ABCMdb

ABCC7 p.His199Arg

ClinVar:	c.596A>G , p.His199Arg ? , not provided c.595C>T , p.His199Tyr D , Pathogenic c.597T>G , p.His199Gln ? , not provided
CF databases:	c.595C>T , p.His199Tyr D , CF-causing ; CFTR1: The mutation was found in a German CF patient who is heterozygous for [delta]F508 and negative for more than 120 other known mutations. The patient was diagnosed by the age of four years because of recurrent pneumonias, but exhibits only mild pancreatic symptoms and borderline swet chloride values. So far, H199Y was not found in a further 28 German and 8 Turkish non-[delta]F508 CF chromosomes. c.596A>G , p.His199Arg (CFTR1) ? , c.597T>G , p.His199Gln (CFTR1) ? , This alteration does not affect a restriciton site so we are testing an ASO.
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: D (91%), P: D (95%), Q: D (63%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (59%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Molecular consequences of cystic fibrosis transmem... Gut. 2003 Aug;52(8):1159-64. Ahmed N, Corey M, Forstner G, Zielenski J, Tsui LC, Ellis L, Tullis E, Durie P
Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas.
Gut. 2003 Aug;52(8):1159-64., [PMID:12865275]

Abstract [show]
BACKGROUND AND AIMS: We tested the hypothesis that the actual or predicted consequences of mutations in the cystic fibrosis transmembrane regulator gene correlate with the pancreatic phenotype and with measures of quantitative exocrine pancreatic function. METHODS: We assessed 742 patients with cystic fibrosis for whom genotype and clinical data were available. At diagnosis, 610 were pancreatic insufficient, 110 were pancreatic sufficient, and 22 pancreatic sufficient patients progressed to pancreatic insufficiency after diagnosis. RESULTS: We identified mutations on both alleles in 633 patients (85.3%), on one allele in 95 (12.8%), and on neither allele in 14 (1.9%). Seventy six different mutations were identified. The most common mutation was DeltaF508 (71.3%) followed by G551D (2.9%), G542X (2.3%), 621+1G-->T (1.2%), and W1282X (1.2%). Patients were categorized into five classes according to the predicted functional consequences of each mutation. Over 95% of patients with severe class I, II, and III mutations were pancreatic insufficient or progressed to pancreatic insufficiency. In contrast, patients with mild class IV and V mutations were consistently pancreatic sufficient. In all but four cases each genotype correlated exclusively with the pancreatic phenotype. Quantitative data of acinar and ductular secretion were available in 93 patients. Patients with mutations belonging to classes I, II, and III had greatly reduced acinar and ductular function compared with those with class IV or V mutations. CONCLUSION: The predicted or known functional consequences of specific mutant alleles correlate with the severity of pancreatic disease in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
309 Table 2 Genotype classification according to the functional consequences of CFTR gene mutations Pancreatic status Class I Class II Class III Class IV Class V PS F1 , 875+1G→C(2) F, F (1) F, G551D (1) F, R117H (11) F,3849+10kbC→T (5) F, G85E2 (1) F, R347H (3) F,3272-26A→G (4) F, S1251N (2) F,A445E (3) F, D614G (1) F,P574H (2) F, R347P (1) F,3120G>A (1) R117H,R117H (1) F, 5T (8) F, L1335P (1) F,2789+5G→A (1) F,P67L (1) F,R347P/R347H (1) F,V232D(2) R334W, R334W(1) PS→PI F,3659delC (1) F,F (15) F,G551D (1) F, I1234V (1) F,2184insA (1) F,R560T (1) PI F, G542X (27) F,F (365) F, G551D (28) F, 621+1G→T (13) F, R560T (7) F,R553X (7) F, N1303K (9) F, R1162X (6) F,L1077P (2) F, 3659delC (5) F, I48T (1) F, 1717-1G→A (5) F,A559T (1) F, W1282X (5) F, G85E2 (2) F, 711+1G→T (5) G551D,G551D(1) F,2184delA(4) F,H199R (1) W1282X,W1282X (4) F,I1072T(1) F,Y1092X (3) F,S549 (R75Q) (1) F,556delA (3) F, Q493X (3) F,4016InsT (3) F, 3120+1G→A (2) F, G551D/R553X (2) F,Q814X(2) F,1154insTC (2) F,441delA (1) F, 4326delTC (1) F,Q552X(1) F,3007delG (1) F,2184insA (1) F, 4010del4 (1) F,3905insT (1) F,1078delT(1) F,E1104X (1) F,3876delA (1) F,4374+1G→T (1) F,E585X (1) F, E60X (1) CFTR, cystic fibrosis transmembrane regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment

[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). Login to comment
65 Among these mutations, we have identified and characterised in the Italian population two novel mutations in two affected children: H199R and 4167delCTAAGCC. Login to comment
66 An abnormal DHPLC pattern in exon 6a due to the nucleotide change A to G at position 728 of CFTR determines the missense mutation H199R that falls into the transmembrane domain, TM1. Login to comment
68 H199R mutation, to our knowledge, has been detected in a single CF chromosome in a population in Brittany [7]. Login to comment
82 H199R has a substitution of a conserved amino acid crucial in the TM1 domain, while the other, a 7bp-deletion, introduces a premature STOP codon, resulting in a truncated protein. Login to comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Glucose intolerance in children with cystic fibros... J Pediatr. 2003 Feb;142(2):128-32. Solomon MP, Wilson DC, Corey M, Kalnins D, Zielenski J, Tsui LC, Pencharz P, Durie P, Sweezey NB
Glucose intolerance in children with cystic fibrosis.
J Pediatr. 2003 Feb;142(2):128-32., [PMID:12584532]

Abstract [show]
OBJECTIVE: To evaluate the relations among glucose intolerance, genotype, and exocrine pancreatic status in patients with cystic fibrosis (CF). STUDY DESIGN: Data on 335 patients <18 years of age were from the Toronto CF database. A modified oral glucose tolerance test was given to 94 patients 10 to 18 years of age without recognized CF-related diabetes. CF transmembrane conductance regulator mutations and exocrine pancreatic status were determined for all patients. RESULTS: CF-related diabetes was clinically recognized in 9 of 335 (2.7%) patients <18 years of age, all of whom were pancreatic insufficient, and 8 of 9 had severe (classes I through III) mutations on both alleles. The ninth patient had unidentified mutations. Although all patients given the oral glucose tolerance test were asymptomatic and had normal fasting blood glucose, 16 of 94 (17%) had impaired glucose tolerance and 4 of 94 (4.3%) had CF-related diabetes without fasting hyperglycemia. Abnormal glucose tolerance was associated exclusively with severe mutations and exocrine pancreatic insufficiency. Glycosylated hemoglobin (HbA(1)C) levels did not correlate with glucose tolerance results. CONCLUSIONS: Screening of pancreatic-insufficient, adolescent patients with CF identified more with abnormal oral glucose tolerance than was suspected clinically and is recommended as a routine practice. HbA(1)C was not useful in screening for CF-related glucose intolerance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 of patients with IGT 2 10 2 0 0 1/1 16 No of patients with CFRD without FH 0 4 0 0 0 0 4 *Genotype class based on mutation with ∆F508: Class I, 621+1G→T, G542X, 441delA, R553X, W1282X, 3120+1G→A, 4016insT, 1154insTC, I1027T; Class II, ∆F508; Class III, G551D, G85E, S549N, L1077P, H199R; Class IV, Class V, 3849+10kbC→T, 5T; Unknown, G85E/-, ∆F508/-; Other, G551D/R506T, W1282X/W1282X. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 g D44G, 300delA, W57X, 405+1G>A, D110H, E116K, 541del4, 542del7, L137R, 621+2T>G, I175V, H199R, H199Y, C225X, V232D, Q290X, E292X, G314V, T338I, 1221delCT, W401X, Q452P, I502T, 1716+2T>C, G544S, R560S, A561E, V562I, Y569D, 1898+3A>G, 1898+5G>A, G628R(G>A), 2143delT, G673X, R851X, Q890X, S977F, 3129del4, 3154delG, 3271+1G>A, G1061R, R1066L, R1070W, 3601-17T>C, S1196X, 3732delA, G1249R, 3898insC, 4374+1G>A, del25kb. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment