ABCMdb

ABCC7 p.Asp192Gly

ClinVar:	c.574G>A , p.Asp192Asn ? , not provided c.575A>G , p.Asp192Gly ? , not provided
CF databases:	c.574G>A , p.Asp192Asn (CFTR1) D , It creates a Msel restriction site in the DNA sequence. The mutation was found in an adult CF patient who has pulmonary infections since childhood. The patient is [delta]F508 heterozygous. c.575A>G , p.Asp192Gly (CFTR1) ? , This mutation was identified by DGGE and direct sequencing. The nucleotide change A->G at position 707 in exon 5 leads to D192G. This mutation was identified on one chromosome of a Yugoslavian patient in collaboration with Dr. Canki Klain.
Predicted by SNAP2:	A: D (95%), C: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: N, C: D, E: N, F: D, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, R: N, S: N, T: N, V: N, W: D, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]

Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
369 H139R, G149R, D192G and R258G in the two first CLs inhibited maturation and transport of CFTR to the cell surface. Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment

[hide] Channel-lining residues in the M3 membrane-spannin... Biochemistry. 1998 Sep 1;37(35):12233-40. Akabas MH
Channel-lining residues in the M3 membrane-spanning segment of the cystic fibrosis transmembrane conductance regulator.
Biochemistry. 1998 Sep 1;37(35):12233-40., 1998-09-01 [PMID:9724537]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) forms a chloride-selective channel. Residues from the 12 putative membrane-spanning segments form at least part of the channel lining. We need to identify the channel-lining residues in order to understand the structural basis for the channel's functional properties. Using the substituted-cysteine-accessibility method we mutated to cysteine, one at a time, 24 consecutive residues (Asp192-Ile215) in the M3 membrane-spanning segment. Cysteines substituted for His199, Phe200, Trp202, Ile203, Pro205, Gln207, Leu211, and Leu214 reacted with charged, sulfhydryl-specific reagents that are derivatives of methanethiosulfonate (MTS). We infer that these residues are on the water-accessible surface of the protein and probably form a portion of the channel lining. When plotted on an alpha-helical wheel the exposed residues from Gln207 to Leu214 lie within an arc of 60 degrees; the exposed residues in the cytoplasmic half (His199-Ile203) lie within an arc of 160 degrees. We infer that the secondary structures of the extracellular and cytoplasmic halves of M3 are alpha-helical and that Pro205, in the middle of the M3 segment, may bend the M3 segment, moving the cytoplasmic end of the segment in toward the central axis of the channel. The bend in the M3 segment may help to narrow the channel lumen near the cytoplasmic end. In addition, unlike full-length CFTR, the current induced by the deletion construct, Delta259, is inhibited by the MTS reagents, implying that the channel structure of Delta259 is different than the channel structure of wild-type CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
222 Several mutations of residues in and flanking the M3 membrane-spanning segment have been identified in patients with CF, including D192G, E193K, H199Y, P205S, and L206W (58, 60-63). Login to comment

[hide] Analysis of the CFTR gene in Iranian cystic fibros... J Cyst Fibros. 2008 Mar;7(2):102-9. Epub 2007 Jul 27. Alibakhshi R, Kianishirazi R, Cassiman JJ, Zamani M, Cuppens H
Analysis of the CFTR gene in Iranian cystic fibrosis patients: identification of eight novel mutations.
J Cyst Fibros. 2008 Mar;7(2):102-9. Epub 2007 Jul 27., [PMID:17662673]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most common inherited disorder in Caucasian populations, with over 1400 mutations identified in the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene. Mutations in the CFTR gene may be also causative for CBAVD (Congenital Bilateral Absence of the Vas Deferens). The type and distribution of mutations varies widely between different countries and/or ethnic groups, and is relatively unknown in Iran. We therefore performed a comprehensive analysis of the CFTR gene in Iranian CF patients. METHODS: 69 Iranian CF patients, and 1 CBAVD patient, were analysed for mutations in the complete coding region, and its exon/intron junctions, of their CFTR genes, using different methods, such as ARMS (amplification refractory mutation system)-PCR, SSCP (single stranded conformation polymorphism) analysis, restriction enzyme digestion analysis, direct sequencing, and MLPA (Multiplex Ligation-mediated Probe Amplification). RESULTS: CFTR mutation analysis revealed the identification of 37 mutations in 69 Iranian CF patients. Overall, 81.9% (113/138) CFTR genes derived from Iranian CF patients could be characterized for a disease-causing mutation. The CBAVD patient was found to be homozygous for the p.W1145R mutation. The most common mutations were p.F508del (DeltaF508) (18.1%), c.2183_2184delAAinsG (2183AA>G) (6.5%), p.S466X (5.8%), p.N1303K (4.3%), c.2789+5G>A (4.3%), p.G542X (3.6%), c.3120+1G>A (3.6%), p.R334W (2.9%) and c.3130delA (2.9%). These 9 types of mutant CFTR genes totaled for 52% of all CFTR genes derived from the 69 Iranian CF patients. Eight mutations, c.406-8T>C, p.A566D, c.2576delA, c.2752-1_2756delGGTGGCinsTTG, p.T1036I, p.W1145R, c.3850-24G>A, c.1342-?_1524+?del, were found for the first time in this study. CONCLUSIONS: We identified 37 CFTR mutations in 69 well characterized Iranian CF patients, obtaining a CFTR mutation detection rate of 81.9%, the highest detection rate obtained in the Iranian population so far. These findings will assist in genetic counseling, prenatal diagnosis and future screening of CF in Iran.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 1 c.406-3TNC I3 T to C at 406-3 mRNA splicing defect 1 p.R170H E5 G to A at 641 Arg to His at 170 1 p.D192G E5 A to G at 707 Asp to Gly at 192 2 p.R334W E7 C to T at 1132 Arg to Trp at 334 4 c.1525-1GNA I9 G to A at 1525-1 mRNA splicing defect 2 p.F508del E10 Deletion of CTT from 1653 Deletion of Phe at 508 25 p.S466X E10 C to G at 1529 Ser to stop at 466 8 c.1677delTA E10 Deletion of TA from 1677 Frame shift 2 p.G542X E11 G to T at 1756 Gly to stop at 542 5 p.S549R E11 T to G at 1779 Ser to Arg at 549 2 p.A566D E12 C to A at 1829 Ala to Asp at 566 2 c.1898+1GNT I12 G→T at 1898+1 mRNA splicing defect 2 c.2183_2184delAAinsG E13 A to G at 2183 and deletion of A at 2184 Frame shift 9 c.2576delA E13 Deletion of A at 2576 Frame shift 1 c.2043delG E13 Deletion of A at 2043 Frame shift 1 c.2184insA E13 Insertion of A after 2184 Frame shift 1 p.R785X E13 C to T at 2485 Arg to stop at 785 2 c.2752-1_2756delGGTGGCinsTTG I14a/ Deletion of GGTGGC mRNA splicing defect 2 E14b From 2752-1 to 2756 and insertion TTG c.2789+5GNA I14b G to A at 2789+5 mRNA splicing defect 6 p.S945L E15 C to Tat 2966 Ser to Leu at 945 2 c.3120+1GNA I16 G to A at 3120+1 mRNA splicing defect 5 c.3121-1GNA I16 G to A at 3121-1 mRNA splicing defect 2 c.3130delA E17a Deletion of A at 3130 Frame shift 4 p.T1036I E17a C to T at 3239 Thr to Ile at 1036 1 p.R1066C E17b C to T at 3328 Arg to Cys at 1066 1 p.L1077P E17b T to C at 3362 Leu to Pro at 1077 1 p.T1086I E17b C to T at 3389 Thr to Ile at 1086 1 p.R1162X E19 C to T at 3616 Arg to stop at 1162 2 p.K1177X E19 A to T at 3361 Lys to stop at 1177 2 c.3850-24GNA I19 G to A at 3850-24 mRNA splicing defect? Login to comment
66 Results A total of 69 unrelated CF patients (38 male and 31 female; aged between 2 months and 15 years) of Iranian Table 2 Genotype of CFTR genes in 53 Iranian patients Genotype Exon/intron Number of patients p.F508del/p.F508del E10/E10 10 p.F508del/p.R1162X E10/E19 2 p.F508del/p.T1036I E10/E17a 1 p.F508del/p.R1066C E10/E17b 1 p.F508del/c.1342-?_1524+?del E10/E9 1 p.S466X/p.S466X E10/E10 4 c.2183_2184delAAinsG/ c.2183_2184delAAinsG E13/E13 4 c.2183_2184delAAinsG/c.186- ?_296+?del E13/E2 1 p.N1303K/p.N1303K E21/E21 2 p.N1303K/p.S945L E21/E15 1 p.N1303K/c.1677delTA E21/E10 1 p.G542X/p.G542X E11/E11 2 p.G542X/c.2789+5GNA E11/I14b 1 c.3120+1GNA/c.3120+1GNA I16/I16 2 c.3120+1GNA/c.3121-1GNA I16 1 c.3121-1GNA/p.T1086I I16/E17b 1 c.3130delA/c.3130delA E17a/E17a 2 p.D192G/p.D192G E5/E5 1 p.R334W/p.R334W E7/E7 1 p.R334W/p.S945L E7/E15 1 p.R334W/p.L1077P E7/E17b 1 c.1525-1GNA/c.1525-1GNA I9/I9 1 p.S549R/p.S549R E11/E11 1 p.A566D/p.A566D E12/E12 1 c.1898+1GNT/c.1898+1GNT I12/I12 1 c.2576delA/p.S1455X/ E13/E24 1 c.2184insA/c.1677delTA E10/E13 1 p.R785X/p.R785X E13/E13 1 c.2752-1_2756delGGTGGCinsTTG/ c.2752-1_2756delGGTGGCinsTTG I14a/E14b 1 c.2789+5GNA/c.2789+5GNA I14b/I14b 1 p.K1177X/p.K1177X E19/E19 1 c.406-?_1716+?del/c.406-?_1716+?del E4-E10/E4-E10 1 Total 53 origin were extensively studied for the presence of mutations in the CFTR gene, for the presence of the deep intronic 3849+10 kbC→T mutation, and large deletions/ duplications. Login to comment
65 Results A total of 69 unrelated CF patients (38 male and 31 female; aged between 2 months and 15 years) of Iranian Table 2 Genotype of CFTR genes in 53 Iranian patients Genotype Exon/intron Number of patients p.F508del/p.F508del E10/E10 10 p.F508del/p.R1162X E10/E19 2 p.F508del/p.T1036I E10/E17a 1 p.F508del/p.R1066C E10/E17b 1 p.F508del/c.1342-?_1524+?del E10/E9 1 p.S466X/p.S466X E10/E10 4 c.2183_2184delAAinsG/ c.2183_2184delAAinsG E13/E13 4 c.2183_2184delAAinsG/c.186- ?_296+?del E13/E2 1 p.N1303K/p.N1303K E21/E21 2 p.N1303K/p.S945L E21/E15 1 p.N1303K/c.1677delTA E21/E10 1 p.G542X/p.G542X E11/E11 2 p.G542X/c.2789+5GNA E11/I14b 1 c.3120+1GNA/c.3120+1GNA I16/I16 2 c.3120+1GNA/c.3121-1GNA I16 1 c.3121-1GNA/p.T1086I I16/E17b 1 c.3130delA/c.3130delA E17a/E17a 2 p.D192G/p.D192G E5/E5 1 p.R334W/p.R334W E7/E7 1 p.R334W/p.S945L E7/E15 1 p.R334W/p.L1077P E7/E17b 1 c.1525-1GNA/c.1525-1GNA I9/I9 1 p.S549R/p.S549R E11/E11 1 p.A566D/p.A566D E12/E12 1 c.1898+1GNT/c.1898+1GNT I12/I12 1 c.2576delA/p.S1455X/ E13/E24 1 c.2184insA/c.1677delTA E10/E13 1 p.R785X/p.R785X E13/E13 1 c.2752-1_2756delGGTGGCinsTTG/ c.2752-1_2756delGGTGGCinsTTG I14a/E14b 1 c.2789+5GNA/c.2789+5GNA I14b/I14b 1 p.K1177X/p.K1177X E19/E19 1 c.406-?_1716+?del/c.406-?_1716+?del E4-E10/E4-E10 1 Total 53 origin were extensively studied for the presence of mutations in the CFTR gene, for the presence of the deep intronic 3849+10 kbC࢐T mutation, and large deletions/ duplications. Login to comment

[hide] Disease-associated mutations in cytoplasmic loops ... Biochemistry. 1997 Sep 30;36(39):11966-74. Seibert FS, Jia Y, Mathews CJ, Hanrahan JW, Riordan JR, Loo TW, Clarke DM
Disease-associated mutations in cytoplasmic loops 1 and 2 of cystic fibrosis transmembrane conductance regulator impede processing or opening of the channel.
Biochemistry. 1997 Sep 30;36(39):11966-74., [PMID:9305991]

Abstract [show]
Since little is known about the contribution to function of the N-terminal cytoplasmic loops (CL1, residues 139-194; CL2, residues 242-307) of cystic fibrosis transmembrane conductance regulator (CFTR), all nine point mutations identified in CLs 1 and 2 from patients with cystic fibrosis were reconstructed in the expression vector pcDNA3-CFTR and expressed transiently in COS-1 and HEK-293 cells and stably in Chinese hamster ovary (CHO) cells. Four amino acid substitutions retarded production of mature, fully glycosylated CFTR, suggesting that misprocessing of the channel causes the disease symptoms in the affected patients. Protein maturation could not be promoted by cell culture conditions of reduced temperature (26 degrees C). When properly processed mutants were evaluated for functional defects by the iodide efflux method, the G178R- and E193K-CFTR-expressing cell lines showed impaired anion translocation activities. Patch-clamp studies of single channels revealed that E193K variants had a significantly decreased open probability, which resulted from an increase in the mean closed time of the channels. This contrasted with a previous study of disease-associated point mutations in CL3 that mainly affected the mean open time. None of the maturation-competent CL 1 and 2 mutants had altered conductance. Thus, the N-terminal CLs appear not to contribute to the anion translocation pathway of CFTR; rather, mutations in CL1 can impede transition to the open state. Interestingly, the ability of the non-hydrolyzable ATP analogue adenylyl imidodiphosphate (AMP-PNP) to lock the channel into open bursts was abolished by the I148T and G178R amino acid substitutions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 The remaining amino acid substitutions significantly decreased the yield of band C, with relative amounts of "vector only" (background) < G149R-CFTR < H139R-CFTR < R258G-CFTR < D192G-CFTR , wild-type CFTR (Figure 2, bottom). Login to comment
120 In accordance with reduced levels of processing, the H139R, G149R, D192G, and R258G mutations significantly decreased the anion translocation capability of CFTR, whereas the properly processed I148T, I175V, and R297Q variants allowed iodide movement comparable to that of wild type. Login to comment
153 When reconstructed in heterologous expression systems, four of the amino acid substitutions (H139R, G149R, D192G, and R258G) inhibited maturation and transport of CFTR to the cell surface, so that the protein cannot carry out its regular functions at that location. Login to comment

[hide] Human epithelial cystic fibrosis transmembrane con... Biophys J. 1996 Dec;71(6):3148-56. Xie J, Drumm ML, Zhao J, Ma J, Davis PB
Human epithelial cystic fibrosis transmembrane conductance regulator without exon 5 maintains partial chloride channel function in intracellular membranes.
Biophys J. 1996 Dec;71(6):3148-56., [PMID:8968585]

Abstract [show]
The cardiac isoform of the cystic fibrosis transmembrane conductance regulator (CFTR) is a splice variant of the epithelial CFTR, with lacks 30 amino acids encoded by exon 5 in the first intracellular loop. For examination of the role of exon 5 in CFTR channel function, a CFTR deletion mutant, in which exon 5 was removed from the human epithelial CFTR, was constructed. The wild type and delta exon5 CFTR were expressed in a human embryonic kidney cell line (293 HEK). Fully mature glycosylated CFTR (approximately 170 kDa) was immunoprecipitated from cells transfected with wild type CFTR cDNA, whereas cells transfected with delta exon5 CFTR express only a core-glycosylated from (approximately 140 kDa). The Western blot test performed on subcellular membrane fractions showed that delta exon5 CFTR was located in the intracellular membranes. Neither incubation at lower temperature (26 degrees C) nor stimulation of 293 HEK cells with forskolin or CPT-cAMP caused improvement in glycosylation and processing of delta exon5 CFTR proteins, indicating that the human epithelial CFTR lacking exon5 did not process properly in 293 HEK cells. On incorporation of intracellular membrane vesicles containing the delta exon5 CFTR proteins into the lipid bilayer membrane, functional phosphorylation- and ATP-dependent chloride channels were identified. CFTR channels with an 8-pS full-conductance state were observed in 14% of the experiments. The channel had an average open probability (Po) of 0.098 +/- 0.022, significantly less than that of the wild type CFTR (Po = 0.318 +/- 0.028). More frequently, the delta exon5 CFTR formed chloride channels with lower conductance states of approximately 2-3 and approximately 4-6 pS. These subconductance states were also observed with wild type CFTR but to a much lesser extent. Average Po for the 2-3-pS subconductance state, estimated from the area under the curve on an amplitude histogram, was 0.461 +/- 0.194 for delta exon5 CFTR and 0.332 +/- 0.142 for wild type (p = 0.073). The data obtained indicate that deleting 30 amino acids from the first intracellular loop of CFTR affects both processing and function of the CFTR chloride channel.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
204 The facts that a splice mutation that deletes exon 5 was found to be a cystic fibrosis disease-causing mutant and that there is an array of cystic fibrosis mutations in the region encoded by exon 5 (L165S, K166E, R170C, 1175V, G178R, D192N, D192G, E193K; Fonknechten et al., 1992; Romey et al., 1994; Zielenski et al., 1991; Audrezet et al., 1994; Mercier et al., 1995; Cystic Fibrosis Mutation Data Base) suggest that exon 5 is important for the structure, function, or both of the CFTR chloride channel. Login to comment
205 The facts that a splice mutation that deletes exon 5 was found to be a cystic fibrosis disease-causing mutant and that there is an array of cystic fibrosis mutations in the region encoded by exon 5 (L165S, K166E, R170C, 1175V, G178R, D192N, D192G, E193K; Fonknechten et al., 1992; Romey et al., 1994; Zielenski et al., 1991; Audrezet et al., 1994; Mercier et al., 1995; Cystic Fibrosis Mutation Data Base) suggest that exon 5 is important for the structure, function, or both of the CFTR chloride channel. Login to comment

[hide] Identification of three novel mutations (457 TAT--... Hum Genet. 1994 Jun;93(6):659-62. Audrezet MP, Canki-Klain N, Mercier B, Bracar D, Verlingue C, Ferec C
Identification of three novel mutations (457 TAT-->G, D192G, Q685X) in the Slovenian CF patients.
Hum Genet. 1994 Jun;93(6):659-62., [PMID:7516305]

Abstract [show]
Chromosomes from a cohort of 60 Slovenian families, corresponding to the 121 cystic fibrosis (CF) chromosomes available, were fully scanned for mutations in the coding sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene (The 60 families yielded 121 CF alleles because the mother of one patient was also affected). This corresponds to the 27 exons and intron/exon boundaries that have been studied in chromosomes carrying unidentified alleles. As a result of this survey 84% of the alleles are now clearly identified and we describe in this paper three novel mutations (457 TAT-->G, D192G, and Q685X).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 As a result of this survey 84% of the alleles are now clearly identified and we describe in this paper three novel mutations (457 TAT-->G, D192G, and Q685X). Login to comment
41 D192G The nucleotide variation is A---~Gat position 706 in exon 5, which leads to a glycine instead of an aspartic acid at codon 192. Login to comment
50 Some clinical data of patients with the three novel mutations Patient Exon Mutation Age of Age at Chloride sweat Pancreatic Lung Pseudomonas onset diagnostic test mmol/per 1 function disease aeruginosa CF-53 4 457 TAT--~G Birth 4 months 90.9-167.0 Insufficient Severe Yes 11 G542X CF-67 5 D192G 2 months 3 months 58.8-106.7 Insufficient Moderate No 10 AF508 CF-52 13 Q685X 3 months 6 years 113.4-177.2 Insufficient Severe Yes 10 AF508 Table 2. Login to comment
51 Mutations identified in the population of Slovenia Number of chromosomes Mutations 661 83 AF508 4 G542X 5 R1162X 2 3905 ins T 2 I148T 1 Q552X 1 Q685X 1 S4X 1 457 TAT---~G 1 D192G 1 R1066H 19 Unidentified 121 Exons Frequencies References 10 68.60% Kerem et al. (1989) 11 3.30% Kerem et al. (1990) 19 4.10% Gasparini et al. (1991) 20 1.65% Personal Communication 4 1.65% Personal Communication 11 0.85% Devoto et al. (1991) 13 0.85% This study 1 0.85% Glavac et al. (1993) 4 0.85% This study and Glavac et al. (1993) 5 0.85% This study 17b 0.85% Ftrec et al. (1992) 15.70% by 11 mutations, occurring in 9 exons of the gene (1, 4, 5, 10, 11, 13, 17b, 19, and 20). Login to comment
66 Of the three novel mutations reported here (Q685X, D192G, and 457TAT---~G), two are clearly pathogenic alleles. Login to comment
68 D192G is a missense mutation located in the transmembrane domain of the CFTR, changing a glycine for an aspartic acid. Login to comment
76 The third mutation (D192G) belongs to class 4, leading probably to abnormal conduction. Login to comment

[hide] Reactive-oxygen-species-mediated P. aeruginosa kil... PLoS One. 2013 Aug 19;8(8):e71717. doi: 10.1371/journal.pone.0071717. eCollection 2013. Cifani N, Pompili B, Anile M, Patella M, Diso D, Venuta F, Cimino G, Quattrucci S, Di Domenico EG, Ascenzioni F, Del Porto P
Reactive-oxygen-species-mediated P. aeruginosa killing is functional in human cystic fibrosis macrophages.
PLoS One. 2013 Aug 19;8(8):e71717. doi: 10.1371/journal.pone.0071717. eCollection 2013., [PMID:23977124]

Abstract [show]
Pseudomonas aeruginosa is the most common pathogen for chronic lung infection in cystic fibrosis (CF) patients. About 80% of adult CF patients have chronic P. aeruginosa infection, which accounts for much of the morbidity and most of the mortality. Both bacterial genetic adaptations and defective innate immune responses contribute to the bacteria persistence. It is well accepted that CF transmembrane conductance regulator (CFTR) dysfunction impairs the airways-epithelium-mediated lung defence; however, other innate immune cells also appear to be affected, such as neutrophils and macrophages, which thus contribute to this infectious pathology in the CF lung. In macrophages, the absence of CFTR has been linked to defective P. aeruginosa killing, increased pro-inflammatory cytokine secretion, and reduced reactive oxygen species (ROS) production. To learn more about macrophage dysfunction in CF patients, we investigated the generation of the oxidative burst and its impact on bacterial killing in CF macrophages isolated from peripheral blood or lung parenchyma of CF patients, after P. aeruginosa infection. Our data demonstrate that CF macrophages show an oxidative response of similar intensity to that of non-CF macrophages. Intracellular ROS are recognized as one of the earliest microbicidal mechanisms against engulfed pathogens that are activated by macrophages. Accordingly, NADPH inhibition resulted in a significant increase in the intracellular bacteria survival in CF and non-CF macrophages, both as monocyte-derived macrophages and as lung macrophages. These data strongly suggest that the contribution of ROS to P. aeruginosa killing is not affected by CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Nine of them were F508del homozygous, one was W1282X homozygous, and two carried at least one delta F508del allele (F508del/D192G, F508del/P5L). Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment