ABCMdb

ABCC7 p.His139Arg

ClinVar:	c.416A>G , p.His139Arg ? , not provided c.416A>T , p.His139Leu ? , not provided
CF databases:	c.416A>G , p.His139Arg (CFTR1) ? , A novel mutation was identified by DGGE and direct sequencing in a CF patient of Italian patient. The nucleotide change is A->G at position 548 in exon 4 leading to H139R c.416A>T , p.His139Leu (CFTR1) ? , This mutation has been identified in exon 4 as H139L (A to T at 548) in six Bahraini patients that belong to five unrelated families. The first patient is a heterozygous H139L / K1177X. The second and third patients are heterozygous siblings for 3120+1G->A. Finally the last three unrelated patients are heterozygous H139L / Unknown.
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), I: D (95%), K: D (95%), L: D (91%), M: D (95%), N: D (95%), P: D (95%), Q: D (85%), R: N (57%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]

Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
369 H139R, G149R, D192G and R258G in the two first CLs inhibited maturation and transport of CFTR to the cell surface. Login to comment

[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

[hide] Genotype/phenotype correlation of the G85E mutatio... Eur Respir J. 2004 May;23(5):679-84. Decaestecker K, Decaestecker E, Castellani C, Jaspers M, Cuppens H, De Boeck K
Genotype/phenotype correlation of the G85E mutation in a large cohort of cystic fibrosis patients.
Eur Respir J. 2004 May;23(5):679-84., [PMID:15176679]

Abstract [show]
In this European study, the phenotype in 68 patients, homozygous or compound heterozygous for the G85E mutation, was investigated. Each index case was compared with two cystic fibrosis (CF) patients from the same clinic, matched for age and sex: one with pancreatic sufficiency (PS) and one with pancreatic insufficiency (PI). When comparing 31 G85E/F508del and F508del/F508del patients, there were no differences in median age at diagnosis, mean sweat chloride value, most recent weight for height, most recent forced expiratory volume in one second % predicted, prevalence of chronic Pseudomonas aeruginosa colonisation and typical CF complications. However, PI was less frequent in the G85E/F508del group. Comparison of 55 G85E patients (with second mutation known and not classified as mild) with PS controls (n=44) showed that the G85E patients had a significantly higher sweat chloride, more often failure to thrive at diagnosis, higher prevalence of PI, worse current weight for height, higher prevalence of chronic P. aeruginosa colonisation and liver cirrhosis. Pulse-chase experiments revealed that G85E cystic fibrosis transmembrane conductance regulator failed to mature on a M470 as well as on a V470 background. Therefore, G85E is a class II mutation. Although there is variability in its clinical presentation, G85E mutation results in a severe phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 - Cystic fibrosis transmembrane conductance regulator genotypes of patients in the three study groups G85E PI PS Genotype Subjects n Genotype Subjects n Genotype Subjects n G85E/F508del# 34 F508del# /F508del# 58 F508del# /unknown 15 G85E/unknown 8 F508del# /unknown 2 F508del# /3849z10 kbCRT} 5 G85E/G542X# 5 F508del# /1717-1GR A 1 F508del# /R117H} 3 G85E/W1282X# 4 F508del# /N1303K# 1 T338I/L1065P 2 G85E/I507del# 3 F508del*/H139R 1 E585X/3272-26ARG} 2 G85E/R1162X# 3 F508del# /R1066C # 1 2183AARG/2789z5GRA 2 G85E/2183AARG 2 F508del# /G542X# 1 F508del# /711z5GRA 1 G85E/G85E 1 F508del# /712-1GRT 1 F508del# /D1152H} 1 G85E/E585X# 1 F508del# /621z1GRT 1 F508del# /1898z3ARG 1 G85E/711z1GRT# 1 F508del# /1898z1 1 F508del# /R347H} 1 G85E/712-1GRT# 1 Total 68 F508del# /2789z5GRA 1 G85E/621z1GRT# 1 2789z5GRA/? Login to comment

[hide] Rescue of DeltaF508 and other misprocessed CFTR mu... Mol Pharm. 2005 Sep-Oct;2(5):407-13. Loo TW, Bartlett MC, Clarke DM
Rescue of DeltaF508 and other misprocessed CFTR mutants by a novel quinazoline compound.
Mol Pharm. 2005 Sep-Oct;2(5):407-13., [PMID:16196493]

Abstract [show]
Cystic fibrosis (CF) is most commonly caused by deletion of Phe508 in the cystic fibrosis transmembrane conductance regulator protein (DeltaF508 CFTR). The misfolded DeltaF508 CFTR protein is retained in the endoplasmic reticulum (misprocessed mutant) and is rapidly degraded. Studies on misprocessed mutants of P-glycoprotein (P-gp), a sister protein of CFTR, however, have shown that specific substrates and modulators can act as specific chemical/pharmacological chaperones to rescue the protein. A major goal in CF research is the identification of compounds that can be used at low concentrations to rescue misprocessed CFTR mutants. Here, we show that a novel quinazoline derivative, 4-cyclohexyloxy-2-{1-[4-(4-methoxy-benzenesulfonyl)piperazin-1-yl]ethyl}qu inazoline (CF(cor)-325), rescued DeltaF508 CFTR. Incubation of BHK cells stably expressing human DeltaF508 CFTR with 1-10 microM CF(cor)-325 resulted in maturation and delivery of a functional molecule to the cell surface as determined by the iodide efflux assay. The misprocessed CFTR mutants R258G, S945L, and H949Y were also rescued by CF(cor)-325 in either BHK or HEK 293 cells. CF(cor)-325 appeared to be specific for DeltaF508 CFTR because another quinazoline derivative, prazosin, did not rescue the misprocessed CFTR mutants. CF(cor)-325 could also rescue misprocessed mutants of P-gp. The compound was a P-gp inhibitor as it inhibited vinblastine-stimulated ATPase activity. P-gp-mediated vinblastine resistance was also reduced about 10-fold with 300 nM CF(cor)-325. These results show that CF(cor)-325 is a particularly important lead compound for treatment of CF because low concentrations can be used to rescue many misprocessed CFTR mutants.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Wild-type, ∆F508, H139R, G149R, R258G, S945L, and H949Y CFTR cDNAs were inserted into the pcDNA3 (Invitrogen, Oakville, ON) vector as described previously.13,14 Wild-type and mutant G268V P-gp cDNAs were inserted into the pMT21 vector (Genetics Institute) as described previously.15 Baby hamster kidney (BHK) cells stably expressing CFTR or P-gp were generated by cotransfection with cDNA and pWL-neo (Stratagene, Cedar Creek, TX). Login to comment
132 (C) BHK cells expressing misprocessed CFTR mutants H139R, G149R, R258G, S945L, H949Y, or wild-type CFTR were incubated for 48 h with (+) or without (-) 3 µM CFcor-325. Whole cell extracts were subjected to immunoblot analysis with a rabbit polyclonal antibody against CFTR. Login to comment
144 BHK cells expressing mutants H139R, G149R, and R258G in the first transmembrane domain (TMD1)30 or mutants S945L and H949Y in TMD213 were treated with or without 3 µM CFcor-325 for 48 h. Whole cell SDS extracts were then subjected to immunoblot analysis. Login to comment
146 By contrast, CFcor-325 had little effect on mutants H139R or G149R. Login to comment
183 These include the substituted benzo[c]- quinolizinium compounds,39 thapsigargin,40 and curcumin.41 Drug rescue of ∆F508 CFTR with benzo[c]quinolizinium compounds, however, requires concentrations that are about 100-fold higher (250-500 µM) than that needed for CFcor-325, while rescue with thapsigargin and curcumin could not be repeated by other investigators.25,42,43 A possible explanation for the observation that curcumin treatment increased cAMP-stimulated iodide efflux in BHK cells expressing ∆F508 CFTR41 was that the compound can directly stimulate CFTR channels that were already present at the cell surface.44 We were unable to induce maturation of misprocessed CFTR mutants that had the mutations H139R or G149R in the first intracellular loop. Login to comment
207 (44) Berger, A. L.; Randak, C. O.; Ostedgaard, L. S.; Karp, P. H.; Vermeer, D. W.; Welsh, M. J. Curcumin stimulates cystic fibrosis transmembrane conductance regulator Cl-channel activity. J. Biol. Chem. 2005, 280, 5221-5226. in the first cytoplasmic loop (H139R or G149R) prevents the establishment of these interactions. Login to comment
24 Wild-type, ∆F508, H139R, G149R, R258G, S945L, and H949Y CFTR cDNAs were inserted into the pcDNA3 (Invitrogen, Oakville, ON) vector as described previously.13,14 Wild-type and mutant G268V P-gp cDNAs were inserted into the pMT21 vector (Genetics Institute) as described previously.15 Baby hamster kidney (BHK) cells stably expressing CFTR or P-gp were generated by cotransfection with cDNA and pWL-neo (Stratagene, Cedar Creek, TX). Login to comment
130 (C) BHK cells expressing misprocessed CFTR mutants H139R, G149R, R258G, S945L, H949Y, or wild-type CFTR were incubated for 48 h with (+) or without (-) 3 µM CFcor-325. Whole cell extracts were subjected to immunoblot analysis with a rabbit polyclonal antibody against CFTR. Login to comment
142 BHK cells expressing mutants H139R, G149R, and R258G in the first transmembrane domain (TMD1)30 or mutants S945L and H949Y in TMD213 were treated with or without 3 µM CFcor-325 for 48 h. Whole cell SDS extracts were then subjected to immunoblot analysis. Login to comment
181 These include the substituted benzo[c]- quinolizinium compounds,39 thapsigargin,40 and curcumin.41 Drug rescue of ∆F508 CFTR with benzo[c]quinolizinium compounds, however, requires concentrations that are about 100-fold higher (250-500 µM) than that needed for CFcor-325, while rescue with thapsigargin and curcumin could not be repeated by other investigators.25,42,43 A possible explanation for the observation that curcumin treatment increased cAMP-stimulated iodide efflux in BHK cells expressing ∆F508 CFTR41 was that the compound can directly stimulate CFTR channels that were already present at the cell surface.44 We were unable to induce maturation of misprocessed CFTR mutants that had the mutations H139R or G149R in the first intracellular loop. Login to comment
205 (44) Berger, A. L.; Randak, C. O.; Ostedgaard, L. S.; Karp, P. H.; Vermeer, D. W.; Welsh, M. J. Curcumin stimulates cystic fibrosis transmembrane conductance regulator Cl- channel activity. J. Biol. Chem. 2005, 280, 5221-5226. in the first cytoplasmic loop (H139R or G149R) prevents the establishment of these interactions. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b. Login to comment

[hide] Disease-associated mutations in cytoplasmic loops ... Biochemistry. 1997 Sep 30;36(39):11966-74. Seibert FS, Jia Y, Mathews CJ, Hanrahan JW, Riordan JR, Loo TW, Clarke DM
Disease-associated mutations in cytoplasmic loops 1 and 2 of cystic fibrosis transmembrane conductance regulator impede processing or opening of the channel.
Biochemistry. 1997 Sep 30;36(39):11966-74., [PMID:9305991]

Abstract [show]
Since little is known about the contribution to function of the N-terminal cytoplasmic loops (CL1, residues 139-194; CL2, residues 242-307) of cystic fibrosis transmembrane conductance regulator (CFTR), all nine point mutations identified in CLs 1 and 2 from patients with cystic fibrosis were reconstructed in the expression vector pcDNA3-CFTR and expressed transiently in COS-1 and HEK-293 cells and stably in Chinese hamster ovary (CHO) cells. Four amino acid substitutions retarded production of mature, fully glycosylated CFTR, suggesting that misprocessing of the channel causes the disease symptoms in the affected patients. Protein maturation could not be promoted by cell culture conditions of reduced temperature (26 degrees C). When properly processed mutants were evaluated for functional defects by the iodide efflux method, the G178R- and E193K-CFTR-expressing cell lines showed impaired anion translocation activities. Patch-clamp studies of single channels revealed that E193K variants had a significantly decreased open probability, which resulted from an increase in the mean closed time of the channels. This contrasted with a previous study of disease-associated point mutations in CL3 that mainly affected the mean open time. None of the maturation-competent CL 1 and 2 mutants had altered conductance. Thus, the N-terminal CLs appear not to contribute to the anion translocation pathway of CFTR; rather, mutations in CL1 can impede transition to the open state. Interestingly, the ability of the non-hydrolyzable ATP analogue adenylyl imidodiphosphate (AMP-PNP) to lock the channel into open bursts was abolished by the I148T and G178R amino acid substitutions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 The remaining amino acid substitutions significantly decreased the yield of band C, with relative amounts of "vector only" (background) < G149R-CFTR < H139R-CFTR < R258G-CFTR < D192G-CFTR , wild-type CFTR (Figure 2, bottom). Login to comment
120 In accordance with reduced levels of processing, the H139R, G149R, D192G, and R258G mutations significantly decreased the anion translocation capability of CFTR, whereas the properly processed I148T, I175V, and R297Q variants allowed iodide movement comparable to that of wild type. Login to comment
153 When reconstructed in heterologous expression systems, four of the amino acid substitutions (H139R, G149R, D192G, and R258G) inhibited maturation and transport of CFTR to the cell surface, so that the protein cannot carry out its regular functions at that location. Login to comment

[hide] A 96-well formatted method for exon and exon/intro... Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5. Lucarelli M, Narzi L, Piergentili R, Ferraguti G, Grandoni F, Quattrucci S, Strom R
A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene.
Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5., [PMID:16635477]

Abstract [show]
Full genotypic characterization of subjects affected by cystic fibrosis (CF) is essential for the definition of the genotype-phenotype correlation as well as for the enhancement of the diagnostic and prognostic value of the genetic investigation. High-sensitivity diagnostic methods, capable of full scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, are needed to enhance the significance of these genetic assays. A method for extensive sequencing of the CFTR gene was optimized. This method was applied to subjects clinically positive for CF and to controls from the general population of central Italy as well as to a single subject heterozygous for a mild mutation and with an uncertain diagnosis. Some points that are crucial for the optimization of the method emerged: a 96-well format, primer project and purification, and amplicon purification. The optimized method displayed a high degree of diagnostic sensitivity; we identified a subset of 13 CFTR mutations that greatly enhanced the diagnostic sensitivity of common methods of mutational analysis. A novel G1244R disease causing mutation, leading to a CF phenotype with pancreatic sufficiency but early onset of pulmonary involvement, was detected in the subject with an uncertain diagnosis. Some discrepancies between our results and previously published CFTR sequence were found.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 In this work, we found a limited subset of 13 mutations (not included in the PCR/OLA/SCS assay) in 7 CFTR exons, significantly improving the sensitivity of standard assays: D110H, R117C, and H139R (exon 4); R334L, T338I, and A349V (exon 7); S549R(A->C) (exon 11); Y849X (exon 14a); L997F (exon 17a); L1065P, R1066C, and L1077P (exon 17b); and G1244E (exon 20). Login to comment

[hide] Correctors of DeltaF508 CFTR restore global confor... FASEB J. 2013 Feb;27(2):536-45. doi: 10.1096/fj.12-216119. Epub 2012 Oct 26. He L, Kota P, Aleksandrov AA, Cui L, Jensen T, Dokholyan NV, Riordan JR
Correctors of DeltaF508 CFTR restore global conformational maturation without thermally stabilizing the mutant protein.
FASEB J. 2013 Feb;27(2):536-45. doi: 10.1096/fj.12-216119. Epub 2012 Oct 26., [PMID:23104983]

Abstract [show]
Most cystic fibrosis is caused by the deletion of a single amino acid (F508) from CFTR and the resulting misfolding and destabilization of the protein. Compounds identified by high-throughput screening to improve DeltaF508 CFTR maturation have already entered clinical trials, and it is important to understand their mechanisms of action to further improve their efficacy. Here, we showed that several of these compounds, including the investigational drug VX-809, caused a much greater increase (5- to 10-fold) in maturation at 27 than at 37 degrees C (<2-fold), and the mature product remained short-lived (T(1/2) approximately 4.5 h) and thermally unstable, even though its overall conformational state was similar to wild type, as judged by resistance to proteolysis and interdomain cross-linking. Consistent with its inability to restore thermodynamic stability, VX-809 stimulated maturation 2-5-fold beyond that caused by several different stabilizing modifications of NBD1 and the NBD1/CL4 interface. The compound also promoted maturation of several disease-associated processing mutants on the CL4 side of this interface. Although these effects may reflect an interaction of VX-809 with this interface, an interpretation supported by computational docking, it also rescued maturation of mutants in other cytoplasmic loops, either by allosteric effects or via additional sites of action. In addition to revealing the capabilities and some of the limitations of this important investigational drug, these findings clearly demonstrate that DeltaF508 CFTR can be completely assembled and evade cellular quality control systems, while remaining thermodynamically unstable. He, L., Kota, P., Aleksandrov, A. A., Cui, L., Jensen, T., Dokholyan, N. V., Riordan, J. R. Correctors of DeltaF508 CFTR restore global conformational maturation without thermally stabilizing the mutant protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
181 B, C) HEK293 cells were transiently transfected with CFTR with misprocessing mutations located in CL1 (H139R), CL2 (R258G), and CL3 (S945L) (B), or in NBD1 (èc;I507 and R560T; C). Login to comment

[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]

Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17]. Login to comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment