ABCMdb

ABCC7 p.Asp1270Asn

Admin's notes:	Class II-III (maturation defect, gating defect) Veit et al.
ClinVar:	c.3808G>A , p.Asp1270Asn ? , Conflicting interpretations of pathogenicity, not provided c.3808G>T , p.Asp1270Tyr ? , not provided
CF databases:	c.3808G>A , p.Asp1270Asn ? , Varying clinical consequence ; CFTR1: The patient that carries the D1270N is an otherwise healthy male wth congenital absence of the vas deferens, an autosomal recessive disorder causing male aterility. The patient also carries an [delta]F508 mutation on the other chromosome. We did not find D1270N in iver 100 CF patients or in 91 fertile CF-carrier males. c.3808G>T , p.Asp1270Tyr (CFTR1) ? , This mutation was identified in two brother siblings with CF.
Predicted by SNAP2:	A: D (91%), C: D (85%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: D (91%), P: D (95%), Q: D (95%), R: D (95%), S: D (91%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Analysis of the complete coding region of the CFTR... Hum Hered. 1999 Mar;49(2):81-4. Loumi O, Baghriche M, Delpech M, Kaplan JC, Bienvenu T
Analysis of the complete coding region of the CFTR gene in ten Algerian cystic fibrosis families.
Hum Hered. 1999 Mar;49(2):81-4., [PMID:10077727]

Abstract [show]
The spectrum of cystic fibrosis (CF) mutations in the North African population remains poorly known. In order to offer an effective diagnostic service and to determine accurate risk estimates, we decided to identify the CF mutations in 10 Algerian CF families. We carried out a chemical-clamp denaturing gradient gel electrophoresis analysis of the CFTR gene and automated direct DNA sequencing. We identified 5 mutations and we characterized 60% of the CF chromosomes. Taking advantage of the homogeneity of the sample, we report clinical features of homozygous CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Moreover, we have identified a complex mutation R74W-D1270N in the mother of an Algerian 'F508 heterozygous CF patient, and none of these variation were inherited by the child. Login to comment
39 Using intragenic polymorphisms, we have confirmed that R74W and D1270N were not inherited by the 'F508 heterozygous CF child. Login to comment

[hide] Fetal bowel hyperechogenicity may indicate mild at... J Med Genet. 2000 Aug;37(8):E15. Abramowicz MJ, Dessars B, Sevens C, Goossens M, Girodon-Boulandet E
Fetal bowel hyperechogenicity may indicate mild atypical cystic fibrosis: a case associated with a complex CFTR allele.
J Med Genet. 2000 Aug;37(8):E15., [PMID:10922395]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 Indeed, mild CFTR mutations or variants combined in cis may produce a more deleterious eVect than each mutation alone, as was recently shown by functional studies in transfected cells for the D1270N-R74W mutations,18 confirming previous observations.19 20 The identification of an increasing number of complex alleles3 21 may partly account for the diYculties in establishing genotype-phenotype correlations. Login to comment

[hide] Gastrointestinal, liver, and pancreatic involvemen... Pancreas. 2001 May;22(4):395-9. Modolell I, Alvarez A, Guarner L, De Gracia J, Malagelada JR
Gastrointestinal, liver, and pancreatic involvement in adult patients with cystic fibrosis.
Pancreas. 2001 May;22(4):395-9., [PMID:11345141]

Abstract [show]
BACKGROUND: The clinical prevalence of cystic fibrosis (CF) in adults continues to rise, with a consequent impact on adult gastroenterology practice. AIM: To characterize the gastrointestinal manifestations of CF in adult patients. PATIENTS AND METHODS: The clinical records of 89 adult CF patients treated at our institution from 1992 to 1999 were reviewed. Patients were distributed into two groups: group A (39 patients), which consisted of patients who were diagnosed with CF at when they were younger than 14 years old and who survived into adulthood; and group B (50 patients), who were diagnosed with CF at the age of 14 years or older. Data on CF genetic mutations, nutritional state, evidence of pulmonary, gastrointestinal, liver, or pancreatic involvement were collected for each patient. RESULTS: The most prevalent genetic mutation in our series was deltaF508, present in 50 patients (56.2%), 29 of whom belonged to group A and 21 who belonged to group B. In group A, the deltaF508 mutation was associated with exocrine pancreatic insufficiency (PI) in 26 of 29 patients (89.6%), whereas in group B it was associated with PI in only four patients (19%). Overall, PI was present in 33 of 39 patients (84.6%) in group A and in eight of 50 patients (16%) in group B. Four patients in group B had experienced previous episodes of acute pancreatitis; two of them had associated PI. Of the 89 patients, 12 (10 in group A) were malnourished. Malnutrition was invariably associated with PI. Hepatic and biliary tree abnormalities were particularly prevalent in patients in group A and was usually associated with PI. Intestinal manifestations were uncommon. CONCLUSIONS: Diagnosis of CF before the age of 14 years is associated with greater gastrointestinal compromise than diagnosis at an older age, particularly with regard to PI. CF carriers of the deltaF508 mutation have an increased risk of developing gastrointestinal manifestations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Other genotypes present in our series ⌬F508/711+1G>T 2A 5T/5T 1B ⌬F508/5T 2B ⌬1507/- 1A ⌬F508/R117H 2B R1162X/1898+1G>A 1A ⌬F508/R1162X 1A 2183A/- 1A ⌬F508/N1303K 1A 1609-CA/1811+1.6kbA>G 1A ⌬F508/3272-26A>G 1B 1609-CA/R347P 1A ⌬F508/D836Y 1B Q890X/- 1A ⌬F508/1717-1G>A 1A R334W/- 1B G542X/W1282X 1A N1303K/2789+5G>A 1B G542X/2789+5G>A 1B 3659-C/- 1B G542X/P205S 1B G85E/- 1B G542X/D1270N 1B Negative 1A, 20B L206W/- 1B Unknown 2A creatic insufficiency was highly prevalent, affecting 33 patients (84.6%). Login to comment

[hide] Adenosine triphosphate-binding cassette superfamil... Biol Reprod. 2001 Aug;65(2):394-400. Larriba S, Bassas L, Egozcue S, Gimenez J, Ramos MD, Briceno O, Estivill X, Casals T
Adenosine triphosphate-binding cassette superfamily transporter gene expression in severe male infertility.
Biol Reprod. 2001 Aug;65(2):394-400., [PMID:11466205]

Abstract [show]
Cystic fibrosis transmembrane regulator (CFTR), multidrug-resistant (MDR)1, and multidrug resistance-associated (MRP) proteins belong to the ATP-binding cassette (ABC) transporter superfamily. A compensatory regulation of MDR1 and CFTR gene expression has been observed in CFTR knockout rodent intestine and in an epithelial cell line of human colon, whereas a high homology and similar anion binding site are shared by MRP and CFTR proteins. To provide better insight into the relationship among the expression behavior in vivo of the three genes in human testis, analysis of MDR1 and MRP gene expression in testicular biopsies was performed and related to the presence of CFTR gene mutations in congenital absence of the vas deferens (CAVD: n = 20) and non-CAVD (n = 30) infertile patients with azoospermia or severe oligozoospermia. A CFTR mutation analysis performed in both groups of patients supported the involvement of CFTR gene mutations in CAVD phenotype (85%) and in defective spermatogenesis (19%). Quantitative reverse transcription-polymerase chain reaction analysis of testicular tissue showed a CFTR-independent MDR1 and MRP gene expression in human testis, suggesting that the mechanisms underlying CFTR gene regulation in testis are different from those in intestine. These findings should contribute to the understanding of patterns of in vivo expression of CFTR, MDR1, and MRP genes in CFTR-related infertility.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Phenotypical and genotypical description of CAVD and non-CAVD infertile patients.a No. patient Phenotype FSH (U/L) Non-CFTR infertility-associated factors Testicular biopsy CFTR mutation M470V polymorphism CAVD infertility 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CUAVD CUAVD CUAVD CUAVD 3.1 7.3 3.1 2.4 1.9 3.5 5.7 4.3 3.6 ND 2.2 4.8 11.3 2.1 ND 7.6 5.3 6.5 3.9 21.4 None None None None None None None None None None None None None None None None None None None Yes 1 Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes V232D/V232D F508del/R117H F508del/R117H G542X/2789ϩ5GϾA F508del/D1270N ϩ R74W F508del/D1270N ϩ R74W S945L/R258G F508del/5T F508del/5T L206W/5T R117H/N F508del/N Y1014C/N 5T/N N/N N/N Y1092X/R258G 621ϩ1GϾT/5T Q890R/N N/N M/M M/M M/M M/M M/V M/V M/V M/M M/V M/V M/V M/V M/V M/V M/M V/V V/V M/V V/V M/M Non-CAVD infertility 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SA) TF (SA) TF (SSO) OA OA OA OA OA OA OA OA 42.0 15.9 34.8 8.9 26.3 6.4 7.8 15.6 8.7 3.2 3.9 12.6 4.7 1.3 5.6 3.9 6.1 9.3 8.8 19.3 9.6 ND 3.3 5.9 6.6 3.6 1.9 4.2 2.0 4.4 None None None None None None None None None None None None None None None None Yes 2 Yes 2 Yes 2, 3 Yes 4 Yes 5 Yes 6 None None None None None Yes 1 Yes 7 Yes 8 Yes Yes Yes Yes No Yes Yes Yes Yes Yes Yes Yes Yes No No No No No No Yes Yes Yes Yes Yes Yes Yes No Yes Yes Yes F508del/N R334W/N N/N N/N N/N N/N N/N N/N N/N R75Q/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N 5T/5T N/N N/N N/N N/N N/N N/N N/N M/M V/V M/V M/V M/V M/V V/V V/V V/V V/V M/V M/V M/V ND V/V M/M M/V M/M M/V M/M M/V V/V M/V M/V M/V V/V V/V M/V M/V V/V a CFTR mutations and M470V allele are also described for each patient. Login to comment
94 CFTR Analysis We have identified 14 different CFTR mutations (R117H, L206W, V232D, R258G, F508del, G542X, 621ϩ1GϾT, Q890R, S945L, Y1014C, Y1092X, D1270N, 2789ϩ5GϾA, IVS8-6[5T]) in 17 of 20 patients of the CAVD group, giving a CFTR mutation frequency of 85%. Login to comment

[hide] Cystic fibrosis phenotype evaluation and paternity... Hum Reprod. 2001 Oct;16(10):2093-7. Josserand RN, Bey-Omar F, Rollet J, Lejeune H, Boggio D, Durand DV, Durieu I
Cystic fibrosis phenotype evaluation and paternity outcome in 50 males with congenital bilateral absence of vas deferens.
Hum Reprod. 2001 Oct;16(10):2093-7., [PMID:11574497]

Abstract [show]
BACKGROUND: Most infertile males with congenital bilateral absence of vas deferens (CBAVD) carry mutations on the cystic fibrosis transmembrane conductance regulator gene and may express mild cystic fibrosis (CF) symptoms. Barriers to paternity for these men can now be overcome by assisted reproduction. Our aims were to investigate the CF-related phenotype and clinical outcome for 50 patients with CBAVD seen at a CF adult centre between 1992 and 1999. METHODS AND RESULTS: The investigation of the patients included screening for 22 CF mutations and identification of the poly-T variant of intron 8, sweat testing, clinical investigation for CF-related extra-genital manifestations, and genetic counselling. CFTR mutations were detected on 56 alleles of the 50 patients. A total of 15 (30%) was compound heterozygote and 26 (52%) heterozygote. In all, 38% of the patients had a positive sweat test. Four patients were diagnosed with typical CF not detected previously. Twenty-one patients became fathers following ICSI (eight cases), artificial insemination by donor or IVF with sperm donor (seven cases) or through adoption (six cases). A mail survey allowed the identification of CF-related clinical symptoms. Information on the occurrence of CF-related symptoms was obtained for 58.5% of patients: in the absence of initial symptoms, no new clinical signs were reported. CONCLUSION: Patients diagnosed with CBAVD need genetic counselling before assisted reproduction. Even when no wish for paternity is expressed, CF gene screening should be associated with at least a sweat test and clinical evaluation because of possible mild forms of CF disease. Medical follow-up did not reveal any new symptoms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Leukocytes samples were analysed for a series of 22 CF mutations including the five most frequently encountered in our region (The CF Genotype Consortium, 1994): ∆F508, G542X, N1303K, 1717-G-A, 885E; and 17 others: R117H, R334W, R347H, R347P, 556delA, S549N, S549I, S549R, G551D, R553X, R560T, G1244E, S1255X, W1282X, R1283K, 3898ins C, D1270N. Login to comment
40 sCFTR mutation was detected in 56 alleles of the 50 patients: ∆F508 in 30 alleles, R117H in six, D1270N in two, G542X in one, 1717ϩG-A in one, 2789ϩ5G-A in one, R347H in one and the 5T allele in 14. Login to comment
45 Description of the 50 men with CBAVD:CF genotype and phenotype Number age CF SCC CF-related (years) genotype (mmol/l) symptoms 1 29 ∆F508/R117H 59 2 35 ∆F508/R117H 54 3 24 ∆F508/R117H 43 4 33 ∆F508/R117H 39 5 26 ∆F508/5T 90 S/B 6 27 ∆F508/5T 67 S 7 32 ∆F508/5T 55 8 30 ∆F508/5T 51 9 31 ∆F508/5T 44 10 44 ∆F508/5T 38 S 11 36 ∆F508/5T 36 S 12 54 ∆F508/5T 21 S 13 31 R117H/R347H 79 S 14 36 1717G-A/5T 50 S 15 32 5T/5T 77 P/DM 16 27 ∆F508/- 94 S 17 41 ∆F508/- 90 S/B 18 30 ∆F508/- 88 19 30 ∆F508/- 82 S 20 32 ∆F508/- 81 21 25 ∆F508/- 79 22 31 ∆F508/- 79 23 27 ∆F508/- 75 S 24 43 ∆F508/- 70 25 38 ∆F508/- 65 26 34 ∆F508/- 52 S 27 31 ∆F508/- 47 S 28 35 ∆F508/- 40 S 29 26 ∆F508/- 39 S 30 25 ∆F508/- 36 31 33 ∆F508/- 33 32 37 ∆F508/- 28 S 33 36 ∆F508/- 18 S 34 33 G542X/- 45 S 35 37 D1270N/- 116 36 34 D1270N/- 103 S/P 37 46 R117H/- 95 39 37 2789ϩ5G-A/- 100 S 40 27 5T/- 90 S 38 30 5T/- 51 44 38 5T/- 45 41 30 -/- 57 S 42 35 -/- 52 S 43 36 -/- 46 B (tobacco) 45 33 -/- 40 S 46 31 -/- 36 S/asthma 47 32 -/- 28 B (tobacco) 48 28 -/- 28 49 30 -/- 26 50 35 -/- 20 S SCC ϭ sweat chloride concentration. Login to comment
49 Results of assisted reproduction procedures Number CF genotype CF mutation in Assisted reproduction procedure women ICSI IVFSD AID adoption 1 ∆F508/R117H 0 failure success 2 ∆F508/R117H failure 3 ∆F508/R117H failure 4 ∆F508/R117H 0 5 ∆F508/5T 0 6 ∆F508/5T success 7 ∆F508/5T ∆F508/- failure 1 8 ∆F508/5T success 9 ∆F508/5T failure 1 10 ∆F508/5T 0 1 11 ∆F508/5T 0 12 ∆F508/5T failure failure 13 R117H/R347H failure failure 14 1717G-A/5T failure 15 5T/5T 0 16 ∆F508/- ∆F508/- 0 success 17 ∆F508/- 0 1 18 ∆F508/- 0 19 ∆F508/- failure 20 ∆F508/- ∆F508/- 0 success 21 ∆F508/- success 22 ∆F508/- failure 23 ∆F508/- failure 24 ∆F508/- in process 25 ∆F508/- 0 1 26 ∆F508/- failure 27 ∆F508/- failure 28 ∆F508/- success 29 ∆F508/- 0 success 30 ∆F508/- failure success 31 ∆F508/- 0 1 32 ∆F508/- 0 33 ∆F508/- success 34 G542X/- failure failure 35 D1270N/- success 36 D1270N/- 0 37 R117H/- failure 39 2789ϩ5G-A/- in process 40 5T/- ∆F508/- 0 38 5T/- failure 44 5T/- 0 success 41 -/- success 42 -/- failure 43 -/- 0 45 -/- in process 46 -/- 0 47 -/- 0 success 48 -/- failure 49 -/- failure 50 -/- success IVFSD ϭ IVF with sperm donor; AID ϭ artificial insemination by donor. Login to comment
50 aureus, reduced forced expiratory volume in one second (FEV1) (60% of predicted value) and positive sweat test (90 mmol/l); the two other patients with one CFTR mutation (D1270N) in number 36 and 5T/5T CFTR genotype for number 15 had positive sweat test (103 and 77 mmol/l respectively) and significantly elevated pancreatic enzymes (two-fold normal values) without steatorrhoea, but with diabetes mellitus in one case. Login to comment

[hide] DHPLC screening of cystic fibrosis gene mutations. Hum Mutat. 2002 Apr;19(4):374-83. Ravnik-Glavac M, Atkinson A, Glavac D, Dean M
DHPLC screening of cystic fibrosis gene mutations.
Hum Mutat. 2002 Apr;19(4):374-83., [PMID:11933191]

Abstract [show]
Denaturing high performance liquid chromatography (DHPLC) using ion-pairing reverse phase chromatography (IPRPC) columns is a technique for the screening of gene mutations. In order to evaluate the potential utility of this assay method in a clinical laboratory setting, we subjected the PCR products of 73 CF patients known to bear CFTR mutations to this analytic technique. We used thermal denaturation profile parameters specified by the MELT program tool, made available by Stanford University. Using this strategy, we determined an initial analytic sensitivity of 90.4% for any of 73 known CFTR mutations. Most of the mutations not detected by DHPLC under these conditions are alpha-substitutions. This information may eventually help to improve the MELT algorithm. Increasing column denaturation temperatures for one or two degrees above those recommended by the MELT program allowed 100% detection of CFTR mutations tested. By comparing DHPLC methodology used in this study with the recently reported study based on Wavemaker 3.4.4 software (Transgenomic, Omaha, NE) [Le Marechal et al., 2001) and with previous SSCP analysis of CFTR mutations [Ravnik-Glavac et al., 1994] we emphasized differences and similarities in order to refine the DHPLC system and discuss the relationship to the alternative approaches. We conclude that the DHPLC method, under optimized conditions, is highly accurate, rapid, and efficient in detecting mutations in the CFTR gene and may find high utility in screening individuals for CFTR mutations. Hum Mutat 19:374-383, 2002. Published 2002 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X. Login to comment
100 Optimization of Temperature (OTm) for Undetected Mutations Nucleotide RTm OTm Exon Mutation change (°C) (°C) 3 W57G 301 T>G 55 57 R74W 352 C>T 55 57 7 R334W 1132 C>T 58 60 R347C 1171 C>T 58 60 10 Q493X 609 C>T 55 56 20 3905 insT 3905 insT 55 56 D1270N 3940 G>A 57 58 RTm, recommended temperature by the MELT program; OTm, optimized temperature. Login to comment

[hide] Sinobronchial allergic mycosis: the SAM syndrome. Chest. 2002 May;121(5):1670-6. Venarske DL, deShazo RD
Sinobronchial allergic mycosis: the SAM syndrome.
Chest. 2002 May;121(5):1670-6., [PMID:12006459]

Abstract [show]
We contend that the presence of concomitant allergic fungal sinusitis (AFS) and allergic bronchopulmonary mycosis in the same patient represents an expression of the same process of fungal hypersensitivity in the upper and lower airways. We have termed this process the SAM syndrome, an acronym for sinobronchial allergic mycosis. Diagnostic criteria have been established for the SAM syndrome, and the clinical characteristics of one previously unreported and four previously reported patients have been tabulated. Patients with the SAM syndrome have chronic sinusitis involving multiple sinuses, asthma, immediate cutaneous reactivity to fungal allergens, peripheral eosinophilia, and radiographic evidence of bronchiectasis. Total serum IgE levels are usually elevated as well. A variety of chest radiographic abnormalities may occur, ranging from mass lesions to diffuse pulmonary infiltrates and even normal findings on chest radiographs. Patients present for an evaluation of either sinus or lung disease and, at that time, demonstrate no clinical features that distinguish them from patients with isolated sinus or lung disease. All patients reported to date have had clinical responses to therapy with corticosteroids. We postulate that SAM is underdiagnosed in patients with AFS, a disease recently reported from medical centers in the southeastern and western United States. Moreover, since our patient had a mutation in the cystic fibrosis transmembrane conductor regulator (CFTR) gene, we further hypothesize that CFTR gene mutations may play an important role in the pathogenesis of the SAM syndrome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 www.chestjournal.org CHEST / 121 / 5 / MAY, 2002 1671 One copy of the D1270N mutation in the CFTR gene was detected. Login to comment
118 Our patient is African-American and had one copy of the D1270N mutation with a normal sweat chloride level. Login to comment
119 The D1270N mutation, which was first described in the heterozygous state in a patient of English and Italian origin, is a missense mutation located in the second adenosine triphosphate-binding region of the CFTR gene.28 This mutation Table 2-Sinopulmonary Syndromes Immotile cilia syndrome Wegener granulomatosis Churg-Strauss syndrome SAM 1674 has been reported previously in three series of patients with congenital bilateral absence of the vas deferens,28 -30 and in a case report of an elderly man with ABPM as a presenting sign of CF.31 In a review of CF carrier frequencies in populations of African origin, two patients were identified who had symptoms suggestive of CF and were heterozygous for the D1270N mutation.32 A sweat test was not performed in one patient and was negative in the other. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment
86 CFTR mutations in 92 men with congenital bilateral absence of vas deferens Mutations CFTR mutation panels CF25 CF25 ϩ 5T ACMG25 ACMG25 ϩ 5T CF100 Mutations detected in ∆F508 39 39 39 39 39 CF25 mutation panel R117H 4 4 4 4 4 W1282X 4 4 4 4 4 G551D 3 3 3 3 3 G542X 1 1 1 1 1 N1303K 1 1 1 1 1 IVS8-polyT IVS8-5T 33 33 33 Additional mutations L206W 3 detected not in CF25 D1270N 2 mutation panel 1154InsTC 1 3272-26A→G 1 A455E 1 1 1 R334W 1 1 1 Q890X 1 Total 14 52 85 54 87 95 respectively, in the total number of patients with at least one mutation. Login to comment
91 CFTR genotypes in 92 men with congenital bilateral absence of vas deferens Genotypesa CFTR mutation panelsb CF25 CF25 ϩ 5T ACMG25 ACMG25 ϩ 5T CF100 Two mutations ∆F508/5T 16 16 16 W1282X/5T 4 4 4 ∆F508/R117Hc 3 3 3 3 3 G542X/5T 1 1 1 G551D/5T 1 1 1 ∆F508/L206W 2 ∆F508/A455E 1 1 1 ∆F508/3272-26A→G 1 Q890X/5T 1 L206W/5T 1 D1270N/D1270N 1 5T/5T 1 1 1 Sub-total 3 26 4 27 33 One mutation ∆F508/ϩ 36 20 35 19 16 5T/ϩ 9 9 7 G551D/ϩ 3 2 3 2 2 G542X/ϩ 1 1 R117H/ϩ 1 1 1 1 1 N1303K/ϩ 1 1 1 1 1 W1282X/ϩ 4 4 R334W/ϩ 1 1 1 1154InsTC/ϩ 1 Sub-total 46 33 46 33 29 Total (%) 49 (53.3) 59 (64.1) 50 (54.3) 60 (65.2) 62 (67.4) No mutation (%) 43 (46.7) 33 (35.9) 42 (45.7) 32 (34.8) 30 (32.6) aMutations L206W, 3272-26A→G, Q890X, D1270N, 1154InsTC and 5T are not in either CF25 and ACMG25 panels, while A455E and R334W are not in CF25, but are part of ACMG25 panel. Login to comment
97 Two homozygotes for 5T and D1270N were also detected. Login to comment

[hide] The I148T CFTR allele occurs on multiple haplotype... Genet Med. 2002 Sep-Oct;4(5):319-23. Rohlfs EM, Zhou Z, Sugarman EA, Heim RA, Pace RG, Knowles MR, Silverman LM, Allitto BA
The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis.
Genet Med. 2002 Sep-Oct;4(5):319-23., [PMID:12394343]

Abstract [show]
PURPOSE: To determine whether intragenic changes modulate the cystic fibrosis (CF) phenotype in individuals who are positive for the I148T allele. METHODS: The genes from individuals who carried at least one copy of the I148T allele were analyzed for additional changes that may be acting as genetic modifiers. RESULTS: Seven of eight individuals with a known or suspected diagnosis of CF who carried I148T in combination with a severe CF mutation also carried 3199del6. Eight apparently healthy adult individuals who were compound heterozygous for I148T and a severe CF mutation or homozygous for I148T did not carry the deletion ( = 0.0014). The I148T allele occurs on at least three haplotypes: an IVS-8 9T background, a 7T background, or a 9T + 3199del6 background. The 3199del6 allele was not identified in 386 non-CF chromosomes. CONCLUSIONS: It is concluded that I148T occurs on at least three haplotypes and the complex allele I148T + 9T + 3199del6 is associated with a classic CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 For example, the complex allele composed of R74W and D1270N is known to produce variable phenotypes. Login to comment
111 has little deleterious effect and could be considered a polymorphism.31 D1270N has a more substantial effect on chloride channel function in this model, with the greatest effect observed in the cells containing the complex allele of R74W ϩ D1270N. Login to comment
112 When in combination with a severe allele on the other chromosome, R74W ϩ D1270N is disease-causing; it was identified in a male with CBAVD, rhinitis, and recurrent respiratory infections.32 However,itwasalsodetectedina25-year-oldwomanwhoseonly clinicalsymptomofCFweretwopositivesweatchloridetests.33 In addition, genotyping programs that detect alleles of unknown functionalconsequence,andunknownpopulationfrequency,are at risk for erroneously reporting two changes in trans that are in fact a complex allele. Login to comment

[hide] Standards and guidelines for CFTR mutation testing... Genet Med. 2002 Sep-Oct;4(5):379-91. Richards CS, Bradley LA, Amos J, Allitto B, Grody WW, Maddalena A, McGinnis MJ, Prior TW, Popovich BW, Watson MS, Palomaki GE
Standards and guidelines for CFTR mutation testing.
Genet Med. 2002 Sep-Oct;4(5):379-91., [PMID:12394352]

Abstract [show]
One mission of the ACMG Laboratory Quality Assurance (QA) Committee is to develop standards and guidelines for clinical genetics laboratories, including cytogenetics, biochemical, and molecular genetics specialties. This document was developed under the auspices of the Molecular Subcommittee of the Laboratory QA Committee by the Cystic Fibrosis (CF) Working Group. It was placed on the "fast track" to address the preanalytical, analytical, and postanalytical quality assurance practices of laboratories currently providing testing for CF. Due to the anticipated impact of the ACMG recommendation statement endorsing carrier testing of reproductive couples, it was viewed that CF testing would increase in volume and that the number of laboratories offering CF testing would also likely increase. Therefore, this document was drafted with the premise of providing useful information gained by experienced laboratory directors who have provided such testing for many years. In many instances, "tips" are given. However, these guidelines are not to be interpreted as restrictive or the only approach but to provide a helpful guide. Certainly, appropriately trained and credentialed laboratory directors have flexibility to utilize various testing platforms and design testing strategies with considerable latitude. We felt that it was essential to include technique-specific guidelines of several current technologies commonly used in laboratories providing CF testing, since three of the four technologies discussed are available commercially and are widely utilized. We take the view that these technologies will change, and thus this document will change with future review.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Mutations not included in the 25 mutation core testing panel that have been reported in these populations include D1270N, W1089X, and S549N.13-15 CF 2.8.4 Insufficient information is available for the Asian American population. Login to comment

[hide] Extensive sequencing of the cystic fibrosis transm... Genet Med. 2003 Jan-Feb;5(1):9-14. Strom CM, Huang D, Chen C, Buller A, Peng M, Quan F, Redman J, Sun W
Extensive sequencing of the cystic fibrosis transmembrane regulator gene: assay validation and unexpected benefits of developing a comprehensive test.
Genet Med. 2003 Jan-Feb;5(1):9-14., [PMID:12544470]

Abstract [show]
PURPOSE: To develop a sequencing assay for the gene to identify mutations in patients with cystic fibrosis (CF). METHODS: An automated assay format was developed to sequence all exons and splice junctional sequences, the promotor region, and parts of introns 11 and 19. RESULTS: After validating the assay using 20 known samples, DNA of seven patients, four of whom were heterozygous for a known CF mutation, was sequenced. Known CF mutations were detected in seven of the eight chromosomes, and a novel missense mutation was detected in the eighth. In addition, this assay allowed 14 ambiguous results obtained using the Roche CF gold strips to be resolved. Three false-positive diagnoses were prevented; a different mutation at the same codon was identified in two patients and confirmation was provided in the remaining nine cases. CONCLUSIONS: Sequencing of the gene provides important information for CF patients and is a valuable adjunct to a carrier screening program to resolve ambiguities in panel testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 However, previous studies have shown that two such mutations, I148T and D1270N, are probably polymorphisms or low penetrance alleles.7 For those reasons, caution must be used when interpreting the presence of a rare or novel mutation found in the sequencing assay. Login to comment
127 The discovery that the I148T and D1270N mutations are likely to be polymorphisms and not causative CF mutations points out the danger in assuming that all mutations listed in the CF database are causative mutations. Login to comment

[hide] Analysis of cystic fibrosis transmembrane conducta... Am J Med Genet A. 2003 Jul 1;120A(1):72-6. Timmreck LS, Gray MR, Handelin B, Allito B, Rohlfs E, Davis AJ, Gidwani G, Reindollar RH
Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina.
Am J Med Genet A. 2003 Jul 1;120A(1):72-6., 2003-07-01 [PMID:12794695]

Abstract [show]
The relationship between cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations and congenital absence of the uterus and vagina (CAUV) was examined. CFTR mutations have previously been associated with congenital bilateral absence of the vas deferens (CBAVD). CBAVD is caused by a disruption in the vas deferens, a Wolffian duct derivative. Because the embryologic development of the Mullerian ducts directly depends on the prior normal development of the Wolffian ducts, the same gene products may be necessary for normal embryologic development of both ductal systems. This study evaluated the role of CFTR mutations in the development of CAUV. DNA samples from 25 patients with CAUV were tested for the presence of 33 of the most common CFTR mutations. Protein-coding DNA fragments from the CFTR gene were amplified in vitro by the polymerase chain reaction (PCR) and analyzed for mutations using allele-specific oligonucleotide (ASO) probes. Two patients were heterozygous for CFTR mutations. One was heterozygous for the W1282X mutation and the other was heterozygous for the DeltaF508 mutation. The incidence of the 33 CFTR mutations found in the patients with CAUV (8%) was twice that found in the general population (4%), but much less than the incidence of CFTR mutations in men with CBAVD (80%). This data suggests that it is unlikely for CFTR mutations to cause CAUV in females as they cause CBAVD in some males. Furthermore, the data suggest that CAUV in females may be the same disorder as CBAVD in males who do not have CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 Mutations continue to be identified in association with CBAVD: A800G, G149R, R258G, E193K [Mercier et al., 1995], D1270N, and G576A [Ravnik-Glavac et al., 2000], to name a few. Login to comment

[hide] High allelic heterogeneity between Afro-Brazilians... Genet Test. 2003 Fall;7(3):213-8. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, Phillips JA 3rd, Allito B, Heim RA, Sugarman EA, Probst CM, Faucz F, Culpi L
High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing.
Genet Test. 2003 Fall;7(3):213-8., [PMID:14641997]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by at least 1,000 different mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR). To determine the frequency of 70 common worldwide CFTR mutations in 155 Euro-Brazilian CF patients and in 38 Afro-Brazilian CF patients, we used direct PCR amplification of DNA from a total of 386 chromosomes from CF patients born in three different states of Brazil. The results show that screening for seventy mutations accounts for 81% of the CF alleles in Euro-Brazilians, but only 21% in the Afro-Brazilian group. We found 21 different mutations in Euro-Brazilians and only 7 mutations in Afro-Brazilians. The frequency of mutations and the number of different mutations detected in Euro-Brazilians are different from Northern European and North American populations, but similar to Southern European populations; in Afro-Brazilians, the mix of CF-mutations is different from those reported in Afro-American CF patients. We also found significant differences in detection rates between Euro-Brazilian (75%) and Afro-Brazilian CF patients (21%) living in the same state, Minas Gerais. These results, therefore, have implications for the use of DNA-based tests for risk assessment in heterogeneous populations like the Brazilians. Further studies are needed to identify the remaining CF mutations in the different populations and regions of Brazil.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes. Login to comment

[hide] Cystic fibrosis in Uruguay. Genet Mol Res. 2002 Mar 31;1(1):32-8. Luzardo G, Aznarez I, Crispino B, Mimbacas A, Martinez L, Poggio R, Zielenski J, Tsui LC, Cardoso H
Cystic fibrosis in Uruguay.
Genet Mol Res. 2002 Mar 31;1(1):32-8., [PMID:14963811]

Abstract [show]
We conducted clinical and genetic analyses of 52 cystic fibrosis (CF) patients in Uruguay, which is about half of the known affected individuals in the country. A relatively high proportion had a mild presentation, characterized by pancreatic sufficiency (28%), a strong pulmonary component (97%), and borderline sweat electrolyte measurements (25%). Mutational analysis of CF chromosomes demonstrated a relatively low incidence of the DeltaF508 allele (40%) and a large number of other cystic fibrosis conductance regulator mutations, with an overall detection rate of about 71%. Fifteen different mutations were detected in our patients: DeltaF508, G542X, R1162X, G85E, N1303K, R334W, R75Q, R74W, D1270N, W1282X, DeltaI507, 2789+5G-->A, R1066C, -816C/T, R553X, as well as RNA splicing variant IVS8-5T. This group of Uruguayan CF patients has some characteristics in common with other populations of similar origin (Hispanics), as well as some unique characteristics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 RESULTS Genetic analysis led to the detection of 15 different mutations: ∆F508, G542X, R1162X, G85E, N1303K, R334W, R75Q, R74W, D1270N, W1282X, ∆I507, 2789+5G→A, R1066C, R553X and -816C/T. Login to comment
47 Mutation Cumulative (%)%N ∆F508 G542X R1162X G85E N1303K R334W R75Q Other mutations* Unknown 42 6 3 3 3 2 2 13 30 40.4 5.7 2.9 2.9 2.9 1.9 1.9 12.5 28.9 40.4 46.1 49.0 51.9 54.9 56.7 58.6 71.1 99.9 *R74W, D1270N, W1282X, ∆I507, 2789+5G→A, R1066C, -816C/T, R553X, 5T (3 cases associated to other mutations, 2 cases without known second mutation). Login to comment
59 Genotypes N Percent ∆F508/∆F508 ∆F508/R1162X ∆F508/G85E ∆F508/G542X ∆F508/5T ∆F508/R334W ∆F508/1303X ∆F508/R1066C ∆F508/Unknown ∆I507/2789+G-A R74W/D1270N N1303K/G542X N1303K/R553K -816C-T/5T 5T/Unknown G542X/Unknown R75Q/Unknown W1282X/Unknown Unknown/Unknown 8 3 3 3 2 2 1 1 11 1 1 1 1 1 2 2 2 1 6 15.4 5.8 5.8 5.8 3.9 3.9 1.9 1.9 21.2 1.9 1.9 1.9 1.9 1.9 3.9 3.9 3.9 1.9 11.5 All individuals had pulmonary symptoms.All those carrying the ∆F508/∆F508 genotype had pancreatic insufficiency. Login to comment

[hide] Novel CFTR mutations in black cystic fibrosis pati... Clin Genet. 2004 Apr;65(4):284-7. Feuillet-Fieux MN, Ferrec M, Gigarel N, Thuillier L, Sermet I, Steffann J, Lenoir G, Bonnefont JP
Novel CFTR mutations in black cystic fibrosis patients.
Clin Genet. 2004 Apr;65(4):284-7., [PMID:15025720]

Abstract [show]
Cystic fibrosis (CF) is considered as a rare disease in black Africans. In fact, this disease is likely to be underestimated since clinical features consistent with CF diagnosis are often ascribed to environmental factors such as malnutrition. Very little is known about CFTR mutations in affected patients from Central Africa. We report here four novel mutations, i.e., IVS2 + 28 (intron 2), 459T > A (exon 4), EX17a_EX18del (exons 17-18), and IVS22 + IG > A (intron 22), in such patients. An update of CFTR mutations reported in black patients from various ethnies is included. These data might be helpful for genetic counselling regarding CF in black patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 Cystic fibrosis (CF) mutations reported in black patients African-Americans South Africans Central Africans Guianese Mutation n/N Reference Mutation n/N Reference Mutation n/N Reference Mutation 3120þ1G>A 18/148 (7) 3120þ1G>A 11/24 (4) 3120þ1G>A 1/2 (1) 14/112 (1) 2/10 4/6 (2) (1) W19C (7) À94G>T 1/24 (4) 3600þ11.5kbC>G 4/4 (13) IVS22þ1G>A* 405þ3A>C 2/148 (7) 2183delAA 1/24 (4) Y109X* 444delA 1/148 (7, 19) 3196del54 1/24 (4) EX17a-EX18 del* 621G>A (7) G1249E 1/24 (4) IVS2þ28A>G* 1002-3T>G (7) 1/6 (1) 1119delA (7) D1270N 2/10 (2) G330X (7) F311del 1/24 (20) S364P (7) 1342-2delAG (7) 1504delG (7) G480C 2/148 (6, 7) R553X 3/148 (7) A559T 3/148 (7) Y563D (7) I618T (7) R764X (7) 2307insA 3/148 (7, 21) 2734delG/insAT (7) 3662delA (22) 3791delC (7) S1255X 2/148 (7, 23) R1283S (24) W1316X (23) n, number of CF chromosomes with a given mutation; N, total number of CF chromosomes tested. Login to comment

[hide] Atypical sinusitis in adults must lead to looking ... Laryngoscope. 2004 May;114(5):839-43. Coste A, Girodon E, Louis S, Pruliere-Escabasse V, Goossens M, Peynegre R, Escudier E
Atypical sinusitis in adults must lead to looking for cystic fibrosis and primary ciliary dyskinesia.
Laryngoscope. 2004 May;114(5):839-43., [PMID:15126740]

Abstract [show]
HYPOTHESES/OBJECTIVES:: In adults, purulent pansinusitis or nasal polyposis starting early in life or that is permanently infected or associated either with chronic bronchial infection, infertility, or situs inversus are uncommon. In these atypical cases of chronic sinusitis (ACS), a primary dysfunction of the mucociliary clearance can be suspected. Adult patients with ACS were therefore investigated to detect primary ciliary dyskinesia (PCD) or cystic fibrosis (CF). STUDY DESIGN: Open, prospective study. PATIENTS AND METHODS: Forty-two patients with ACS were investigated with ciliary beat frequency and ultrastructure analysis in nasal cells and cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation analysis in blood leukocytes. RESULTS: The diagnosis of PCD was confirmed in seven (17%) patients. At least one CFTR gene mutation was detected in 16 (38%) patients. The diagnosis of CF was suggested in three (7%) compound heterozygous patients. Another 13 (31%) patients were heterozygous for a CFTR gene mutation or a complex allele. Comparison of clinical features of ACS showed that only a family history of chronic sinusitis (P <.01) or chronic bronchitis (P <.02) and the presence of diffuse bronchiectasis (P <.0001) or serous otitis media (P <.0001) were significantly more frequent in PCD patients than in patients carrying CFTR gene mutations or those without PCD or CFTR gene mutations. CONCLUSIONS: ACS should be considered a remarkable entity in which congenital abnormalities of epithelial cells are frequently detected (55% of patients). The higher frequency of mutations in ACS patients compared with the general population suggests that heterozygoty for CFTR gene mutation could be a sinusitis-causing status.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Patients CFTR Gene Mutation(s) Sweat Test (mmol/L) CFTR 1 ⌬F508* 3849 ؉ 10kbC3T* 97 CFTR 2 ⌬F508* 3272-26A3G NA CFTR 3 2143delT S1235R NA CFTR 4 R74W-D1270N - NA CFTR 5 G576A-R668C - NA CFTR 6 IVS8-5T - NA CFTR 7 IVS8-5T - NA CFTR 8 R170C - 32 CFTR 9 ⌬F508* - NA CFTR 10 IVS8-5T - 44 CFTR 11 G1069R - 52 CFTR 12 IVS8-5T - 36 CFTR 13 IVS8-5T - NA CFTR 14 G551D* - NA CFTR 15 G542X* - Ͻ40 CFTR 16 F1074L - NA *Mutations detected with the CF-oligonulcleotide ligation assay kit. Login to comment

[hide] A low prevalence of cystic fibrosis in Uruguayans ... Genet Mol Res. 2004 Jun 30;3(2):258-63. Cardoso H, Crispino B, Mimbacas A, Cardoso ME
A low prevalence of cystic fibrosis in Uruguayans of mainly European descent.
Genet Mol Res. 2004 Jun 30;3(2):258-63., [PMID:15266396]

Abstract [show]
Cystic fibrosis is the most common hereditary disease in populations of European descent, with its prevalence depending on the populations and ethnic groups studied. In contrast to Europe and North America, there is little information about this disease in Latin America. Uruguay currently has a human population of 3,000,000, with a low rate of miscegenation and no remaining isolated Amerindian groups. In the present study, we estimated the prevalence of cystic fibrosis in this country based on the detection of DeltaF508 mutation carriers in 500 unrelated individuals and on the frequency of individuals homozygous for this mutation within the affected population. The latter was calculated from the frequency of the different mutations and genotypes observed in a sample of 52 previously described patients with confirmed cystic fibrosis. A theoretical estimate of the prevalence of cystic fibrosis based on anthropological data suggested a frequency of 25 affected individuals/100,000 inhabitants. However, our data indicated that the true prevalence in the population was considerably lower (6.9 cases/100,000 inhabitants).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 *G542X, R1162X, G85E, N1303K, R334W, R75Q, R74W, D1270N, W1282X, ∆I507, 2789+5G->A, R1066C, -816C/T, and R553X. Table 1. Login to comment
56 *G542X, R1162X, G85E, N1303K, R334W, R75Q, R74W, D1270N, W1282X, ∆I507, 2789+5G->A, R1066C, -816C/T, R553X. Table 2. Login to comment

[hide] Relation of sweat chloride concentration to severi... Pediatr Pulmonol. 2004 Sep;38(3):204-9. Davis PB, Schluchter MD, Konstan MW
Relation of sweat chloride concentration to severity of lung disease in cystic fibrosis.
Pediatr Pulmonol. 2004 Sep;38(3):204-9., [PMID:15274098]

Abstract [show]
In cystic fibrosis (CF), sweat chloride concentration has been proposed as an index of CFTR function for testing systemic drugs designed to activate mutant CFTR. This suggestion arises from the assumption that greater residual CFTR function should lead to a lower sweat chloride concentration, as well as protection against severe lung disease. This logic gives rise to the hypothesis that the lower the sweat chloride concentration, the less severe the lung disease. In order to test this hypothesis, we studied 230 patients homozygous for the DeltaF508 allele, and 34 patients with at least one allele associated with pancreatic sufficiency, born since January 1, 1955, who have pulmonary function data and sweat chloride concentrations recorded in our CF center database, and no culture positive for B. cepacia. We calculated a severity index for pulmonary disease, using an approach which takes into account all available pulmonary function data as well as the patient's current age and survival status. Patients with alleles associated with pancreatic sufficiency had significantly better survival (P = 0.0083), lower sweat chloride concentration (81.4 +/- 23.8 vs. 103.2 +/- 14.2 mEq/l, P < 0.0001), slower rate of decline of FEV(1) % predicted (-0.75 +/- 0.34 vs. -2.34 +/- 0.17% predicted per year), and a better severity index than patients homozygous for the DeltaF508 allele (median 73rd percentile vs. median 55th percentile, P = 0.0004). However, the sweat chloride concentration did not correlate with the severity index, either in the population as a whole, or in the population of patients with alleles associated with pancreatic sufficiency, who are thought to have some residual CFTR function. These data suggest that, by itself, sweat chloride concentration does not necessarily predict a milder pulmonary course in patients with cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 T (12); A455E (1); D1270N; G85E (3); R117H (4); R334W (1); R347H (1); T347P (6); 2859 þ 5 G ! Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Specimens positive for D1270N (see later) or I148T in the absence of 3199del6 were reclassified as negative for the purpose of this analysis. Login to comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment
43 D1270N/R74W analysis A subset of 192 D1270N-positive samples derived from this sample set as well as samples received for a variety of indications and ethnicities were analyzed for the R74W sequence change using LightCycler (Roche) amplification and melting curve analysis. Login to comment
92 Reclassification of specimens positive for the D1270N sequence change Mutation analysis for all samples included D1270N. Login to comment
93 Comparison of D1270N chromosomes between African American CF patients and carrier screening referrals revealed a Ͼ 100-fold increase among carriers (2 CF patient chromosomes: 228 CF carrier alleles). Login to comment
94 To investigate a potential modifying effect of R74W on the D1270N phenotype, we analyzed 192 D1270N-positive individuals for the presence of R74W.29 Patients were of varying ethnicities (46.4% African American, 29.2% Hispanic, 11.9% Caucasian, 12.5% Other/Mix/Not Provided) and indications (Table 4). Login to comment
95 Two individuals with the indication of carrier testing were homozygous for both D1270N and R74W. Login to comment
97 Six individuals carried the genotype of a severe CF mutation (i.e., ⌬F508), one copy of D1270N and one copy of R74W. Login to comment
99 Among those samples (n ϭ 167) received for carrier testing, 169 D1270N alleles and 159 R74W alleles were detected. Login to comment
100 While we were unable to determine phase, overall 94% of individuals with a D1270N allele also carried an R74W allele. Login to comment
101 In this data set there is no apparent correlation between D1270N, R74W, and phenotype. Login to comment
102 The D1270N sequence change was therefore not included in analysis of data for the larger study and has subsequently been removed from our CF test. Login to comment
116 From direct comparison of patient and carrier screening populations tested for the same mutation panel, we also identified a Ͼ 100-fold increase in the number of D1270N chromosomes among African American carriers as compared with African American CF patients. Login to comment
117 D1270N has been identified in individuals with cystic fibrosis24,33,35,36 as well as in men with congenital absence of the vas deferens.24,37 Similar discrepancies in mutation frequency between carrier and patient populations are now well known for the R117H15 and I148T38,39 sequence changes, each of which has a cis-acting modifier influencing phenotype (5T21 and 3199del6,40 respectively). Login to comment
118 There have been similar reports that R74W may be a potential modifier for the clinical phenotype of D1270N.29 The ⌬F508/ D1270N-R74W genotype has been reported in a girl with CF symptoms,41 in 2 CF patients, 3 CBAVD patients,24 and a 27-year-old man with CBAVD, elevated sweat chlorides, recurrent respiratory infection, and rhinitis.35 Our study of 192 D1270N-positive specimens was not suggestive of a role for R74W as a modifying allele, and a definitive explanation for the variable D1270N frequencies remains unknown. Login to comment
125 Table 4 Indications for 192 D1270N-positive patient samples Indication No. of Specimens Carrier testing-no family history 153 Carrier testing-family history 9 Carrier testing-abnormal fetal ultrasound findings 5 Known affected-CF diagnosis 3 Infertility 5 Suspected diagnosis (CF or pancreatitis) 15 Indication not provided 2 With 14% of our carrier screening referrals being from Hispanic and African American individuals, and another 12% from individuals with ethnicities other than the ACMG/ACOG recommended Caucasian or Ashkenazi Jewish, it is evident that clinicians are offering or making CF carrier screening available to a diverse population, many of whom choose testing. Login to comment
128 We appreciate the assistance of Michelle Blalock, of the University of Virginia, for R74W analysis of D1270N-positive specimens and Stephen Lake for support with statistical calculations. Login to comment

[hide] Rapid detection of CFTR gene rearrangements impact... J Med Genet. 2004 Nov;41(11):e118. Niel F, Martin J, Dastot-Le Moal F, Costes B, Boissier B, Delattre V, Goossens M, Girodon E
Rapid detection of CFTR gene rearrangements impacts on genetic counselling in cystic fibrosis.
J Med Genet. 2004 Nov;41(11):e118., [PMID:15520400]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
136 The subjects were divided into three groups according to the results of a previous screening: (i) 43 CF patients who fulfilled the diagnostic criteria of CF15 and who carried a CF mutation, and seven parents of deceased CF patients, a CF mutation having already been identified in the other parent (50 unidentified CF alleles); (ii) 12 CF patients with no identified CF mutation (24 unidentified CF alleles); and (iii) 16 patients apparently homozygous for a CFTR mutation and who had CF (F508del 2n = 6-, 2104insA22109del10, S945L, 3120+1GRA, N1303K) or a CFTR related disease, that is, isolated CBAVD (D110H, R117H, L997F, R74W-D1270N) or DB (R334W, R668C- G576A-D443Y) (0-16 unidentified CF alleles). Login to comment

[hide] Frequency and phenotypic consequences of the 3199d... Genet Med. 2005 Mar;7(3):210-1. Ruchon AF, Ryan SR, Fetni R, Rozen R, Scott P
Frequency and phenotypic consequences of the 3199del6 CFTR mutation in French Canadians.
Genet Med. 2005 Mar;7(3):210-1., [PMID:15775760]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations? Login to comment

[hide] Lack of association of common cystic fibrosis tran... Am J Gastroenterol. 2005 Apr;100(4):874-8. Gallegos-Orozco JF, E Yurk C, Wang N, Rakela J, Charlton MR, Cutting GR, Balan V
Lack of association of common cystic fibrosis transmembrane conductance regulator gene mutations with primary sclerosing cholangitis.
Am J Gastroenterol. 2005 Apr;100(4):874-8., [PMID:15784035]

Abstract [show]
BACKGROUND: Primary sclerosing cholangitis (PSC) is a chronic progressive cholestatic liver disease of uncertain etiology. However, the histologic features of PSC liver disease can resemble those in cystic fibrosis (CF), an inherited disorder caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. We sought to determine if PSC patients have a higher frequency of common CF alleles than disease controls. METHODS: DNA was extracted from peripheral lymphocytes of patients with end-stage liver disease. Samples were obtained before liver transplantation from 59 PSC patients and from three groups of control patients (20 each with primary biliary cirrhosis, autoimmune hepatitis, or hepatitis C). DNA samples were genotyped for 32 common CF mutations, the intron 8 T tract variants, and the M470V variant. RESULTS: One of 59 PSC patients (1.7%) had the common CF mutation (DeltaF508) in one CFTR gene. Two controls (3.3%) carried a single CF mutation (DeltaF508 in one primary biliary cirrhosis patient; W1282X in one hepatitis C patient). These rates do not differ from expected in the general population. The frequency of CFTR variants (5T and M470V) was also similar between PSC patients and controls. CONCLUSIONS: Despite anatomical similarities between CF liver disease and PSC, we could not confirm that PSC patients carried common CF mutations or common CFTR variants in higher than expected frequencies. These data suggest that CFTR dysfunction does not influence the pathogenesis of PSC.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 Three of the mutations identified in the PSC patients were previously reported to cause mild disease in CF patients (L997F, S1235R, and D1270N). Login to comment
106 of Classic CF Nonclassic CFTR Mutations Reference PSC Patients Mutations CF Mutations IVS8-5T of Unknown Effect McGill (1996) (21) 19 1 (G551D) 1 (R117H) NA NA Girodon (2002)(19) 29 0 3 (L997F, S1235R, D1270N) 2 1 (N782K) Sheth (2003)* (18) 19 0 3 (2752-26A→G, 3849 + 10kbC→T, I1139V) 1 3 (S686Y, I1366F, R75Q) Gallegos-Orozco (2004) 59 1 ( F508) 0 2 NA Total, no. Login to comment

[hide] Genotype-phenotype correlation for pulmonary funct... Thorax. 2005 Jul;60(7):558-63. de Gracia J, Mata F, Alvarez A, Casals T, Gatner S, Vendrell M, de la Rosa D, Guarner L, Hermosilla E
Genotype-phenotype correlation for pulmonary function in cystic fibrosis.
Thorax. 2005 Jul;60(7):558-63., [PMID:15994263]

Abstract [show]
BACKGROUND: Since the CFTR gene was cloned, more than 1000 mutations have been identified. To date, a clear relationship has not been established between genotype and the progression of lung damage. A study was undertaken of the relationship between genotype, progression of lung disease, and survival in adult patients with cystic fibrosis (CF). METHODS: A prospective cohort of adult patients with CF and two CFTR mutations followed up in an adult cystic fibrosis unit was analysed. Patients were classified according to functional effects of classes of CFTR mutations and were grouped based on the CFTR molecular position on the epithelial cell surface (I-II/I-II, I-II/III-V). Spirometric values, progression of lung disease, probability of survival, and clinical characteristics were analysed between groups. RESULTS: Seventy four patients were included in the study. Patients with genotype I-II/I-II had significantly lower current spirometric values (p < 0.001), greater loss of pulmonary function (p < 0.04), a higher proportion of end-stage lung disease (p < 0.001), a higher risk of suffering from moderate to severe lung disease (odds ratio 7.12 (95% CI 1.3 to 40.5)) and a lower probability of survival than patients with genotype I-II/III, I-II/IV and I-II/V (p < 0.001). CONCLUSIONS: The presence of class I or II mutations on both chromosomes is associated with worse respiratory disease and a lower probability of survival.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
209 To study the decline in pulmonary function between groups the ANOVA method (repeated measures) was used with baseline and current spirometric values as dependent variables, genotype groups as the independent variable, and age and evolution time as Table 1 CFTR mutation according to functional classification Class Molecular dysfunction Mutation I Defective protein production G542X, 711+1GRT, 1609delCA, R1162X, 1717-8GRA, W1282X, 1782delA, Q890X, 1898+3ARG, CFTRdele19, 936delTA II Defective protein processing F508del, N1303K, I507del, R1066C III Defective protein regulation D1270N, G551D IV Defective protein conductance L206W, R334W, R117H, R347H, D836Y, P205S V Partially defective production or processing 2789+5GRA, 1811+1.6kbARG, 3849+10kbCRT, 3272+26GRA Table 2 Groups based on genotype in CF adult patients Functional classes Genotype No of subjects I-I G542X/W1282X 1 R1162X/1898+3ARG 1 R1162X/CFTRdele19 1 I-II F508del/G542X 5 F508del/711+1GRT 2 F508del/1717-8GRA 1 F508del/936delTA 1 F508del/R1162X 1 N1303K/1609delCA 1 I-III G542X/D1270N+R74W 1 711+1G-T/G551D 1 I-IV G542X/P205S 1 Q890X/R334W 1 1609delCA/R347H 1 I-V G542X/2789+5GRT 2 G542X/1811+1.6kbARG 1 1782delA/2789+5GRA 1 1609delCA/1811+1.6kbARG 1 II-II F508del/F508del 21 F508del/N1303K 1 F508del/R1066C 1 II-III F508del/D1270N+R74W 1 I507del/D1270N+R74W 1 II-IV F508del/L206W 4 F508del/R334W 3 F508del/R117H 3 F08del/R347H 2 F508del/D836Y 1 II-V F508del/2789+5GRA 5 F508del/3849+10kbCRT 2 F508del/1811+1.6kbARG 2 F508del/3272+26GRA 1 N1303K/1811+1.6kbARG 1 N1303K/2789+5GRA 1 adjusted variables. Login to comment
272 Only the mutations D1270N and G551D were analysed and they were associated with a more favourable outcome of pulmonary function. Nevertheless, previous studies have pointed out that, among functional class III mutations, there may exist a wide variability in their phenotypes that depends principally on the CFTR protein site for which they code.33 34 In summary, the results of this study suggest that the genotype, based on functional class mutation on the two chromosomes, seems to be one of the most decisive factors for pulmonary phenotype and for survival in relation to pulmonary damage. Login to comment

[hide] Identification of CFTR, PRSS1, and SPINK1 mutation... Pancreas. 2006 Oct;33(3):221-7. Keiles S, Kammesheidt A
Identification of CFTR, PRSS1, and SPINK1 mutations in 381 patients with pancreatitis.
Pancreas. 2006 Oct;33(3):221-7., [PMID:17003641]

Abstract [show]
OBJECTIVES: Chronic pancreatitis is a progressive inflammatory disorder leading to irreversible exocrine and/or endocrine impairment. It is well documented that mutations in the cationic trypsinogen (PRSS1) gene can cause hereditary pancreatitis. Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) and the serine protease inhibitor Kazal type 1 (SPINK1) genes are also associated with pancreatitis. METHODS: We analyzed 381 patients with a primary diagnosis of chronic or recurrent pancreatitis using the Ambry Test: Pancreatitis to obtain comprehensive genetic information for the CFTR, SPINK1, and PRSS1 genes. RESULTS: The results identified 32% (122/381) of patients with 166 mutant CFTR alleles, including 12 novel CFTR variants: 4375-20 A>G, F575Y, K598E, L1260P, G194R, F834L, S573C, 2789 + 17 C>T, 621+83 A>G, T164S, 621+25 A>G, and 3500-19 G>A. Of 122 patients with CFTR mutations, 5.5% (21/381) also carried a SPINK1 mutation, and 1.8% (7/381) carried a PRSS1 mutation. In addition, 8.9% (34/381) of all patients had 1 of 11 different SPINK1 mutations. Another 6.3% (24/381) of the patients had 1 of 8 different PRSS1 mutations. Moreover, 1.3% of the patients (5/381) had 1 PRSS1 and 1 SPINK1 mutation. A total 49% (185/381) of the patients carried one or more mutations. CONCLUSIONS: Comprehensive testing of the CFTR, PRSS1, and SPINK1 genes identified genetic variants in nearly half of all subjects considered by their physicians as candidates for genetic testing. Comprehensive test identified numerous novel variants that would not be identified by standard clinical screening panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Patients With More Than 1 CFTR Mutation CFTR Mutation 1 CFTR Mutation 2 CFTR Mutation 3 No. of Patients deltaF508 5T 3 deltaF508 D1152H 1 deltaF508 deltaF508 1 deltaF508 F575Y 1 deltaF508 K598E 1 deltaF508 T164S 1 deltaF508 R74W D1270N 1 deltaF508 Q1476X 1 deltaF508 L997F 1 R553X D1152H 1 R553X G1069R 1 2789+5 G9A 2183 AA9G 1 3849+10kb C9T L1260P 1 711+3 A to G I1139V 1 1341+1 G9A G194R 5T 1 621+25 A9G 3500-19 C9T 1 R74W V855I 1 G542X R117H 1 G551D F311L 1 G576A R668C 2 K710X L997F 1 L997F L320V 1 G1069R 5T 1 1818+18 G9A 5T 1 F1074L 5T 1 F834L 5T 1 R74Q R297Q 1 R74Q R297Q 5T 1 R785Q 5T 1 R117H 5T 3 deltaF508 I1027T 1 Total patients 36 MutationsinboldfacewouldnothavebeendetectedbytheAmericanCollegeofObstetrics and Gynecology (ACOG)/American College of Medical Genetics (ACMG) mutation panel. Login to comment
83 Patients With SPINK1 and CFTR Mutations SPINK Mutation 1 SPINK Mutation 2 SPINK1 Mutation 3 CFTR Mutation 1 CFTR Mutation 2 No. of Patients 5¶UTR-147 A9G W1282X 1 5¶UTR-41 G9A 5¶UTR-41 G9A D1445N 1 5¶-41 G9A D1270N R74W 1 5¶UTR-81 C9T deltaF508 5T 1 IVS3+184 T9A S1235R 1 IVS3+184 T9A 5T 1 IVS3+184 T9A deltaF508 5T 1 IVS-72delCT R75X 1 L12F IVS3+90 A9T 296+28 A9G 1 L12F IVS3+90 A9T 4375-20 A9G 1 M1R 5¶UTR-147 A9G 5T 1 N34S IVS3-66-65insTTTT N37S Q1352H 1 N34S IVS3-66-65insTTTT L997F 1 N34S 5T 1 N34S IVS3-66-65insTTTT 5T 3 N34S IVS3-66-65insTTTT IVS1-37T 9C deltaF508 R117H 1 N34S IVS3-66-65insTTTT IVS1-37T9C R117H 5T 1 N34S IVS3-66-65insTTTT 621+83 A9G 1 N34S IVS3-66-65insTTTT IVS1-37T9C deltaF508 S1235R 1 Total patients 21 CFTR mutations in boldface would not have been detected by the ACOG/ACMG mutation panel. Login to comment

[hide] A novel computational and structural analysis of n... Genomic Med. 2008 Jan;2(1-2):23-32. Epub 2008 May 14. George Priya Doss C, Rajasekaran R, Sudandiradoss C, Ramanathan K, Purohit R, Sethumadhavan R
A novel computational and structural analysis of nsSNPs in CFTR gene.
Genomic Med. 2008 Jan;2(1-2):23-32. Epub 2008 May 14., [PMID:18716917]

Abstract [show]
Single Nucleotide Polymorphisms (SNPs) are being intensively studied to understand the biological basis of complex traits and diseases. The Genetics of human phenotype variation could be understood by knowing the functions of SNPs. In this study using computational methods, we analyzed the genetic variations that can alter the expression and function of the CFTR gene responsible candidate for causing cystic fibrosis. We applied an evolutionary perspective to screen the SNPs using a sequence homology-based SIFT tool, which suggested that 17 nsSNPs (44%) were found to be deleterious. The structure-based approach PolyPhen server suggested that 26 nsSNPS (66%) may disrupt protein function and structure. The PupaSuite tool predicted the phenotypic effect of SNPs on the structure and function of the affected protein. Structure analysis was carried out with the major mutation that occurred in the native protein coded by CFTR gene, and which is at amino acid position F508C for nsSNP with id (rs1800093). The amino acid residues in the native and mutant modeled protein were further analyzed for solvent accessibility, secondary structure and stabilizing residues to check the stability of the proteins. The SNPs were further subjected to iHAP analysis to identify htSNPs, and we report potential candidates for future studies on CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
125 The nsSNPs which were predicted to be Table 1 List of nsSNPs that were predicted to be deleterious by SIFT and PolyPhen SNPs ID Alleles AA change Tolerance index PSIC rs1800072 G/A V11C 1.00 0.150 rs1800073 C/T R31C 0.18 2.288 rs1800074 A/T D44V 0.01 2.532 rs1800076 G/A R75Q 0.03 1.754 rs1800078 T/C L138P 0.01 2.192 rs35516286 T/C I148T 0.41 1.743 rs1800079 G/A R170H 0.05 1.968 rs1800080 A/G S182G 0.03 1.699 rs1800086 C/G T351S 0.30 1.600 rs1800087 A/C Q353H 0.03 2.093 rs4727853 C/A N417K 1.00 0.015 rs11531593 C/A F433L 0.65 0.694 rs1800089 C/T L467F 0.15 1.568 rs213950 G/A V470M 0.17 1.432 rs1800092 C/A/G I506M 0.00 1.574 rs1801178 A/G I507V 0.38 0.314 rs1800093 T/G F508C 0.00 3.031 rs35032490 A/G K532E 1.00 1.525 rs1800097 G/A V562I 0.13 0.345 rs41290377 G/C G576A 0.33 1.262 rs766874 C/T S605F 0.03 2.147 rs1800099 A/G S654G 0.03 1.611 rs1800100 C/T R668C 0.01 2.654 rs1800101 T/C F693L 0.61 0.895 rs1800103 A/G I807M 0.01 1.554 rs1800106 T/C Y903H 0.52 0.183 rs1800107 G/T S909I 0.10 1.624 rs1800110 T/C L967S 0.07 1.683 rs1800111 G/C L997F 0.24 1.000 rs1800112 T/C I1027T 0.03 1.860 rs1800114 C/T A1067V 0.04 1.542 rs36210737 T/A M1101K 0.05 2.637 rs35813506 G/A R1102K 0.52 1.589 rs1800120 G/T R1162L 0.00 2.038 rs1800123 C/T T1220I 0.22 0.059 rs34911792 T/G S1235R 0.45 1.483 rs11971167 G/A D1270N 0.12 1.739 rs4148725 C/T R1453W 0.00 2.513 Highly deleterious by SIFT and damaging by PolyPhen are indicated as bold deleterious in causing an effect in the structure and function of the protein by SIFT, PolyPhen and Pupasuite correlated well with experimental studies (Tsui 1992; Ghanem et al. 1994; Bienvenu et al. 1998) (Table 3). Login to comment

[hide] Phenotypic characterisation of patients with inter... Thorax. 2009 Aug;64(8):683-91. Epub 2009 Mar 23. Goubau C, Wilschanski M, Skalicka V, Lebecque P, Southern KW, Sermet I, Munck A, Derichs N, Middleton PG, Hjelte L, Padoan R, Vasar M, De Boeck K
Phenotypic characterisation of patients with intermediate sweat chloride values: towards validation of the European diagnostic algorithm for cystic fibrosis.
Thorax. 2009 Aug;64(8):683-91. Epub 2009 Mar 23., [PMID:19318346]

Abstract [show]
BACKGROUND: In patients with symptoms suggestive of cystic fibrosis (CF) and intermediate sweat chloride values (30-60 mmol/l), extensive CFTR gene mutation analysis and nasal potential difference (NPD) measurement are used as additional diagnostic tests and a positive result in either test provides evidence of CFTR dysfunction. To define the phenotype of such patients and confirm the validity of grouping them, patients with intermediate sweat chloride values in whom either additional CF diagnostic test was abnormal were compared with subjects in whom this was not the case and patients with classic CF. METHODS: The phenotypic features of four groups were compared: 59 patients with CFTR dysfunction, 46 with an intermediate sweat chloride concentration but no evidence of CFTR dysfunction (CF unlikely), 103 patients with CF and pancreatic sufficiency (CF-PS) and 62 with CF and pancreatic insufficiency (CF-PI). RESULTS: The CFTR dysfunction group had more lower respiratory tract infections (p = 0.01), more isolation of CF pathogens (p<0.001) and clubbing (p = 0.001) than the CF unlikely group, but less frequent respiratory tract infections with CF pathogens than the CF-PS group (p = 0.05). Patients in the CF-PS group had a milder phenotype than those with PI. Many features showed stepwise changes through the patient groups. CONCLUSION: Patients with intermediate sweat chloride values and two CFTR mutations or an abnormal NPD measurement have a CF-like phenotype compatible with CFTR dysfunction and, as a group, differ phenotypically from patients with intermediate sweat chloride values in whom further CF diagnostic tests are normal as well as from CF-PS and CF-PI patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Table 2 CFTR mutations in the patient subgroups CF-PS CFTR dysfunction CF unlikely Genotype Subjects (n) Genotype Subjects (n) Genotype Subjects (n) F508del*/Not found 12 F508del*/3849+10 kb(C.T){ 11 Not found/Not found 39 Not found/Not found 10 F508del*/R117H{ 7 F508del*/Not found 4 F508del*/3849+10 kb(C.T){ 7 F508del*/Not found 7 IVS8-5T{/Not found 1 F508del*/R347P{ 5 Not found/Not found 5 S1235E/E528E 1 F508del*/R117H{ 4 F508del*/D1152H{ 4 No mutation analysis 1 F508del*/2789+5G.A{ 4 F508del*/IVS8-5T{ 4 Total 46 F508del*/S945L* 3 F508del*/S945L* 2 2789+5G.A{/Not found 3 W1282X*/IVS8-5T{ 2 F508del*/3272-26 A.G{ 2 F508del*/R1070W{ 1 F508del*/A455E{ 2 F508del*/L159S 1 F508del*/711+5G.A 2 F508del*/T1246I 1 F508del*/2789+5G.A 2 F508del*/L165S 1 G542X*/R334W{ 2 W1282X*/D1152H{ 1 F508del*/R334W{ 2 R1162X*/D1152H{ 1 R347P{/Not found 2 R347Hu/D1152H{ 1 F508del*/2116delCTAA 1 R553X*/R117H{ 1 F508del*/IVS8-5T{ 1 3659delC*/R117H{ 1 F508del*/D1152H{ 1 3849+10kb(C.T){/G551R 1 F508del*/711+3A.G 1 R1162X*/3849+10 kb(C.T){ 1 F508del*/L206W{ 1 2789+5G.A{/Not found 1 F508del*/I336K{ 1 G542X*/T854A 1 F508del*/G970D 1 R553X*/Q1463H 1 F508del*/L159S 1 S1235R/R668C 1 F508del*/R751L 1 2789+5G.A{/S977F 1 F508del*/E656X 1 No mutation analysis 1 F508del*/4015delA 1 Total 59 F508del*/Y913S 1 F508del*/L165S 1 F508del*/2143delT 1 G551D*/I336K{ 1 G551D*/3272-26A.G{ 1 G551D*/711+3A.G 1 R553X*/4005+2T.C 1 R553X*/E92K{ 1 G542X*/L206W{ 1 W1282X*/I336K 1 R1162X*/3849+10 kb(C.T){ 1 R1162X*/2789+5G.A{ 1 574delA*/3141del9 1 9890X/I105N 1 R334W{/R1070Q{ 1 3272-26A.G{/4218insT 1 3272-26A.G{/L165S 1 711+3A.G/G1244E 1 R352Q/1812-1G.A 1 F1052V/IVS8-5T{ 1 R74W/D1270N 1 1898-3G.A/1898-3G.A 1 1717-1G.A*/R334W{ 1 3659delC*/Not found 1 394delTT/Not found 1 R1162X*/Not found 1 R553X*/Not found 1 R117H{/Not found 1 G85E*/Not found 1 3849+10k(C.T){/Not found 1 Total 103 *Mutation class I, II or III. Login to comment

[hide] Is CFTR 621+3 A>G a cystic fibrosis causing mutati... J Hum Genet. 2010 Jan;55(1):23-6. Epub 2009 Nov 6. Forzan M, Salviati L, Pertegato V, Casarin A, Bruson A, Trevisson E, Di Gianantonio E, Clementi M
Is CFTR 621+3 A>G a cystic fibrosis causing mutation?
J Hum Genet. 2010 Jan;55(1):23-6. Epub 2009 Nov 6., [PMID:19893581]

Abstract [show]
The 621+3 A>G variant of the CFTR gene was initially detected in four Greek patients with a severe form of cystic fibrosis, and it is reported to impair CFTR mRNA splicing. We present three lines of evidence that argue against the pathogenicity of this variant. First, its allelic frequency in the Italian population was 0.4%. Even considering the lowest value in the confidence interval we would expect 10% of Italian CF patients to be heterozygotes for this variant, whereas it has been reported only in one patient (0.04% of Italian CF patients). Second, expression of the 621+3 A>G variant in HeLa cells using a hybrid minigene showed that 39.5+/-1.1% of transcripts were correctly spliced, indicating that its effects on mRNA splicing are similar to those of the CFTR intron 8 5T variant, associated with congenital bilateral absence of vas deferens (CBAVD), but not with CF. Third, we have identified an asymptomatic individual who harbored the 621+3 A>G variant in trans with the Q552X mutation. Because 621+3 A>G is often included in population-screening programs, this information is critical to provide adequate counseling to patients. Further work should be aimed at investigating whether this variant may have a role in CBAVD or atypical CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 3 Claustres, M., Altieri, J. P., Guittard, C., Templin, C., Chevalier-Porst, F. & Des Georges, M. Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations? Login to comment

[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For many of these subjects mutations were identified following DGGE and/or dHPLC analysis, and not through the RDB-based test, as gene alterations are "rare"/uncommon [A238V, R352W, S42F, (V201M, D1270N & R74W) and L206W] or because they have never been identified before [D372E (1251T→G) and L1414S (4373T→C)]. Login to comment
97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction. Login to comment
99 Notes to Tables: (A) CFTR mutations A238V, R352W, 4006-19del3, S42F, D372E (1251T→G), L1414S (4373T→C), (V201M, D1270N & R74W) and L206W are not included in the RDB-based screening. Login to comment
137 In North America, for example, missense mutations I148T and D1270N were found N100 and N200 times, respectively, more frequently in CF carriers than in patients. Login to comment

[hide] Genetic testing in pancreatitis. Gastroenterology. 2010 Jun;138(7):2202-6, 2206.e1. Epub 2010 Apr 20. Ooi CY, Gonska T, Durie PR, Freedman SD
Genetic testing in pancreatitis.
Gastroenterology. 2010 Jun;138(7):2202-6, 2206.e1. Epub 2010 Apr 20., [PMID:20416310]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Interpretation of Mutations Requires an Understanding of Their Functional Consequences Mutation group Reported mutations Complex allele: These mutations are recognized to occur on a single allele R117H ϩ T G576A ϩ R668C F508del ϩ I1027T Benign sequence alterations: These mutations have no known clinical consequence R74Q R297Q R74W 621 * 25 AϾG 3500-19 CϾT T164S C855I I1139V CFTR-related disorder associated: These mutations have been described in individuals with CF-like single organ disease (such as pancreatitis, sinopulmonary disease, or obstructive azoospermia), but do not fulfill the diagnostic criteria for CF 5T R117H D1270N L320V Q1352H 1818-18 GϾA S1235R CF causing F508del Q1476X R553X K710X G542X G551D F311L 2789-5 GϾA 2183AAϾG 711ϩ3 AϾG 3849ϩ10kb CϾT 1341ϩ1GϾA D1152Ha F1074La R553X Unknown clinical consequence F575Y L1260P G194R G1069R L997F K598E F834L R785Q To illustrate this point, mutations identified by extensive mutation testing in a cohort of patients with recurrent acute or chronic pancre- atitis14 are listed according to their clinical consequences (based on current consensus guidelines13 and functional and/or clinical reports; available: http://www.genet.sickkids.on.ca). Login to comment

[hide] Cystic fibrosis newborn screening: using experienc... J Inherit Metab Dis. 2010 Oct;33(Suppl 2):S255-61. Epub 2010 Jun 3. Hale JE, Parad RB, Dorkin HL, Gerstle R, Lapey A, O'Sullivan BP, Spencer T, Yee W, Comeau AM
Cystic fibrosis newborn screening: using experience to optimize the screening algorithm.
J Inherit Metab Dis. 2010 Oct;33(Suppl 2):S255-61. Epub 2010 Jun 3., [PMID:20521170]

Abstract [show]
Newborn screening (NBS) for cystic fibrosis (CF) offers the opportunity for early diagnosis and improved outcomes in patients with CF and has been universally available in the state of Massachusetts since 1999 using an immunoreactive trypsinogen (IRT)-DNA algorithm. Ideally, CF NBS is incorporated as part of an integrated NBS system that allows for comprehensive and coordinated education, laboratory screening, clinical follow-up, and evaluation so that evidence-based data can be used to maximize quality improvements and optimize the screening algorithm. The New England Newborn Screening Program (NENSP) retrospectively analyzed Massachusetts's CF newborn screening data that yielded decisions to eliminate a screen-positive category, maintain the IRT cutoff value that prompts the second tier DNA testing, and communicate CF relative risk to primary care providers (PCPs) based on categorization of positive CF NBS results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 Extensive follow-up Table 1 Children who are followed at a cystic fibrosis (CF) center who were not identified by CF newborn screening (NBS) Presentation Status at last update NBS IRT%, age at dx Genotype Sweat [Cl- ] (MEq/L)a Five CF infants with false-negative CF NBS results FTT, upper respiratory infections, chronic cough Pancreatic sufficient, sinus disease, positive cultures for Staph. aureus and H. flu 84.2%, 3 months DF508/R117H 67 Meconium ileus 93.9%, birth G542X / unknown 57.7, 67.4 FTT, recurrent pneumonia, asthma 62.3%, 4 years D828G / 3271+18 C or T 62 Asthma 78.6%, 3 years D1270N / R74W 86.5 Chronic cough and sinusitis 74.1%, 4 years R75Q / unknown (second mutation not identified by sequencing) 82, 68 Four additional infants followed at CF center who do not (yet) carry a CF diagnosis Chronic cough Pancreatic sufficient, asthma, moderate Staph. aureus and H. flu 39.7%, 5 years DF508 / unknown 39 Chronic cough; sweat-tested and genotyped after parents found to be carriers during pregnancy with younger sibling Does not carry CF diagnosis, pancreatic sufficient, exercise-induced asthma, normal PFTs, cultures Staph. aureus 94.6%, 3 years DF508/R117H 56 Two siblings who are well; genotyped for family history Positive cultures for Staph. aureus and H.flu 21.3%, 71.2% (sib) DF508 / R117H 20, not done IRT Immunoreactive trypsinogen, FTT failure to thrive, PFT pulmonary function test a Value(s) reported from independent visits of infants with positive CF NBS results has allowed the MA CF NBS program to incorporate communication of relative risk of CF following a positive NBS result that is based upon combined consideration (multi-analyte profiling) of both the IRT concentration and the screening-genotype results. Login to comment

[hide] A new complex allele of the CFTR gene partially ex... Genet Med. 2010 Sep;12(9):548-55. Lucarelli M, Narzi L, Pierandrei S, Bruno SM, Stamato A, d'Avanzo M, Strom R, Quattrucci S
A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation.
Genet Med. 2010 Sep;12(9):548-55., [PMID:20706124]

Abstract [show]
PURPOSE: To evaluate the role of complex alleles, with two or more mutations in cis position, of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in the definition of the genotype-phenotype relationship in cystic fibrosis (CF), and to evaluate the functional significance of the highly controversial L997F CFTR mutation. METHODS: We evaluated the diagnosis of CF or CFTR-related disorders in 12 unrelated subjects with highly variable phenotypes. According to a first CFTR mutational analysis, subjects appeared to be compound heterozygotes for a classic mutation and the L997F mutation. A further CFTR mutational analysis was conducted by means of a protocol of extended sequencing, particularly suited to the detection of complex alleles. RESULTS: We detected a new [R117L; L997F] CFTR complex allele in the four subjects with the highest sweat test values and CF. The eight subjects without the complex allele showed the most varied biochemical and clinical outcome and were diagnosed as having mild CF, CFTR-related disorders, or even no disease. CONCLUSIONS: The new complex allele partially explains the variable phenotype in CF subjects with the L997F mutation. CFTR complex alleles are likely to have a role in the definition of the genotype-phenotype relationship in CF. Whenever apparently identical CFTR-mutated genotypes are found in subjects with divergent phenotypes, an extensive mutational search is mandatory.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 In vivo findings and, in some cases, in vitro functional characterizations have been reported for [F508C; S1251N],38 [R347H; D979A],39,40 [R74W; D1270N],41 [G628R; S1235R],42,43 [M470V; S1235R],42 [S912L; G1244V],44 [R117H; (TG)mTn],45-47 [R117C; (TG)mTn],46 [S1235R; (TG)mT5],48 [G576A; R668C],10,49 [V562I; A1006E],49 [R352W; P750L],49 [1198_1203del TGGGCT; 1204GϾA],49 [V754M; CFTRdele3_10,14b_16],50 and [F508del; I1027T].51 These complex alleles have been found in patients with either CF or CFTR-RD, although more often in the former. Login to comment

[hide] p.Ser1235Arg should no longer be considered as a c... Eur J Hum Genet. 2011 Jan;19(1):36-42. Epub 2010 Aug 18. Rene C, Paulet D, Girodon E, Costa C, Lalau G, Leclerc J, Cabet-Bey F, Bienvenu T, Blayau M, Iron A, Mittre H, Feldmann D, Guittard C, Claustres M, Georges M
p.Ser1235Arg should no longer be considered as a cystic fibrosis mutation: results from a large collaborative study.
Eur J Hum Genet. 2011 Jan;19(1):36-42. Epub 2010 Aug 18., [PMID:20717170]

Abstract [show]
Among the 1700 mutations reported in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, a missense mutation, p.Ser1235Arg, is a relatively frequent finding. To clarify its clinical significance, we collected data from 104 subjects heterozygous for the mutation p.Ser1235Arg from the French CF network, addressed for various indications including classical CF, atypical phenotypes or carrier screening in subjects with or without a family history. Among them, 26 patients (5 having CF, 10 CBAVD (congenital bilateral absence of the vas deferens) and 11 with CF-like symptoms) and 14 healthy subjects were compound heterozygous for a second CFTR mutation. An exhaustive CFTR gene analysis identified a second mutation in cis of p.Ser1235Arg in all CF patients and in 81.8% CBAVD patients. Moreover, epidemiological data from >2100 individuals found a higher frequency of p.Ser1235Arg in the general population than in CF or CBAVD patients. These data, added to the fact that in silico analysis and functional assays suggest a benign nature of this substitution, give several lines of evidence against an association of p.Ser1235Arg with CF or CBAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
175 11 Claustres M, Altieri JP, Guittard C, Templin C, Chevalier-Porst F, Des Georges M: Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations? Login to comment

[hide] [R74W;R1070W;D1270N]: a new complex allele respons... J Cyst Fibros. 2010 Dec;9(6):447-9. Epub 2010 Sep 28. de Prada Merino A, Butschi FN, Bouchardy I, Beckmann JS, Morris MA, Hafen GM, Fellmann F
[R74W;R1070W;D1270N]: a new complex allele responsible for cystic fibrosis.
J Cyst Fibros. 2010 Dec;9(6):447-9. Epub 2010 Sep 28., [PMID:20880762]

Abstract [show]
Since the beginning of population screening for CF carriers, it has become apparent that complex CFTR alleles are not uncommon. Deciphering their impact in disease pathogenesis remains a challenge for both clinicians and researchers. We report the observation of a new complex allele p.[R74W+R1070W+D1270N] found in trans with a type 1 mutation and associated with clinical diagnosis of cystic fibrosis in a one year-old Moroccan patient. This case underlines the difficulties in counseling patients with uncommon mutations and the necessity of functional studies to evaluate the structure-function relationships, since the association of several variations in cis can dramatically alter CFTR function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Keywords: Complex allele; R74W; D1270N; R1070W; CFTR; Cystic fibrosis 1. Login to comment
9 Since the beginning of population screening for CF carriers, it has become apparent that complex alleles such as [R74W; D1270N] (HGVS nomenclature: c. Login to comment
46 Discussion Here we report a new complex allele [R74W;R1070W; D1270N] in trans with a type I CFTR mutation in a patient with clinical diagnosis of CF and elevated sweat conductivity measurements. Login to comment
98 Are p.1148T, p.R74W and p.D1270N CF causing mutations? Login to comment

[hide] Orphan missense mutations in the cystic fibrosis t... J Mol Diagn. 2011 Sep;13(5):520-7. Epub 2011 Jun 25. Fresquet F, Clement R, Norez C, Sterlin A, Melin P, Becq F, Kitzis A, Thoreau V, Bilan F
Orphan missense mutations in the cystic fibrosis transmembrane conductance regulator a three-step biological approach to establishing a correlation between genotype and phenotype.
J Mol Diagn. 2011 Sep;13(5):520-7. Epub 2011 Jun 25., [PMID:21708286]

Abstract [show]
More than 1860 mutations have been found within the human cystic fibrosis transmembrane conductance regulator (CFTR) gene sequence. These mutations can be classified according to their degree of severity in CF disease. Although the most common mutations are well characterized, few data are available for rare mutations. Thus, genetic counseling is particularly difficult when fetuses or patients with CF present these orphan variations. We describe a three-step in vitro assay that can evaluate rare missense CFTR mutation consequences to establish a correlation between genotype and phenotype. By using a green fluorescent protein-tagged CFTR construct, we expressed mutated proteins in COS-7 cells. CFTR trafficking was visualized by confocal microscopy, and the cellular localization of CFTR was determined using intracellular markers. We studied the CFTR maturation process using Western blot analysis and evaluated CFTR channel activity by automated iodide efflux assays. Of six rare mutations that we studied, five have been isolated in our laboratory. The cellular and functional impact that we observed in each case was compared with the clinical data concerning the patients in whom we encountered these mutations. In conclusion, we propose that performing this type of analysis for orphan CFTR missense mutations can improve CF genetic counseling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
122 Summary of the Patients` Data, Concerning Genotype, Phenotype, and Protein Dysfunction Patient no./sex/age at molecular diagnostics (years) Genotype Phenotype Protein dysfunctions Channel activity* Maturation† Intracellular localization‡ 1/F/3 p.[Leu102Pro] ϩ [Arg553X] Positive sweat test result, bacterial lung colonization, no pancreatitis ϩϩ ϩϩ ϩϩ 2/F/newborn p.[Phe508del] ϩ [Leu167Arg] Positive sweat test result, recurrent pancreatitis, no lung infection ϩϩ ϩϩ ϩϩ 3/F/3 p.[Asn1303Lys] ϩ [Pro574Ser] Normal sweat test result, asymptomatic ϩϩ ϩ ϩ 4/M/31 p.[Arg74Trp;Val201Met; Asp1270Asn] ϩ [Pro841Arg]; c. Login to comment
214 His genotype was p.[Pro841Arg] ϩ [Arg74Trp;Val201Met; Asp1270Asn]. Login to comment
81 Summary of the Patients` Data, Concerning Genotype, Phenotype, and Protein Dysfunction Patient no./sex/age at molecular diagnostics (years) Genotype Phenotype Protein dysfunctions Channel activity* Maturation† Intracellular localization‡ 1/F/3 p.[Leu102Pro] ϩ [Arg553X] Positive sweat test result, bacterial lung colonization, no pancreatitis ϩϩ ϩϩ ϩϩ 2/F/newborn p.[Phe508del] ϩ [Leu167Arg] Positive sweat test result, recurrent pancreatitis, no lung infection ϩϩ ϩϩ ϩϩ 3/F/3 p.[Asn1303Lys] ϩ [Pro574Ser] Normal sweat test result, asymptomatic ϩϩ ϩ ϩ 4/M/31 p.[Arg74Trp;Val201Met; Asp1270Asn] ϩ [Pro841Arg]; c. Login to comment
210 His genotype was p.[Pro841Arg] ϩ [Arg74Trp;Val201Met; Asp1270Asn]. Login to comment

[hide] Testicular CFTR splice variants in patients with c... Hum Mol Genet. 1998 Oct;7(11):1739-43. Larriba S, Bassas L, Gimenez J, Ramos MD, Segura A, Nunes V, Estivill X, Casals T
Testicular CFTR splice variants in patients with congenital absence of the vas deferens.
Hum Mol Genet. 1998 Oct;7(11):1739-43., [PMID:9736775]

Abstract [show]
The involvement of the five thymidine (5T) variant in intron 8 of the cystic fibrosis membrane regulator (CFTR) gene in congenital bilateral absence of the vas deferens (CBAVD) phenotype has been extensively demonstrated. This variant leads to alternative splicing of the CFTR gene which results in a wild-type transcript and one without exon 9. Little is known about expression of the CFTR gene in the testis. We analysed the level of the aberrantly spliced transcripts in testicular biopsies and correlated it with disease expression. Quantitative RT-PCR analysis in testicular biopsies from control and CBAVD patients showed a correlation between the length of the IVS8-6(T) n tract and the level of alternatively spliced transcripts. Results from histological analysis also suggest an involvement of the alternative transcript in the spermatogenic status of patients, leading to a decreased number of mature sperm forms in the tubule.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 RESULTS CFTR analysis Eight different mutations (R117H, L206W, V232D, ∆F508, G542X, 711+1G→T, D1270N and 2789+5G→A) were found in nine of the 12 CBAVD patients, yielding a CFTR mutation frequencyof75%.ThreepatientspresentedtwoCFTRmutations, with one of them homozygous for the V232D mutation. Login to comment
26 CFTR genotype, IVS8-6 poly(T) allele and proportion of exon 9+ (E9+) and exon 9- (E9-) CFTR transcripts in testicular and epididymal biopsies Sample Phenotype CF mutation IVS8-6(T) Testis Epididymis n E9+ (%) E9- (%) n E9+ (%) E9- (%) 1 Non-CBAVD N/N 9T/9T 5 99 ± 0 1 ± 0 2 Non-CBAVD N/N 7T/7T 2 96 ± 2 4 ± 2 3 Non-CBAVD N/N 7T/7T 3 98 ± 0 2 ± 0 4 Non-CBAVD N/N 7T/7T 3 97 ± 1.5 3 ± 1.5 5 Non-CBAVD R334W/N 7T/7T 3 94 ± 1 6 ± 1 6 Non-CBAVD N/N 7T/7T 2 95 ± 1 5 ± 1 7 CBAVD V232D/V232D 9T/9T 4 96 ± 1.5 4 ± 1.5 8 CBAVD ∆F508/N 9T/9T 2 99 ± 0 1 ± 0 9 CBAVD ∆F508/D1270N 7T/9T 2 98 ± 1 2 ± 1 10 CBAVD G542X/2789+5G→A 7T/9T 2 96 ± 1 4 ± 1 11 CBAVD N/N 7T/7T 3 96 ± 2 4 ± 2 2 90 ± 3 10 ± 3 12 CBAVD N/N 7T/7T 2 94 ± 2 6 ± 2 5 78 ± 5 22 ± 5 13 CBAVD R117H/N 7T/7T 2 99 ± 0 1 ± 0 4 95 ± 2 5 ± 2 14 CBAVD G542X/5T 5T/9T 3 30 ± 2 70 ± 2 15 CBAVD ∆F508/5T 5T/9T 2 80 ± 5 20 ± 5 16 CBAVD L206W/5T 5T/9T 2 58 ± 2 42 ± 2 17 CBAVD 711+1G→T/5T 5T/7T 3 77 ± 4 23 ± 4 18 CBAVD 5T/N 5T/7T 5 71 ± 2 29 ± 2 The mean proportion of E9+ and E9- CFTR transcripts is calculated as the mean of the proportions found for each sample. Login to comment
79 (A and B) Patient 9 with genotype ∆F508/D1270N; (C and D) patient 17 with genotype 711+1G→T/5T. Login to comment

[hide] Complete mutational screening of the CFTR gene in ... Hum Genet. 1998 Dec;103(6):718-22. Bombieri C, Benetazzo M, Saccomani A, Belpinati F, Gile LS, Luisetti M, Pignatti PF
Complete mutational screening of the CFTR gene in 120 patients with pulmonary disease.
Hum Genet. 1998 Dec;103(6):718-22., [PMID:9921909]

Abstract [show]
In order to determine the possible role of the cystic fibrosis transmembrane regulator (CFTR) gene in pulmonary diseases not due to cystic fibrosis, a complete screening of the CFTR gene was performed in 120 Italian patients with disseminated bronchiectasis of unknown cause (DBE), chronic bronchitis (CB), pulmonary emphysema (E), lung cancer (LC), sarcoidosis (S) and other forms of pulmonary disease. The 27 exons of the CFTR gene and their intronic flanking regions were analyzed by denaturing gradient gel electrophoresis and automatic sequencing. Mutations were detected in 11/23 DBE (P = 0.009), 7/25 E, 5/27 CB, 5/26 LC, 5/8 S (P = 0.013), 1/4 tuberculosis, and 1/5 pneumonia patients, and in 5/33 controls. Moreover, the IVS8-5T allele was detected in 6/25 E patients (P = 0.038). Four new mutations were identified: D651N, 2377C/T, E826K, and P1072L. These results confirm the involvement of the CFTR gene in disseminated bronchiectasis of unknown origin, and suggest a possible role for CFTR gene mutations in sarcoidosis, and for the 5T allele in pulmonary emphysema.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Of these 22 mutations, 14 (R75Q, P111L, R117H, I148T, Y301C, ∆F508, E585X, V754M, L997F, R1066C, M1137V, 3667ins4, D1270N, 4382delA) are listed by the Cystic Fibrosis Genetic Analysis Consortium (CFGAC) as CF mutations (CFGAC website), even if their role in CF disease remains to be proven, as is the case for R75Q, P111L, V754M, L997F, and D1270N. Login to comment
88 of cases CFTR gene PolyTb status tested mutationa DBE 23 1 G576A-R668C/L997F 7/9 1 ∆F508/L997F 9/9 1 ∆F508/- 7/9 1 R1066C/- 5/7 1 3667ins4/- 5/7 1 R75Q/- 7/7 1 M1137V/- 7/7 1 -/- 5/5 3 -/- 5/7 10 -/- 7/7 2 -/- 7/9 CB 27 1 P111L/- 7/7 1 R117H/- 7/7 1 E585X/- 7/7 1 P1072L/- 7/7 1 -/- 5/7 15 -/- 7/7 6 -/- 7/9 1 -/- 9/9 E 25 1 R668C/- 7/7 6 -/- 5/7 16 -/- 7/7 6 -/- 7/9 S 8 1 E826K/- 7/7 1 ∆F508/- 7/9 1 4382delA/- 7/7 1 L997F/- 7/9 1 V754M/- 7/9 3 -/- 7/7 LC 26 1 I148T/- 5/7 1 D1270N-R74W 5/7 1 D651N/- 7/7 1 Y301C/- 7/7 1 -/- 5/7 16 -/- 7/7 5 -/- 7/9 TB 4 1 -/- 5/7 1 -/- 7/7 2 -/- 7/9 Pneumonia 5 4 -/- 7/7 1 -/- 5/7 Pnx 2 2 -/- 7/7 Controls 68 1 L997F/- 7/9 1 R31C/- 7/7 1 I506V/- 5/7 1 -/- 5/7 1 -/- 5/9 23 -/- 7/7 4 -/- 7/9 1 -/- 9/9 2 ? Login to comment
117 One LC patient had mutations D1270N and R74W, which have been previously described to be syntenic in a CBAVD patient (Mercier et al. 1995). Login to comment
118 D1270N is now included in the CF mutation list by the CFGAC. Login to comment

[hide] Cystic fibrosis carrier frequencies in populations... J Med Genet. 1999 Jan;36(1):41-4. Padoa C, Goldman A, Jenkins T, Ramsay M
Cystic fibrosis carrier frequencies in populations of African origin.
J Med Genet. 1999 Jan;36(1):41-4., [PMID:9950364]

Abstract [show]
Cystic fibrosis (CF) is a common autosomal recessive disorder in populations of European descent. However, very little is known about CF in populations of African origin among whom it has been believed to be extremely rare. The aim of this study was to determine if this is the case or whether it is under-reported. A CFTR mutation, 3120+1G-->A, which was first reported in three African-American CF patients, has been shown to account for 9-14% of African-American CF chromosomes. It has also been found in 4/6 CF chromosomes in South African blacks and one CF chromosome of Cameroonian origin. In order to determine the carrier frequency of the 3120+1G-->A mutation in Africa, 1360 unrelated, healthy subjects were screened. Nine carriers were identified. In addition, two out of five black CF patients with positive sweat tests were found to be heterozygous for the 3120+1G-->A mutation and two out of another four black patients with symptoms suggestive of CF, but unconfirmed by sweat tests, were heterozygous for the D1270N mutation. A further three CFTR mutations, A559T, S1255X, and 444delA, which had been found in African-American CF patients, were not identified in the patients or in over 373 healthy subjects tested. The 3120+1G-->A mutation has a carrier frequency of 1 in 91 (8/728) in South African blacks with a 95% confidence interval of 1 in 46 to 1 in 197. Since this mutation accounts for between 15% and 65% of CF chromosomes in South African blacks, a corrected CF carrier frequency would be between 1 in 14 and 1 in 59. Hence, the incidence of CF would be predicted to be between 1 in 784 and 1 in 13924 births in this population. There are several possible reasons why these people are not being detected. Some of these are misdiagnosis as chronic pulmonary infection, malnutrition, tuberculosis, infantile diarrhoea, failure to thrive, or a high infant mortality rate.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 In addition, two out of five black CF patients with positive sweat tests were found to be heterozygous for the 3120+1G→A mutation and two out of another four black patients with symptoms suggestive of CF, but unconfirmed by sweat tests, were heterozygous for the D1270N mutation. Login to comment
40 Sequencing showed the presence of the D1270N mutation, the detection of which was confirmed by a PCR assay. Login to comment
41 The D1270N mutation destroys a TaqI restriction endonuclease site.16 In the absence of the mutation, fragments of 256 and 217 bp are generated. Login to comment
47 Results Of the nine black patients with symptoms suggestive of CF, two were heterozygous for the 3120+1G→A mutation (both had positive sweat tests) and two were heterozygous for the D1270N mutation (a sweat test had not been performed in one and was negative in the other). Login to comment
48 D1270N was detected by SSCP analysis and subsequent sequencing (of the first patient), while the second chromosome carrying this mutation was identified by means of the PCR assay. Login to comment
63 Of the nine black patients suspected of having CF, two were heterozygous for the 3120+1G→A mutation and two were heterozygous for the D1270N mutation. Login to comment
65 This mutation seems to be very rare as it has only been reported in 1/2083 CF chromosomes.19 The two patients who are heterozygous for the D1270N mutation may have a milder form of CF as this mutation has been associated with CBAVD and sodium and chloride concentrations in the normal range. Login to comment

[hide] Are p.I148T, p.R74W and p.D1270N cystic fibrosis c... BMC Med Genet. 2004 Aug 2;5:19. Claustres M, Altieri JP, Guittard C, Templin C, Chevalier-Porst F, Des Georges M
Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations?
BMC Med Genet. 2004 Aug 2;5:19., 2004-08-02 [PMID:15287992]

Abstract [show]
BACKGROUND: To contribute further to the classification of three CFTR amino acid changes (p.I148T, p.R74W and p.D1270N) either as CF or CBAVD-causing mutations or as neutral variations. METHODS: The CFTR genes from individuals who carried at least one of these changes were extensively scanned by a well established DGGE assay followed by direct sequencing and familial segregation analysis of mutations and polymorphisms. RESULTS: Four CF patients (out of 1238) originally identified as carrying the p.I148T mutation in trans with a CF mutation had a second mutation (c.3199del6 or a novel mutation c.3395insA) on the p.I148T allele. We demonstrate here that the deletion c.3199del6 can also be associated with CF without p.I148T. Three CBAVD patients originally identified with the complex allele p.R74W-p.D1270N were also carrying p.V201M on this allele, by contrast with non CF or asymptomatic individuals including the mother of a CF child, who were carrying p.R74W-p.D1270N alone. CONCLUSION: These findings question p.I148T or p.R74W-p.D1270N as causing by themselves CF or CBAVD and emphazises the necessity to perform a complete scanning of CFTR genes and to assign the parental alleles when novel missense mutations are identified.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 Mireille Claustres*1, Jean-Pierre Altiéri1, Caroline Guittard1, Carine Templin1, Françoise Chevalier-Porst2 and Marie Des Georges1 Address: 1Laboratoire de Génétique Moléculaire, Institut Universitaire de Recherche Clinique et Centre Hospitalier Universitaire, 641 avenue du Doyen Gaston Giraud, 34093 Montpellier, France and 2Laboratoire de Biochimie pédiatrique, Centre Hospitalier Universitaire Paul-Brousse, 69000 Lyon, France Email: Mireille Claustres* - Mireille.Claustres@igh.cnrs.fr; Jean-Pierre Altiéri - Jean-Pierre.Altieri@igh.cnrs.fr; Caroline Guittard - Caroline.Guittard@igh.cnrs.fr; Carine Templin - Carine.Templin@igh.cnrs.fr; Françoise Chevalier-Porst - francoise.chevalier-porst@chu-lyon.fr; Marie Des Georges - Marie.Desgeorges@igh.cnrs.fr * Corresponding author Abstract Background: To contribute further to the classification of three CFTR amino acid changes (p.I148T, p.R74W and p.D1270N) either as CF or CBAVD-causing mutations or as neutral variations. Login to comment
5 Three CBAVD patients originally identified with the complex allele p.R74W-p.D1270N were also carrying p.V201M on this allele, by contrast with non CF or asymptomatic individuals including the mother of a CF child, who were carrying p.R74W-p.D1270N alone. Login to comment
6 Conclusion: These findings question p.I148T or p.R74W-p.D1270N as causing by themselves CF or CBAVD and emphazises the necessity to perform a complete scanning of CFTR genes and to assign the parental alleles when novel missense mutations are identified. Login to comment
18 In North American populations, missense mutations p.I148T and p.D1270N were found >100 times and >200 times, respectively, more frequently in carrier screening than in CF patients [8,9]. Login to comment
19 Moreover, we and others have found that individuals affected with CF or CBAVD carry p.D1270N associated with p.R74W on the same allele [p.R74W;p.D1270N] [10,11,5]. Login to comment
21 A completely asymptomatic male individual who is a compound heterozygote for p.D1270N and p.I148T has been recently identified [9]. Login to comment
23 The result of full scanning of CFTR sequences showed that a second mutation (c.3199del6 or the novel mutation c.3395insA) was associated in cis with p.I148T in all individuals with a CF phenotype, and that a third missense mutation (p.V201M) was associated in cis with complex allele [p.D1270N;p.R74W] in patients with a CBAVD phenotype in this series. Login to comment
24 Methods CFTR scanning for individuals with p.I148T or [p.D1270N;p.R74W] From 1990 to 2003, we have analysed for CFTR mutations genomic DNA from 437 families with CF and 170 with isolated azoospermia caused by CBAVD, using a combination of mutation screening for known and scanning for unknown mutations. Login to comment
49 Only the double-mutant p.R74W-p.D1270N was present in the two unaffected individuals who were found with these changes in our sample. Login to comment
52 This woman, who was carrying p.P67L on one CFTR gene and [p.R74W-p.D1270N] on the other (table 1), was completely asymptomatic at age 45 years Table 1: CFTR haplotypes associated with mutations found in CF patients carrying p.I148T in cis with c.3395insA or c.3199del6 and in one CF patient carrying c.3199del6 alone Indiv No. Login to comment
72 A CFTR alteration producing a premature termination signal is a class I mutation, considered severe enough to cause CF by itself and exclude the contribution of any other sequence Table 2: CFTR sequence changes found in individuals carrying missense alterations p.R74W, p.D1270N, or p.V201M Mutations Haplotype IVS1 IVS8 IVS8 IVS8 470 IVS17B IVS17B CA CA TGm Tn TA CA CBAVD1 p.R1066C 22 16 11 7 V 30 13 [p.R74W;p.V201M;p.D1270N] 22 16 11 7 V 31 13 CBAVD2 p.M952I 26 17 10 7 M 7 17 [p.R74W;p.V201M;p.D1270N] 22 16 11 7 V 31 13 CBAVD3 [p.R74W;p.V201M;p.D1270N] 22 16 11 7 V 31 13 [p.R74W;p.V201M;p.D1270N] 22 16 11 7 V 31 13 Individual non affected with CF No mutation 21 nd 10 7 M 7 17 [p.R74W;p.D1270N] 22 nd 11 7 V 30 13 Asymptomatic mother of a CF affected girl p.P67L 23 16 10 7 M 7 17 [p.R74;p.D1270N] 22 16 11 7 V 31 13 change on the same allele. Login to comment
76 The complex allele [p.R74W;p.D1270N] may be not enough to cause disease We and others had initially described p.R74W [23] and p.D1270N [24] in isolation but they have since been found in association in many CBAVD or CF patients [10,11] and these two changes were thought to be deleterious, alone or in combination. Login to comment
78 When expressed in HeLa cells, mutant p.R74W, p.D1270N and [p.R74W;p.D1270N] did not affect CFTR processing, however a lower cAMP-responsive anion conductance was observed with the double mutant [p.R74W;p.D1270N] [3]. Login to comment
79 The assay suggested that p.R74W alone should be considered as a polymorphism, p.D1270N alone could generate a CBAVD phenotype while the complex allele could produce a more severe phenotype as p.R74W could enhance the effect of p.D1270N [3]. Login to comment
84 Recent large scale screening for CF carrier showed that p.D1270N was present 205 times more commonly in the screened population than in the CF patients (frequency of 14% versus 0.068%); in addition, a completely asymptomatic adult compound heterozygote for p.D1270N and p.I148T has been identified [9]. Login to comment
87 Conclusions This report further corroborates the recent hypothesis [9] that p.I148T and p.R74W-p.D1270N may not be true CF/ CBAVD mutations. Login to comment

[hide] A neutral variant involved in a complex CFTR allel... Hum Genet. 2005 May;116(6):454-60. Epub 2005 Mar 3. Clain J, Lehmann-Che J, Girodon E, Lipecka J, Edelman A, Goossens M, Fanen P
A neutral variant involved in a complex CFTR allele contributes to a severe cystic fibrosis phenotype.
Hum Genet. 2005 May;116(6):454-60. Epub 2005 Mar 3., [PMID:15744523]

Abstract [show]
In order to further elucidate the contribution of complex alleles to the wide phenotypic variability of cystic fibrosis (CF), we investigated the structure-function relationships of a severe CF-associated complex allele [p.S912L;p.G1244V]. To evaluate the contribution of each mutation to the phenotype, cystic fibrosis transmembrane conductance regulator (CFTR) mutants were expressed in HeLa cells and analysed for protein processing and Cl- channel activity. Both p.G1244V and [p.S912L;p.G1244V] mutants had normal protein processing but markedly decreased Cl- channel activity compared with wild-type. Notably, the double mutant displayed a dramatic decrease in Cl- channel activity compared with p.G1244V (P<0.001). p.S912L had normal protein processing and no detectable impact on CFTR function. In other respects, the p.S912L variation was identified in compound heterozygosity with p.R709X in a healthy fertile man. Together, these data strongly support the view that p.S912L in isolation should be considered as a neutral variant but one that might significantly impair CFTR function when inherited in cis with another CFTR mutation. Our data also further document the contribution of complex alleles to the wide phenotypic variability of CF. The results of functional studies of such complex alleles in other genetic diseases are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
12 The combination of two missense mutations on the same chromo some has been described clinically to lessen ([p.R553Q;p.F508del], [p.R334W;p.R1158X]; Dork et al. 1991; Duarte et al. 1996) or worsen ([p.R74W;p.D1270N], [p.R347H;p.D979A]; Casals et al. 1995; Hojo et al. 1998) the phenotype of CF patients with regard to the commonest mutation alone (p.F508del, p.R1158X, p.D1270N, p.R347H). Login to comment

[hide] Molecular evaluation of CFTR sequence variants in ... Int J Androl. 2005 Oct;28(5):284-90. Larriba S, Bonache S, Sarquella J, Ramos MD, Gimenez J, Bassas L, Casals T
Molecular evaluation of CFTR sequence variants in male infertility of testicular origin.
Int J Androl. 2005 Oct;28(5):284-90., [PMID:16128988]

Abstract [show]
Although the involvement of the CFTR gene has been well established in congenital agenesia of vas deferens, its role in non-obstructive (NOb) infertility is still a matter of debate. In order to definitively define the involvement of the CFTR gene in spermatogenic impairment and a potential synergistic contribution to known genetic and clinical factors, genetic variants in the entire coding sequence and the immediately flanking regions of the CFTR gene, along with a thorough clinical evaluation, were analysed in 83 NOb infertile patients and 87 clinically well-defined fertile individuals as controls. The results of our study showed no statistical difference between CFTR carrier frequency in the infertile and fertile population. Specifically, the IVS8-6(5T) allele carrier frequency was similar in NOb infertile patients when compared with fertile men, but it is noteworthy that, when fertile men were classified into having optimal and suboptimal fertility, no 5T allele was found among the 35 men with optimal fertility parameters. In conclusion, extensive CFTR analysis in infertile individuals and fertile population as adequate control definitively excludes the involvement of the CFTR gene variants in sperm production and stresses the importance of carefully identifying those individuals with obstructive defects, in whom CFTR screening will be beneficial.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 CFTR analysis We identified 14 different, potential disease-causing CFTR sequence variants, 11 of them are translated into missense amino acid changes (p.R75Q, p.P111L, p.R117H, p.I148T, p.R334W, p.M348K, p.G576A, p.R668C, p.D1270N, p.S1235R and p.S1426F), one deletion (p.F508del) and two alleles affecting exon splicing [IVS8-6(5T), c.1716G>A] in 30 of 83 infertile patients (Table 1) giving a frequency of 36.1%. Login to comment
72 Description of genetic abnormalities and other risk factors of infertile and fertile CFTR carrier individuals No. Phenotype CFTR genotype Associated factors Testicular histologya b c Infertile individuals 1 NOb (SO) p.R75Q No Severe hypospermatogenesis 2 NOb (SO) p.R75Q No nd 3 NOb (A) p.P111L AZFb,c del Sertoli cell only 4 NOb (A) p.R117H AZFc del Severe hypospermatogenesis 5 NOb (SO) p.I148T No Severe hypospermatogenesis 6 NOb (A) p.R334W No Primary spermatocyte arrest 7 NOb (SO) p.M348K UV grade III Primary spermatocyte arrest 8 NOb (A) p.F508del No Sertoli cell only 9 NOb (A) p.F508del No Primary spermatocyte arrest 10 NOb (A) p.G576A, p.R668C No Severe hypospermatogenesis, Leydig cell hyperplasia 11 NOb (SO) p.G576A, p.R668C No Primary spermatocyte arrest (unilateral) 12 NOb (SO) p.G576A, p.R668C No Severe hypospermatogenesis 13 NOb (A) p.R668C UC Sertoli cell-only (incomplete) 14 NOb (SO) p.D1270N No nd 15 NOb (SO) p.S1235R No Severe hypospermatogenesis 16 NOb (SO) p.S1426F* UC Sertoli cell only 17 NOb (A) (T)5-(TG)12 No Severe hypospermatogenesis, Sertoli cell only (80%) 18 NOb (A) (T)5-(TG)12 No Sertoli cell only 19 NOb (SO) (T)5-(TG)11 UV grade III Bilateral moderate hypospermatogenesis 20 NOb (SO) (T)5-(TG)11 UV grade II Severe hypospermatogenesis 21 NOb (A) (T)5-(TG)11 No nd 22 NOb (SO) c.1716 G>A Dysplasia SV Severe hypospermatogenesis, Sertoli cell only (95%) 23 NOb (A) c.1716 G>A No nd 24 NOb (A) c.1716 G>A No Primary spermatocyte arrest (bilateral) 25 NOb (SO) c.1716 G>A No Sertoli cell only (95%) 26 NOb (SO) c.1716 G>A No Severe hypospermatogenesis 27 NOb (SO) c.1716 G>A UV grade III Severe hypospermatogenesis 28 NOb (SO) c.1716 G>A No nd 29 NOb (SO) c.1716 G>A No nd 30 NOb (SO) c.1716 G>A AZFc del Severe hypospermatogenesis Fertile individuals 1 F1 p.R75Q No nd 2 F1 p.F508del No nd 3 F1 p.F508del No nd 4 F1 p.G576A, p.R668C/ c.1716 G>A No nd 5 F1 p.D836Y No nd 6 F1 p.S1235R/c.1716 G>A No nd 7 F1 c.1716 G>A No nd 8 F1 c.1716 G>A No nd 9 F1 c.1716 G>A No nd 10 F1 c.1716 G>A No nd 11 F1 c.1716 G>A No nd 12 F2 p.R75Q No nd the expected CF carrier frequency in the local population (Van der Ven et al., 1996; Larriba et al., 2001; Dohle et al., 2002) or with the general population (Jakubiczka et al., 1999; Pallares-Ruiz et al., 1999; Ravnik-Glavac et al., 2001) and not normospermic fertile individuals, the latter considered as adequate controls. Login to comment

[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]

Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4. Login to comment
67 Seven other complex alleles were observed: [c.296 + 3insT; p.V754M], [p.F508del; p.I1027T], [p.S549R; -102T > A], [p.G576A; p.R668C], [p.R1070W; p.R668C], [p.D1270N; p.R74W] and [p.T1299I; p.I148T]. Login to comment

[hide] Reduced Arylsulfatase B activity in leukocytes fro... Pediatr Pulmonol. 2012 May 1. doi: 10.1002/ppul.22567. Sharma G, Burke J, Bhattacharyya S, Sharma N, Katyal S, Park RL, Tobacman J
Reduced Arylsulfatase B activity in leukocytes from cystic fibrosis patients.
Pediatr Pulmonol. 2012 May 1. doi: 10.1002/ppul.22567., [PMID:22550062]

Abstract [show]
The enzyme Arylsulfatase B (ARSB; N-acetylgalactosamine-4-sulfatase) removes 4-sulfate groups from chondroitin-4-sulfate and dermatan sulfate and is required for the degradation of these sulfated glycosaminoglycans (sGAGs). Since these GAGs accumulate in patients with Cystic Fibrosis (CF), we investigated the activity of ARSB in leukocytes of patients with CF, to consider if reduced activity of ARSB might contribute to the pathophysiology of CF. Previous cell-based experiments had demonstrated that when the deficiency of the cystic fibrosis transmembrane regulator (CFTR) was corrected in bronchial epithelial cells, the ARSB activity increased significantly. De-identified, citrated blood samples were collected from 16 children with CF and 31 control subjects, seen in the Pediatric Clinic at Rush University Medical Center. Polymorphonuclear leukocytes (PMN) and mononuclear cell (MC) populations were separated by density gradient, and blinded determinations of ARSB activity were performed using the exogenous substrate 4-methylumbilliferyl sulfate. Interleukin-6 was measured in the plasma samples by ELISA. ARSB activity was significantly less in the PMN and MC from the CF patients than controls (P < 0.0001, unpaired t-test, two-tailed). Interleukin-6 levels in plasma were significantly greater in the CF population (P < 0.001). Mean age, age range, and male:female ratio of CF patients and controls were similar, and no association of ARSB activity with age, gender, or CFTR genotype was evident. Since recombinant human ARSB is used successfully for replacement therapy in Mucopolysaccharidosis VI, it may be useful to restore ARSB activity to normal levels and increase degradation of sulfated GAGs in CF patients. Pediatr Pulmonol. (c) 2012 Wiley Periodicals, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 TABLE 2- Subject Data Gender Age (yrs) PMN ARSBa (nmol/mg protein/hr) MC ARSBb (nmol/mg protein/hr) WBC ARSBc (nmol/mg protein/hr) IL-6d (pg/ml) Other Cystic fibrosis Male 10.5 52.3 44.7 63.9 DF508/DF508 Female 6.5 48.4 63.8 DF508/DF508 Male 14.5 52.0 46.2 66.6 DF508/G551D Female 9 44.1 50.9 60.8 2307insA/3120 þ 1G > A Female 17.5 49.8 53.7 73.8 NAe Male 17.5 57.1 53.0 73.8 DF508/DF508 Female 15.5 46.0 61.3 DF508/1717-1G > A Male 6.5 52.1 68.6 DF508/DF508 Male 16.5 53.6 52.2 66.2 DF508/DF508 Female 9 60.2 53.7 66.8 S1255x(2)/11203V(2) Female 15 42.9 69.4 DF508/DF508 Male 17 50.1 58.1 64.3 R74W/D1270N/(TG)11-5T/(TG)11-7T Female 9 44.4 48.0 58.2 DF508/DF508 Male 8.5 59.7 48.7 65.2 DF508/312011G > A Female 10.5 53.8 58.3 75.1 DF508/312011G > A Male 15 45.5 48.2 50.0 F508del/P74W/D1270N/P798S/G921E Controls Female 5 67.4 66.4 4.8 Neuromuscular Female 4.5 72.7 64.8 5.1 Down Syndrome Female 17 71.7 60.2 4.3 Down Syndrome; renal Male 3.5 83.8 63.6 4.4 Neuromuscular Male 12 71.0 67.6 4.6 Trauma Male 16 68.8 59.4 5.8 Neuromuscular Male 7 82.8 59.4 - Heme/Onc Male 17 78.7 55.8 5.3 Renal Female 16.5 76.9 65.2 4.1 Renal Male 12.5 69.7 66.6 6.3 Renal Male 8 78.0 56.2 5.0 None Female 8 69.6 67.9 5.6 None Female 5 66.8 64.0 4.8 None Female 11 77.9 68.6 5.8 None Male 14 85.5 61.2 5.0 None Female 9 77.6 65.3 5.0 None Female 16 67.4 64.0 5.0 None Female 9 75.9 57.4 4.7 None Male 16 81.9 58.8 5.4 None Male 14 81.3 69.1 6.2 None Male 15.5 73.0 62.9 3.6 None Male 7.5 73.9 57.2 13.5 Asthma Male 11 62.5 69.9 18.2 Asthma Female 11 70.1 65.3 13.8 Asthma Female 8.5 81.3 56.8 11.4 Asthma Male 9 53.1 55.6 12.2 Asthma Male 3.5 60.0 47.6 17.8 Asthma Male 5.5 68.6 39.0 13.0 Asthma Male 12 84.4 45.8 24.9 Asthma Male 12 68.1 51.4 26.6 Asthma Male 16.5 56.3 47.8 26.6 Asthma a for polymorphonuclear leukocyte arylsulfatase B activity. Login to comment

[hide] Pancreas divisum is not a cause of pancreatitis by... Am J Gastroenterol. 2012 Feb;107(2):311-7. doi: 10.1038/ajg.2011.424. Epub 2011 Dec 13. Bertin C, Pelletier AL, Vullierme MP, Bienvenu T, Rebours V, Hentic O, Maire F, Hammel P, Vilgrain V, Ruszniewski P, Levy P
Pancreas divisum is not a cause of pancreatitis by itself but acts as a partner of genetic mutations.
Am J Gastroenterol. 2012 Feb;107(2):311-7. doi: 10.1038/ajg.2011.424. Epub 2011 Dec 13., [PMID:22158025]

Abstract [show]
OBJECTIVES: The role of pancreas divisum (PD) as a cause of acute recurrent or chronic pancreatitis (AR/CP) is still a matter of debate. METHODS: The aims of this study were to evaluate the frequency of PD diagnosed using magnetic resonance cholangiopancreatography (MRCP) in patients with AR/CP of unknown origin (n=40) after careful exclusion of all known causes and to test the hypothesis of an interaction between anatomical (PD) and functional genetic anomalies (SPINK1, PRSS1, or CFTR gene mutations or polymorphisms (n=19, 25, and 30, respectively)) that could result in AR/CP. Patients with alcohol-induced pancreatitis (n=29) and subjects who had MRCP for a nonpancreatic disease (n=45) served as controls. RESULTS: PD frequency was 7% in subjects without pancreatic disease, 7% in patients with alcohol-induced pancreatitis, and 5, 16, 16, and 47% in those with idiopathic, and PRSS1-, SPINK1-, and CFTR-associated pancreatitis, respectively (P<0.0001). There was no significant difference between idiopathic pancreatitis and the two control groups. The frequency of PD was higher in patients with CFTR gene-associated pancreatitis as compared with those with idiopathic and alcoholic pancreatitis (P<0.0001) and with those with SPINK1 and PRSS1 gene-associated pancreatitis (P<0.02). CONCLUSIONS: The frequency of PD was not different in patients with idiopathic pancreatitis as compared with controls, demonstrating that PD by itself is not a cause of pancreatitis. PD frequency was higher in patients with genetic pancreatitis, especially in those with CFTR mutations or polymorphisms, suggesting a cumulative effect of these two cofactors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 We defined three groups of patients: (i) common CF mutations called CFcom, previously identified in patients with classic CF with or without pancreatic insufficiency (such as p.F508del, p.W1282, and so on…); (ii) uncommon CF mutations causing variable phenotype called CFunc, previously identified in patients with CFTR-related disease such as bilateral absence of the vas deferens, disseminated bronchiectasis, and pancreatitis (p.R74W-D1270N, IVS8-5T, and so on…); and (iii) variants of unknown significance called CFvus, considered to be polymorphisms on the basis of linkage analysis and their frequency in normal individuals, but which may alter the CFTR protein function in a minor way (such as 1716G>A (p.E528E), p.R75Q…) (www.genet.sickkids.on.ca/cftr/app) (34). Login to comment

[hide] Extensive molecular analysis of patients bearing C... J Mol Diagn. 2012 Jan;14(1):81-9. Epub 2011 Oct 20. Amato F, Bellia C, Cardillo G, Castaldo G, Ciaccio M, Elce A, Lembo F, Tomaiuolo R
Extensive molecular analysis of patients bearing CFTR-related disorders.
J Mol Diagn. 2012 Jan;14(1):81-9. Epub 2011 Oct 20., [PMID:22020151]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR)-related disorders (CFTR-RDs) may present with pancreatic sufficiency, normal sweat test results, and better outcome. The detection rate of mutations is lower in CFTR-RD than in classic CF: mutations may be located in genes encoding proteins that interact with CFTR or support channel activity. We tested the whole CFTR coding regions in 99 CFTR-RD patients, looking for gene mutations in solute carrier (SLC) 26A and in epithelial Na channel (ENaC) in 33 patients who had unidentified mutations. CFTR analysis revealed 28 mutations, some of which are rare. Of these mutations, RT-PCR demonstrated that the novel 1525-1delG impairs exon 10 splicing; by using minigene analysis, we excluded the splicing effect of three other novel intronic variants. Analysis of SLC26A genes revealed several variants, some of which are novel, that did not affect mRNA expression. Other mutations occurred in the ENaC genes encoding the ENaC subunits, but their frequency did not significantly differ between patients and controls. Our data, although obtained on a preliminary cohort of CFTR-RD patients, exclude a role of mutations in SLC26A and in SCNN genes in the pathogenesis of such disease; we confirm that CFTR analysis has a relevant role in CFTR-RD patients; and it appears mandatory to use CFTR scanning techniques and approaches to reveal the effect of novel mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
157 The R74W mutation was originally considered a disease-causing mutation (http://www.genet.sickkids.on.ca), but more recently, it was classified as a sequence variation with no phenotypic effect if present alone, whereas the D1270N mutation, frequently observed in cis with R74W, acts as a mutation even if this point is controversial.36 We did not find D1270N in our patient, who instead carried 1525-1delG in cis with R74W. Login to comment

[hide] Cystic fibrosis mutations for p.F508del compound h... Clin Genet. 2012 Dec;82(6):546-551. doi: 10.1111/j.1399-0004.2011.01804.x. Epub 2011 Nov 29. Sebro R, Levy H, Schneck K, Dimmock D, Raby B, Cannon C, Broeckel U, Risch N
Cystic fibrosis mutations for p.F508del compound heterozygotes predict sweat chloride levels and pancreatic sufficiency.
Clin Genet. 2012 Dec;82(6):546-551. doi: 10.1111/j.1399-0004.2011.01804.x. Epub 2011 Nov 29., [PMID:22035343]

Abstract [show]
Sebro R, Levy H, Schneck K, Dimmock D, Raby BA, Cannon CL, Broeckel U, Risch NJ. Cystic fibrosis mutations for p.F508del compound heterozygotes predict sweat chloride levels and pancreatic sufficiency. Cystic fibrosis (CF) is a monogenetic disease with a complex phenotype. Over 1500 mutations in the CFTR gene have been identified; however, the p.F508del mutation is most common. There has been limited correlation between the CFTR mutation genotype and the disease phenotypes. We evaluated the non-p.F508del mutation of 108 p.F508del compound heterozygotes using the biological classification method, Grantham and Sorting Intolerant from Tolerant (SIFT) scores to assess whether these scoring systems correlated with sweat chloride levels, pancreatic sufficiency, predicted FEV(1) , and risk of infection with Pseudomonas aeruginosa in the last year. Mutations predicted to be 'mild' by the biological classification method are associated with more normal sweat chloride levels (p < 0.001), pancreatic sufficiency (p < 0.001) and decreased risk of infection with Pseudomonas in the last year (p = 0.014). Lower Grantham scores are associated with more normal sweat chloride levels (p < 0.001), and pancreatic sufficiency (p = 0.014). Higher SIFT scores are associated with more normal sweat chloride levels (p < 0.001) and pancreatic sufficiency (p = 0.011). There was no association between pulmonary function measured by predicted FEV(1) and the biological classification (p = 0.98), Grantham (p = 0.28) or SIFT scores (p = 0.62), which suggests the pulmonary disease related to CF may involve other modifier genes and environmental factors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 CFTR mutation classification for compound heterozygotesa Mutations n (%) Biological classification Grantham score SIFT Q493X 3 (3) Ib - - G542X 21 (20) Ib,c,e - - R553X 4 (4) Ib,e - - Y1092X 2 (2) Ib - - R1158X 1 (1) NA - - W1282X 9 (9) Ib,e - - G85E 4 (4) IIIb 98 0.01 R117H 4 (4) IVb,c 29 0.60 R334W 1 (1) IVb 101 0.02 R347P 1 (1) IVb 103 0.05 R352Q 1 (1) NA 43 0.35 G551D 20 (19) IIIb,c 94 0.00 R560T 3 (3) IIIb 71 0.00 D1270N 1 (1) NA 23 0.01 N1303K 6 (6) IIg 94 0.00 I507del 3 (3) IId - - 394delTT 1 (1) NAc - - 621+1G>T 7 (7) Ib,f - - 711+1G>T 2 (2) Ib - - 1717-1G>A 5 (5) Ib,c,e,f - - 1898+1G>A 2 (2) NA - - 2789+5G>A 3 (3) Vb - - 3659delC 1 (1) Ib - - 3849+10kbC>T 2 (2) Vb,c,f - - 3905insT 1 (1) Ib - - NA, not applicable; SIFT, Sorting Intolerant from Tolerant. a The following mutations biological classification scores could not be verified: 1898+G-A, 394delTT, D1270N, R352Q, and R1158X. Login to comment

[hide] Outcome of intracytoplasmic sperm injection for a ... Fertil Steril. 2008 Nov;90(5):2004.e23-6. Epub 2008 Aug 13. Brugnon F, Bilan F, Heraud MC, Grizard G, Janny L, Creveaux I
Outcome of intracytoplasmic sperm injection for a couple in which the man is carrier of CFTR p.[R74W;V201M;D1270N] and p.P841R mutations and his spouse a heterozygous carrier of p.F508del mutation of the cystic fibrosis transmembrane conductance regulator gene.
Fertil Steril. 2008 Nov;90(5):2004.e23-6. Epub 2008 Aug 13., [PMID:18703181]

Abstract [show]
OBJECTIVE: To document the phenotype associated with the p.[R74W;V201M;D1270N] and p.P841R mutations of cystic fibrosis transmembrane conductance regulator (CFTR) gene. DESIGN: Case report. SETTING: Biology and medicine of reproduction in a university hospital. PATIENT(S): A couple in which the man is carrier of the triple mutant p.[R74W;V201M;D1270N] allele in trans to p.P841R mutation and his spouse a heterozygous carrier for the severe p.F508del mutation of the CFTR gene, who became pregnant after intracytoplasmic sperm injection (ICSI) with twins. INTERVENTION(S): Genetic counseling; CFTR gene sequencing; ICSI; children's follow-up. MAIN OUTCOME MEASURE(S): First report of a male phenotype associated with the p.P841R mutation. RESULT(S): The triple mutant p.[R74W;V201M;D1270N] allele associated with the unknown p.P841R mutations were detected in this man with congenital bilateral absence of the vas deferens, which may presume p.P841R as a severe mutation. After genetic counseling, the couple preferred prenatal diagnosis after ICSI than preimplantation genetic diagnosis, which revealed that the boys were both carriers of p.[R74W;V201M;D1270N] and p.F508del mutations. They are now 4 years old and show normal growth without nutritional deficiency. CONCLUSION(S): This case report documents for the first time a male phenotype associated with the p.P841R mutation and underlines the difficulties in counseling a man with congenital bilateral absence of the vas deferens carrying uncommon mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene before ICSI.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Electrophoregrams of the sequencing products obtained in the patient showing heterozygous profiles for the p.D1270N, p.R74W, and the newly identified p.841R mutations (indicated by red arrow in each figure). Login to comment
54 (a) p.D1270N mutation (3940 G>A); (b) p.R74W mutation (352 C>T); (c) p.P841R mutation (2854 C>G). Login to comment
71 Since the beginning of population screening for CF carriers, new datahavedemonstratedthattheprevalenceofcertaincom- plex alleles like p.[D1270N;p.R74W] is high (6). Login to comment
73 Thus p.D1270N was found more frequently (6) in carrier screening than in patients with CF (frequency 14% vs. 0.068%). Login to comment
74 Initially p.R74W and p.D1270N were described in isolation but they have since been found in association in many men with CBAVD (3, 7). Login to comment
75 Structure function analysis demonstrated that when they are expressed in HeLa cells; mutants p.R74W, p.D1270N, and p.[R74W;D1270N] do not affect CFTR processing.However,lowercyclicadenosine30 :50 monophosphate (cAMP) responsive anion conductance was observed with the double mutant p.[R74W;D1270N]. Login to comment
76 This study suggested that mutant p.R74Walone could be considered as a polymorphism, p.D1270N alone could generate a CBAVD phenotype, whereas the complex allele p.[R74W;D1270N] may produce a more severe phenotype because p.R74W could enhance the effect of p.D1270N (8). Login to comment
78 Compound heterozygote for p.D1270N has been identified in asymptomatic adults (6), whereas individuals carrying p.D1270N associated with p.R74W on the same allele (p.[R74W;D1270N]) have not been found among asymptomatic (3) or among men with CBAVD (7). Login to comment
51 Electrophoregrams of the sequencing products obtained in the patient showing heterozygous profiles for the p.D1270N, p.R74W, and the newly identified p.841R mutations (indicated by red arrow in each figure). Login to comment
52 (a) p.D1270N mutation (3940 G>A); (b) p.R74W mutation (352 C>T); (c) p.P841R mutation (2854 C>G). Login to comment
69 Since the beginning of population screening for CF carriers, new datahavedemonstratedthattheprevalenceofcertaincom- plex alleles like p.[D1270N;p.R74W] is high (6). Login to comment
72 Initially p.R74W and p.D1270N were described in isolation but they have since been found in association in many men with CBAVD (3, 7). Login to comment

[hide] Validation of high-resolution DNA melting analysis... J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7. Audrezet MP, Dabricot A, Le Marechal C, Ferec C
Validation of high-resolution DNA melting analysis for mutation scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7., [PMID:18687795]

Abstract [show]
High-resolution melting analysis of polymerase chain reaction products for mutation scanning, which began in the early 2000s, is based on monitoring of the fluorescence released during the melting of double-stranded DNA labeled with specifically developed saturation dye, such as LC-Green. We report here the validation of this method to scan 98% of the coding sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. We designed 32 pairs of primers to amplify and analyze the 27 exons of the gene. Thanks to the addition of a small GC-clamp at the 5' ends of the primers, one single melting domain and one identical annealing temperature were obtained to co-amplify all of the fragments. A total of 307 DNA samples, extracted by the salt precipitation method, carrying 221 mutations and 21 polymorphisms, plus 20 control samples free from variations (confirmed by denaturing high-performance liquid chromatography analysis), was used. With the conditions described in this study, 100% of samples that carry heterozygous mutations and 60% of those with homozygous mutations were identified. The study of a cohort of 136 idiopathic chronic pancreatitis patients enabled us to prospectively evaluate this technique. Thus, high-resolution melting analysis is a robust and sensitive single-tube technique for screening mutations in a gene and promises to become the gold standard over denaturing high-performance liquid chromatography, particularly for highly mutated genes such as CFTR, and appears suitable for use in reference diagnostic laboratories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
171 Results of CFTR Analysis by HRM on 136 Samples of Patients with Idiopathic Chronic Pancreatitis (ICP) Exon Number of positive samples Mutations identified Variants identified New positive controls 1 14 14 125GϾC 2 1 1 R31C 3 9 1 G85E 7 R75Q 1 R74W 4 4 1 R117G 1 I148T R117G 1 R117H 1 A120T 5 1 1 L188P L188P 6a 5 1 V201M 1 A221A A221A 3 875ϩ40 AϾG 6b 27 1 M284T 26 1001ϩ11CϾT M284T 7 1 1 L320V L320V 8 0 0 9 1 1 D443Y 10 16 8 F508del 8 E528E 11 1 1 G542X 12 6 4 G576A 1 Y577Y L568F 1 L568F 13 7 1 S737F 4 R668C S737F 1 V754M L644L 1 L644L 14a 53 52 T854T T854TϩI853I 1 T854TϩI853I 14b 0 0 15 3 1 L967S T908S 1 T908S 1 S945L 16 0 0 17a 10 7 L997F 1 3271ϩ18CϾT 3271 ϩ 3AϾG 1 3271 ϩ 3 AϾG 1 Y1014C 17b 3 1 L1096L L1096L 1 H1054DϩG1069R 1 3272-33AϾG H1054DϩG1069R 3272-33AϾG 18 2 1 D1152H E1124del 1 E1124del 19 5 5 S1235R poly 20 7 1 W1282X 5 P1290P 1 D1270N 21 2 1 N1303K 1 T1299T 22 0 0 23 1 0 4374ϩ13 AϾG 24 43 40 Q1463Q 2 Y1424Y 1 Q1463QϩY1024Y ing domain of a gene brings an excellent sensitivity for heterozygote detection that is very close to 100%. Login to comment

[hide] CFTR mutations in the Algerian population. J Cyst Fibros. 2008 Jan;7(1):54-9. Epub 2007 Jun 14. Loumi O, Ferec C, Mercier B, Creff J, Fercot B, Denine R, Grangaud JP
CFTR mutations in the Algerian population.
J Cyst Fibros. 2008 Jan;7(1):54-9. Epub 2007 Jun 14., [PMID:17572159]

Abstract [show]
The nature and frequency of the major CFTR mutations in the North African population remain unclear, although a small number of CFTR mutation detection studies have been done in Algeria and Tunisia, showing largely European mutations such as F508del, G542X and N1303K, albeit at different frequencies, which presumably emerged via population admixture with Caucasians. Some unique mutations were identified in these populations. This is the first study that includes a genetic and clinical evaluation of CF patients living in Algeria. In order to offer an effective diagnostic service and to make accurate risk estimates, we decided to identify the CFTR mutations in 81 Algerian patients. We carried out D-HPLC, chemical-clamp denaturing gradient gel electrophoresis, multiplex amplification analysis of the CFTR gene and automated direct DNA sequencing. We identified 15 different mutations which account for 58.5% of the CF chromosomes. We used a quantitative PCR technique (quantitative multiplex PCR short fragment fluorescence analysis) to screen for deletion/duplication in the 27 exons of the gene. Taking advantage of the homogeneity of the sample, we report clinical features of homozygous CF patients. As CFTR mutations have been detected in males with infertility, 46 unrelated Algerian individuals with obstructive azoospermia were also investigated.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Moreover, we have identified two complex mutations: R74W-D1270N in the mother of an Algerian F508del heterozygous CF patient, and none of these variations were inherited by the child. Login to comment
60 Using intragenic polymorphisms, we have confirmed that R74W and D1270N were not inherited by the F508del heterozygous CF child. Login to comment
90 Table 1 CFTR mutations detected in 36 Algerian patients (N=72 CF chromosomes) Mutations Substitution nucleotide Substitution amino acid Localisation N % Cum. fr. hF508del del CTT Del phe 507/508 Exon 10 12 16.7 16.7 N1303K C→G 4041 Asn→Lys 1303 Exon 21 6 8.3 25.0 711+1G→T G→T711+1 MRNA splicing defect Intron 5 6 8.3 33.3 2183AA/G del A2184 Frameshift Exon 13 3 4.2 37.5 A→G 2183 1609delCA delCA Frameshift Exon 10 2 2.8 40.3 1812-1G→A G→A 1812-1 mRNA splicing defect Intron 11 2 2.8 43.1 V562I G→A 1816 Val→Ile 562 Exon 12 2 2.8 45.9 V754M G→A 2392 Val→Met 754 Exon 13 1 1.4 47.3 W1282X G→A 3978 Trp→Stop 1282 Exon 20 3 4.2 51.5 621+3A/Ga A→G 621+3 mRNA splicing defect Intron 4 1 1.4 52.9 4332delTGa delTG4332 Frameshift Exon 23 G542X G→T 1756 Gly→Stop 542 Exon 11 1 1.4 54.3 4271delC del A 4271 Frameshift Exon 23 1 1.4 55.7 S977F C→T 3062 Ser→Phe 97 Exon 16 1 1.4 57.1 21Kb del 21-kb del Del AA E2-E3 1 1.4 58.5 R74W C→T 352 Argș2;Trp 74 Exon 3 0 0 D1270N G→A 3940 Asp→Asn 1270 Exon 20 0 0 Total 43 58.5 N=number of chromosomes; Cum. fr.=cumulative frequency. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Table 1. Continued CFTR location Amino acid change Nucleotide change 141 IVS 16 Splicing defect 3120 ϩ 1GϾA 142 IVS 16 Splicing defect 3121 - 2AϾG 143 IVS 16 Splicing defect 3121 - 2AϾT 144 E 17a Frameshift 3132delTG 145 E 17a I1005R 3146TϾG 146 E 17a Frameshift 3171delC 147 E 17a Frameshift 3171insC 148 E 17a del V1022 and I1023 3199del6 149 E 17a Splicing defect 3271delGG 150 IVS 17a Possible splicing defect 3272 - 26AϾG 151 E 17b G1061R 3313GϾC 152 E 17b R1066C 3328CϾT 153 E 17b R1066S 3328CϾA 154 E 17b R1066H 3329GϾA 155 E 17b R1066L 3329GϾT 156 E 17b G1069R 3337GϾA 157 E 17b R1070Q 3341GϾA 158 E 17b R1070P 3341GϾC 159 E 17b L1077P 3362TϾC 160 E 17b W1089X 3398GϾA 161 E 17b Y1092X (TAA) 3408CϾA 162 E 17b Y1092X (TAG) 3408CϾG 163 E 17b L1093P 3410TϾC 164 E 17b W1098R 3424TϾC 165 E 17b Q1100P 3431AϾC 166 E 17b M1101K 3434TϾA 167 E 17b M1101R 3434TϾG 168 IVS 17b 3500 - 2AϾT 3500 - 2AϾT 169 IVS 17b Splicing defect 3500 - 2AϾG 170 E 18 D1152H 3586GϾC 171 E 19 R1158X 3604CϾT 172 E 19 R1162X 3616CϾT 173 E 19 Frameshift 3659delC 174 E 19 S1196X 3719CϾG 175 E 19 S1196T 3719TϾC 176 E 19 Frameshift and K1200E 3732delA and 3730AϾG 177 E 19 Frameshift 3791delC 178 E 19 Frameshift 3821delT 179 E 19 S1235R 3837TϾG 180 E 19 Q1238X 3844CϾT 181 IVS 19 Possible splicing defect 3849 ϩ 4AϾG 182 IVS 19 Splicing defect 3849 ϩ 10 kb CϾT 183 IVS 19 Splicing defect 3850 - 1GϾA 184 E 20 G1244E 3863GϾA 185 E 20 G1244V 3863GϾT 186 E 20 Frameshift 3876delA 187 E 20 G1249E 3878GϾA 188 E 20 S1251N 3884GϾA 189 E 20 T1252P 3886AϾC 190 E 20 S1255X 3896CϾA and 3739AϾG in E19 191 E 20 S1255L 3896CϾT 192 E 20 Frameshift 3905insT 193 E 20 D1270N 3940GϾA 194 E 20 W1282R 3976TϾC 195 E 20 W1282X 3978GϾA 196 E 20 W1282C 3978GϾT 197 E 20 R1283M 3980GϾT 198 E 20 R1283K 3980GϾA 199 IVS 20 Splicing defect 4005 ϩ 1GϾA 200 E 21 Frameshift 4010del4 201 E 21 Frameshift 4016insT 202 E 22 Inframe del E21 del E21 203 E 21 N1303K 4041CϾG 204 E 24 Frameshift 4382delA Genomic and Synthetic Template Samples Where possible, native genomic DNA was collected. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 Spectrum of CFTR Sequence Variants in 257 Hispanic Patients Who Underwent Diagnostic DNA Testing for CF Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) ACMG/ACOG recommended 25 mutation panel* DeltaF508 53 28.96 10.31 G542X 7 3.83 1.36 R334W 2 1.09 0.39 R553X 2 1.09 0.39 DeltaI507 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 3120 ϩ 1 GϾA 1 0.55 0.19 7 different mutations 67 36.61 13.04 All mutations included ACMG/ACOG 1248 ϩ 1 GϾA 1 0.55 0.19 1249 - 29delAT 1 0.55 0.19 1288insTA1288insTA 1 0.55 0.19 1341 ϩ 80 GϾA1341 ϩ 80 GϾA 1 0.55 0.19 1429del71429del7 1 0.55 0.19 1525 - 42 GϾA1525 - 42 GϾA 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 1717 - 8 GϾA 2 1.09 0.39 1811 ϩ 1 GϾA1811 ϩ 1 GϾA 1 0.55 0.19 2055del9-ϾA 3 1.64 0.58 2105-2117del13insAGAAA 1 0.55 0.19 2215insG 1 0.55 0.19 2585delT2585delT 1 0.55 0.19 2752 - 6 TϾC 1 0.55 0.19 296 ϩ 28 AϾG 1 0.55 0.19 3120 ϩ 1 GϾ A 1 0.55 0.19 3271 ϩ 8 AϾG3271 ϩ 8 AϾG 1 0.55 0.19 3271delGG 1 0.55 0.19 3272 - 26 AϾG 2 1.09 0.39 3876delA 2 1.09 0.39 4016insT 1 0.55 0.19 406 - 1 GϾA 6 3.28 1.17 406 - 6 TϾC 1 0.55 0.19 4374 ϩ 13 A ϾG 1 0.55 0.19 663delT 1 0.55 0.19 874insTACA874insTACA 1 0.55 0.19 A1009T 2 1.09 0.39 A559T 1 0.55 0.19 D1152H 1 0.55 0.19 D1270N 3 1.64 0.58 D1445N 2 1.09 0.39 D836Y 1 0.55 0.19 DeltaF311 1 0.55 0.19 DeltaF508 53 28.96 10.31 DeltaI507 1 0.55 0.19 E116K 2 1.09 0.39 E585X 1 0.55 0.19 E588VE588V 2 1.09 0.39 E831X 1 0.55 0.19 F311L 1 0.55 0.19 F693L 1 0.55 0.19 G1244E 1 0.55 0.19 G542X 7 3.83 1.36 G576A 1 0.55 0.19 H199Y 3 1.64 0.58 I1027T 3 1.64 0.58 I285FI285F 1 0.55 0.19 L206W 3 1.64 0.58 L320V 1 0.55 0.19 L967S 1 0.55 0.19 L997F 3 1.64 0.58 P1372LP1372L 1 0.55 0.19 P205S 1 0.55 0.19 P439SP439S 1 0.55 0.19 Q1313X 1 0.55 0.19 Q890X 2 1.09 0.39 Q98R 1 0.55 0.19 R1066C 1 0.55 0.19 R1066H 1 0.55 0.19 (Table continues) missense variant, I1027T (3212TϾC), in exon 17a.25 Family studies have not been performed to identify which allele carries two mutations. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment
201 Comparison of Relative Frequencies of CFTR Sequence Variants in Comprehensive CFTR Studies in US and Mexican Hispanics This study % Orozco 2000 % US/ Mexican % deltaF508 28.96 54.48 43.72 G542X 3.83 8.28 5.19 406 - 1GϾA 3.28 2.07 2.38 W1204X 2.19 Ͻ1 1.08 R74W 1.64 Ͻ1 R75X 1.64 2.07 1.51 H199Y 1.64 Ͻ1 Ͻ1 L206W 1.64 Ͻ1 L997F 1.64 Ͻ1 I1027T 1.64 Ͻ1 2055del9ϾA 1.64 1.38 1.27 D1270N 1.64 Ͻ1 E116K 1.09 Ͻ1 V232D 1.09 Ͻ1 R334W 1.09 Ͻ1 S492F 1.09 Ͻ1 T501A 1.09 Ͻ1 R553X 1.09 Ͻ1 Ͻ1 E588V 1.09 Ͻ1 R668C 1.09 Ͻ1 Q890X 1.09 Ͻ1 W1089X 1.09 Ͻ1 S1235R 1.09 Ͻ1 D1445N 1.09 Ͻ1 3876delA 1.09 3.24 1717 - 8GϾA 1.09 Ͻ1 3272 - 26AϾG 1.09 Ͻ1 A1009T 1.09 Ͻ1 deltaI507 Ͻ1 3.45 1.30 S549N Ͻ1 3.45 1.95 G567A Ͻ1 Ͻ1 I148T 2.07 1.08 I506T 1.38 Ͻ1 N1303K 2.76 1.08 935delA 1.38 1.30 2183AAϾG 1.38 Ͻ1 3199del6 1.38 Ͻ1 3849 ϩ 10kbCϾT Ͻ1 1.30 ACMG/ACOG italicized. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Hepatol. 2002 Aug;37(2):192-7. Girodon E, Sternberg D, Chazouilleres O, Cazeneuve C, Huot D, Calmus Y, Poupon R, Goossens M, Housset C
Cystic fibrosis transmembrane conductance regulator (CFTR) gene defects in patients with primary sclerosing cholangitis.
J Hepatol. 2002 Aug;37(2):192-7., [PMID:12127423]

Abstract [show]
BACKGROUND/AIMS: Because biliary tract lesions that resemble those of primary sclerosing cholangitis (PSC) may occur in cystic fibrosis (CF), we examined the prevalence and influence of CF transmembrane conductance regulator (CFTR) gene mutations in PSC patients. METHODS: Genomic DNA was analyzed in 29 consecutive PSC patients and in 115 healthy control individuals. A scanning method followed by direct DNA sequencing was used to scan the CFTR coding regions. RESULTS: Four patients (13.8%) were heterozygous for a CFTR mutation, including a new putative severe CF-causing mutation (N782K), and three mild defects (L997F, D1270N, and S1235R). The comparison of PSC patients with healthy controls showed no significant difference in the frequency of CFTR mutations (P=0.415). In addition, two patients (6.9%) were heterozygous for the IVS8-5T allele, which is not significantly different from the 5-6%-prevalence in the general population. Unusual clinical features including a severe outcome in childhood, with a lethal outcome at age 22, and biliary aspergillosis were recorded in patients with a CFTR mutation. CONCLUSIONS: The proportion of CF carriers is not significantly higher in PSC patients than in the general population. The possibility that CFTR mutations may contribute to a severe clinical course in PSC patients is worth further examining.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Results: Four patients (13.8%) were heterozygous for a CFTR mutation, including a new putative severe CF-causing mutation (N782K), and three mild defects (L997F, D1270N, and S1235R). Login to comment
72 Four patients (13.8%) were heterozygous for one of the following CFTR mutations: N782K, L997F, S1235R and D1270N. Login to comment
73 L997F [14,15], S1235R [40,41], and D1270N [42,43] have been previously described as mild mutations. Login to comment
74 N782K, a new missense mutation (C-to-A transversion at nucleotide 2478), is located in exon 13, generates an ApoI restriction site, and putatively E. Girodon et al. / Journal of Hepatology 37 (2002) 192-197 193 E.Girodonetal./JournalofHepatology37(2002)192-197194 Table 1 Clinical status and CFTR genotype in PSC patientsa Patient Gender Age (years) at onset IBD Episode(s) of acute cholangitis Cirrhosis and/or portal hypertension Cholangiocarcinoma Liver transplantation CFTR mutations TGmTn genotype Other sequence variations 1 F 37 UC Yes Yes Yes (67) No N782K/- 12-7/11-7 M470V 2 M 8 No No Yes No Yes (18) D1270N/- 11-9/11-7 M470V 3 M 27 No Yes No No No L997F/- 11-7/11-7 V470V 4 M 58 Crohn Yes No No Yes (65) S1235R/- 11-7/12-7 M470V 5 F 17 Unclassified No No No No 10-7/11-5 M470M 6 F 43 Crohn Yes Yes No Yes (46) 10-7/11-5 M470M 7 F 58 UC Yes Yes Yes (58) No 10-7/11-7 M470V,R75Q,406-13T/C 8 M 32 Crohn Yes Yes No Yes (38) 11-7/11-7 V470V, R75Q 9 F 41 UC No No No Yes (48) 10-7/11-7 M470V, 1716G/A 10 M 23 No No No No No 12-7/10-7 M470M, 1715-12T/C 11 F 55 Crohn No No No No 11-9/12-7 M470M 12 M 39 Unclassified Yes No No No 10-7/11-7 M470M 13 M 45 No No No No No 9-9/11-7 M470V 14 M 23 UC No No No Yes (23) 10-9/11-7 M470M 15 M 20 No Yes Yes No Yes (29) 10-9/10-7 M470M 16 M 17 Crohn No Yes No Yes (47) 11-9/11-7 M470V 17 M 43 Unclassified Yes No No No 11-9/11-7 M470V 18 M 47 No No No No No 11-9/10-7 M470M 19 M 42 Crohn Yes No No No 11-7/11-7 V470V 20 M 31 Crohn Yes No No Yes (34) 10-7/11-7 M470V 21 M 16 Crohn No No No No 10-7/12-7 M470V 22 M 56 No Yes Yes No No 11-7/11-7 V470V 23 F 47 No Yes No Yes (54) No 11-7/12-7 M470V 24 F 19 Crohn No No Yes (29) No 10-7/12-7 M470M 25 M 35 UC Yes No No No 11-7/12-7 M470V 26 M 31 UC No Yes Yes (45) Yes (45) 11-7/12-7 V470V 27 F 52 Crohn Yes Yes No Yes (56) 10-7/11-7 M470V 28 F 55 Crohn No No No No 10-9/11-7 M470V 29 F 43 NA No No Yes (43) No 11-7/11-7 V470V a IBD, inflammatory bowel disease; UC, ulcerative colitis; NA, non-available; and age (years) at diagnosis of cholangicarcinoma or at liver transplantation is indicated within brackets. Login to comment
78 Four additional subjects (3.5%) carried one of the following mild defects: R117H, R347H, R74W-D1270N and R668C-G576A. Login to comment
96 The D1270N mutation, described in patients with CBAVD or mild CF, is classified as a mild defect upon results of functional studies [42]. Login to comment

[hide] Relation between the anatomical genital phenotype ... Fertil Steril. 2002 May;77(5):889-96. Robert F, Bey-Omar F, Rollet J, Lapray JF, Morel Y
Relation between the anatomical genital phenotype and cystic fibrosis transmembrane conductance regulator gene mutations in the absence of the vas deferens.
Fertil Steril. 2002 May;77(5):889-96., [PMID:12009340]

Abstract [show]
OBJECTIVE: To study the correlation between genital phenotype and cystic fibrosis genotype in men lacking at least one vas deferens. DESIGN: Prospective study. SETTING: Institut Rhonalpin pour la Reproduction Humaine, Lyon-Bron, France. PATIENT(S): Forty-seven infertile men lacking at least one vas deferens. INTERVENTION(S): All patients were screened for the 13 most common CFTR gene mutations and for the 5-thymidine variant of intron 8. Renal, scrotal, and transrectal ultrasonography were systematically performed. MAIN OUTCOME MEASURE(S): Epididymal and seminal vesicular abnormalities and testicular volume were compared among men with two, one, or no CFTR gene mutation, with or without the 5T allele. RESULTS: Seminal vesicles and the symmetry of epididymal and vesicular abnormalities did not differ between patients with and those without the CFTR gene mutation. Epididymal abnormalities were more frequent in men without the mutation. Testicular volumes were significantly lower in men without the mutation and those with the 5T allele only. CONCLUSION: Men with the CFTR mutation, the 5T allele only, and those without CFTR mutation have few differences in genital phenotype. Low testicular volume is observed in men without the CFTR mutation and those with the 5T allele only.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 Patient Mutations Intron 8 Phenotype Seminal vesicle Epididymis Testicular volume (right/left) (mL) Comments 1 ⌬F508/R117H 7T/9T BAVD A/D C/C 20/20 2 ⌬F508/R117H 7T/9T BAVD A/A E/C 15/12 3 R117H/R347H 7T/9T BAVD A/D E/E 15/15 Compound heterozygote 4 ⌬F508/o 5T/7T BAVD A/h C/C 10/13 Compound heterozygote 5 ⌬F508/o 5T/9T BAVD A/A E/E 16/17 Compound heterozygote 6 ⌬F508/o 5T/9T BAVD A/D E/E 15/15 7 ⌬F508/o 5T/9T BAVD A/A E/E 11/9 8 ⌬F508/o 5T/9T BAVD h/h E/E 20/20 9 ⌬F508/o 5T/9T BAVD A/A C/C 17/9 10 ⌬F508/o 5T/9T BAVD D/A E/E 15/12 11 ⌬F508/o 5T/9T BAVD A/D E/E 10/12 12 ⌬F508/o 7T/9T BAVD A/N C/E 20/20 13 ⌬F508/o 7T/7T BAVD A/A E/E 20/18 14 ⌬F508/o 7T/7T BAVD h/h E/E 10/9 15 ⌬F508/o 9T/9T BAVD A/D C/C 23/26 16 1612delTT/o 7T/9T BAVD A/D C/C 8/7 17 D1270N/o 7T/7T BAVD A/A E/E 12/13 18 R117H/o 7T/7T BAVD A/D E/E 20/18 19 2789ϩ5GBA/o 7T/7T BAVD A/A C/C 18/13 20 o/o 5T/5T BAVD D/A E/E 8/10 21 o/o 5T/9T BAVD A/A C/E 20/18 22 o/o 5T/7T BAVD A/A E/E 20/20 23 o/o 5T/9T BAVD A/A E/E 9/10 24 o/o 5T/7T BAVD A/D E/E 10/10 25 o/o 5T/7T BAVD A/A E/E 9/10 26 o/o 5T/9T BAVD A/D E/A 12/0 Left testicular atrophy 27 o/o 5T/7T BAVD A/A C/E 9/8 28 o/o 7T/7T BAVD A/A E/E 15/15 29 o/o 7T/7T BAVD A/h E/E 11/11 30 o/o 9T/9T BAVD h/h C/C 7/8 31 o/o 7T/7T BAVD h/A E/E 12/12 32 o/o 7T/7T BAVD A/A E/C 10/10 33 o/o 7T/9T BAVD A/A E/E 11/12 34 o/o 7T/7T BAVD h/A C/C 9/9 35 o/o 7T/7T BAVD A/D C/A 10/11 Bilateral dilatation of rete testis 36 o/o 7T/7T BAVD A/D C/C 12/12 37 o/o 7T/9T BAVD A/A C/E 15/15 38 o/o 7T/7T BAVD D/A C/C 12/15 39 o/o 7T/7T BAVDϩURA A/A C/C 12/12 40 o/o 7T/7T BAVDϩURA D/A A/C 0/20 Right testis absent 41 o/o 5T/9T UAVD D/A E/E 13/13 42 o/o 5T/7T UAVD D/A E/C 8/10 Right testicular hypotrophy 43 o/o 5T/7T UAVD h/N E/E 7/8 44 o/o 7T/7T UAVD A/D E/A 12/0 Left cryptorchidism 45 o/o 7T/7T UAVD D/A E/E 4/5 Bilateral testicular hypotrophy 46 o/o 7T/7T UAVD h/h E/E 8/8 47 o/o 7T/7T UAVDϩURA D/A E/E 15/15 Note: A ϭ absent; D ϭ dilated; C ϭ caput only; E ϭ whole; h ϭ hypotrophic; N ϭ normal; o ϭ no detected mutation; BAVD ϭ bilateral absence of the vas deferens; UAVD ϭ unilateral absence of the vas deferens; URA ϭ unilateral renal agenesis. Robert. Absence of the vas deferens. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 D1270N (n=1)]. Login to comment
215 Mutations D1270N and R74W have been independently reported elsewhere to be CF alleles [Anguiano et al., 1992; Claustres et al., 1993]. Login to comment

[hide] Screening practices for mutations in the CFTR gene... Hum Mutat. 2000;15(2):135-49. Girodon-Boulandet E, Cazeneuve C, Goossens M
Screening practices for mutations in the CFTR gene ABCC7.
Hum Mutat. 2000;15(2):135-49., [PMID:10649490]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) gene studies are now one of the most frequent activities in clinical molecular genetics laboratories. The number of requests is growing, owing to the increasingly wide range of recognized CFTR gene diseases (cystic fibrosis, congenital bilateral absence of the vas deferens, disseminated bronchiectasis, allergic bronchopulmonary aspergillosis and chronic pancreatitis), and the availability of efficient molecular tools for detecting mutations. A growing number of tests capable of simultaneously detecting several frequent CF mutations are being developed, and commercial kits are now available. The most recent kits detect nearly 90% of defective alleles in Caucasians, a rate high enough for carrier screening and for the majority of diagnostic requests. However, because of the wide variety of molecular defects documented in the CFTR gene, only a limited number of laboratories have mastered the entire panoply of necessary techniques, while other laboratories have to refer certain cases to specialized centers with complementary and/or scanning tools at their disposal. A good knowledge of CFTR diseases and their molecular mechanisms, together with expertise in the various techniques, is crucial for interpreting the results. Diagnostic strategies must take into account the indication, the patient's ethnic origin, and the time available in the framework of genetic counseling. This review presents the methods most frequently used for detecting CFTR gene mutations, and discusses the strategies most suited to the different clinical settings.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
179 The functional consequence of the double mutant R74W-D1270N was recently studied [Fanen et al., 1999]: R74W was shown to be a polymorphism with regard to chloride channel function, but was found to aggravate the deleterious effect of D1270N. Login to comment
180 D1270N alone is thus considered as a CBAVD mutation, while R74W-D1270N is considered as a CF mutation, in keeping with a previous clinical observation [Casals et al., 1995]. Login to comment

[hide] Structure-function analysis of a double-mutant cys... FEBS Lett. 1999 Jun 11;452(3):371-4. Fanen P, Clain J, Labarthe R, Hulin P, Girodon E, Pagesy P, Goossens M, Edelman A
Structure-function analysis of a double-mutant cystic fibrosis transmembrane conductance regulator protein occurring in disorders related to cystic fibrosis.
FEBS Lett. 1999 Jun 11;452(3):371-4., [PMID:10386624]

Abstract [show]
A number of disorders related to cystic fibrosis have been described since the cloning of the cystic fibrosis gene, including infertility due to the congenital bilateral absence of the vas deferens. We have identified, in several patients, complex cystic fibrosis transmembrane conductance regulator genotypes like double-mutant alleles. We have now analyzed the structure-function relationships of one of these mutants, R74W-D1270N cystic fibrosis transmembrane conductance regulator, expressed in HeLa cells, to evaluate the contribution of each mutation in the phenotype. We found that R74W cystic fibrosis transmembrane conductance regulator appears to be a polymorphism, while D1270N cystic fibrosis transmembrane conductance regulator could be responsible for the congenital bilateral absence of the vas deferens phenotype. The combination of the two produced a more severe effect on the chloride conductance pathway as well as on the phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 We have now investigated the structure-function relationships of one of these mutants, R74W-D1270N-CFTR, using a heterologous expression system. Login to comment
14 The 'rst mutation lies in the intracellular N-terminus of the CFTR protein and the second within the second nucleotide binding domain (NBD2), replacing an arginine by a tryptophan at position 74 and an aspartic acid by an asparagine at position 1270 [9,10]. Login to comment
20 These assays showed that the R74W mutation should be considered to be a polymorphism and suggest that D1270N alone is su¤cient to produce the CBAVD phenotype, while the combination of the two increases the chloride conductance pathway dysfunction and the phenotype. Login to comment
88 Lastly, 89% of D1270N-CFTR and 81% of R74W-D1270N-CFTR also had a cAMP-responsive anion conductance with di¡erent ratios between fast and slow responding cells (38% fast in D1270N-CFTR and 24% fast in R74W-D1270-CFTR). Login to comment
90 Discussion We have analyzed the structure-function relationships of three CFTR mutations, R74W, D1270N and the R74W-D1270N double-mutant, and compared their properties with those of wild-type CFTR. Login to comment
91 R74W was 'rst described in isolation [10], but has since been found in association with D1270N (Mireille Claustres, personal communication). Login to comment
92 D1270N was found in a CBAVD patient bearing the vF508 common mutation on the other allele [9]. Login to comment
93 Finally, the R74W-D1270N double-mutant was 'rst identi'ed in a compound, vF508, heterozygote with clinical features of CBAVD, rhinitis, recurrent respiratory infections and elevated sweat chloride concentrations [13]. Login to comment
97 To our knowledge, this is the 'rst reported expression of the R74W- and/or D1270N-CFTR mutant and the 'rst functional description of a double-mutant associated with CBAVD, a disorder related to CF. Login to comment
104 HeLa cells were transfected with either wild-type CFTR (vFstim/vFbasal = 12), R74W-CFTR (vFstim/vFbasal = 11), D1270N-CFTR (vFstim/vFbasal = 3) or R74W-D1270N-CFTR (vFstim/ vFbasal = 2). Login to comment
105 Table 1 Summary of the MEQ assay results Cell type Wild-type R74W D1270N R74W-D1270N PTracer Total 53 30 27 26 28 Non-responding 8 10 3 5 28 All responding 45 (85%)a 20 (67%)a 24 (89%)a 21 (81%)a 0 Fast 21 (47%)b 9 (45%)b 9 (38%)b 5 (24%)b 0 vFstim/vFbasal 13.3 þ 6.3c 11.9 þ 8.7c 7.7 þ 2.4c 7.3 þ 2.7c Range 5.4^26.3 5.9^34 5.6^12.8 5.2^12 Slow 24 (53%)b 11 (55%)b 15 (62%)b 16 (76%)b 0 vFstim/vFbasal 2.7 þ 1.1c 2.5 þ 0.9c 2.8 þ 0.9c 3.2 þ 1.2c Range 1.3^5 1.1^4.1 1.4^4.5 1.2^4.9 a Percentage of all cells. Login to comment
107 c Mean values þ S.D. FEBS 22106 -6-99 P. Fanen et al./FEBS Letters 452 (1999) 371^374 373 Expression of these three mutant genes in HeLa cells showed that R74W-CFTR, D1270N-CFTR and R74W-D1270N-CFTR proteins elicited cAMP-dependent chloride £uxes. Login to comment
111 D1270N and R74W-D1270N had abnormal responsive patterns. Login to comment
113 This fraction, as well as that of D1270N-CFTR (38%), resembles the pattern of responses of R117H-CFTR, another mild mutant associated with CBAVD [11]. Login to comment
118 The R74W-D1270N double-mutant was associated with a 7T background in the three patients studied. Login to comment
122 We therefore believe that the R74W-D1270N double-mutant is responsible for the CBAVD phenotype. Login to comment
123 The contribution of each mutant to this phenotype may be as follows: R74W is a polymorphism which may slightly reduce the normal amount of CFTR protein (67% of responding cells versus 81^89%) in vivo and D1270N has a cAMP-responsive anion conductance with di¡erent ratios between fast and slow responder cells, as for the R117H mutation. Login to comment
124 We infer that the combination of R74W enhances the e¡ect of D1270N by reducing the number of fast responder cells, as a consequence of the defective regulation of the R74W-D1270N mutated protein or of a di¡erent turn-over of the protein at the cell surface in vivo. Login to comment
125 This is supported by the fact that the compound heterozygote vF508/ D1270N described by Anguiano et al. occurred in a CBAVD patient with normal sweat sodium and chloride values, i.e. normal chloride secretion [9], whereas the compound heterozygote vF508/R74W-D1270N described by Casals et al. had a more severe phenotype and elevated sweat chloride concentrations suggesting an abnormal chloride secretion [13]. Login to comment

[hide] Complex cystic fibrosis allele R334W-R1158X result... Hum Mutat. 1996;8(2):134-9. Duarte A, Amaral M, Barreto C, Pacheco P, Lavinha J
Complex cystic fibrosis allele R334W-R1158X results in reduced levels of correctly processed mRNA in a pancreatic sufficient patient.
Hum Mutat. 1996;8(2):134-9., [PMID:8844211]

Abstract [show]
CFTR alleles containing two mutations have been very rarely found in cystic fibrosis (CF) patients. They provide an opportunity to study the effect of two in cis-interacting gene defects on gene expression. Here, we describe a three-generation CF family with a complex CFTR allele that has not been previously described, containing the missense mutation R334W in exon 7 and the nonsense mutation R1158X in exon 19. Lymphocyte RNA analysis showed that (1) the mRNA corresponding to the complex allele is present although at markedly reduced levels; and (2) the nonsense mutation does not lead to detectable skipping of exon 19. The clinical picture of the patients with the genotype R334W-R1158X/delta F508 is characterized by pancreatic sufficiency and an atypical course of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Other in cis missense mutations have been reported, namely F508C-Sl251N (Kalin et al., 1992), G628R- S1235R (Mercier et al., 1995) and R74W- D1270N (Verlingue et al., 1993). Login to comment

[hide] Screening Young syndrome patients for CFTR mutatio... Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7. Friedman KJ, Teichtahl H, De Kretser DM, Temple-Smith P, Southwick GJ, Silverman LM, Highsmith WE Jr, Boucher RC, Knowles MR
Screening Young syndrome patients for CFTR mutations.
Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7., [PMID:7551394]

Abstract [show]
Young syndrome is characterized by obstructive azoospermia associated with chronic sinobronchial disease of an infectious nature, but normal sweat-gland and pancreatic function as well as normal nasal potential differences. Congenital bilateral absence of the vas deferens (CBAVD) in some patients arises from mutations within the cystic fibrosis (CF) transmembrane regulator (CFTR) gene. Because of some similarities between Young syndrome, CF, and CBAVD, we evaluated 13 patients with Young syndrome, including screening for more than 30 different mutations within the CFTR gene. The mean age of the patients was 43 yr (range, 32 to 50 yr), and all were of northern European extraction. The sweat chloride concentration was normal in all patients (mean = 29 mEq/L; range, 8 to 43 mEq/L). Most had intermittent bronchial and sinus infections, but none was chronically colonized with Staphylococcus aureus or Pseudomonas aeruginosa. The FEV1 was normal or only mildly reduced in most patients (mean = 74%; range, 48 to 100% predicted). Of 26 Young syndrome chromosomes, we identified one with the recognized CF mutation delta F508. The incidence of CFTR mutations (1 in 26) did not differ significantly from the expected carrier frequency in this population. In summary, it is unlikely that the typical Young syndrome patient has a clinical disease associated with CFTR mutation on both alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No. Login to comment

[hide] Mutations in the cystic fibrosis gene in patients ... N Engl J Med. 1995 Jun 1;332(22):1475-80. Chillon M, Casals T, Mercier B, Bassas L, Lissens W, Silber S, Romey MC, Ruiz-Romero J, Verlingue C, Claustres M, et al.
Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens.
N Engl J Med. 1995 Jun 1;332(22):1475-80., [PMID:7739684]

Abstract [show]
BACKGROUND: Congenital bilateral absence of the vas deferens (CBAVD) is a form of male infertility in which mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene have been identified. The molecular basis of CBAVD is not completely understood. Although patients with cystic fibrosis have mutations in both copies of the CFTR gene, most patients with CBAVD have mutations in only one copy of the gene. METHODS: To investigate CBAVD at the molecular level, we have characterized the mutations in the CFTR gene in 102 patients with this condition. None had clinical manifestations of cystic fibrosis. We also analyzed a DNA variant (the 5T allele) in a noncoding region of CFTR that causes reduced levels of the normal CFTR protein. Parents of patients with cystic fibrosis, patients with types of infertility other than CBAVD, and normal subjects were studied as controls. RESULTS: Nineteen of the 102 patients with CBAVD had mutations in both copies of the CFTR gene, and none of them had the 5T allele. Fifty-four patients had a mutation in one copy of CFTR, and 34 of them (63 percent) had the 5T allele in the other CFTR gene. In 29 patients no CFTR mutations were found, but 7 of them (24 percent) had the 5T allele. In contrast, the frequency of this allele in the general population was about 5 percent. CONCLUSIONS: Most patients with CBAVD have mutations in the CFTR gene. The combination of the 5T allele in one copy of the CFTR gene with a cystic fibrosis mutation in the other copy is the most common cause of CBAVD: The 5T allele mutation has a wide range of clinical presentations, occurring in patients with CBAVD or moderate forms of cystic fibrosis and in fertile men.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 OF PATIENTS POLYT GENOTYPE† ⌬F508/R668C ⌬F508/D1152H ⌬F508/D1270N ⌬F508/R75L ⌬F508/R117H ⌬F508/L206W ⌬F508/R258G ⌬F508/S1235R ⌬F508/R347H ⌬F508/R347H R117H/G1349D R117H/712-1G→T G149R/R668C R347H/R1066H R553X/R668C R1070W/2869insG ⌬F508/- G542X/- W1282X/- R334W/- K1060T/- R1162X/- N1303K/- A800G/- ⌬F508/- ⌬F508/- ⌬F508/- ⌬E115/- R117H/- R347H/- G542X/- R553X/- 1677delTA/- 2184delA/- 2789ϩ5G→Α/- S1235R/- W1282X/- -/- -/- -/- -/- 2 2 2 1 1 1 1 1 1 1 1 1 1 1 1 1 22 4 3 1 1 1 1 1 7 1 1 1 1 2 1 1 1 1 1 1 1 3 3 1 19 9T/7T 9T/7T 9T/7T 9T/7T 9T/7T 9T/9T 9T/7T 9T/7T 9T/7T 9T/9T 7T/7T 7T/9T 9T/7T 9T/7T 7T/7T 7T/7T 9T/5T 9T/5T 7T/5T 7T/5T 7T/5T 7T/5T 9T/5T 5T/5T 9T/7T 9T/9T 7T/7T 7T/7T 7T/7T 9T/7T 9T/7T 7T/7T 7T/7T 7T/7T 7T/7T 7T/9T 7T/7T 9T/5T 7T/5T 5T/5T 7T/7T -/- 3 7T/9T *Data were obtained from the Spanish population analyzed in this study. Login to comment

[hide] Increased incidence of cystic fibrosis gene mutati... Hum Mol Genet. 1995 Apr;4(4):635-9. Pignatti PF, Bombieri C, Marigo C, Benetazzo M, Luisetti M
Increased incidence of cystic fibrosis gene mutations in adults with disseminated bronchiectasis.
Hum Mol Genet. 1995 Apr;4(4):635-9., [PMID:7543317]

Abstract [show]
In order to identify a possible hereditary predisposition to the development of obstructive pulmonary disease of unknown origin, we have looked for the presence of Cystic Fibrosis Transmembrane Regulator (CFTR) gene mutations in unrelated patients with no signs of Cystic Fibrosis (CF). We screened for 70 common mutations, and also for rare mutations by denaturing gradient gel electrophoresis analysis. In this search, different CFTR gene mutations (R75Q, delta F508, R1066C, M1137V and 3667ins4) were found in five out of 16 adult Italian patients with disseminated bronchiectasis, a significant increase over the expected frequency of carriers. Moreover, three rare CFTR gene DNA polymorphisms (G576A, R668C, and 2736 A-->G), not deemed to be the cause of CF, were found in two patients, one of which was a compound heterozygote with R1066C. These results indicate that CFTR gene mutations, and perhaps also DNA polymorphisms, may be involved in the etiopathogenesis of at least some cases of bronchiectasis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 Several mutations were searched by restriction analysis: 457 TAT-»G, R334W, R347P/H/L, A455E, Q552X, 3849 + 10 kbC->T, D1270N. Login to comment

[hide] Extensive analysis of 40 infertile patients with c... Hum Genet. 1995 Feb;95(2):205-11. Casals T, Bassas L, Ruiz-Romero J, Chillon M, Gimenez J, Ramos MD, Tapia G, Narvaez H, Nunes V, Estivill X
Extensive analysis of 40 infertile patients with congenital absence of the vas deferens: in 50% of cases only one CFTR allele could be detected.
Hum Genet. 1995 Feb;95(2):205-11., [PMID:7532150]

Abstract [show]
Mutations in the cystic fibrosis (CF) conductance transmembrane regulator (CFTR) gene have been detected in patients with CF and in males with infertility attributable to congenital bilateral absence of the vas deferens (CBAVD). Thirty individuals with CBAVD and 10 with congenital unilateral absence of the vas deferens (CUAVD) were analyzed by single-strand conformation analysis and denaturing gradient gel electrophoresis for mutations in most of the CFTR gene. All 40 individuals were pancreatic sufficient, but twenty patients had recurrent or sporadic respiratory infections, asthma/asthmatic bronchitis, and/or rhino-sinusitis. Agenesia or displasia of one or both seminal vesicles was detected in 30 men and other urogenital malformations were present in six subjects. Among the 40 samples, we identified 13 different CFTR mutations, two of which were previously unknown. One new mutation in exon 4 was the deletion of glutamic acid at codon 115 (delta E115). A second new mutation was found in exon 17b, viz., an A --> C substitution at position 3311, changing lysine to threonine at codon 1060 (K1060T). CFTR mutations were detected in 22 out of 30 (73.3%) CBAVD patients and in one out of 10 (10%) CUAVD individuals, showing a significantly lower incidence of CFTR mutations in CBAVD/CUAVD patients (P << 0.0001), compared with that found in the CF patient population. Only three CBAVD patients were found with more than one CFTR mutation (delta F508/L206W, delta F508/R74W + D1270N, R117H/712-1G --> T), highlighting L206W, R74W/D1270N, and R117H as benign CF mutations. Sweat electrolyte values were increased in 76.6% of CBAVD patients, but three individuals without CFTR mutations had normal sweat electrolyte levels (10% of the total CBAVD patients), suggesting that factors other than CFTR mutations are involved in CBAVD. The failure to identify a second mutation in exons and their flanking regions of the CFTR gene suggests that these mutations could be located in introns or in the promoter region of CFTR. Such mutations could result in CFTR levels below the minimum 6%-10% necessary for normal protein function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
10 J. Gimrnez 9M. D. Ramos 9V. Nunes X. Estivill (Ig~l) Molecular Genetics Department, Cancer Research Institute, Hospital Duran i Reynals, Autovfa de Castelldefels Km. 2.7, L'Hospitalet de Llobregat, E-08907 Barcelona, Catalonia, Spain L. Bassas 9J. Ruiz-Romero 9H. Narwiez Andrology Department, I.U.N.A., Fundaci6 Puigvert, Barcelona, Catalonia, Spain G. Tapia Pediatrics Department, Hospital de Sant Pau, Barcelona, Catalonia, Spain D1270N, and R117H as benign CF mutations. Login to comment
59 Direct sequencing of these two abnormal fragments identified mutation R ll7H, a known Table 1 Semen analysis of patients with CAVD, given as the mean (range) CBAVD CUAVD (n = 27) (n = 10) Sperm (x 106/ml) 0 10.6 (0-90) Seminal volume (ml) 0.9 (0.2-3.1) 2.5 (0.4 5.4) pH 6.7 (6.0-8.0) 7.3 (6.4-7.7) Fructose (retool/l) 2.6 (0-9) 10.3 (3-) '~Citrate (mmol/l) 77.5 (11-188) 48.6 (36-88) ~Reference values: fructose, 8 28 retool/l; citrate, 10 35 retool/1 Table 2 CFTR mutation analysis in 30 CBAVD and 10 CUAVD patients (CBAVD congenital bilateral absence of the vas deferens, CUAVD congenital unilateral absence of the vas deferens, ND not determined, - absence of mutations, RRI recurrent respiratory infection, R rhinitis, RS rhino-sinusitis, BR.ASTH bronchitis asthmatic) Table 3 Congenital malformations associated with CAVD in 40 patients 207 Patient Age Phenotype Sweat test Mutation Other clinical (years) (mEq/l) features 1 37 CBAVD 108 1677delTA 2 28 CBAVD 50 G542X 3 28 CBAVD 118 - 4 33 CBAVD 90 AF508/L206W RRI, R 5 26 CBAVD 118 R117H/712-1G-+T 6 42 CBAVD 66 - RS 7 31 CBAVD 170 AF508 R 8 27 CBAVD 100 AF508/R74W + D1270N RRI, R 9 32 CBAVD 74 AE115 RS 10 35 CBAVD 90 - Nasal polyps 11 33 CBAVD 78 KI060T RI, family history 12 45 CBAVD 150 R334W RS 13 42 CBAVD 60 - 14 40 CBAVD 110 R 1070W RS 15 29 CBAVD 110 G542X 16 37 CBAVD 80 R117H RI, RS, BR.ASTH 17 37 CBAVD 85 - Asthma 18 46 CBAVD 15 R1162X 19 37 CBAVD 110 AF508 RS, diarrhoea 20 42 CBAVD 45 2789+5G--)A RI 21 49 CBAVD 95 AF508 22 36 CBAVD 70 AF508 RRI, RS 23 42 CBAVD 90 - 24 15 CBAVD 150 AF508 25 26 CBAVD 60 - 26 39 CBAVD 100 AF508 RRI, RS 27 33 CBAVD 57 AF508 RRI 28 33 CBAVD 80 G542X 29 34 CBAVD 78 - 30 32 CBAVD 113 G542X 31 33 CUAVD ND AF508 RS, pancreatitis 32 37 CUAVD ND - 33 31 CUAVD 77 - BR.ASTH 34 39 CUAVD ND - 35 40 CUAVD 40 - 36 33 CUAVD 59 - 37 40 CUAVD 90 - 38 47 CUAVD 40 - RRI 39 39 CUAVD 50 - 40 35 CUAVD 100 - No. Login to comment
89 Another abnormal DGGE fragment detected in exon 3 was the result of mutation R74W (Claustres et al. 1993); this mutation was found to be associated with mutation D1270N in exon 20 (Anguiano et al. 1992; C. F6rec and M. Claustres, personal communication). Login to comment
99 The third patient had AF508/R74W + D1270N, with clinical features of rhinitis and recurrent respiratory infections. Login to comment
100 We do not know which of the two mutations (R74W or D1270N, or both) is involved in the CBAVD phenotype. Login to comment

[hide] Is congenital bilateral absence of vas deferens a ... Am J Hum Genet. 1995 Jan;56(1):272-7. Mercier B, Verlingue C, Lissens W, Silber SJ, Novelli G, Bonduelle M, Audrezet MP, Ferec C
Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients.
Am J Hum Genet. 1995 Jan;56(1):272-7., [PMID:7529962]

Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) is an important cause of sterility in men. Although the genetic basis of this condition is still unclear, it has been shown recently that some of these patients carry mutations in their cystic fibrosis transmembrane conductance regulator (CFTR) genes. To extend this observation, we have analyzed the entire coding sequence of the CFTR gene in a cohort of 67 men with CBAVD, who are otherwise healthy. We have identified four novel missense mutations (A800G, G149R, R258G, and E193K). We have shown that 42% of subjects were carriers of one CFTR allele and that 24% are compound heterozygous for CFTR alleles. Thus, we have been unable to identify 76% of these patients as carrying two CFTR mutations. Furthermore, we have described the segregation of CFTR haplotypes in the family of one CBAVD male; in this family are two male siblings, with identical CFTR loci but displaying different phenotypes, one of them being fertile and the other sterile. The data presented in this family, indicating a discordance between the CBAVD phenotype and a marked carrier (delta F508) chromosome, support the involvement of another gene(s), in the etiology of CBAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 In addition, we identified the following missense mutations: four R668C, one A800G, one (G628R + S1235R, borne on the same chromosome), one (R74W + D1270N, borne on the same chromosome), six R117H, one F1052V, one R117C, one S1235R, one G149R, one R258G, two R347H, one R1066H, one R75L, and one E193K. Login to comment
77 of Patients Genotypea 1 AF508 + (G628R + S1235R) 1 AF508 + (R74W + D1270N) 2 AF508 + R668C 4 AF508 + R117H 1 AF508 + R258G 1 AF508 + R75L 1 E193K + N1303K 1 R347H + R1066H 1 R117C + W1282X 1 R553X + R668C 1 G149R + R668C 1 R117H+R117H 18 AF508/unidentified 4 W1282X/unidentified 1 G542X/unidentified 1 N1303K/unidentified 1 S1235R/unidentified 1 R347H/unidentified 1 A800G/unidentified 1 F1052V/unidentified 23 unidentified/unidentified a In parentheses are the two mutations located on the same haplotype. Login to comment
98 Two patients were carriers of two missense mutations on the same allele (G268R + S1235 R and R74W + D1270N) (table 1). Login to comment
100 We also had previously reported that haplotype R74W + D1270N was present in a healthy 23 le b 12 t 113 t 11,4 t *,13 13 a|13 1 131313 Figure I CFTR locus for brothers II-1 and II-4. Login to comment
117 These results show clearly that these two brothers are carrying two identical CFTR haplotypes and suggest that another locus could account for the phenotype observed for subject II,. Discussion mother of an affected child (Verlingue et al. 1993), her genotype being (R74W + D1270N) + 2183 AA--oG. If we consider that CBAVD may be a mild form of CF, these observations suggest that a second mutation in a CFTR allele may result in a reversion or partial reversion of phenotype. Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment

[hide] The cystic fibrosis transmembrane conductance regu... J Biol Chem. 1994 May 20;269(20):14584-8. Ko YH, Thomas PJ, Pedersen PL
The cystic fibrosis transmembrane conductance regulator. Nucleotide binding to a synthetic peptide segment from the second predicted nucleotide binding fold.
J Biol Chem. 1994 May 20;269(20):14584-8., [PMID:7514174]

Abstract [show]
Previous studies from this laboratory with a 67-amino acid synthetic peptide (P-67) demonstrated directly that the first predicted nucleotide binding fold of the cystic fibrosis transmembrane conductance regulator (CFTR) binds ATP (Thomas, P.J, Shenbagamurthi, P., Ysern, S., and Pedersen, P.L. (1991) Science 251, 555-557). Although mutational analysis within the predicted second nucleotide binding fold indicates that this domain may be functionally important also, direct evidence for nucleotide binding is lacking. Here, we report the design, chemical synthesis, and purification of a 51-amino acid segment (P-51) of the second predicted nucleotide binding fold of CFTR and demonstrate that this peptide binds ATP. P-51 consists of amino acid residues from glutamic acid 1228 through threonine 1278 and contains a motif, GX4GKS, very similar or identical to that found in many nucleotide-binding proteins. The freshly dissolved peptide moves predominantly as a single species upon molecular sieve chromatography and readily binds ATP without eliciting its hydrolysis. P-51 also readily binds the fluorescent ATP analogs TNP-ATP (2'(3')-0-(2,4,6-trinitrophenyl)-adenosine-5'-triphosphate) and TNP-ADP but exhibits much less capacity to bind TNP-AMP. ATP displaces TNP-ATP with a Kd (ATP) of 0.46 mM. In the presence of the denaturant urea, P-51 loses most of its binding capacity indicating that structure is important for binding. Consistent with this conclusion, circular dichroism spectroscopy revealed that P-51 has significant secondary structure. Elements of such structure calculated from deconvolution of the circular dichroism spectra compare favorably with those predicted from the program of Chou, P.Y., and Fasman, G.D. (1977) J. Mol. Biol. 115, 135-175. These experiments provide the first direct evidence that the second predicted nucleotide binding fold of CFTR binds ATP and define a 51-amino acid segment within the approximately 150-amino acid fold critical for this function. They also indicate that the beta and gamma phosphate groups of ATP may be important for binding and that the 51-amino acid region studied is not sufficient to catalyze ATP hydrolysis. Finally, as seven different mutations within P-51 are known to cause cystic fibrosis, these studies will be important in future efforts to understand the molecular basis of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 TNP Nucleotide Binding-The enhancement of fluorescence of the TMS-1 TMS-2 NBF-2 COO- + % N E P-51 (122B-<278) ENISFSISPGQRVGLL&TGSG~TLLSAFLP.LLNTEGEIQIDGVSWDSIT1/1 51 -ttl).ttttttt"-, CF Mutations within P-51 Q123ESTOP 11234" G1244E S1251N S1255P D1270N S1255STOP FIG.1.Primary sequence of P-51 and its predicted secondary structure. Login to comment

[hide] Heterogeneity in the severity of cystic fibrosis a... Hum Genet. 1994 Apr;93(4):364-8. Dean M, Santis G
Heterogeneity in the severity of cystic fibrosis and the role of CFTR gene mutations.
Hum Genet. 1994 Apr;93(4):364-8., [PMID:7513291]

Abstract [show]
Cystic fibrosis is a common, fatal disorder caused by abnormalities in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. CFTR encodes a chloride channel that regulates secretion in many exocrine tissues. The presentation of cystic fibrosis is highly variable as measured by the age of onset of disease, the presence of pancreatic insufficiency, or the progression of lung disease. Over 400 mutations in the CFTR gene have been described in cystic fibrosis patients and considerable effort has focused on the correlation between specific mutations and genotypes and clinical characteristics. Individual tissues display variation in their sensitivity to CFTR mutations. The vas deferens is functionally disrupted in nearly all males, whereas mild and severe pancreatic involvement is determined by the patient's genotype. The severity of pulmonary disease is poorly correlated with genotype, suggesting that there are other important genetic and/or environmental factors that contribute to lung infections and the subsequent disruption of lung function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Whether other missense alleles associated with CBAVD (D1270N, G576A, F508C) also encode for aberrant channel proteins remains to be determined. Login to comment

[hide] Analysis of the 27 exons and flanking regions of t... Hum Mol Genet. 1993 Aug;2(8):1209-13. Claustres M, Laussel M, Desgeorges M, Giansily M, Culard JF, Razakatsara G, Demaille J
Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France.
Hum Mol Genet. 1993 Aug;2(8):1209-13., [PMID:7691344]

Abstract [show]
In order to characterize the non-delta F508 mutations that account for 36% of cystic fibrosis (CF) chromosomes in Southern France in a sample of 137 patients, we have systematically screened the entire coding region and adjacent sequences of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by the single strand conformation polymorphism (SSCP) technique followed by direct sequencing of the mutant DNAs. We identified 13 novel mutations (9 reported in this paper) and 4 novel rare nucleotide sequence variations. Forty different mutations including delta F508, located in 15 exons, account for only 91.2% of mutants in a population originating from Southern France, in contrast with a recent report on the Celtic population of Brittany demonstrating that 90% of mutations can be detected with only three mutations. We present a very large spectrum of different CF mutations identified in a small geographical area.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation? Login to comment

[hide] The spectrum of cystic fibrosis mutations. Trends Genet. 1992 Nov;8(11):392-8. Tsui LC
The spectrum of cystic fibrosis mutations.
Trends Genet. 1992 Nov;8(11):392-8., [PMID:1279852]

Abstract [show]
Although the major mutation causing cystic fibrosis accounts for almost 70% of mutant chromosomes screened, almost 300 sequence alterations have been identified in the gene during the past two and a half years. At least 230 of these mutations are probably associated with disease. This rapid accumulation of data is in part due to the highly coordinated effort by members of the Cystic Fibrosis Genetic Analysis Consortium. The information is not only essential to genetic diagnosis, but also will aid in understanding the structure and function of the protein, and possibly in correlating genotype with phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
123 8 NO. 11 m []~EVIEWS G551D R553Q G551S I L558S aI~7 S5491 I I 1&559T A455F E5040 I&F508 V520F SS49NII IIR560T PS74H I G458V G480C $492F /" • ss,9 II III* oa. / III / NBF1 ~t ~t NBF2 I I I I I III I I I 11234V G1244E IS1255P D1270N II I Q1291H N1303K G1349D S1251N W1282R] F1286S N1303H Q1283M, FIG[] Cystic fibrosis (missense) mutations located within the two presumptive ATP-binding domains (NBF1 and NBF2) of CFTR. Login to comment

[hide] Effects of cystic fibrosis and congenital bilatera... Am J Hum Genet. 2000 May;66(5):1485-95. Epub 2000 Apr 4. Mickle JE, Milewski MI, Macek M Jr, Cutting GR
Effects of cystic fibrosis and congenital bilateral absence of the vas deferens-associated mutations on cystic fibrosis transmembrane conductance regulator-mediated regulation of separate channels.
Am J Hum Genet. 2000 May;66(5):1485-95. Epub 2000 Apr 4., [PMID:10762539]

Abstract [show]
The protein defective in cystic fibrosis (CF), the CF transmembrane-conductance regulator (CFTR), functions as an epithelial chloride channel and as a regulator of separate ion channels. Although the consequences that disease-causing mutations have on the chloride-channel function have been studied extensively, little is known about the effects that mutations have on the regulatory function. To address this issue, we transiently expressed CFTR-bearing mutations associated with CF or its milder phenotype, congenital bilateral absence of the vas deferens, and determined whether mutant CFTR could regulate outwardly rectifying chloride channels (ORCCs). CFTR bearing a CF-associated mutation in the first nucleotide-binding domain (NBD1), DeltaF508, functioned as a chloride channel but did not regulate ORCCs. However, CFTR bearing disease-associated mutations in other domains retained both functions, regardless of the associated phenotype. Thus, a relationship between loss of CFTR regulatory function and disease severity is evident for NBD1, a region of CFTR that appears important for regulation of separate channels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Expression Analysis The mutations DF508, R1070W, D1270N, and G1349D were created in the vector pBQ4.7 containing CFTR cDNA (pBQ4.7 is a gift from J. Rommens and L. Login to comment
51 C. Tsui), by single-stranded mutagenesis (Youssoufian et al. 1995), and then were shuttled into pRSV-CFTR, a Rous sarcoma virus (RSV)-driven expression plasmid, by use of Kpn2I and HpaI (for DF508) or NcoI and SalI (for R1070W, D1270N, and G1349D) restriction sites common to both plasmids (Fulmer et al. 1995). Login to comment
75 Also selected for study were two mutations in NBF2-D1270N and G1349D, which are associated with different pulmonary phenotypes (table 1). Login to comment
76 The mutation D1270N has been identified in at least nine men with CBAVD. Login to comment
77 For comparison purposes, we selected the CF-associated mutation G1349D, since it occurs in the same functional domain as does D1270N. Login to comment
97 OF CASES PHENOTYPE Lung Status Pancreatic Status Sweat Cl2 Fertility Normala Abnormal Not Reported Sufficient Insufficient Not Reported Reported (Mean 5 SEM [mmol/literb ]) Not Reported Subfertilec Not Reported R1070W (7)d 5 0 2 5 0 2e 6 ( ) 50.2 5 13.4 1 6 1 CBAVD R1070P (2)f 0 1 1 0 1 1 1 (Positive) 1 0 2 CF R1070Q (14)g 0 7 7 0 7 7 7 (Positive) 7 2 12 CF D1270N (9)h 4 0 5 4 0 5 3 ( ) 77.5 5 16.7 6 3 6 CBAVD G1349D (3)i 0 0 3 0 0 3 ) 3 1 2 CF a No history of chronic lung disease. Login to comment
173 C, CBAVD(D1270N) and CF(G1349D) mutations in NBF2 had I-V profiles comparable to those of wild-type CFTR. Login to comment
180 Thus, the combination of I-V relationship and response to inhibitors allowed dissection of whole-cell Cl-currents into two components: outwardly rectified and DIDS sensitive, carried by separate channels such as ORCCs; and linear, DIDS insensitive, and gli- Table 2 Summary of Processing and Whole-Cell Function of CFTR Mutants DOMAIN AND MUTATION PHENOTYPE CFTR STATUS a Processingb Function Band A Band B Band C Cl2 Channel Regulatoryc Not applicable: Wild type Normal 2 2 111 111 1 NBF1:d A455Ee CFe 1 11 2 111 1 DF508 CF 1 11 2 1 2 G551D CF 2 2 111 1 2 TMD2: R1070W CBAVD 2 1 11 111 1 R1070P CF 1 11 2 111 1 R1070Q CF 2 1 11 111 1 NBF2: D1270N CBAVD 2 2 111 111 1 G1349D CF 2 2 111 111 1 a A minus sign (2) denotes absence; a single plus sign (1) denotes "low"; a double plus sign (11) denotes "intermediate"; and a triple plus sign denotes "high." Login to comment
190 Likewise, cells expressing either of the NBF2 mutants- D1270N (CBAVD) and G1349D (CF)-had both components of whole-cell Cl2 currents (fig. 3C). Login to comment

[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 At least another 38 mutations have been searched for, but none of them were found in the CF patients from Latin America: p.E60X, p.Y122X, p.G178R, p.G330X, p.R347H, p.R352Q, p.S364P, p.A455E, p.Q493X, p.V520F, p.C524X, p.R560T, p.Y563D, p.P574H, p.K710X, p.Q890X, p. R1158X, p.S1196X, p.S1255X, p.D1270N, p.W1310X, p. W1316X, c.405+1G-A, c.444delA, c.556delA, c.574delA, c.1677delTA, c.2043delG, c.2307insA, c.2909delT, c.3120G-A, c.3358delAC, c.3662delA, c.3750delAG, c.3791delC, c.3821delT, c.3849+4A-G, c.3905insT. Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
86 For example, the baseline level of chloride transport and ivacaftor response was higher for mutant CFTR forms associated with mild defects in CFTR processing (e.g., E56K, P67L, L206W, A455E, D579G, S945L, S977F, A1067T, R1070Q, R1070W, F1074L, and D1270N) than for those associated with severe defects in CFTR processing (e.g., F508del, H1054D, R1066H). Login to comment
92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3. Login to comment
116 Other examples of complex CFTR alleles include the number of TG repeats in intron 8 along with the 5T CFTR mutation (e.g., TG11-5T, TG12-5T, TG13-5T), R668C-G576A-D443Y, and R74W-D1270N [8,16]. Login to comment

[hide] Defining the disease liability of variants in the ... Nat Genet. 2013 Oct;45(10):1160-7. doi: 10.1038/ng.2745. Epub 2013 Aug 25. Sosnay PR, Siklosi KR, Van Goor F, Kaniecki K, Yu H, Sharma N, Ramalho AS, Amaral MD, Dorfman R, Zielenski J, Masica DL, Karchin R, Millen L, Thomas PJ, Patrinos GP, Corey M, Lewis MH, Rommens JM, Castellani C, Penland CM, Cutting GR
Defining the disease liability of variants in the cystic fibrosis transmembrane conductance regulator gene.
Nat Genet. 2013 Oct;45(10):1160-7. doi: 10.1038/ng.2745. Epub 2013 Aug 25., [PMID:23974870]

Abstract [show]
Allelic heterogeneity in disease-causing genes presents a substantial challenge to the translation of genomic variation into clinical practice. Few of the almost 2,000 variants in the cystic fibrosis transmembrane conductance regulator gene CFTR have empirical evidence that they cause cystic fibrosis. To address this gap, we collected both genotype and phenotype data for 39,696 individuals with cystic fibrosis in registries and clinics in North America and Europe. In these individuals, 159 CFTR variants had an allele frequency of l0.01%. These variants were evaluated for both clinical severity and functional consequence, with 127 (80%) meeting both clinical and functional criteria consistent with disease. Assessment of disease penetrance in 2,188 fathers of individuals with cystic fibrosis enabled assignment of 12 of the remaining 32 variants as neutral, whereas the other 20 variants remained of indeterminate effect. This study illustrates that sourcing data directly from well-phenotyped subjects can address the gap in our ability to interpret clinically relevant genomic variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
137 In addition to these ten variants, c.1210-12(7) (legacy name 7T) had already been reported to be non-penetrant48 and was identified as a second variant in numerous fathers, and a twelfth variant, p.Ile1027Thr, was deemed 159 variants ࣙ0.01% frequency in CFTR2 127 variants meet clinical and functional criteria Clinical and functional analysis 13 variants meet neither criteria 14 variants 5 variants 7 variants 6 variants Evidence of non-penetrance No evidence of non-penetrance 19 variants meet clinical or functional criteria 127 variants are CF causing 12 variants are non CF causing 20 variants are indeterminate p.Arg117HisߤC p.Arg75Gln p.Gly576Alaߤ p.Arg668Cys ߤ p.Met470Val C p.IIe1027Thr ߤC p.Val754Met ߤC p.IIe148Thr ߤC p.Arg31Cys C p.Ser1235Arg ߤ p.Leu997Phe ߤ p.Arg1162Leu p.Leu227Arg F p.Gln525* F p.Leu558SerC p.Asp614Gly C c.2657+2_2657+3insA C c.1418delG F c.1210-12(7) ߤ p.Arg1070Gln C p.Asp1270Asn ߤC p.[Gln359Lys; Thr360Lys] p.Gly1069Argߤ p.Asp1152His p.Phe1052Val c.1210-12(5) p.Arg74Trpߤ p.IIe1234Val ߤC p.Arg1070Trp ߤF p.Ser977Phe F p.Asp579Gly C p.Tyr569Asp F Penetrance analysis Figure 4ߒ Assignment of disease liability to the 159 most frequent CFTR variants using three criteria. Login to comment
147 Included among the variants meeting neither clinical nor functional criteria are those that have previously been associated with variable penetrance (such as p.Asp1152His), variants that have been reported as part of complex alleles in which the disease liability of each variant individually could not be determined (such as the pair p.Arg74Trp and p.Asp1270Asn) and variants with incomplete clinical or functional analysis. Login to comment

[hide] Genetics of cystic fibrosis: CFTR mutation classif... Int J Biochem Cell Biol. 2014 Jul;52:94-102. doi: 10.1016/j.biocel.2014.02.023. Epub 2014 Mar 12. Fanen P, Wohlhuter-Haddad A, Hinzpeter A
Genetics of cystic fibrosis: CFTR mutation classifications toward genotype-based CF therapies.
Int J Biochem Cell Biol. 2014 Jul;52:94-102. doi: 10.1016/j.biocel.2014.02.023. Epub 2014 Mar 12., [PMID:24631642]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes an epithelial anion channel. Since the identification of the disease in 1938 and up until 2012, CF patients have been treated exclusively with medications aimed at bettering their respiratory, digestive, inflammatory and infectious symptoms. The identification of the CFTR gene in 1989 gave hopes of rapidly finding a cure for the disease, for which over 1950 mutations have been identified. Since 2012, recent approaches have enabled the identification of small molecules targeting either the CFTR protein directly or its key processing steps, giving rise to novel promising therapeutic tools. This review presents the current CFTR mutation classifications according to their clinical consequences and to their effect on the structure and function of the CFTR channel. How these classifications are essential in the establishment of mutation-targeted therapeutic strategies is then discussed. The future of CFTR-targeted treatment lies in combinatory therapies that will enable CF patients to receive a customized treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 Group A Group B Group C Group D Classic-CF CF-causing mutations Non-classic CF CFTR-related disorder associated mutations No clinical consequence Unknown clinical relevance All mutations in Table 2 and 711 + 3A > G*, R117H-T5*, D1152H*, L206W*, TG13-T5* TG13-T5a , R117H-T5a , D1152Ha , L206Wa , L997F, M952I, D565Ga , TG11-T5b , R117H-T7b , D443Y-G576A-R668C, R74W-D1270N, R75Qb TG11-T5b , R117H-T7b , R75Qb , 875 + 40A/G, M470V, T854T, P1290P, I807M, I521F, R74W, F508C, I506V, I148T All mutations (mostly missense) not yet analyzed or undergoing functional analysis a Mutations that may belong either to Group A or to Group B. b Mutations that may belong either to Group B or to Group C. Login to comment

[hide] Genetics and treatment options for recurrent acute... Curr Treat Options Gastroenterol. 2014 Sep;12(3):359-71. doi: 10.1007/s11938-014-0022-y. Shelton CA, Whitcomb DC
Genetics and treatment options for recurrent acute and chronic pancreatitis.
Curr Treat Options Gastroenterol. 2014 Sep;12(3):359-71. doi: 10.1007/s11938-014-0022-y., [PMID:24954874]

Abstract [show]
OPINION STATEMENT: Worldwide research efforts demonstrate a major role of gene-environment interactions for the risk, development, and progression of most pancreatic diseases, including recurrent acute and chronic pancreatitis. New findings of pancreas disease-associated risk variants have been reported in the CPA1, GGT1, CLDN2, MMP1, MTHFR, and other genes. These risk genes and their regulatory regions must be added to the known pathogenic variants in the PRSS1, SPINK1, CFTR, CTRC, CASR, UBR1, SBDS, CEL, and CTSB genes. This new knowledge promises to improve disease management and prevention through personalized medicine. At the same time, however, knowledge of an increasing number of pathogenic variants, and their complicated effects when present in combination, results in increasing difficulty in interpretation and development of recommendations. Direct-to-consumer marketing of genetic testing results also adds complexity to disease management paradigms, especially without interpretation and, in many cases, proven accuracy. While improvements in the ability to rapidly and accurately interpret complex genetic tests are clearly needed, some results, such as pathogenic CFTR variants, including a new class of bicarbonate-defective mutations, and PRSS1 variants have immediate implications that direct management. In addition, discovery of pancreatitis-associated genetic variants in patients with glucose intolerance may suggest underlying type 3c diabetes, which also has implications for treatment and disease management.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 Members of the CFTR bicarbonate-defective genetic variants (CFTRBD ) include R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N [23ߦߦ, 25]. Login to comment

[hide] Mechanisms of CFTR functional variants that impair... PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul. LaRusch J, Jung J, General IJ, Lewis MD, Park HW, Brand RE, Gelrud A, Anderson MA, Banks PA, Conwell D, Lawrence C, Romagnuolo J, Baillie J, Alkaade S, Cote G, Gardner TB, Amann ST, Slivka A, Sandhu B, Aloe A, Kienholz ML, Yadav D, Barmada MM, Bahar I, Lee MG, Whitcomb DC
Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.
PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul., [PMID:25033378]

Abstract [show]
CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Login to comment
62 Of 43 CFTR variants identified in the NAPS2 cohort (Table 1), nine not associated with typical CF but reported in patients with pancreatitis[25-29] were of particular interest: R74Q, R75Q, R117H (CFTRm-v only when in cis with IVS8-T5[30]; R117H*T5), R170H, L967S, L997F, D1152H, S1235R, and D1270N. Login to comment
79 Furthermore, all CFTRBD candidate variants lowered bicarbonate conductance (GHCO3/ GCl), which is an important metric determining apical bicarbonate efflux in CFTR-expressing epithelia (Figure 1f); the decrease was statistically significant for all variants except D1270N. Login to comment
95 CFTR variant %Cases %Uctrls OR p-value %Cases w/N34S OR w/N34S p-value w/N34S CF/BD or BD/BD 2.5 0.1 31.9 ,0.0001 5.5 7.46 0.12 All CF 8.7 3.3 2.76 ,0.0001 16.4 5.65 ,0.0001 F508del CF 6.9 3.1 2.32 ,0.0001 14.5 5.13 ,0.0001 IVS8T5** CF 9.9 8.2 1.24 0.079 10.9 1.37 0.47 2789+5G.A CF 0.3 0.0 0.028 0.0 3849+10kbC.T CF 0.3 0.0 0.028 0.0 N1303K CF 0.3 0.0 0.027 0.0 621+1G.T CF 0.1 0.0 0.13 1.8 ,0.0001 2184delA CF 0.1 0.0 0.13 0.0 3120+1G.A CF 0.1 0.0 0.13 0.0 G551D CF 0.2 0.1 2.50 0.20 0.0 0.00 0.83 W1282X CF 0.2 0.1 2.50 0.20 0.0 0.00 0.83 G542X CF 0.2 0.0 0.059 0.0 R1162X CF 0.1 0.0 0.13 0.0 2183AA.G CF 0.0 0.1 0.17 0.0 0.00 0.83 All BD 14.2 9.8 1.50 0.002 25.5 4.63 ,0.0001 R75Q BD 6.3 6.2 1.02 0.30 16.4 2.97 0.003 S1235R BD 2.4 1.4 1.69 0.052 1.8 1.30 0.80 R117H CF/BD 2.3 0.7 3.49 0.0007 5.5 8.74 0.0002 L967S BD 1.1 0.2 6.87 0.002 1.8 11.17 0.014 L997F BD 0.8 1.0 0.82 0.26 1.8 1.84 0.55 D1152H BD 0.4 0.0 0.014 0.0 D1270N BD 0.3 0.2 1.25 0.29 0.0 0.00 0.71 R170H BD 0.3 0.0 0.028 0.0 R74Q BD 0.3 0.1 3.02 0.17 1.8 21.15 0.002 Other M470V 76.1 74.2 1.11 0.14 70.9 0.85 0.59 T854T 57.3 57.8 0.98 0.29 45.5 0.61 0.071 Q1463Q 39.6 39.5 1.01 0.30 40.0 1.02 0.94 1001+11C.T* 13.4 10.9 1.27 0.016 14.5 1.40 0.42 125G.C 10.3 9.7 1.07 0.26 12.7 1.36 0.45 P1290P 7.6 7.9 0.95 0.28 7.3 0.91 0.86 1716G.A 4.5 4.1 1.10 0.26 1.8 0.43 0.39 R668C 1.0 1.4 0.72 0.19 0.0 0.00 0.38 G576A 0.7 1.2 0.58 0.11 0.0 0.00 0.41 computationally modeled the molecular structure, and studied the dynamics, of wild type (WT) and mutated CFTR channels. Login to comment
205 Two variants (S1235 and D1270N) were on the surface of NBD2 (Figure 2). Login to comment
208 D1270N is of varying clinical consequences for CF, with low rates of pancreatic insufficiency and retention of chloride conductance [54]. Login to comment
209 D1270N was identified both in the cases (0.3%) and controls (0.2%). Login to comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Both methods used 5 &#b5;l of isolated DNA for the NGS assay. NGS assay for detection of CFTR mutations/variants CFTR mutations are described using both the international nomenclature of the Human Genome Variation Society Mutations that have varying consequences c.3454G>C (D1152H) c.3154T>G (F1052V) c.3208C>T (R1070W) c.2930C>T (S977F) - c.3808G>A (D1270N) c.3205G>A (G1069R) c.350G>A (R117H) PolyTG/ polyT - c.1736A>G (D579G) c.3209G>A (R1070Q) c.220C>T (R74W) - - Mutations still under evaluation c.2657ߙ+ߙ2_2657ߙ+ߙ3insA (2789ߙ+ߙ2insA) c.680T>G (L227R) c.1705T>G (Y569D) - - c.1841A>G (D614G) c.1673T>C (L558S) - - - c.3700A>G (I1234V) c. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
365 [Arg74Trp;Val201Met;Asp1270Asn] D1270N varying clinical consequence [359insT;(TG)12T5] c. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 [Gln359Lys; Thr360Lys] L558S c.1673 T4C p.Leu558Ser Y569D c.1705 T4G p.Tyr569Asp D579G c.1736 A4G p.Asp579Gly D614G c.1841 A4G p.Asp614Gly S977F c.2930C4T p.Ser977Phe F1052V c.3154 T4G p.Phe1052Val G1069R c.3205G4A p.Gly1069Arg R1070Q c.3209G4A p.Arg1070Gln D1152H c.3454G4C p.Asp1152His I1234V c.3700 A4G p.Ile1234Val 5T c.1210 - 12[5] Examples of common not CF-causing variantsc R31C c.91C4T p.Arg31Cys R74W c.220C4T p.Arg74Trp R75Q c.224G4A p.Arg75Gln I148T c.443 T4C p.Ile148Thr M470V c.1408 A4G p.Met470Val G576A c.1727G4C p.Gly576Ala R668C c.2002C4T p.Arg668Cys V754M c.2260G4A p.Val754Met L997F c.2991G4C p.Leu997Phe I1027T c.3080 T4C p.Ile1027Thr R1070W c.3208C4T p.Arg1070Trp R1162L c.3485G4T p.Arg1162Leu Table 1 (Continued) HGVS nomenclature Legacy name cDNA nucleotide name Protein name S1235R c.3705 T4G p.Ser1235Arg D1270N c.3808G4A p.Asp1270Asn 7T c.1210-12[7] Abbreviation: HGVS, Human Genome Variation Society. Login to comment
99 Missense variants R74W, R1070W, D1270N are classified as 'indeterminate` by Sosnay et al.,17 however, as they are frequently found in trans with a severe CF variant in asymptomatic individuals (including fertile fathers), they may not be sufficient to cause disease.19 Moreover, they are often associated within the same allele (eg in cis), forming various combinations ('complex alleles`) depending on individuals, so that their disease liability is questionable. Login to comment
104 I1027T is usually found in cis with F508del: Notes: (i) Some missense variants classified as either indeterminate or non CF-causing (R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R and D1270N) can selectively alter the bicarbonate permeation of the CFTR channel (but not the chloride channel), thus affecting primarily the organs that utilize CFTR for bicarbonate secretion (pancreas, nasal sinus, or vas deferens) and, consequently, they could be involved in the pathogenic mechanisms of CFTR-RDs.14 (ii) In Table 1, the traditional name of common CFTR variants is referenced alongside the HGVS version in order to ensure compatibility with clinical reports and understanding by clinicians and couples. Login to comment
211 Nat Genet 2013; 45: 1160-1167. 18 Thauvin-Robinet C, Munck A, Huet F et al: The very low penetrance of cystic fibrosis for the R117H mutation: a reappraisal for genetic counselling and newborn screening. J Med Genet 2009; 46: 752-758. 19 Claustres M, Altieri JP, Guittard C, Templin C, Chevalier-Ports F, Des Georges M: Are p.148 T, p.R74W and p.D1270N CF causing mutations? Login to comment

[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]

Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented. Login to comment

[hide] [Male infertility caused by bilateral agenesis of ... Rev Med Interne. 1997;18(2):114-8. Durieu I, Bey-Omar F, Rollet J, Boggio D, Bellon G, Morel Y, Vital Durand D
[Male infertility caused by bilateral agenesis of the vas deferens: a new clinical form of cystic fibrosis?].
Rev Med Interne. 1997;18(2):114-8., [PMID:9092029]

Abstract [show]
Congenital bilateral absence of vas deferens causes male excretory infertility and represents 1 to 2% of male infertility. Because of a genotypic similarity with cystic fibrosis, the possible in vitro fertilization with epididymal sperm requires careful genetic counselling. We studied genotype, sweat chloride concentration, respiratory function tests, sinus abnormalities, pancreatic and hepatic functions in 22 subjects with congenital bilateral absence of vas deferens. Among them, four were compound heterozygotus, all of them with the R117H mutation. Ten had a positive sweat test, one of them also being compound heterozygotus. Congenital bilateral absence of vas deferens and double mutation or positive sweat test led to high probable cystic fibrosis diagnosis in 13 subjects. Six subjects were heterozygotus for one cystic fibrosis mutation, criterium which is not sufficient for cystic fibrosis diagnosis; five of them had sinus abnormalities, present in 11 of the 22 subjects. Only three patients had no mutation nor sweat chloride abnormalities. This work confirms the high frequency of cystic fibrosis mutations in males with congenital bilateral absence of vas deferens, with a higher frequency of positive sweat test than in other publications, and a high frequency of sinus abnormalities. This monosymptomatic phenotype of cystic fibrosis suggests new hypotheses for a relationship between genotype and phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Vingt-deux mutations du gene CFTR ont Cte recher- chtes : les cinq plus frequentes (AF508, G542X, N1303K, 1717-G--A, G85E) et les 17 suivantes : R117H, 556delA, R334W, R347H, R347P, S549N, S5491, S549R, G551D, R553X,R560T,G1244E3,S1255X,W1282X,R1283K,3898 ins C, D1270N. Login to comment
55 Quatorze sujetsCtaienth&&o- zygotespourlesmutationsAF508 (12), G542X (un) et D1270N (un). Login to comment