro ABCC7 p.Arg347His ABCC7 p.Arg347His ABCC7 p.Thr338Ile ABCC7 p.Thr338Ile ABCC7 p.Met348Lys ABCC7 p.Arg334Leu ABCC7 p.Arg334Leu ABCC7 p.Leu320Val ABCC7 p.Leu320Val 991del5 c.859_863delAACTT CF-PI nd p.Asn287LysfsX19 L320V c.958T>G uncertain: CF-PI and/or CF-PS and/or CFTR-RD nd p.Leu320Val R334W c.1000C>T CF-PI,CF-PS CF-causing p.Arg334Trp R334L c.1001G>T CF-PS nd p.Arg334Leu T338I c.1013C>T CF-PS,CFTR-RD,CBAVD CF-causing p.Thr338Ile R347P c.1040G>C CF-PI,CF-PS CF-causing p.Arg347Pro R347H c.1040G>A CF-PS CF-causing p.Arg347His [M348K;S912X] c. Login to comment 371 ABCC7 p.Met348Lys ABCC7 p.Ser912* [1043T>A;2735C>A] CF-PI M348K nd; S912X CF-causing p. Login to comment 372 ABCC7 p.Met348Lys [Met348Lys;Ser912*] [1249-8A>G;G576A;R668C] c. Login to comment 373 ABCC7 p.Arg668Cys ABCC7 p.Gly576Ala ABCC7 p.Glu379* ABCC7 p.Met394Arg ABCC7 p.Met394Arg [1117-8A>G;1727G>C;2002C>T] uncertain: found only with an unknown allele in trans 1249-8A>G nd; G576A non CF-causing; R668C non CF-causing 1259insA c.1127_1128insA CF-PI CF-causing p.Gln378AlafsX4 E379X c.1135G>T CF-PI nd p.Glu379* M394R c.1181T>G CF-PI nd p.Met394Arg (TG)11T5 c. Login to comment 377 ABCC7 p.Ala1006Glu ABCC7 p.Val562Ile ABCC7 p.Thr465Asn ABCC7 p.Thr465Asn ABCC7 p.Lys442* [1210-14TG[11];1210-12T[5];1684G>A;3017C>A] CF-PS,CFTR-RD T5 varying clinical consequence; V562I nd; A1006E nd K442X c.1324A>T CF-PI nd p.Lys442* T465N c.1394C>A CF-PI nd p.Thr465Asn [S466X(TGA);R1070Q] c. Login to comment 378 ABCC7 p.Arg1070Gln [1397C>G;3209G>A] CF-PI S466X(TGA) CF-causing; R1070Q varying clinical p. Login to comment 379 ABCC7 p.Glu479* [Ser466*;Arg1070Gln] consequence [E479X;V754M] c. Login to comment 380 ABCC7 p.Val754Met ABCC7 p.Glu479* [1435G>T;2260G>A] CF-PI E479X nd; V754M non CF-causing p. Login to comment 381 ABCC7 p.Gly551Asp ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Gly542* ABCC7 p.Ser549Arg ABCC7 p.Ser549Arg ABCC7 p.Ser549Asn ABCC7 p.Ser549Asn ABCC7 p.Gln552* ABCC7 p.Tyr569Asp ABCC7 p.Tyr569Asp ABCC7 p.Leu558Ser ABCC7 p.Leu558Ser ABCC7 p.Asp529Asn ABCC7 p.Asp529Asn [Glu479*;Val754Met] F508del c.1521_1523delCTT CF-PI CF-causing p.Phe508del 1717-8G>A c.1585-8G>A CF-PI CF-causing 1717-1G>A c.1585-1G>A CF-PI CF-causing D529N c.1585G>A CF-PI nd p.Asp529Asn G542X c.1624G>T CF-PI CF-causing p.Gly542* S549R(A>C) c.1645A>C CF-PI CF-causing p.Ser549Arg S549N c.1646G>A CF-PI CF-causing p.Ser549Asn S549R(T>G) c.1647T>G CF-PI CF-causing p.Ser549Arg G551D c.1652G>A CF-PI CF-causing p.Gly551Asp Q552X c.1654C>T CF-PI CF-causing p.Gln552* R553X c.1657C>T CF-PI CF-causing p.Arg553* L558S c.1673T>C CF-PI unknown significance p.Leu558Ser Y569D c.1705T>G CFTR-RD,CBAVD unknown significance p.Tyr569Asp Continued on next page 2 0 | L U C A R E L L I E T A L . Login to comment 383 ABCC7 p.Gly576Ala ABCC7 p.Leu571Ser ABCC7 p.Leu571Ser L571S c.1712T>C CF-PI nd p.Leu571Ser [G576A;R668C] c. Login to comment 384 ABCC7 p.Arg668Cys ABCC7 p.Gly576Ala [1727G>C;2002C>T] CFTR-RD G576A non CF-causing; R668C non-CF causing p. Login to comment 385 ABCC7 p.Glu831* ABCC7 p.Glu585* ABCC7 p.Leu1065Pro ABCC7 p.Leu1065Pro ABCC7 p.Ala613Thr ABCC7 p.Ala613Thr ABCC7 p.Arg1066Cys ABCC7 p.Arg1066Cys ABCC7 p.Ser945Leu ABCC7 p.Ser945Leu ABCC7 p.Gly576Ala ABCC7 p.Arg764* ABCC7 p.Leu997Phe ABCC7 p.Leu997Phe ABCC7 p.Arg1066His ABCC7 p.Arg1066His ABCC7 p.Gly1069Arg ABCC7 p.Gly1069Arg ABCC7 p.Pro1013Leu ABCC7 p.Pro1013Leu ABCC7 p.Ser977Phe ABCC7 p.Ser977Phe ABCC7 p.Asp614Gly ABCC7 p.Asp614Gly ABCC7 p.Arg709* ABCC7 p.Asp579Gly ABCC7 p.Asp579Gly ABCC7 p.Tyr1032Cys ABCC7 p.Tyr1032Cys ABCC7 p.Tyr849* ABCC7 p.Ser912Leu ABCC7 p.Ser912Leu ABCC7 p.Leu732* ABCC7 p.Leu1065Arg ABCC7 p.Leu1065Arg ABCC7 p.Gln779* ABCC7 p.His609Leu ABCC7 p.His609Leu [Gly576Ala;Arg668Cys] D579G c.1736A>G CF-PS varying clinical consequence p.Asp579Gly E585X c.1753G>T CF-PI CF-causing p.Glu585* H609L c.1826A>T CFTR-RD nd p.His609Leu A613T c.1837G>A CF-PS nd p.Ala613Thr D614G c.1841A>G CF-PS unknown significance p.Asp614Gly 2143delT c.2012delT CF-PS CF-causing p.Leu671* 2183AA>G c.2051_2052delAAinsG CF-PI,CF-PS CF-causing p.Lys684SerfsX38 2184insA c.2052_2053insA CF-PI CF-causing p.Gln685ThrfsX4 R709X c.2125C>T CF-PI CF-causing p.Arg709* L732X c.2195T>G CF-PI CF-causing p.Leu732* R764X c.2290C>T CF-PI CF-causing p.Arg764* Q779X c.2335C>T uncertain: CF-PI and/or CF-PS nd p.Gln779* E831X c.2491G>T CF-PS CF-causing p.Glu831* Y849X c.2547C>A CF-PI CF-causing p.Tyr849* ex14b-17bdel c.2620-674_3367+198del9858 CF-PI nd 2789+5G>A c.2657+5G>A CF-PI,CF-PS CF-causing 2790-2A>G c.2658-2A>G CF-PS nd S912L c.2735C>T uncertain: found only with an unknown allele in trans nd p.Ser912Leu S945L c.2834C>T CF-PS CF-causing p.Ser945Leu S977F c.2930C>T CFTR-RD varying clinical consequence p.Ser977Phe L997F c.2991G>C CF-PS,CFTR-RD,CBAVD non CF-causing p.Leu997Phe ex17a-18del c.2988+1173_3468+2111del8600 CF-PI nd P1013L c.3038C>T CFTR-RD nd p.Pro1013Leu Y1032C c.3095A>G CFTR-RD nd p.Tyr1032Cys 3272-26A>G c.3140-26A>G CF-PS CF-causing L1065P c.3194T>C CF-PI,CF-PS CF-causing p.Leu1065Pro L1065R c.3194T>G uncertain: CF-PI and/or CF-PS nd p.Leu1065Arg R1066C c.3196C>T CF-PI CF-causing p.Arg1066Cys R1066H c.3197G>A CF-PI CF-causing p.Arg1066His G1069R c.3205G>A uncertain: found only with an unknown allele in trans varying clinical consequence p.Gly1069Arg Continued on next page of 0.021). Login to comment 390 ABCC7 p.Trp1282* ABCC7 p.Gly1244Glu ABCC7 p.Gly1244Glu ABCC7 p.Gly1349Asp ABCC7 p.Gly1349Asp ABCC7 p.Asn1303Lys ABCC7 p.Asn1303Lys ABCC7 p.Arg1162* ABCC7 p.Ser1455* ABCC7 p.Ser1235Arg ABCC7 p.Ser1235Arg ABCC7 p.Asp1152His ABCC7 p.Asp1152His ABCC7 p.Ile1234Val ABCC7 p.Ile1234Val ABCC7 p.Leu1077Pro ABCC7 p.Leu1077Pro ABCC7 p.Gln1291Arg ABCC7 p.Gln1291Arg ABCC7 p.Gln1476* ABCC7 p.Met1137Val ABCC7 p.Met1137Val ABCC7 p.Gly1247Arg ABCC7 p.Ser1206* ABCC7 p.Val1240Gly ABCC7 p.Val1240Gly ABCC7 p.Asp1168Gly ABCC7 p.Asp1168Gly ABCC7 p.Gly1244Arg ABCC7 p.Gly1244Arg ABCC7 p.His1375Pro ABCC7 p.His1375Pro L1077P c.3230T>C CF-PI CF-causing p.Leu1077Pro Y1092X(C>A) c.3276C>A CF-PI CF-causing p.Tyr1092* M1137V c.3409A>G CFTR-RD nd p.Met1137Val D1152H c.3454G>C CF-PI,CF-PS,CFTR-RD varying clinical consequence p.Asp1152His R1162X c.3484C>T CF-PI CF-causing p.Arg1162* D1168G c.3503A>G CFTR-RD nd p.Asp1168Gly 3667ins4 c.3535_3536insTCAA CF-PI CF-causing p.Thr1179IlefsX17 S1206X c.3617C>A uncertain: CF-PI and/or CF-PS nd p.Ser1206* I1234V c.3700A>G CF-PI,CF-PS CF-causing p.Ile1234Val S1235R c.3705T>G CFTR-RD non CF-causing p.Ser1235Arg 3849+10kbC>T c.3717+12191C>T CF-PI,CF-PS CF-causing V1240G c.3719T>G CFTR-RD nd p.Val1240Gly G1244R c.3730G>A uncertain: CF-PI and/or CF-PS nd p.Gly1244Arg G1244E c.3731G>A CF-PI,CF-PS CF-causing p.Gly1244Glu G1247R(G>C) c.3739G>C CF-PS nd p.Gly1247Arg W1282X c.3846G>A CF-PI CF-causing p.Trp1282* Q1291R c.3872A>G CF-PI,CF-PS,CFTR-RD nd p.Gln1291Arg 4016insT c.3884_3885insT CF-PI CF-causing p.Ser1297PhefsX5 4040delA c.3908delA CF-PI nd p.Asn1303ThrfsX25 N1303K c.3909C>G CF-PI CF-causing p.Asn1303Lys ex22-24del c.3964-3890_4443+3143del9454ins5 CF-PI nd ex22,23del c.3964-78_4242+577del1532 CF-PI CF-causing 4168delCTAAGCC c.4036_4042del CF-PI nd p.Leu1346MetfsX6 G1349D c.4046G>A CF-PI CF-causing p.Gly1349Asp H1375P c.4124A>C uncertain: CF-PI and/or CF-PS nd p.His1375Pro S1455X c.4364C>G CF-PS,CFTR-RD nd p.Ser1455* Q1476X c.4426C>T CFTR-RD nd p.Gln1476* nd,Not determined.According to the three rules described (see Materials and Methods),each mutated allele was classified according to its clinical outcome.It was impossible to univocally assign 16 of the 125 different mutated alleles to one or more macrocategories.A comparison with the CFTR2 project (11) (http://www.cftr2.org) is shown.The alleles are ordered according to their nucleotidic position. Login to comment 422 ABCC7 p.Arg117His ABCC7 p.Arg117His ABCC7 p.Ser977Phe ABCC7 p.Ser977Phe ABCC7 p.Asp579Gly ABCC7 p.Asp579Gly A good level of agreement may also be recognized for mutations R117H (p.Arg117His) and S977F (p.Ser977Phe), classified in our study as CFTR-RD-causing, and the mutation D579G (p.Asp579Gly), classified in our study as CF-PS-causing, and both recognized in the CFTR2 study with varying clinical consequences, therefore also including our phenotypic findings. Login to comment 423 ABCC7 p.Ser1235Arg ABCC7 p.Ser1235Arg ABCC7 p.Arg31Cys ABCC7 p.Arg31Cys A similar good match may also be assumed for two mutations classified as non-CF-causing in CFTR2 [S1235R (p.Ser1235Arg) and R31C (p.Arg31Cys)] but as CFTR-RD-causing in our study, owing to the fact that CFTR2 is mainly aimed at classic CF and is more prone to a classification as non-causing for those mutations originating nonclassic clinical and biochemical phenotypes. Login to comment 424 ABCC7 p.Leu206Trp ABCC7 p.Leu206Trp ABCC7 p.Arg117Leu ABCC7 p.Arg117Leu ABCC7 p.Thr338Ile ABCC7 p.Thr338Ile ABCC7 p.Leu997Phe ABCC7 p.Leu997Phe The three actually discrepant alleles were L997F (p.Leu997Phe), without the R117L (p.Arg117Leu) in cis, L206W (p.Leu206Trp) and T338I (p.Thr338Ile). Login to comment 425 ABCC7 p.Leu997Phe ABCC7 p.Leu997Phe The L997F (p.Leu997Phe) allele can, according to the findings that emerge both from this work and previous studies (28), also give rise to CF-PS, whereas in the CFTR2 study, it was classified as non-CF-causing. Login to comment 426 ABCC7 p.Leu206Trp ABCC7 p.Leu206Trp The L206W (p.Leu206Trp), which in our study was classified as a CFTR-RD-causing mutation, was classified as CF-causing in the CFTR2 study. Login to comment 428 ABCC7 p.Thr338Ile ABCC7 p.Thr338Ile | M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 A G E N O T Y P I C - O R I E N T E D V I E W O F C F T R G E N E T I C S The T338I (p.Thr338Ile) is classified in the CFTR2 study as CF-causing. Login to comment