ABCC7 p.Ser42Phe
| ClinVar: |
c.125C>T
,
p.Ser42Phe
D
, Likely pathogenic
|
| CF databases: |
c.125C>T
,
p.Ser42Phe
(CFTR1)
D
, This mutation was identified on one Italian CF chromosome.
|
| Predicted by SNAP2: | A: N (57%), C: D (66%), D: D (66%), E: D (63%), F: D (59%), G: D (53%), H: D (75%), I: D (71%), K: D (63%), L: D (71%), M: D (80%), N: N (53%), P: N (57%), Q: D (59%), R: D (66%), T: N (87%), V: D (63%), W: D (85%), Y: D (80%), |
| Predicted by PROVEAN: | A: N, C: D, D: N, E: N, F: D, G: N, H: N, I: D, K: N, L: D, M: N, N: N, P: N, Q: N, R: N, T: N, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]
Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL.
X
ABCC7 p.Ser42Phe 12007216:111:186
status: NEW[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]
Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).
Comments [show]
None has been submitted yet.
No. Sentence Comment
55 These mutations included S4X (143 C to A), exon 1; S42F (257 C to T), exon 2; R117L (482 G to T), exon 4; S549R (1779 T to G), exon 11; 3667ins4, exon 19; A1006E (3149 C to A), exon17a; L1065P (3326 T to C), R1066C (3328 C to T), L1077P (3362 T to C), exon 17b.
X
ABCC7 p.Ser42Phe 15084222:55:51
status: NEW89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency.
X
ABCC7 p.Ser42Phe 15084222:89:1470
status: NEW[hide] A large-scale study of the random variability of a... Eur J Hum Genet. 2005 Feb;13(2):184-92. Modiano G, Bombieri C, Ciminelli BM, Belpinati F, Giorgi S, Georges M, Scotet V, Pompei F, Ciccacci C, Guittard C, Audrezet MP, Begnini A, Toepfer M, Macek M, Ferec C, Claustres M, Pignatti PF
A large-scale study of the random variability of a coding sequence: a study on the CFTR gene.
Eur J Hum Genet. 2005 Feb;13(2):184-92., [PMID:15536480]
Abstract [show]
Coding single nucleotide substitutions (cSNSs) have been studied on hundreds of genes using small samples (n(g) approximately 100-150 genes). In the present investigation, a large random European population sample (average n(g) approximately 1500) was studied for a single gene, the CFTR (Cystic Fibrosis Transmembrane conductance Regulator). The nonsynonymous (NS) substitutions exhibited, in accordance with previous reports, a mean probability of being polymorphic (q > 0.005), much lower than that of the synonymous (S) substitutions, but they showed a similar rate of subpolymorphic (q < 0.005) variability. This indicates that, in autosomal genes that may have harmful recessive alleles (nonduplicated genes with important functions), genetic drift overwhelms selection in the subpolymorphic range of variability, making disadvantageous alleles behave as neutral. These results imply that the majority of the subpolymorphic nonsynonymous alleles of these genes are selectively negative or even pathogenic.
Comments [show]
None has been submitted yet.
No. Sentence Comment
33 In the Tajima`s test,19 the null hypothesis of neutrality is rejected if a statistically significant difference between p Common and rare nonsynonymous and synonymous cSNSs G Modiano et al European Journal of Human Genetics Table 1 List of the 61 cSNSsa encountered in the present survey The random samples of genes (and the technique utilized) cSNS variants found NE Italy (DGGE) Central Italy (DGGE) Southern France (DGGE) Northern France (DHPLC) Spain (SSCA) Czechia (DGGE) Hb  104 Exon Exon Length (bp) Ref. no. SNS SASc 1st 100d 2nd 500 1st 100d 2nde 1st 100d 2nd 500 1st 100 2nde 82d 72 Abs. Freq. Total sample size q  104 se  104 NSf Sf 1g 53 0 0 0 0 0/452 0 924 2 111 1 223C4T R31C 1 1 1/500 1 1 0 0/450 0 5 (11) 1 932 (2 432) 45.23 13.61 90 2 224G4T R31L 0 0 0/500 0 0 0 1/450 0 1 1 932 5.17 5.17 10 3 257C4T S42F 0 0 1/500 0 0 0 0/450 0 1 1 932 5.17 5.17 10 3 109 4 334A4G K68E 1 0 0 0/498 0 0 0 0/452 0 0 1 2 504 3.99 3.99 8 5 352C4T R74W 0 0 0 0/498 0 0 0 1/452 0 0 1 2 504 3.99 3.99 8 6 356G4A R75Q 1 7 1 7/498 2 9 2 9/452 0 2 40 (40) 2 504 (2 544) 157.23 24.66 310 7 386G4A G85E 0 0 1 1/498 0 0 0 0/452 0 0 2 2 504 7.99 5.65 16 4 216 8 482G4A R117H 0 0 0 0/292 0 2 0 1/456 0 0 3 2 302 13.03 7.52 26 9 528T4G I132M 0 0 0 0/292 0 0 0 1/456 0 0 1 2 302 4.34 4.34 8 10 575T4C I148T 1 2 0 1/292 0 0 0 1/456 0 1 6 2 302 26.06 10.63 52 5 90 11 640C4T R170C 0 0 0 0/6 0 0 1/448 0 1 1 436 6.96 6.96 14 12 641G4A R170H 1 1 0 0/6 0 0 2/448 0 4 (4) 1 436 (1 930) 20.73 10.35 41 6a 164 0 0 0/6 0 0 0/432 0 0 992 6b 126 0 0 0/6 0 0 0/454 0 942 7 247 0 0 0/6 0 0 0/796 0 1 284 8 93 13 1281G4A L383 0 0 0 0/6 0 0 1/456 0 0 1 1 516 6.60 6.60 13 9 183 14 1402G4A G424S 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 15 1459G4T D443Y 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 10 192 16 1540A4G M470Vh 42 197 30 37/96 39 199 (i) (i) 27 571(736) 1 484 (1 912) 3849.37 111.28 4 735 17 1598C4A S489X 0 0 0 0/96 0 0 0 1/796 0 1 2 374 4.21 4.21 8 18 1648A4G I506V 1 0 0 0/96 0 0 0 0/796 0 1 2 374 4.21 4.21 8 19 1655T4G F508C 0 1 0 0/96 0 0 0 1/796 0 2 2 038 8.42 5.96 17 20 1716G4A Q528 2 16 1 0/96 0 19 i I 5 43 (58) 1 478 (2 024) 286.56 37.08 557 11 95 21 1756G4T G542X 0 2 0 0/134 0 0 0/796 0 0 2 1 984 10.08 7.12 20 22 1764T4G G544 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 23 1784G4A G551D 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 12 87 24 1816G4A V562I 0 0 0 0 1 0 0/450 0 0 1 (1) 2 004 (2 504) 3.99 3.99 8 25 1816G4C V562L 0 0 0 1 0 0 1/450 0 0 2 (3) 2 004 (2 504) 11.98 6.91 24 26 1859G4C G576A 1 2 0 1 11 0 8/450 0 0 23 (27) 2 004 (2 538) 106.38 20.36 213 13 724j 449 27 1997G4A G622D 0 0 0/80 0/96 1 0 0 0/444 0 1 2 002 5.00 5.00 10 28 2082C4T F650 1 0 0/80 0/20 0 0 0 0/444 0 1 (1) 1 926 (2 412) 4.15 4.15 8 29 2134C4T R668C 1 2 0/80 0/96 1 11 0 12/444 0 27(32) 2 002 (2 558) 125.10 21.98 247 275 30 2377C4T L748 0 0 0/6 0 1 1 388 25.77 25.77 52 14a 129 31 2670G4A W846X 0 0 0/6 0 1 0/452 0/80 0 1 1 010 9.90 9.90 20 32 2694T4G T854 33 23 0/6 33 38 149/452 14/80 11 301 1 010 2980.20 143.92 4 184 33 2695G4A V855I 0 0 0/6 0 0 1/452 0/80 0 1 1 010 9.90 9.90 20 14b 38 0 0 0 0/520 0 0 0 0/446 0 2 448 15 251 34 2816G4C S895T 0 0 0/6 0 0 2/436 0 0 2 996 20.08 14.18 40 35 2831A4C N900T 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 36 2988G4C M952I 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 37 3030G4A T966 (2)k (1)k 0 6/436 0 6 (25)k 618 (1814)k 137.82 27.37 272 38 3032T4C L967S 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 16 80 0 0 0/498 0 0 0/450 0 0 1 502 17a 151 39 3123G4C L997F 0 2 2 1/494 0 7 1 4/454 0 0 17 2 502 67.95 16.42 135 40 3157G4A A1009T 0 2 0 0/494 0 0 0 0/454 0 0 2 2 502 7.99 5.65 16 41 3212T4C I1027T 1 0 0 0/494 0 0 0 0/454 0 0 1 2 502 4.00 4.00 8 17b 228 42 3286T4G F1052V 1 1 0 1/194 0 0 0 0/452 0 0 3 (3) 2 200 (2 240) 13.39 7.73 27 43 3337G4A G1069R 0 1 0 0/194 0 0 0 0/452 0 0 1 2 200 4.55 4.55 9 CommonandrarenonsynonymousandsynonymouscSNSs GModianoetal 186 EuropeanJournalofHumanGenetics 44 3345G4T Q1071H 0 0 0 0/194 0 1 0 0/452 0 0 1 2 200 4.55 4.55 9 45 3417A4T T1995 1 3 0 0/194 1 1 0 0/452 0 0 6 (8) 2 200 (2 506) 31.92 11.27 64 46 3419T4G L1096R 0 0 0 0/194 1 0 0 0/452 0 0 1 2 200 4.55 4.55 9 47 3477C4A T1115 0 0 0 0/194 0 0 0 1/452 0 0 1 2 200 4.55 4.55 9 18 101 48 3523A4G I1131V 0 0 1 0/10 0 0 0/448 0 0 1 (2) 1 512 (1 908) 10.48 7.07 21 49 3586G4C D1152H 0 0 0 0/10 0 0 1/448 0 0 1 1 512 6.61 6.61 13 19 249 50 3617G4T R1162L 0 0 1 1/494 0 0/260 0 0/454 0 0 2 2 262 8.84 6.25 18 51 3690A4G Q1186 0 0 0 0/494 0 0/260 0 0/454 1 0 1 2 262 4.42 4.42 9 52 3813A4G L1227 0 1 0 0/494 0 0/260 0 0/454 0 0 1 2 262 4.42 4.42 9 53 3837T4G S1235R 1 1 0 1/494 0 4/260 0 7/454 0 1 15 (15) 2 262 (2 310) 69.94 16.71 140 20 156 54 4002A4G P1290 2 3 0/6 3 5 18/454 3/80 2 36 1 012 357.73 58.22 690 21 90 55 4009G4A V1293I 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 56 4029A4G T1299 1 0 0/6 0 1/300 0 1/456 0 0 3 (8) 1 316 (2 330) 34.33 12.12 69 57 4041C4G N1303K 1 0 0/6 0 0/300 0 0/456 0 0 1 1 316 7.60 7.60 15 58 4085T4C V1318A 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 22 173 0 0 0/18 0 0 0/450 0 0 1 022 23 106 0 0 0 0/6 0 0 0/448 0 1 436 24l 198+3 59 4404C4T Y1424 1 0 0/6 1 2 5/420 0 2 11 (32) 980 (2 516) 127.19 22.34 251 60m 4521G4A Q1463 (21) (16) (3/32) (14/80) (30) (94/420) 15/76 (17) 15 (227) 76 (1052) 2142.86 131.07 3 367 61 4563T4C D1477 0 0 0/6 0 1 0/420 0 0 1 980 10.20 10.20 20 Totals 6 525 9 584 16 109 The bracketed figures include also the RFLP analysis data (see Materials and methods); the NE Italy, Central Italy, Southern and Northern France are each subdivided into two samples where the 1st is made up of 100 genes.
X
ABCC7 p.Ser42Phe 15536480:33:838
status: NEW[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]
Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.
Comments [show]
None has been submitted yet.
No. Sentence Comment
76 This test involved nine subjects from the infertile group, revealing the occurrence of the following rare mutations: E217G, T1054A, W356X, D443Y and 3667insTC in males and L997F and R297Q in females and 29 subjects from the control, in which we found: A1009T, D110Y, E826K, G1069R, G1130A, G194V, I556V, L320F, M348K, M82V, P1290T, R117C, R352W, R74W, S42F, S660T, S911R, S912L, T1086A, T582S, V920L and Y89C.
X
ABCC7 p.Ser42Phe 16126774:76:355
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... Cancer. 2010 Jan 1;116(1):203-9. McWilliams RR, Petersen GM, Rabe KG, Holtegaard LM, Lynch PJ, Bishop MD, Highsmith WE Jr
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations and risk for pancreatic adenocarcinoma.
Cancer. 2010 Jan 1;116(1):203-9., 2010-01-01 [PMID:19885835]
Abstract [show]
BACKGROUND: Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are common in white persons and are associated with pancreatic disease. The purpose of this case-control study was to determine whether CFTR mutations confer a higher risk of pancreatic cancer. METHODS: In a case-control study, the authors compared the rates of 39 common cystic fibrosis-associated CFTR mutations between 949 white patients with pancreatic adenocarcinoma and 13,340 white controls from a clinical laboratory database for prenatal testing for CFTR mutations. The main outcome measure was the CFTR mutation frequency in patients and controls. RESULTS: Overall, 50 (5.3%) of 949 patients with pancreatic cancer carried a common CFTR mutation versus 510 (3.8%) of 13,340 controls (odds ratio [OR], 1.40; 95% confidence interval [CI], 1.04-1.89; P = .027). Among patients who were younger when their disease was diagnosed (<60 years), the carrier frequency was higher than in controls (OR, 1.82; 95% CI, 1.14-2.94; P = .011). In patient-only analyses, the presence of a mutation was associated with younger age (median 62 vs 67 years; P = .034). In subgroups, the difference was seen only among ever-smokers (60 vs 65 years, P = .028). Subsequent sequencing analysis of the CFTR gene detected 8 (16%) compound heterozygotes among the 50 patients initially detected to have 1 mutation. CONCLUSIONS: Carrying a disease-associated mutation in CFTR is associated with a modest increase in risk for pancreatic cancer. Those affected appear to be diagnosed at a younger age, especially among smokers. Clinical evidence of antecedent pancreatitis was uncommon among both carriers and noncarriers of CFTR mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
95 S42F has been described in 1 Italian CF patient.25 E528E is a synonymous polymorphism involving the last base pair in exon 10 (1716 G > A), which has been reported to affect splicing, but has not been linked to severe pulmonary disease.26 S912L is thought to be a neutral variant (serine for a leucine), unless in cis position to another mutation.27 The F1052V missense mutation is a variant with a modest effect, with normal or near-normal sweat chloride tests in combination with other mild variants.28,29 N1088S is a novel mutation that substitutes asparagine for a serine amino acid, both positively charged, and its functionality is unclear.
X
ABCC7 p.Ser42Phe 19885835:95:0
status: NEW103 Compound Heterozygotes Among Pancreatic Cancer Cases CFTR Mutations Sex Age at Diagnosis, y Ever/Never Smoker Family History of Pancreatic Cancer Pancreatitis ‡3 Years Before Cancer Diagnosis df508/S42F M 70 Nonsmoker No No R117H/E528E (splice site) M 75 Smoker Yes No df508/S912L W 56 Smoker No No df508/N1088S W 73 Smoker No No df508/M1191I M 79 Smoker No No df508/S1235R M 73 Smoker No No df508/F1052V M 49 Smoker No No df508/5T M 60 Smoker No No Man indicates man; W, woman.
X
ABCC7 p.Ser42Phe 19885835:103:205
status: NEW[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]
Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.
Comments [show]
None has been submitted yet.
No. Sentence Comment
74 For many of these subjects mutations were identified following DGGE and/or dHPLC analysis, and not through the RDB-based test, as gene alterations are "rare"/uncommon [A238V, R352W, S42F, (V201M, D1270N & R74W) and L206W] or because they have never been identified before [D372E (1251T→G) and L1414S (4373T→C)].
X
ABCC7 p.Ser42Phe 19897426:74:182
status: NEW89 Mutations found in the homozygous (n=2) and heterozygous (n=20) diagnosed foetuses are the following: ΔF508/ΔF508 (n=1), 711+5G→A/711+5G→A (n=1), ΔF508/P5L (n=1), 2183AA→G/S42F (n=1), ΔF508/ D1445N (n=1), 711+5G→A/ΔF508 (n=1), G542X/E527G (n=1), N1303K/1717-1 G→A (n=1), R117H/E527G (n=1), ΔF508/2183AA→G (n=1), ΔF508/D1152H (n=1), R347H/ ΔF508 (n=1), ΔF508/G542X (n=2), ΔF508/N1303K (n=2), R1162X/ΔF508 (n=3), N1303K/D1152H (n=3).
X
ABCC7 p.Ser42Phe 19897426:89:211
status: NEW97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction.
X
ABCC7 p.Ser42Phe 19897426:97:881
status: NEW99 Notes to Tables: (A) CFTR mutations A238V, R352W, 4006-19del3, S42F, D372E (1251T→G), L1414S (4373T→C), (V201M, D1270N & R74W) and L206W are not included in the RDB-based screening.
X
ABCC7 p.Ser42Phe 19897426:99:63
status: NEW[hide] Distribution of CFTR mutations in the Czech popula... J Cyst Fibros. 2013 Sep;12(5):532-7. doi: 10.1016/j.jcf.2012.12.002. Epub 2012 Dec 29. Krenkova P, Piskackova T, Holubova A, Balascakova M, Krulisova V, Camajova J, Turnovec M, Libik M, Norambuena P, Stambergova A, Dvorakova L, Skalicka V, Bartosova J, Kucerova T, Fila L, Zemkova D, Vavrova V, Koudova M, Macek M, Krebsova A, Macek M Jr
Distribution of CFTR mutations in the Czech population: positive impact of integrated clinical and laboratory expertise, detection of novel/de novo alleles and relevance for related/derived populations.
J Cyst Fibros. 2013 Sep;12(5):532-7. doi: 10.1016/j.jcf.2012.12.002. Epub 2012 Dec 29., [PMID:23276700]
Abstract [show]
BACKGROUND: This two decade long study presents a comprehensive overview of the CFTR mutation distribution in a representative cohort of 600 Czech CF patients derived from all regions of the Czech Republic. METHODS: We examined the most common CF-causing mutations using the Elucigene CF-EU2v1 assay, followed by MLPA, mutation scanning and/or sequencing of the entire CFTR coding region and splice site junctions. RESULTS: We identified 99.5% of all mutations (1194/1200 CFTR alleles) in the Czech CF population. Altogether 91 different CFTR mutations, of which 20 were novel, were detected. One case of de novo mutation and a novel polymorphism was revealed. CONCLUSION: The commercial assay achieved 90.7%, the MLPA added 1.0% and sequencing increased the detection rate by 7.8%. These comprehensive data provide a basis for the improvement of CF DNA diagnostics and/or newborn screening in our country. In addition, they are relevant to related Central European populations with lower mutation detection rates, as well as to the sizeable North American "Bohemian diaspora".
Comments [show]
None has been submitted yet.
No. Sentence Comment
48 [125CNT]+[223CNT] S42F/R75X# Ex2/Ex3 1 0.08 44. c.164+1GNA 296+1GNA In2 1 0.08 45. c.274GNA E92K# Ex4 1 0.08 46. c.349CNT R117C*# Ex4 1 0.08 47. c.509GNA R170H Ex5 1 0.08 48. c.533GNA G178E Ex5 1 0.08 49. c.579+1GNT 711+1GNT*# In5 1 0.08 50. c.902ANG Y301C Ex7 1 0.08 51. c.1040GNA R347H*# Ex7 1 0.08 52. c.1114CNT Q372X Ex7 1 0.08 53. c.1117-1GNA 1249-1GNA In7 1 0.08 54. c.1209+1GNA 1341+1GNA# In8 1 0.08 55. c.1519_1521delATC I507del*# Ex10 1 0.08 56. c.1654CNT Q552X# Ex11 1 0.08 57. c.1673TNC L558S# Ex11 1 0.08 58. c.1679+1GNC 1811+1GNC In11 1 0.08 59. c.1687TNC Y563H Ex12 1 0.08 60. c.1753GNT E585X# Ex12 1 0.08 61. c.1766+1GNC 1898+1GNC In12 1 0.08 62. c.2044delA 2176delA Ex13 1 0.08 63. c.2051_2052delAAinsG 2183delAANG# Ex13 1 0.08 64. c.2052delA 2184delA*# Ex13 1 0.08 3.
X
ABCC7 p.Ser42Phe 23276700:48:18
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2015 Sep;14(5):661-7. doi: 10.1016/j.jcf.2015.03.009. Epub 2015 Apr 11. Chang MC, Jan IS, Liang PC, Jeng YM, Yang CY, Tien YW, Wong JM, Chang YT
Cystic fibrosis transmembrane conductance regulator gene variants are associated with autoimmune pancreatitis and slow response to steroid treatment.
J Cyst Fibros. 2015 Sep;14(5):661-7. doi: 10.1016/j.jcf.2015.03.009. Epub 2015 Apr 11., [PMID:25869325]
Abstract [show]
BACKGROUND: Autoimmune pancreatitis (AIP) is a distinct type of chronic pancreatitis. To date, the association of CFTR gene variants with AIP has not been studied. METHODS: The entire coding and intronic regions of the CFTR gene were examined using next-generation sequencing in 89 AIP patients. Clinical features, including imaging, histology, serology, steroid treatment response and extra-pancreatic involvement, were compared between AIP patients with and without CFTR gene variants. RESULTS: A total of 28.1% (25/89) of the AIP patients carried 26 CFTR variants, including nine with I556V, seven with 5T, four with S42F, two with I125T, and one each with R31C, R553X, S895N, and G1069R. The presence of CFTR variants and age was independent predictors of the response to steroid treatment, as shown by multivariate analysis. CONCLUSIONS: CFTR variants are associated with AIP. Because AIP patients with CFTR variants show slower and reduced steroid treatment responses, different treatments should be considered in AIP patients with CFTR variants.
Comments [show]
None has been submitted yet.
No. Sentence Comment
8 Results: A total of 28.1% (25/89) of the AIP patients carried 26 CFTR variants, including nine with I556V, seven with 5T, four with S42F, two with I125T, and one each with R31C, R553X, S895N, and G1069R.
X
ABCC7 p.Ser42Phe 25869325:8:132
status: NEW112 The identified variants included I556V in nine patients, 5T in seven, S42F in four, I125T in two, and R31C, R553X, S895N, and G1069R each in one patient (Table 1).
X
ABCC7 p.Ser42Phe 25869325:112:70
status: NEW140 AIP (n = 89) CFTR variants n = 26 % in AIP % with variant I556V 9 10.1% 34.6% 5 T 7 7.9% 26.9% S42F 4 4.5% 15.4% I125T 2 2.2% 7.7% R31C 1 1.1% 3.8% R553X 1 1.1% 3.8% S895T 1 1.1% 3.8% G1069R 1 1.1% 3.8% Table 2 Comparison of patients with and without CFTR variants in 89 patients with autoimmune pancreatitis.
X
ABCC7 p.Ser42Phe 25869325:140:95
status: NEW149 The most common CFTR variant in AIP patients was I556V (34.6%), followed by the T5 allele in intron 8 (26.9%) and S42F (15.4%).
X
ABCC7 p.Ser42Phe 25869325:149:114
status: NEW151 The S42F mutation was not detected in ICP and HLP patients in our previous studies [19,20].
X
ABCC7 p.Ser42Phe 25869325:151:4
status: NEW[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]
Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.
Comments [show]
None has been submitted yet.
No. Sentence Comment
54 [1117-8A>G;1727G>C; 2002C>T]) and mutations G1069R (p.Gly1069Arg), D614G (p.Asp614Gly), S42F (p.Ser42Phe) and S912L (p.Ser912Leu) should also be considered as part of this extension, even if not found in CF-PI but studied up to the DEL step because they are found in genotypes with an unknown allele.
X
ABCC7 p.Ser42Phe 25910067:54:88
status: NEWX
ABCC7 p.Ser42Phe 25910067:54:96
status: NEW363 [72G>C;164+2T>G] uncertain: CF-PI and/or CF-PS L24F nd; 296+2T>G nd R31C c.91C>T CFTR-RD non CF-causing p.Arg31Cys S42F c.125C>T uncertain: found only with an unknown allele in trans nd p.Ser42Phe E56G c.167G>A CBAVD nd p.Glu56Lys [R74W;V201M;D1270N] c.
X
ABCC7 p.Ser42Phe 25910067:363:115
status: NEWX
ABCC7 p.Ser42Phe 25910067:363:188
status: NEW