ABCMdb

ABCC7 p.Leu206Trp

Admin's notes:	Class II-III (maturation defect, gating defect) Veit et al.
ClinVar:	c.617T>G , p.Leu206Trp D , Pathogenic c.618G>T , p.Leu206Phe ? , not provided
CF databases:	c.617T>G , p.Leu206Trp D , CF-causing ; CFTR1: This mutation was identified in two unrelated CF patient from Southern France. c.618G>T , p.Leu206Phe (CFTR1) ? , We would like to report a novel mutation we have identified by DGGE and direct sequencing.
Predicted by SNAP2:	A: D (95%), C: D (91%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (91%), K: D (95%), M: D (91%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: D (85%), W: D (71%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: N, G: D, H: D, I: N, K: D, M: N, N: D, P: D, Q: D, R: D, S: D, T: D, V: N, W: D, Y: N,

[switch to compact view]
Comments [show]

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Blood immunoreactive trypsinogen concentrations ar... Acta Paediatr. 1999 Mar;88(3):338-41. Lecoq I, Brouard J, Laroche D, Ferec C, Travert G
Blood immunoreactive trypsinogen concentrations are genetically determined in healthy and cystic fibrosis newborns.
Acta Paediatr. 1999 Mar;88(3):338-41., [PMID:10229049]

Abstract [show]
Newborns with cystic fibrosis (CF) have increased blood immunoreactive trypsinogen concentrations. When screening for CF in the newborn by immunoreactive trypsinogen measurement, an abnormally high proportion of healthy deltaF508 carriers is found among false-positive neonates, suggesting that a relationship could exist between immunoreactive trypsinogen concentration at birth and the genetic status. Therefore, this study analysed the possible relationships between neonatal blood immunoreactive trypsinogen concentrations and genotype in 1842 healthy newborns and 111 CF patients detected by a neonatal screening programme. A close correlation was found between immunoreactive trypsinogen and deltaF508: the probability of a healthy newborn being a carrier of this mutation increased regularly with the neonatal immunoreactive trypsinogen concentration. In CF patients, there was a significant difference between deltaF508 homozygotes and deltaF508/X (X = other mutation) compound heterozygotes with respect to the mean neonatal blood immunoreactive trypsinogen concentration. CF neonates with two mutations affecting the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator protein had significantly higher mean immunoreactive trypsinogen concentrations than patients with one mutation affecting a membrane-spanning domain. The data strongly suggest that the neonatal immunoreactive trypsinogen concentration is, in part, genetically determined, with a wide range of variations, similar to the features which have been shown for the relations between the genotype and clinical phenotypes of CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Twins or unrelated patients with identical genotype had very similar neonatal IRT concentrations: DF508/I148T (twins), 1040 and 1055 mg LÀ1 ; N1303K/G149R (twins), 1600 and 1725 mg LÀ1 ; DF508/E585X, 900 and 945 mg LÀ1 ; DF508/ G542X, 1535 and 1660 mg LÀ1 ; DF508/L206W, 980, 1090 and 1100 mg LÀ1 . Login to comment
72 In this study, CF newborns with one mutation in an exon encoding for either NBD1 or NBD2 (DF508, G542X, G551D, E585X, N1303K, etc.) and the other affecting one of the MSD (R117H, 574delA, I148T, G149R, L206W, etc.) had significantly lower IRT concentrations than CF neonates with both mutations located in NBD. Login to comment

[hide] Proportion of cystic fibrosis gene mutations not d... JAMA. 1999 Jun 16;281(23):2217-24. Mak V, Zielenski J, Tsui LC, Durie P, Zini A, Martin S, Longley TB, Jarvi KA
Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia.
JAMA. 1999 Jun 16;281(23):2217-24., 1999-06-16 [PMID:10376575]

Abstract [show]
CONTEXT: Infertile men with obstructive azoospermia may have mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, many of which are rare in classic cystic fibrosis and not evaluated in most routine mutation screening. OBJECTIVE: To assess how often CFTR mutations or sequence alterations undetected by routine screening are detected with more extensive screening in obstructive azoospermia. DESIGN: Routine screening for the 31 most common CFTR mutations associated with the CF phenotype in white populations, testing for the 5-thymidine variant of the polythymidine tract of intron 8 (IVS8-5T) by allele-specific oligonucleotide hybridization, and screening of all exons through multiplex heteroduplex shift analysis followed by direct DNA sequencing. SETTING: Male infertility clinic of a Canadian university-affiliated hospital. SUBJECTS: Of 198 men with obstructive (n = 149) or nonobstructive (n = 49; control group) azoospermia, 64 had congenital bilateral absence of the vas deferens (CBAVD), 10 had congenital unilateral absence of the vas deferens (CUAVD), and 75 had epididymal obstruction (56/75 were idiopathic). MAIN OUTCOME MEASURE: Frequency of mutations found by routine and nonroutine tests in men with obstructive vs nonobstructive azoospermia. RESULTS: Frequency of mutations and the IVS8-5T variant in the nonobstructive azoospermia group (controls) (2% and 5.1% allele frequency, respectively) did not differ significantly from that in the general population (2% and 5.2%, respectively). In the CBAVD group, 72 mutations were found by DNA sequencing and IVS8-5T testing (47 and 25, respectively; P<.001 and P = .002 vs controls) vs 39 by the routine panel (P<.001 vs controls). In the idiopathic epididymal obstruction group, 24 mutations were found by DNA sequencing and IVS8-5T testing (12 each; P=.01 and P=.14 vs controls) vs 5 by the routine panel (P=.33 vs controls). In the CUAVD group, 2 mutations were found by routine testing (P=.07 vs controls) vs 4 (2 each, respectively; P=.07 and P=.40 vs controls) by DNA sequencing and IVS8-5T testing. The routine panel did not identify 33 (46%) of 72, 2 (50%) of 4, and 19 (79%) of 24 detectable CFTR mutations and IVS8-5T in the CBAVD, CUAVD, and idiopathic epididymal obstruction groups, respectively. CONCLUSIONS: Routine testing for CFTR mutations may miss mild or rare gene alterations. The barrier to conception for men with obstructive infertility has been overcome by assisted reproductive technologies, thus raising the concern of iatrogenically transmitting pathogenic CFTR mutations to the progeny.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 (%) Men With 2 Mutations ⌬F508/IVS8-5T 7 (11) ⌬F508/IVS8-5T 1 (10) ⌬F508/IVS8-5T 1 (1.8) ⌬F508/R117H 6 (9) W1282X/IVS8-5T 1 (1.8) ⌬F508/L206W 1 (1.6) G544S/IVS8-5T 1 (1.8) ⌬F508/M952T 1 (1.6) V754M/-741T→G 1 (1.8) ⌬F508/P67L 1 (1.6) R75Q/R258G 1 (1.8) ⌬F508/S549R 1 (1.6) R334W/R334W 1 (1.6) R117H/R117H 1 (1.6) R117H/IVS8-5T 1 (1.6) R347P/IVS8-5T 1 (1.6) N1303K/IVS8-5T 1 (1.6) 1677delTA/IVS8-5T 1 (1.6) R117L/IVS8-5T 1 (1.6) D979A/IVS8-5T 1 (1.6) IVS8-5T/IVS8-5T 1 (1.6) Men With 1 Mutation IVS8-5T/N 10 (16) ⌬F508/N 1 (10) IVS8-5T/N 9 (16) ⌬F508/N 1 (2) ⌬F508/N 6 (9) IVS8-5T/N 1 (10) ⌬F508/N 1 (1.8) G542X/N 1 (2) W1282X/N 2 (3) R75Q/N 1 (1.8) IVS8-5T/N 5 (10) L206W/N 1 (1.6) W1282X/N 1 (1.8) 4016insT/N 1 (1.6) R117H/N 1 (1.8) 2423delG/N 1 (1.8) Men With No Mutations 18 (28) 7 (70) 37 (66) 42 (86) *N indicates that no CFTR mutations or variants were detected. Login to comment
50 Of the 8 additional CFTR gene sequence alterations detected using extensive CFTR exon screening, 5 have been described rarely in the CF population (L206W [identified in 2 subjects], P67L, 1677delTA, R117L, and 4016insT).60 One mutation, D979A, was previously identified in a Vietnamese CBAVD patient.60 Interestingly, our CBAVD subject with D979A (also a carrier of IVS8-5T) was of Vietnamese descent as well. Login to comment
58 (%) 31 Mutation panel† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1 (1) R117H 9 (7) W1282X 2 (1.8) G542X 1 (1) W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) Extensive screen† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1Mutations included in R117H 9 (7) W1282X 2 (1.8) G542X 131 mutation panel W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) L206W 2 (1.6)‡ R75Q 2 (1.8)‡Mutations not included in P67L 1 (0.8)‡ G544S 1 (0.9)‡31 mutation panel 1677delTA 1 (0.8)‡ 2423delG 1 (0.9)‡ R117L 1 (0.8)‡ V754M 1 (0.9)‡ 4016insT 1 (0.8)‡ -741T→G 1 (0.9)‡ D979A 1 (0.8)§ R258G 1 (0.9)§ M952T 1 (0.8)¶ IVS8-5T 25 (20)# 2 (10) 12 (11) 5 (5) Detectable mutations 72 (56)# 4 (20) 24 (21)# 7 (7) Detectable mutations missed by 31 mutation panel 33 (46) 2 (50) 19 (79) Detectable non-IVS8-5T mutations missed by 31 mutation panel 8 (17) 0 (0) 7 (58) *Percentages indicate allele frequency. Login to comment
85 These mild CFTR gene mutations are associated with pancreatic sufficiency and tend to be class 4 through 5 mutations: R117H, R334W, R347P, L206W,andP67L.Thethirdgroupcon- sists of mutations identified exclusively in some men with obstructive azoospermia; however, because these sequencealterationsareextremelyrare, it is only speculated that they contribute to this phenotype.7,10,12 These CFTR genesequencechangesincludeD979A, R258G, and M952T. Login to comment

[hide] Molecular analysis in Brazilian cystic fibrosis pa... Genet Test. 2000;4(1):69-74. Bernardino AL, Ferri A, Passos-Bueno MR, Kim CE, Nakaie CM, Gomes CE, Damaceno N, Zatz M
Molecular analysis in Brazilian cystic fibrosis patients reveals five novel mutations.
Genet Test. 2000;4(1):69-74., [PMID:10794365]

Abstract [show]
We have performed molecular genetic analyses on 160 Brazilian patients diagnosed with cystic fibrosis (CF). Screening of mutations in 320 CF chromosomes was performed through single strand conformation polymorphism (SSCP) and heteroduplex analyses assay followed by DNA sequencing of the 27 exons and exon/intron boundaries of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The frequency of CFTR variants of T-tract length of intron 8 (IVS8 Tn) was also investigated. This analysis enabled the detection of 232/320 CF mutations (72.2%) and complete genotyping of 61% of the patients. The deltaF508 mutation was found in 48.4% of the alleles. Another fifteen mutations (previously reported) were detected: G542X, R1162X, N1303K, R334W, W1282X, G58E, L206W, R553X, 621+1G-->T, V232D, 1717-1G-->A, 2347 delG, R851L, 2789+5G-->A, and W1089X. Five novel mutations were identified, V201M (exon 6a), Y275X (exon 6b), 2686 insT (exon 14a), 3171 delC (exon 17a), and 3617 delGA (exon 19). These results contribute to the molecular characterization of CF in the Brazilian population. In addition, the identification of the novel mutation Y275X allowed prenatal diagnosis in a high-risk fetus.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Another fifteen mutations (previously reported) were detected: G542X, R1162X, N1303K, R334W, W1282X, G58E, L206W, R553X, 6211 1GRT, V232D, 1717-1GRA, 2347 delG, R851L, 27891 5GRA, and W1089X. Login to comment
51 The next most common mutations were: G542X (8.8%), R1162X (2.5%), N1303K (2.5%), R334W (2.5%), W1282X (1.3%), G58E (1.3%), L206W (0.6%), and R553X (0.6%). Login to comment
81 In this study, 16 mutations were identified: D F508, G542X, R1162X, N1303K, R334W, W1282X, G58E, L206W, R553X, 6211 1GRT, V232D, 1717-1GRA, 2347 delG, R851L, 27891 5GRA, and W1089X. Login to comment
84 GEN OTYPES, FREQUENCIES, AN D PRESENCE OF PI FRO M 160 CF PATIE NTS (320 CF CHROM OSOM ES) Number and frequency (%) Genotype Number Frequency (%) of patients with PI D F508/D F508 47 29.40 47 (100%) D F508/G542X 13 8.10 13 (100%) D F508/R1162X 6 3.80 6 (100%) D F508/R334W 5 3.10 3 (60%) D F508/N1303K 3 1.90 3 (100%) D F508/W1282X 2 1.20 2 (100%) D F508/G58E 2 1.20 1 (50%) D F508/L206W 1 0.62 0 D F508/R553X 1 0.62 1 (100%) D F508/R851L 1 0.62 0 D F508/2789 1 5g ® A 1 0.62 0 D F508/3617delGA 1 0.62 1 (100%) D F508/3171delC 1 0.62 1 (100%) D F508/2686insT 1 0.62 1 (100%) D F508/Y275X 1 0.62 1 (100%) D F508/U 22 13.80 14 (64%) G542X/G542X 3 1.90 3 (100%) G542X/N1303K 3 1.90 2 (67%) G542X/R1162X 1 0.62 1 (100%) G542X/U 5 3.10 4 (80%) N1303K/R1162X 1 0.62 1 (100%) N1303K/G58E 1 0.62 0 2347delG/2347delG 1 0.62 1 (100%) R334W/V232D 1 0.62 0 R334W/W1089X 1 0.62 1 (100%) R334W/U 1 0.62 1 (100%) W1282X/U 1 0.62 1 (100%) G58E/U 1 0.62 1 (100%) R553X/U 1 0.62 1 (100%) L206W/U 1 0.62 0 621 1 1G ® T/U 1 0.62 1 (100%) 1717-1G ® A/U 1 0.62 Not known V201M/U 1 0.62 0 U/U 27 16.90 12 (44%) Total 160 100 - U, Unknown CF mutation. Login to comment

[hide] Heterogeneity for mutations in the CFTR gene and c... Hum Reprod. 2000 Jul;15(7):1476-83. Casals T, Bassas L, Egozcue S, Ramos MD, Gimenez J, Segura A, Garcia F, Carrera M, Larriba S, Sarquella J, Estivill X
Heterogeneity for mutations in the CFTR gene and clinical correlations in patients with congenital absence of the vas deferens.
Hum Reprod. 2000 Jul;15(7):1476-83., [PMID:10875853]

Abstract [show]
Congenital absence of the vas deferens (CAVD) is a heterogeneous disorder, largely due to mutations in the cystic fibrosis (CFTR) gene. Patients with unilateral absence of the vas deferens (CUAVD) and patients with CAVD in association with renal agenesis appear to have a different aetiology to those with isolated CAVD. We have studied 134 Spanish CAVD patients [110 congenital bilateral absence of the vas deferens (CBAVD) and 24 CUAVD], 16 of whom (six CBAVD, 10 CUAVD) had additional renal anomalies. Forty-two different CFTR mutations were identified, seven of them being novel. Some 45% of the CFTR mutations were specific to CAVD, and were not found in patients with cystic fibrosis or in the general Spanish population. CFTR mutations were detected in 85% of CBAVD patients and in 38% of those with CUAVD. Among those patients with renal anomalies, 31% carried one CFTR mutation. Anomalies in seminal vesicles and ejaculatory ducts were common in patients with CAVD. The prevalence of cryptorchidism and inguinal hernia appeared to be increased in CAVD patients, as well as nasal pathology and frequent respiratory infections. This study confirms the molecular heterogeneity of CFTR mutations in CAVD, and emphasizes the importance of an extensive CFTR analysis in these patients. In contrast with previous studies, this report suggests that CFTR might have a role in urogenital anomalies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 In contrast, mutations L206W and R117H, Molecular analysis of the CFTR gene was performed in all 134 each causing a mild CF phenotype (Dean et al., 1990; patients. Login to comment
62 Recently, direct analysis of 31 CFTR mutations (PCR/OLA Cystic Fibrosis Assay; Perkin Elmer, Foster City) was 6(5T), ∆F508, G542X, L206W and R117H are the most performed in 30 of these infertile men. Login to comment
71 Six polymorphisms: 125G/C, 1525-61A/G, L206W 9 (6) 0 9 (5) 1898ϩ152T/A, 1716G/A, G576A and 875ϩ40A/G presented R117H 8 (5) 0 8 (5) frequencies of between 2.5% and 4.0%. Login to comment
95 CFTR genotypes in 24 patients with congenital unilateral absenceTable III. CFTR genotypes in 110 patients with congenital bilateral absence of the vas deferens of the vas deferens Mutations IVS8-6(T) n (%)Mutations IVS8-6(T) n (%) Two CFTR mutations 62 (56) Two CFTR mutations 5 (21) ∆F508/- 5T/9T 2 (8)∆F508/- 5T/9T 17 (15) G542X/- 5T/9T 6 (5) G542X/- 5T/9T 1 3732delA/- 5T/7T 1∆F508/L206W 9T/9T 6 (5) ∆F508/D1270NϩR74W 7T/9T 3 (3) L383S/- 5T/7T 1 One CFTR mutation 4 (17)∆F508/R117H 7T/7T 1 ∆F508/P1021S 7T/9T 1 ∆F508/-a 7T/9T 1 3732delA/-a 7T/7T 1∆F508/M952T 7T/9T 1 ∆F508/D110Y 7T/9T 1 Q890R/- 7T/7T 1 -/-a 5T/7T 1∆F508/S50P 5T/9T 1 ∆F508/2751ϩ3A→G 5T/9T 1 Negative CFTR mutations 15 (62) -/- 7T/7T 10 (42)G542X/R117H 7T/9T 1 G542X/2789ϩ5G→A 7T/9T 1 -/- 7T/9T 3 (12) -/- 9T/9T 2 (8)R117H/2789ϩ5G→A 7T/7T 1 R117H/712-1G→T 7T/9T 1 R117H/∆I507 7T/7T 1 aThree carrier patients with renal agenesis. Login to comment
96 L206W/- 5T/9T 1 L206W/3121-1G→A 7T/9T 1 L206W/1949del84 7T/9T 1 transrectal ultrasonography was significantly smaller in∆E115/S50P 7T/7T 1 2869insG/R1070W 7T/7T 1 CBAVD than in CUAVD (F ϭ 8.1, P ϭ 0.005). Login to comment
201 Desgeorges, M., Dodier, M., Piot, M. et al. (1995) Four adult patients with the missense mutation L206W and a mild cystic fibrosis phenotype. Login to comment

[hide] Distribution of CFTR gene mutations in cystic fibr... J Med Genet. 2000 Aug;37(8):E16. Teder M, Klaassen T, Oitmaa E, Kaasik K, Metspalu A
Distribution of CFTR gene mutations in cystic fibrosis patients from Estonia.
J Med Genet. 2000 Aug;37(8):E16., [PMID:10922396]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 First, several known mutations were tested directly by the heteroduplex analysis (HA; F508, 394delTT, polyT variants in IVS8), restriction digestion (RD; G551D, R553X, 1811+1.6kbA→G, L206W, 3849+10kbC→T), and amplification refractory mutation system (ARMS, kits from Cellmark Diagnostics, UK; G542X, 621+1G→T, N1303K). Login to comment

[hide] Gastrointestinal, liver, and pancreatic involvemen... Pancreas. 2001 May;22(4):395-9. Modolell I, Alvarez A, Guarner L, De Gracia J, Malagelada JR
Gastrointestinal, liver, and pancreatic involvement in adult patients with cystic fibrosis.
Pancreas. 2001 May;22(4):395-9., [PMID:11345141]

Abstract [show]
BACKGROUND: The clinical prevalence of cystic fibrosis (CF) in adults continues to rise, with a consequent impact on adult gastroenterology practice. AIM: To characterize the gastrointestinal manifestations of CF in adult patients. PATIENTS AND METHODS: The clinical records of 89 adult CF patients treated at our institution from 1992 to 1999 were reviewed. Patients were distributed into two groups: group A (39 patients), which consisted of patients who were diagnosed with CF at when they were younger than 14 years old and who survived into adulthood; and group B (50 patients), who were diagnosed with CF at the age of 14 years or older. Data on CF genetic mutations, nutritional state, evidence of pulmonary, gastrointestinal, liver, or pancreatic involvement were collected for each patient. RESULTS: The most prevalent genetic mutation in our series was deltaF508, present in 50 patients (56.2%), 29 of whom belonged to group A and 21 who belonged to group B. In group A, the deltaF508 mutation was associated with exocrine pancreatic insufficiency (PI) in 26 of 29 patients (89.6%), whereas in group B it was associated with PI in only four patients (19%). Overall, PI was present in 33 of 39 patients (84.6%) in group A and in eight of 50 patients (16%) in group B. Four patients in group B had experienced previous episodes of acute pancreatitis; two of them had associated PI. Of the 89 patients, 12 (10 in group A) were malnourished. Malnutrition was invariably associated with PI. Hepatic and biliary tree abnormalities were particularly prevalent in patients in group A and was usually associated with PI. Intestinal manifestations were uncommon. CONCLUSIONS: Diagnosis of CF before the age of 14 years is associated with greater gastrointestinal compromise than diagnosis at an older age, particularly with regard to PI. CF carriers of the deltaF508 mutation have an increased risk of developing gastrointestinal manifestations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Mutations L206W and 2789+5G>A were identified in five patients each. Login to comment
50 In the remaining 14 patients, ⌬F508 was carried with G542X, R1162X, N1303K, L206W, 1717-1G>A, 711+1G>T, or an unidentified mutation. Login to comment
54 ⌬F508 was present in only 21 of the 50 patients and was in heterozygosis in all cases, carried together with L206W, 2789+5G>A, 3272-26A>G, R117H, 5T, R334W, or an unidentified mutation. Login to comment
56 5T, G542X, R334W, N1303K, L206W, 3659-C, and G85E were identified in the remaining nine patients. Login to comment
64 Other genotypes present in our series ⌬F508/711+1G>T 2A 5T/5T 1B ⌬F508/5T 2B ⌬1507/- 1A ⌬F508/R117H 2B R1162X/1898+1G>A 1A ⌬F508/R1162X 1A 2183A/- 1A ⌬F508/N1303K 1A 1609-CA/1811+1.6kbA>G 1A ⌬F508/3272-26A>G 1B 1609-CA/R347P 1A ⌬F508/D836Y 1B Q890X/- 1A ⌬F508/1717-1G>A 1A R334W/- 1B G542X/W1282X 1A N1303K/2789+5G>A 1B G542X/2789+5G>A 1B 3659-C/- 1B G542X/P205S 1B G85E/- 1B G542X/D1270N 1B Negative 1A, 20B L206W/- 1B Unknown 2A creatic insufficiency was highly prevalent, affecting 33 patients (84.6%). Login to comment
137 Interestingly, of the eight group B pancreatic-insufficient patients, four were carriers of ⌬F508, in three cases with known mutations: 2789+5G>A and L206W; another patient was 5T homozygote. Login to comment

[hide] Adenosine triphosphate-binding cassette superfamil... Biol Reprod. 2001 Aug;65(2):394-400. Larriba S, Bassas L, Egozcue S, Gimenez J, Ramos MD, Briceno O, Estivill X, Casals T
Adenosine triphosphate-binding cassette superfamily transporter gene expression in severe male infertility.
Biol Reprod. 2001 Aug;65(2):394-400., [PMID:11466205]

Abstract [show]
Cystic fibrosis transmembrane regulator (CFTR), multidrug-resistant (MDR)1, and multidrug resistance-associated (MRP) proteins belong to the ATP-binding cassette (ABC) transporter superfamily. A compensatory regulation of MDR1 and CFTR gene expression has been observed in CFTR knockout rodent intestine and in an epithelial cell line of human colon, whereas a high homology and similar anion binding site are shared by MRP and CFTR proteins. To provide better insight into the relationship among the expression behavior in vivo of the three genes in human testis, analysis of MDR1 and MRP gene expression in testicular biopsies was performed and related to the presence of CFTR gene mutations in congenital absence of the vas deferens (CAVD: n = 20) and non-CAVD (n = 30) infertile patients with azoospermia or severe oligozoospermia. A CFTR mutation analysis performed in both groups of patients supported the involvement of CFTR gene mutations in CAVD phenotype (85%) and in defective spermatogenesis (19%). Quantitative reverse transcription-polymerase chain reaction analysis of testicular tissue showed a CFTR-independent MDR1 and MRP gene expression in human testis, suggesting that the mechanisms underlying CFTR gene regulation in testis are different from those in intestine. These findings should contribute to the understanding of patterns of in vivo expression of CFTR, MDR1, and MRP genes in CFTR-related infertility.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Phenotypical and genotypical description of CAVD and non-CAVD infertile patients.a No. patient Phenotype FSH (U/L) Non-CFTR infertility-associated factors Testicular biopsy CFTR mutation M470V polymorphism CAVD infertility 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CUAVD CUAVD CUAVD CUAVD 3.1 7.3 3.1 2.4 1.9 3.5 5.7 4.3 3.6 ND 2.2 4.8 11.3 2.1 ND 7.6 5.3 6.5 3.9 21.4 None None None None None None None None None None None None None None None None None None None Yes 1 Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes V232D/V232D F508del/R117H F508del/R117H G542X/2789ϩ5GϾA F508del/D1270N ϩ R74W F508del/D1270N ϩ R74W S945L/R258G F508del/5T F508del/5T L206W/5T R117H/N F508del/N Y1014C/N 5T/N N/N N/N Y1092X/R258G 621ϩ1GϾT/5T Q890R/N N/N M/M M/M M/M M/M M/V M/V M/V M/M M/V M/V M/V M/V M/V M/V M/M V/V V/V M/V V/V M/M Non-CAVD infertility 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SA) TF (SA) TF (SSO) OA OA OA OA OA OA OA OA 42.0 15.9 34.8 8.9 26.3 6.4 7.8 15.6 8.7 3.2 3.9 12.6 4.7 1.3 5.6 3.9 6.1 9.3 8.8 19.3 9.6 ND 3.3 5.9 6.6 3.6 1.9 4.2 2.0 4.4 None None None None None None None None None None None None None None None None Yes 2 Yes 2 Yes 2, 3 Yes 4 Yes 5 Yes 6 None None None None None Yes 1 Yes 7 Yes 8 Yes Yes Yes Yes No Yes Yes Yes Yes Yes Yes Yes Yes No No No No No No Yes Yes Yes Yes Yes Yes Yes No Yes Yes Yes F508del/N R334W/N N/N N/N N/N N/N N/N N/N N/N R75Q/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N 5T/5T N/N N/N N/N N/N N/N N/N N/N M/M V/V M/V M/V M/V M/V V/V V/V V/V V/V M/V M/V M/V ND V/V M/M M/V M/M M/V M/M M/V V/V M/V M/V M/V V/V V/V M/V M/V V/V a CFTR mutations and M470V allele are also described for each patient. Login to comment
94 CFTR Analysis We have identified 14 different CFTR mutations (R117H, L206W, V232D, R258G, F508del, G542X, 621ϩ1GϾT, Q890R, S945L, Y1014C, Y1092X, D1270N, 2789ϩ5GϾA, IVS8-6[5T]) in 17 of 20 patients of the CAVD group, giving a CFTR mutation frequency of 85%. Login to comment

[hide] Human genetics: lessons from Quebec populations. Annu Rev Genomics Hum Genet. 2001;2:69-101. Scriver CR
Human genetics: lessons from Quebec populations.
Annu Rev Genomics Hum Genet. 2001;2:69-101., [PMID:11701644]

Abstract [show]
The population of Quebec, Canada (7.3 million) contains approximately 6 million French Canadians; they are the descendants of approximately 8500 permanent French settlers who colonized Nouvelle France between 1608 and 1759. Their well-documented settlements, internal migrations, and natural increase over four centuries in relative isolation (geographic, linguistic, etc.) contain important evidence of social transmission of demographic behavior that contributed to effective family size and population structure. This history is reflected in at least 22 Mendelian diseases, occurring at unusually high prevalence in its subpopulations. Immigration of non-French persons during the past 250 years has given the Quebec population further inhomogeneity, which is apparent in allelic diversity at various loci. The histories of Quebec's subpopulations are, to a great extent, the histories of their alleles. Rare pathogenic alleles with high penetrance and associated haplotypes at 10 loci (CFTR, FAH, HBB, HEXA, LDLR, LPL, PAH, PABP2, PDDR, and SACS) are expressed in probands with cystic fibrosis, tyrosinemia, beta-thalassemia, Tay-Sachs, familial hypercholesterolemia, hyperchylomicronemia, PKU, oculopharyngeal muscular dystrophy, pseudo vitamin D deficiency rickets, and spastic ataxia of Charlevoix-Saguenay, respectively) reveal the interpopulation and intrapopulation genetic diversity of Quebec. Inbreeding does not explain the clustering and prevalence of these genetic diseases; genealogical reconstructions buttressed by molecular evidence point to founder effects and genetic drift in multiple instances. Genealogical estimates of historical meioses and analysis of linkage disequilibrium show that sectors of this young population are suitable for linkage disequilibrium mapping of rare alleles. How the population benefits from what is being learned about its structure and how its uniqueness could facilitate construction of a genomic map of linkage disequilibrium are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
236 The L206W allele (with a mild phenotypic effect) reflects a particular French Canadian heritage (142), whereas W1282X and G542X are prominent in Ashkenazi Jews (2, 145), which reflects corresponding twentieth century immigrations into Quebec. Login to comment
905 L206W mutation of the cystic fibrosis gene, relatively frequent in French Canadians, is associated with atypical presentations of cystic fibrosis. Login to comment

[hide] ATB(0)/SLC1A5 gene. Fine localisation and exclusio... Eur J Hum Genet. 2001 Nov;9(11):860-6. Larriba S, Sumoy L, Ramos MD, Gimenez J, Estivill X, Casals T, Nunes V
ATB(0)/SLC1A5 gene. Fine localisation and exclusion of association with the intestinal phenotype of cystic fibrosis.
Eur J Hum Genet. 2001 Nov;9(11):860-6., [PMID:11781704]

Abstract [show]
The Na+-dependent amino acid transporter named ATB(0) was previously found to be located in 19q13.3 by fluorescence in situ hybridisation. Genetic heterogeneity in the 19q13.2-13.4 region, syntenic to the Cystic Fibrosis Modulator Locus 1 (CFM1) in mouse, seemed to be associated to the intestinal phenotypic variation of cystic fibrosis (CF). We performed fine chromosomal mapping of ATB(0) on radiation hybrid (RH) panels G3 and TNG. Based on the most accurate location results from TNG-RH panel, mapping analysis evidenced that ATB(0) is localised between STS SHGC-13875 (D19S995) and STS SHGC-6138 in 19q13.3, that corresponds with the immediately telomeric/distal segment of the strongest linkage region within the human CFM1 (hCFM1) syntenic region. Regarding to the genomic structure and exon organisation, our results show that the ATB(0) gene is organised into eight exons. The knowledge of the genomic structure allowed us to perform an exhaustive mutational analysis of the gene. Evaluation of the possible implication of ATB(0) in the intestinal phenotype of CF was performed on the basis of the functional characteristics of the encoded protein, its apparent relevance to meconium ileus (MI) and position in relation to the hCFM1 syntenic region. We have analysed this gene in samples from CF patients with and without MI. Several sequence variations in the ATB(0) gene were identified, although none of them seemed to be related to the intestinal phenotype of CF. Even though no particular allele or haplotype in ATB(0) appears to be associated to CF-MI disease, new SNPs identified should be useful in segregation and linkage disequilibrium analyses in families affected by other disorders caused by the impairment of neutral amino acid transport.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
151 Statistical analysis showed that the higher incidence for P17A and the lower incidence for V512L observed in the general population Table 3 CFTR mutations of the CF patients under study with and without meconium ileus (MI) CF-non MI CF-MI CFTR mutations n CFTR mutations n F508del/R117H 2 F508del/F508del 7 F508del/R334W 3 F508del/L365P 1 F508del/R347P 1 F508del/G542X 1 F508del/621+1G4Ta 1 F508del/621+IG4Ta 1 F508del/M1101K 1 F508del/R1066C 1 F508del/1609delCAa 1 F508del/W1089X 1 F508del/2789+5G4Aa 3 F508del/R1162X 1 F508del/3849+10kbC4T 1 F508del/1609delCAa 1 G542X/G85E 1 F508del/Q1281X 1 G542X/V232D 1 F508del/1811+1.6kbA4G 1 G542X/1811+1.6kb A4Ga 1 F508del/2789+5G4Aa 1 G542X/2789+5G4A 1 F508del/2869insG 1 Q890X/L206W 1 F508del/unknown 1 1811+1.6kbA4G/P205S 1 I507del/I507del 1 R1162X/3272-26A4G 1 G542X/1078delT 1 N1303K/R347H 1 G542X/1811+1.6kbA4Ga 1 N1303K/A1006E+5T 1 S549R/CFTR50kbdel 1 2789+5G4A/405+1G4A 1 R1066C/R1066C 1 W1282X/712-1G4T 1 a CF patient with a sibling presenting identical CFTR genotype and discordance of intestinal phenotype. Login to comment

[hide] Predictors of deterioration of lung function in cy... Pediatr Pulmonol. 2002 Jun;33(6):483-91. Schaedel C, de Monestrol I, Hjelte L, Johannesson M, Kornfalt R, Lindblad A, Strandvik B, Wahlgren L, Holmberg L
Predictors of deterioration of lung function in cystic fibrosis.
Pediatr Pulmonol. 2002 Jun;33(6):483-91., [PMID:12001283]

Abstract [show]
The severity of lung disease in cystic fibrosis (CF) may be related to the type of mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, and to environmental and immunological factors. Since pulmonary disease is the main determinant of morbidity and mortality in CF, it is important to identify factors that can explain and predict this variation. The aim of this longitudinal study of the whole Swedish CF population over age 7 years was to correlate genetic and clinical data with the rate of decline in pulmonary function. The statistical analysis was performed using the mixed model regression method, supplemented with calculation of relative risks for severe lung disease in age cohorts.The severity of pulmonary disease was to some extent predicted by CFTR genotype. Furthermore, the present investigation is the first long-term study showing a significantly more rapid deterioration of lung function in patients with concomitant diabetes mellitus. Besides diabetes mellitus, pancreatic insufficiency and chronic Pseudomonas colonization were found to be negative predictors of pulmonary function. In contrast to several other reports, we found no significant differences in lung function between genders. Patients with pancreatic sufficiency have no or only a slight decline of lung function with age once treatment is started, but an early diagnosis in this group is desirable.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 TABLE 3CFTR Mutations Associated With Pancreatic Sufficiency in Swedish CF Population Y109C S549I/S549I Y109N S945L R117C N1088D À R75Q R117H G1244E L206W 711 þ 3A !G T338I 1249 À 5A !G A455E 2789 þ 5G ! Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment
112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment
76 After the 5T allele, the relative frequent mutations with two to four alleles were: R117H (four alleles), W1282X (four alleles), G551D (three alleles), L206W (three alleles) and D1270 (two alleles). Login to comment
86 CFTR mutations in 92 men with congenital bilateral absence of vas deferens Mutations CFTR mutation panels CF25 CF25 ϩ 5T ACMG25 ACMG25 ϩ 5T CF100 Mutations detected in ∆F508 39 39 39 39 39 CF25 mutation panel R117H 4 4 4 4 4 W1282X 4 4 4 4 4 G551D 3 3 3 3 3 G542X 1 1 1 1 1 N1303K 1 1 1 1 1 IVS8-polyT IVS8-5T 33 33 33 Additional mutations L206W 3 detected not in CF25 D1270N 2 mutation panel 1154InsTC 1 3272-26A→G 1 A455E 1 1 1 R334W 1 1 1 Q890X 1 Total 14 52 85 54 87 95 respectively, in the total number of patients with at least one mutation. Login to comment
91 CFTR genotypes in 92 men with congenital bilateral absence of vas deferens Genotypesa CFTR mutation panelsb CF25 CF25 ϩ 5T ACMG25 ACMG25 ϩ 5T CF100 Two mutations ∆F508/5T 16 16 16 W1282X/5T 4 4 4 ∆F508/R117Hc 3 3 3 3 3 G542X/5T 1 1 1 G551D/5T 1 1 1 ∆F508/L206W 2 ∆F508/A455E 1 1 1 ∆F508/3272-26A→G 1 Q890X/5T 1 L206W/5T 1 D1270N/D1270N 1 5T/5T 1 1 1 Sub-total 3 26 4 27 33 One mutation ∆F508/ϩ 36 20 35 19 16 5T/ϩ 9 9 7 G551D/ϩ 3 2 3 2 2 G542X/ϩ 1 1 R117H/ϩ 1 1 1 1 1 N1303K/ϩ 1 1 1 1 1 W1282X/ϩ 4 4 R334W/ϩ 1 1 1 1154InsTC/ϩ 1 Sub-total 46 33 46 33 29 Total (%) 49 (53.3) 59 (64.1) 50 (54.3) 60 (65.2) 62 (67.4) No mutation (%) 43 (46.7) 33 (35.9) 42 (45.7) 32 (34.8) 30 (32.6) aMutations L206W, 3272-26A→G, Q890X, D1270N, 1154InsTC and 5T are not in either CF25 and ACMG25 panels, while A455E and R334W are not in CF25, but are part of ACMG25 panel. Login to comment
127 L206W is another mild mutation reported with relatively high frequency in both CF and CBAVD patients (Chillon et al., 1995; Mak et al., 1999; Claustres et al., 2000) and which we noted in three compound heterozygotes, two with ∆F508 and one with 5T. Login to comment
128 It appears that L206W is associated in cis with the 9T allele since both ∆F508/L206W patients have a homozygous 9T background, while 5T/L206W exists in a 5T/9T background. Login to comment

[hide] Variant cystic fibrosis phenotypes in the absence ... N Engl J Med. 2002 Aug 8;347(6):401-7. Groman JD, Meyer ME, Wilmott RW, Zeitlin PL, Cutting GR
Variant cystic fibrosis phenotypes in the absence of CFTR mutations.
N Engl J Med. 2002 Aug 8;347(6):401-7., 2002-08-08 [PMID:12167682]

Abstract [show]
BACKGROUND: Cystic fibrosis is a life-limiting autosomal recessive disorder with a highly variable clinical presentation. The classic form involves characteristic findings in the respiratory tract, gastrointestinal tract, male reproductive tract, and sweat glands and is caused by loss-of-function mutations in the cystic fibrosis transmembrane conductance regulator (CFTR ) gene. Nonclassic forms of cystic fibrosis have been associated with mutations that reduce but do not eliminate the function of the CFTR protein. We assessed whether alteration in CFTR function is responsible for the entire spectrum of variant cystic fibrosis phenotypes. METHODS: Extensive genetic analysis of the CFTR gene was performed in 74 patients with nonclassic cystic fibrosis who had been referred by 34 medical centers. We evaluated two families that each included a proband without identified mutations and a sibling with nonclassic cystic fibrosis to determine whether there was linkage to the CFTR locus and to measure the extent of CFTR function in the sweat gland and nasal epithelium. RESULTS: Of the 74 patients studied, 29 had two mutations in the CFTR gene, 15 had one mutation, and 30 had no mutations. A final genotype of two mutations was more common among patients who had been referred after screening for common cystic fibrosis-causing mutations identified one mutation than among those who had been referred after screening had identified no such mutations (26 of 34 patients vs. 3 of 40 patients, P<0.001). Comparison of clinical features and sweat chloride concentrations revealed no significant differences among patients with two, one, or no CFTR mutations. Haplotype analysis in the two families revealed no linkage to CFTR. Although each of the affected siblings had elevated sweat chloride concentrations, measurements of cyclic AMP-mediated ion and fluid transport in the sweat gland and nasal epithelium demonstrated the presence of functional CFTR. CONCLUSIONS: Factors other than mutations in the CFTR gene can produce phenotypes clinically indistinguishable from nonclassic cystic fibrosis caused by CFTR dysfunction.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 MUTATION IDENTIFIED BY SCREENING FOR COMMON MUTATIONS MUTATION IDENTIFIED BY DNA SEQUENCING NO. OF PATIENTS ∆F508 5T* 3 ∆F508 D1152H 2 ∆F508 2789+2insA 2 ∆F508 R117C 2 ∆F508 D110H 1 ∆F508 2789+5G→A 1 ∆F508 P205S 1 ∆F508 L967S 1 ∆F508 I1027T 1 ∆F508 L206W 1 ∆F508 T1053I and 5T 1 ∆F508 V920M and 5T 1 ∆F508 R1070W 1 ∆F508 D579G 1 ∆F508 P67L 1 ∆F508 2811G→T†‡ 1 G85E F191V† 1 R117H G103X and 5T 1 I148T I556V 1 G542X R1162L 1 W1282X D1152H 1 None L138ins and 3272-26 A→G 1 None G463D† and 5T 1 None F693L and 5T 1 ∆F508 None 6 G551D None 1 W1282X None 1 None 5T 4 None 2307insA 1 None L997F 1 None V520I 1 None None 30 in Subject II-2 in Family 1. Login to comment

[hide] CFTR genotypes in patients with normal or borderli... Hum Mutat. 2003 Oct;22(4):340. Feldmann D, Couderc R, Audrezet MP, Ferec C, Bienvenu T, Desgeorges M, Claustres M, Mittre H, Blayau M, Bozon D, Malinge MC, Monnier N, Bonnefont JP, Iron A, Bieth E, Dumur V, Clavel C, Cazeneuve C, Girodon E
CFTR genotypes in patients with normal or borderline sweat chloride levels.
Hum Mutat. 2003 Oct;22(4):340., [PMID:12955726]

Abstract [show]
In recent years, some patients bearing "atypical" forms of cystic fibrosis (CF) with normal sweat chloride concentrations have been described. To identify the spectrum of mutant combinations causing such atypical CF, we collected the results of CFTR (ABCC7) mutation analysis from 15 laboratories. Thirty patients with one or more typical symptoms of the disease associated with normal or borderline sweat chloride levels and bearing two CFTR mutations were selected. Phenotypes and genotypes of these 30 patients are described. A total of 18 different CFTR mutations were observed in the 60 chromosomes analysed. F508del was present in 31.6 % of the mutated chromosomes and 3849+10kbC>T in 13.3 %. R117H, D1152H, L206W, 3272-26A>G, S1235R, G149R, R1070W, S945L, and the poly-T tract variation commonly called IVS8-5T were also observed. The relative frequency of CFTR mutations clearly differed from that observed in typical CF patients or in CBAVD patients with the same ethnic origin. A mild genotype with one or two mild or variable mutations was observed in all the patients. These findings improve our understanding of the distribution of CFTR alleles in CF with normal or borderline sweat chloride concentrations and will facilitate the development of more sensitive CFTR mutation screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 R117H, D1152H, L206W, 3272-26A>G, S1235R, G149R, R1070W, S945L, and the poly-T tract variation commonly called IVS8-5T were also observed. Login to comment
18 Other mutations that might be associated with intermediate (40-60 mmol/L) or normal sweat chloride values have been reported: R117H [Kerem et al., 1997; Massie et al., 2000], G551S [Strong et al., 1991], A455E [Gan et al., 1995], L206W [Desgeoges et al., 1995], D1152H [Feldmann et al., 1995; Lebecque et al., 2001]. Login to comment
44 Table 1 : Genotypes and Phenotypes of Patients with Normal or BordIerline Sweat Tests Patient Age at diagnosis (years) CFTR GENOTYPE* Allele 1 Allele 2 SWEAT CL- MEAN (MMOL/L) PHENOTYPE 1 0.2 F508del G149R 38 P+PI, neonatal hypertrypsinemia, 2 0.3 G551D R117H-7T 31 neonatal hypertrypsinemia 3 0.4 F508del R1070W 30.5 neonatal hypertrypsinemia 4 0.4 F508del R117H-7T 52 P 5 0.6 F508del 3849+10kbC>T 48 P 6 0.11 F508del S945L 58 P+PI 7 1 F508del 5T 40 P+CBAVD 8 2 F508del L206W 53 P 9 2 W1282X 5T 42.5 P 10 5 F508del 3849+10kbC>T 55.5 P 11 5 F508del L206W 55 P 12 5 G91R 5T 47.5 P 13 6 G551D S1235R+5T 49.5 P, neonatal hypertrypsinemia 14 7 F508del 3849+10kb 50 P, nasal popyposis 15 13 F508del R117H-7T 58 P, nasal polyposis 16 18 F508del 5T 60.5 P 17 20 G542X 3849+10kbC>T 52 P+PI 18 21 I507del 3849+10kbC>T 54 P, bronchiectasis 19 30 R347P 3849+10kbC>T 43 P, Pseudomonas colonisation 20 30 I507del L206W 57.5 CBAVD, chronic cough 21 31 F508del R117H-7T 60 CBAVD 22 32 G542X 3849+10kbC>T 30 P, Pseudomonas colonisation 23 34 F508del 3272-26A>G 64 P, CBAVD 24 37 R1070Q D1152H 56 CBAVD, bronchectasis 25 46 F508del D1152H 43 P 26 55 F508del D1152H 48 P, Pseudomonas colonisation 27 56 I507del S1235R 53 P 28 >18 F508del D1152H 60 P+PI 29 >20 F508del 3849+10kbC>T 18 P, bronchiectasis 30 >20 F508del 3272-26A>G 61 P *All mutations are named in accordance with the numbering used in the CFTR Mutation Database: http://www.genet.sickkids.on.ca/cftr/. Login to comment
52 Other common mutations observed in our study such as 3849+10kbC>T, R117H, D1152H, L206W were found at a low prevalence in typical CF patients (0.4 % to 0.2 %). Login to comment
82 Other common mutations observed in our study were R117H, IVS8(5T), D1152H, and L206W. Login to comment
99 Previous reports on L206W suggested that this mutation caused CBAVD or mild pulmonary disease [Rozen, 1995; Desgeorges, 1995]. Login to comment
100 In our study, L206W with F508del in trans was observed in a patient with CBAVD, but also in one patient with pancreatic insufficiency. Login to comment

[hide] CFTR, PRSS1 and SPINK1 mutations in the developmen... JOP. 2003 Sep;4(5):169-77. Bernardino AL, Guarita DR, Mott CB, Pedroso MR, Machado MC, Laudanna AA, Tani CM, Almeida FL, Zatz M
CFTR, PRSS1 and SPINK1 mutations in the development of pancreatitis in Brazilian patients.
JOP. 2003 Sep;4(5):169-77., [PMID:14526128]

Abstract [show]
CONTEXT: Mutations in cystic fibrosis transmembrane conductance regulator (CFTR), in cationic trypsinogen (PRSS1) and in serine protease inhibitor Kazal type 1 (SPINK1) genes have been associated with chronic pancreatitis (alcohol related, idiopathic and hereditary). However, the inheritance pattern is still not clear. PATIENTS: Eighty-two unrelated Brazilian patients with chronic pancreatitis (alcohol-related disease in 64, idiopathic disease in 16, and hereditary disease in 2). Two hundred unrelated individuals with an ethnic distribution comparable to the patients were studied as controls. MAIN OUTCOME MEASURE: Detection of mutations in CFTR, PRSS1, and SPINK1 genes. RESULTS: Mutations in the CFTR gene were found in 8 patients (9.8%) with chronic pancreatitis, 5 of them with idiopathic disease. Interestingly, the only clinical symptom in a male patient in the alcoholic group, who was a compound heterozygote (DeltaF508/R170C) for two CFTR mutations, was pancreatitis without infertility or pulmonary involvement. In the PRSS1 gene, the E79K change in exon 3 was found in one patient (1.2%) with alcohol-related chronic pancreatitis. Four different alterations were identified in the SPINK1 gene. CONCLUSIONS: Mutations in the CFTR gene represent the major cause of idiopathic chronic pancreatitis in Brazilian patients. No mutation was found in the PRSS1 gene among our patients suggesting further genetic heterogeneity for hereditary and idiopathic chronic pancreatitis. Interestingly, the most frequent SPINK1 N34S mutation was not present in patients or controls. Moreover, the -253C allele for the SPINK1 gene was significantly more frequent in patients than controls (P=0.004), suggesting that it might represent a risk factor for the development of pancreatitis in our population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 A total of 13 changes were found: 7 in the CFTR gene (∆F508/R851L, ∆F508/R170C, ∆F508/L206W, 2 N/∆F508, N/P205S, N/R31C and N/V920M), 2 in the PRSS1 gene (E79K and N246N) and 4 in the SPINK1 gene (-253T>C, -164G>C, -7T>G, c75C>T) (Table 1). Login to comment
69 The CFTR Gene Molecular analysis showed that 8 patients (9.8%) had mutations in the CFTR gene: 3 were compound heterozygotes (∆F508/R851L, ∆F508/R170C and ∆F508/L206W) and 5 had mutations on just one allele (2 N/∆F508, N/P205S, N/R31C and N/V920M). Login to comment
70 Among the 16 patients with idiopathic chronic pancreatitis, 5 (31.3%) had mutations in the CFTR gene (∆F508/R851L, ∆F508/L206W, N/∆F508, N/P205S and N/V920M). Login to comment
71 Two of these patients (∆F508/L206W and N/P205S), were found to have congenital absence of the vas deferens in addition to chronic pancreatitis. Login to comment
78 Gene Localization Mutation Polymorphism Frequency in patients' chromosomes Frequency in controls' chromosomes P value Exon 2 R31C 1/164 (0.6%) - - Exon 5 R170C 1/164 (0.6%) - - P205S 1/164 (0.6%) - -Exon 6 L206W 1/164 (0.6%) - - Exon 10 ∆F508 5/164 (3.0%) - - Exon 14a R851L 1/164 (0.6%) - - CFTR Exon 15 V920M 1/164 (0.6%) - - Exon 3 E79K 1/164 (0.6%) 1/300 (0.3%) 1.000a PRSS1 Exon 5 N246N 47/164 (28.7%) 85/300 (28.3%) 1.000b -253T>C 20/164 (12.2%) 20/400 (5.0%) 0.004b Promoter -164G>C 4/164 (2.4%) 13/400 (3.3%) 0.788a Exon 1 -7T>G 5/164 (3.0%) 8/300 (2.7%) 0.777a SPINK1 Exon 2 c75C>T 1/164 (0.6%) 3/300 (1.0%) 1.000a a Fisher's exact test b Yates' corrected chi-squared test alcohol-related chronic pancreatitis, but with no family history. Login to comment
94 Molecular analysis showed that 9.8% of the total group of patients had mutations in the CFTR gene: 3 were compound heterozygotes (∆F508/R851L, ∆F508/R170C and ∆F508/L206W) and 5 had mutations on just one allele (2 N/∆F508, N/P205S, N/R31C and N/V920M). Login to comment
96 Among the 16 patients with idiopathic chronic pancreatitis, 5 had mutations in the CFTR gene (∆F508/R851L, ∆F508/L206W, N/∆F508, N/P205S and N/V920M). Login to comment
97 Two of these patients (∆F508/L206W and N/P205S), were found to have congenital absence of the vas deferens, a condition associated with cystic fibrosis mutations in addition to chronic pancreatitis. Login to comment

[hide] Population-based newborn screening for genetic dis... Pediatrics. 2004 Jun;113(6):1573-81. Comeau AM, Parad RB, Dorkin HL, Dovey M, Gerstle R, Haver K, Lapey A, O'Sullivan BP, Waltz DA, Zwerdling RG, Eaton RB
Population-based newborn screening for genetic disorders when multiple mutation DNA testing is incorporated: a cystic fibrosis newborn screening model demonstrating increased sensitivity but more carrier detections.
Pediatrics. 2004 Jun;113(6):1573-81., [PMID:15173476]

Abstract [show]
OBJECTIVES: Newborn screening for cystic fibrosis (CF) provides a model to investigate the implications of applying multiple-mutation DNA testing in screening for any disorder in a pediatric population-based setting, where detection of affected infants is desired and identification of unaffected carriers is not. Widely applied 2-tiered CF newborn screening strategies first test for elevated immunoreactive trypsinogen (IRT) with subsequent analysis for a single CFTR mutation (DeltaF508), systematically missing CF-affected infants with any of the >1000 less common or population-specific mutations. Comparison of CF newborn screening algorithms that incorporate single- and multiple-mutation testing may offer insights into strategies that maximize the public health value of screening for CF and other genetic disorders. The objective of this study was to evaluate technical feasibility and practical implications of 2-tiered CF newborn screening that uses testing for multiple mutations (multiple-CFTR-mutation testing). METHODS: We implemented statewide CF newborn screening using a 2-tiered algorithm: all specimens were assayed for IRT; those with elevated IRT then had multiple-CFTR-mutation testing. Infants who screened positive by detection of 1 or 2 mutations or extremely elevated IRT (>99.8%; failsafe protocol) were then referred for definitive diagnosis by sweat testing. We compared the number of sweat-test referrals using single- with multiple-CFTR-mutation testing. Initial physician assessments and diagnostic outcomes of these screened-positive infants and any affected infants missed by the screen were analyzed. We evaluated compliance with our screening and follow-up protocols. All Massachusetts delivery units, the Newborn Screening Program, pediatric health care providers who evaluate and refer screened-positive infants, and the 5 Massachusetts CF Centers and their affiliated genetic services participated. A 4-year cohort of 323 506 infants who were born in Massachusetts between February 1, 1999, and February 1, 2003, and screened for CF at approximately 2 days of age was studied. RESULTS: A total of 110 of 112 CF-affected infants screened (negative predictive value: 99.99%) were detected with IRT/multiple-CFTR-mutation screening; 2 false-negative screens did not show elevated IRT. A total of 107 (97%) of the 110 had 1 or 2 mutations detected by the multiple- CFTR-mutation screen, and 3 had positive screens on the basis of the failsafe protocol. In contrast, had we used single-mutation testing, only 96 (87%) of the 110 would have had 1 or 2 mutations detectable by single-mutation screen, 8 would have had positive screens on the basis of the failsafe protocol, and an additional 6 infants would have had false-negative screens. Among 110 CF-affected screened-positive infants, a likely "genetic diagnosis" was made by the multiple-CFTR-mutation screen in 82 (75%) versus 55 (50%) with DeltaF508 alone. Increased sensitivity from multiple-CFTR-mutation testing yielded 274 (26%) more referrals for sweat testing and carrier identifications than testing with DeltaF508 alone. CONCLUSIONS: Use of multiple-CFTR-mutation testing improved sensitivity and postscreening prediction of CF at the cost of increased referrals and carrier identification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
150 112 CF-Affected MA Infants Who Were Screened: Details of CF Newborn Screening Results and Diagnostic Follow-up Sweat Test Result (mEq Cl-/L) CF-Screen Positive CF-Screen Negative Total 2 Mutations 1 Mutation 0 Mutations Positive (Ն60) 62 19 3 2 86 Borderline (Ն30 and Ͻ60) Within expectations for specific CF genotype* 5 3 8¶ Monozygotic twin sweat test positive† 1 1 Negative (Ͻ30) Within expectations for specific CF genotype‡ 4 1 5 Incomplete (not done or QNS) 2 CFTR mutations identified and clinical symptoms§ 6 1 7 2 CFTR mutations identified without clinical symptoms࿣ 5 5 Total 82 25 3 2 112 * ⌬F508/R117H;7T (3), ⌬F508/3849 ϩ 10kb (2), ⌬F508/L206W (1), G551D/R117C (1), and G85E/R117C (1). Login to comment
159 Genotypes and Frequencies Observed in 112 CF-Affected Infants First Mutation Second Mutation N ⌬F508 ⌬F508 55 ⌬F508 R117H 7* ⌬F508 G551D 4 ⌬F508 N1303K 3 ⌬F508 W1282X 3 ⌬F508 G542X 2 ⌬F508 1898 ϩ 1 G Ͼ A 2 G85E R117C 2 ⌬F508 1717-GϾA 1 ⌬F508 3849 ϩ 10kbC Ͼ T 1 ⌬F508 R1066C 1 ⌬F508 Y1092X 1 ⌬F508 L206W 1 ⌬F508 R560T 1 ⌬F508 1152H 1 ⌬F508 621 ϩ 1G Ͼ T 1 R117H G551D 1 R117H G85E 1 G551D 2789 ϩ 5GϾA 1 G551D R117C 1 G85E 711 ϩ 1GϾT 1 W1282X 3849 ϩ 10kbCϾT 1 R553X 2183AAϾG 1 A455E S549R 1 ⌬F508 Unknown† 13 N1303K Unknown 2 G542X Unknown 1 Unknown Unknown 2 * Includes 1 of the false-negative screens. Login to comment
170 § Presumed second CFTR mutation: R1066C, 1898GϾA (2), D1152H, L206W, Y1092X, and "not present in additional mutation analysis and yet to be identified" (13). Login to comment

[hide] Genotype/phenotype correlation of the G85E mutatio... Eur Respir J. 2004 May;23(5):679-84. Decaestecker K, Decaestecker E, Castellani C, Jaspers M, Cuppens H, De Boeck K
Genotype/phenotype correlation of the G85E mutation in a large cohort of cystic fibrosis patients.
Eur Respir J. 2004 May;23(5):679-84., [PMID:15176679]

Abstract [show]
In this European study, the phenotype in 68 patients, homozygous or compound heterozygous for the G85E mutation, was investigated. Each index case was compared with two cystic fibrosis (CF) patients from the same clinic, matched for age and sex: one with pancreatic sufficiency (PS) and one with pancreatic insufficiency (PI). When comparing 31 G85E/F508del and F508del/F508del patients, there were no differences in median age at diagnosis, mean sweat chloride value, most recent weight for height, most recent forced expiratory volume in one second % predicted, prevalence of chronic Pseudomonas aeruginosa colonisation and typical CF complications. However, PI was less frequent in the G85E/F508del group. Comparison of 55 G85E patients (with second mutation known and not classified as mild) with PS controls (n=44) showed that the G85E patients had a significantly higher sweat chloride, more often failure to thrive at diagnosis, higher prevalence of PI, worse current weight for height, higher prevalence of chronic P. aeruginosa colonisation and liver cirrhosis. Pulse-chase experiments revealed that G85E cystic fibrosis transmembrane conductance regulator failed to mature on a M470 as well as on a V470 background. Therefore, G85E is a class II mutation. Although there is variability in its clinical presentation, G85E mutation results in a severe phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 1 G85E/W496X 1 F508del# /N1303K# 1 G85E/N1303K# 1 T388I/R1158X 1 G85E/711z5GRA} 1 3272-26AwG} /E822X 1 G85E/R334W} 1 F508del# /R334W} 1 Total 68 574delA/2789z5GRA 1 F508del# /3272-26ARG} 1 F508del# /R352Q 1 F508del# /3272-26AwG} 1 R334W} /444delA 1 L206W/3272-26ARG} 1 F508del# /F508del# 1 L206W/? Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. Login to comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment
63 The most prevalent mutations were as follows: ⌬F508, D1152H, R117H, G542X, L206W, I148T (3199del6 status unknown), ⌬I507, R1066C, R553X, 3849ϩ10kbCϾT, and R334W representing 83.72% of the total identified. Login to comment
71 In the carrier screening group, 4 mutations, D1152H, R117H, ⌬I507, and L206W, had frequencies of 3.8% 1 CFTR mutation distribution among Hispanic CF patients and carrier screening referrals CFTR Mutation Identified CF Patients Carrier Screening Referrals # of CF Chromosomes % Detection # of Carrier Screen Referrals % of Positive Carriers ⌬F508a 118 37.11c 136 47.39 G542Xa 11 3.46 12 4.18 R334Wa 11 3.46 6 2.09 3120 ϩ 1G Ͼ Aa 7 2.20 5 1.74 3876delAb 7 2.20 4 1.39 W1089Xb 7 2.20 R1066Cb 6 1.89 9 3.14 3849 ϩ 10kbC Ͼ Ta 3 0.94 6 2.09 R1162Xa 2 0.63 5 1.74 G85Ea 2 0.63 3 1.05 S549Nb 2 0.63 2 0.70 711 ϩ 1G Ͼ Ta 2 0.63 1 0.35 2789 ϩ 5G Ͼ Aa 2 0.63 1 0.35 1949del84b 2 0.63 1 0.35 R117Ha 1 0.31 14 4.88 ⌬I507a 1 0.31 11 3.83 R553Xa 1 0.31 7 2.44 ⌬F311b 1 0.31 1 0.35 1078delTa 1 0.31 1 0.35 621 ϩ 1G Ͼ Ta 1 0.31 1 0.35 3659delCa 1 0.31 1 0.35 Q890Xb 1 0.31 1 0.35 G551Da 1 0.31 1812 - 1G Ͼ Ab 1 0.31 I148T ϩ 3199del6a 1 0.31 A559Tb 1 0.31 1717 - 1G Ͼ Aa 1 0.31 3905insTb 1 0.31 3821delTb 1 0.31 G178Rb 1 0.31 D1152Hb 18 6.27 L206Wb 11 3.83 I148T (3199del6 status unknown)a 10 3.48 N1303Ka 4 1.39 W1282Xa 4 1.39 R117Cb 4 1.39 R352Qb 2 0.70 712 - 1G Ͼ Tb 2 0.70 Y1092Xb 1 0.35 444delAb 1 0.35 S549Rb 1 0.35 1609delCAb 1 0.35 Negative for mutations analyzed 120 37.74 15046 Total 318 62.20d 15333 100.00 a Mutation included in the ACMG/ACOG Recommended Core Mutation Panel for general population CF carrier screening.4,5 b Mutation not included in the ACMG/ACOG Recommended Core Mutation Panel for general population CF carrier screening. Login to comment
112 In both the Hispanic and African American populations, mutations associated with a variable clinical phenotype such as R117H, D1152H, and L206W were more common in the carrier screening population than the affected population. Login to comment

[hide] Multimutational analysis of eleven cystic fibrosis... Clin Chem. 2004 Nov;50(11):2155-7. Farez-Vidal ME, Gomez-Llorente C, Blanco S, Morales P, Casals T, Gomez-Capilla JA
Multimutational analysis of eleven cystic fibrosis mutations common in the Mediterranean areas.
Clin Chem. 2004 Nov;50(11):2155-7., [PMID:15502086]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Two multiplex reactions were designed for the analysis of 11 mutations: multiplex 1 (M1) analyzed K710X, R1066C/R1066S, 2869 insG, and Q890X polymorphisms; and multiplex 2 (M2) analyzed L206W, 1609delCA, R1066L/R1066H, R709X, and 1811 ϩ 1.6Kb polymorphisms. Login to comment
87 Peaks in M2 multiplex correspond to the following mutations: L206W, 1609delCA, R1066L/H, R709X, and 1811 ϩ 1.6Kb. Login to comment
88 Peaks sizes for wild-type positions studied (nt) were as follows: for L206W, 28.78-29.10; for 1609delCA, 32.71-32.89; for R1066L/H, 35.77-36.16; for R709X, 41.89-42.16; and for 1811 ϩ 1.6Kb, 49.71-49.91. Login to comment

[hide] Misprocessing of the CFTR protein leads to mild cy... Hum Mutat. 2005 Apr;25(4):360-71. Clain J, Lehmann-Che J, Dugueperoux I, Arous N, Girodon E, Legendre M, Goossens M, Edelman A, de Braekeleer M, Teulon J, Fanen P
Misprocessing of the CFTR protein leads to mild cystic fibrosis phenotype.
Hum Mutat. 2005 Apr;25(4):360-71., [PMID:15776432]

Abstract [show]
Cystic fibrosis (CF) is mainly caused by mutations that interfere with the biosynthetic folding of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. The aim of this study was to determine the mechanism of dysfunction of a disease-causing mutation associated with variable phenotypes. In order to attain these objectives, we studied the effect of the p.L206W mutation on CFTR protein production and function, and we examined the genotype-phenotype correlation of [p.L206W]+[p.F508del] patients. We showed that p.L206W is a processing (class II) mutation since the CFTR biosynthetic pathway was severely impaired, whereas single-channel measurements indicated ion conductance similar to the wild-type protein. These data raise the larger question of the phenotypic variability of class II mutants, including p.F508del. Since multiple potential partners could modify the processing of the CFTR protein during its course to the cell surface, environmental and other genetic factors might contribute to this variability.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 RESULTS Genotype Data Among CF PatientsWith L206W Mutation Among the 668 French CF families and 162 CBAVD patients included in our study, 12 patients were identified as heterozygotes for the p.L206W mutation. Login to comment
209 Cells expressing wild-type or p.L206W CFTR produced a significantly higher cAMP-dependent fluorescence change than mock-transfected cells (wild-type: 0.03170.051; L206W: 0.01270.011), indicating a CFTR-depen- FIGURE 2. Login to comment
235 Because for most CF patients the mild L206W is associated with a severe mutation on the other chromosome, the particular haplotype linked to p.L206W strengthens the mild dominant effect of the p.L206W mutation. Login to comment
3 The aim of this study was to determine the mechanism of dysfunction of a disease-causing mutation associated with variable phenotypes. In order to attain these objectives, we studied the effect of the p.L206W mutation on CFTR protein production and function, and we examined the genotype-phenotype correlation of [p.L206W]+[p.F508del] patients. Login to comment
4 We showed that p.L206W is a processing (class II) mutation since the CFTR biosynthetic pathway was severely impaired, whereas single-channel measurements indicated ion conductance similar to the wild-type protein. Login to comment
19 Individuals bearing p.L206W in Received 3 August 2004; accepted revised manuscript 30 November 2004. n Correspondence to: Pascale Fanen, INSERM U.468, Ho" pital Henri Mondor,94010 Cre¤ teil, France. Login to comment
31 The aim of this study was to determine the mechanism of dysfunction of a disease-causing mutation that can result in such variable phenotypes. In order to attain these objectives, we studied the effect of the p.L206W mutation on CFTR protein production and function, and we examined the genotype-phenotype correlation of [p.L206W]+[p.F508del] patients. Login to comment
32 These studies showed that p.L206W is a class II but mild mutation. Login to comment
33 MATERIALS AND METHODS Patients We selected the patients with p.L206W mutation for this study among patients having well documented CF (n=668) or CBAVD (n=162), who were referred to our CF diagnosis center. Login to comment
39 Segregation of the p.L206W mutation was studied in the families by StyI restriction analysis. Login to comment
41 Intragenic haplotypes were determined by studying three microsatellites, IVS8(CA), IVS17b (TA), and IVS17b(CA) [Morral et al., 1992], in the patients having a p.L206W allele and, when possible, in their parents. Login to comment
42 Relation Between Genotype and Phenotype We extracted from the French CF registry all the patients who attended at least once in a participating care center during 1999 or 2000 and for whom the genotype was composed of the p.L206W and p.F508del mutations. Login to comment
50 For statistical comparison of clinical measures, patients heterozygous [p.L206W]+[p.F508del] were compared with those homozygous for p.F508del. Login to comment
103 Table 1 summarizes the CFTR genotype data among the 12 patients with the p.L206W mutation. Login to comment
104 Because p.L206W was found to be associated with one single haplotype in four patients previously described [Desgeorges et al., 1995], we also analyzed three intragenic microsatellites IVS8(CA), IVS17b(TA), and IVS17b(CA), the variable IVS8 sequence (TG)m(T)n, and the 1540A4G (M470V) common variant. Login to comment
105 All p.L206W chromosomes had the 1540A and the (TG)9(T)9 polymorphisms, six had the true [IVS8(CA)16;IVS17b(TA) 7;IVS17b(CA)17] haplotype defined by the three intragenic microsatellites, whereas six had a ''possible`` [IVS8(CA) 16;IVS17b(TA)7;IVS17b(CA)17] haplotype (see Table 1 for explanations). Login to comment
106 Our data together with the study of Desgeorges et al. [1995] showed that the p.L206W mutation was associated with one haplotype using this set of polymorphic sites. Login to comment
107 A more extensive study with seven diallelic and three multiallelic markers describes a second p.L206W-associated haplotype, as the result of recombination [Claustres et al., 1996]. Login to comment
108 The p.L206W mutation was found to account for 0.6% of the CF genes identified in our specialized center, and 0.9% in CBAVD patients. Login to comment
110 Relation Between Genotype and Phenotype To investigate the conditions associated with the p.L206W mutation, we first described the clinical data of 12 patients with the p.L206W mutation identified in our center, compared with 24 cases for which clinical data are available in the literature. Login to comment
111 Table 2 summarizes the clinical features and CFTR genotype in p.L206W patients. Login to comment
112 For most patients (30/36), p.L206W was combined with a severe mutation (p.F508del, p.I507del, p.G542X, p.W216X, p.R851X, and p.E60X) on the other CFTR allele. Login to comment
114 The patient conditions varied from isolated CBAVD to severe CF, even within the same genotype [p.L206W]+[p.F508del]. Login to comment
115 Interestingly, one newly identified CBAVD patient had 5(T) adjacent to 12 (TG) repeats at the IVS8(TG)m(T)n locus in trans with p.L206W, consistent with the recent demonstration that the (TG)12(T)5 allele is associated with disease penetrance [Groman et al., 2004]. Login to comment
117 All patients presenting with pulmonary outcomes had the [p.L206W]+[p.F508del] or [p.L206W]+[p.I507del] genotype, except one [p.L206W]+[?] Login to comment
119 The phenotypes of the 12 patients identified in the present study did not differ from those previously described in the literature and suggest that the p.L206W mutation is mostly associated with a mild CF or CBAVD phenotype. Login to comment
120 To examine the relationship between morbidity and the p.L206W mutation further, we performed a multicenter cross-sectional study, in which every CF patient with the [p.L206W]+[p.F508del] genotype was matched by age and sex to a p.F508del homozygote from the same center in France. Login to comment
123 Patients with the [p.L206W]+[p.F508del] genotype had a significantly better nutritional status and absence of diarrhea or meconium ileus at diagnosis. Login to comment
124 Pancreatic insufficiency occurred very rarely (1/12) and the lower frequency of Pseudomonas aeruginosa lung colonization explains the absence of i.v. antibiotic therapy in the compound heterozygous group for p.L206W. Login to comment
126 The mean age at diagnosis was borderline significant (P=0.057) when diagnosis based on neonatal screening was excluded: 13.7 years for [p.L206W]+[p.F508del] patients and 3.2 years for p.F508del homozygotes. Login to comment
127 Altogether, these results indicate milder CF disease in patients carrying the [p.L206W]+[p.F508del] genotype. Login to comment
128 Based on the pancreatic sufficient phenotype (>90% of patients), the p.L206W mutation should be considered as a mild mutation. Login to comment
129 Processing of CFTR Mutants To determine why patients with the p.L206W-CFTR allele suffered from mild CF, we first studied the maturation of CFTR in HeLa cells transiently transfected with cDNA encoding the wild-type and mutated CFTR proteins. Login to comment
134 Immunoprecipitation experiments at steady-state show that both wild-type and CF-associated p.L206W CFTR produced mature, fully glycosylated protein (band C), while none of the mock-transfected cells produced CFTR (Fig. 1A). Login to comment
139 By using a classical 15-minute radioactive metabolic labeling of proteins, the kinetics of wild-type and p.L206W core-glycosylated forms of CFTR were identical, whereas the mature band C of the mutant was not detected at any time of a 4-hr chase (Fig. 2A and B) and a even 24-hr chase (data not shown). Login to comment
142 CFTR Genotype of CF PatientsWith p.L206W Patient Genotype 15404Ga IVS8(TG)m(T)n a Haplotypeb 2296 [p.L206W]+[p.R851X] [1540A]+[1540G] [(TG)9(T)9]+[(TG)11(T)7] [16;7;17]+[16;31;14] 1929 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[23;31;13]c 1749 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[? Login to comment
143 ]c 179 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[23;31;13] 422 [p.L206W]+[p.G542X] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[23;33;13] 1720 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[17;32;13]c 1878 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[17;31;13]c 626 [p.L206W]+[p.E60X] [1540A]+[1540G] [(TG)9(T)9]+[(TG)11(T)7] [16;7;17]+[16;31;13] 1455 [p.L206W]+[1342-6(T)5]] [1540A]+[1540G] [(TG)9(T)9]+[(TG)12(T)5] [16;7;17]+[16;31;14]c 2104 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[23;31;13]c 652 [p.L206W]+[p.E216X] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[23;32;13] 2345 [p.L206W]+[p.F508del] [1540A]+[1540A] [(TG)9(T)9]+[(TG)10(T)9] [16;7;17]+[17;32;13] a The DNA and mutation numbering follows the CFTR mutation database, (www.genet.sickkids.on.ca/cftr), the A of the ATG translation start codon being numbered +133 (GeneBank NM_000492.2).We followed the approved nomenclature format in mutation names at the protein level and in genotype writing. Login to comment
145 c The segregation has not been studied in the family; the suggested genotype indicates a possible [IVS8(CA)16;IVS17b(TA)7;IVS17b(CA)17] haplotype linked to p.L206W, the other haplotype having been described linked to the second mutation [Morral et al.,1993]. Login to comment
146 TABLE2.ClinicalDataAmongPatientsWithp.L206W GenotypeClassa Ageat diagnosis(yr) Current age(yr)Sex Genital statusb Pancreatic status Pulmonary outcomes SweatCl(mEq/liter) mean7sd(n)Reference [p.L206W]+[p.F508del]II/II523FPSMild6171(2)Desgeorgesetal. Login to comment
147 [1995] [p.L206W]+[p.F508del]II/II1525FOUPSAsthma190710(2)Desgeorgesetal. Login to comment
148 [1995] [p.L206W]+[p.G542X]II/I2237MCBAVDPS^c 65711(3)Desgeorgesetal. Login to comment
149 [1995] [p.L206W]+[p.1507del]II/II3448MCBAVDPSInfection60710(3)Desgeorgesetal. Login to comment
150 [1995] [p.L206W]+[p.F508del]II/II^^^^PSYes460Bernardinoetal. Login to comment
151 [2000] [p.L206W]+[?]II/-^^^^PSYes460Bernardinoetal. Login to comment
152 [2000] [p.L206W]+[p.F508del]II/II0.312F^PSMildNegativeRozenetal. Login to comment
153 [1995] [p.L206W]+[p.F508del]II/II0.515F^PSMildNegativeRozenetal. Login to comment
154 [1995] [p.L206W]+[p.F508del]II/II0.616M^PSMildNegativeRozenetal. Login to comment
155 [1995] [p.L206W]+[p.F508del]II/II^38MCBAVD^^8773(2)Rozenetal. Login to comment
156 [1995] [p.L206W]+[p.F508del]II/II^56MCBAVD^^7773(2)Rozenetal. Login to comment
157 [1995] [p.L206W]+[p.F508del]II/II^55F^^Mild^Rozenetal. Login to comment
158 [1995] [p.L206W]+[p.F508del]II/II^45F^^Mild^Rozenetal. Login to comment
159 [1995] [p.L206W]+[p.F508del](n=6)II/II^^MCBAVDPSNo^Casalsetal. Login to comment
160 [2000] [p.L206W]+[?]II/-^^MCBAVDPSNo^Casalsetal. Login to comment
161 [2000] [p.L206W]+[3121-1G4A]II/I^^MCBAVDPSNo^Casalsetal. Login to comment
162 [2000] [p.L206W]+[1949del84]II/?^^MCBAVDPSNo^Casalsetal. Login to comment
163 [2000] [p.L206W]+[p.F508del]II/II^^MCBAVDPS^^Maketal. Login to comment
164 [1999] [p.L206W]+[?]II/-^^MCBAVDPS^^Maketal. Login to comment
165 [1999] [p.L206W]+[p.W216X]II/I0.116F^PSNo75(1)Thisstudy [p.L206W]+[p.F508del]II/II0.2d 2F^PSe BronchialhyperreactivityPositiveThisstudy [p.L206W]+[p.F508del]II/II216F^PSNo54714(6)Thisstudy [p.L206W]+[p.F508del]II/II24M^PSe Bronchitis65(1)Thisstudy [p.L206W]+[p.F508del]II/II23M^PSe Bronchitis9672(2)Thisstudy [p.L206W]+[p.F508del]II/II47F^PIBronchitis5478(2)Thisstudy [p.L206W]+[p.F508del]II/I56F^PSAsthma7576(2)Thisstudy [p.L206W]+[1342-6(T)5]II/-2833MCBAVDPSBronchitis^Thisstudy [p.L206W]+[p.G542X]II/I3243MCBAVDPSNo^Thisstudy [p.L206W]+[p.F508del]II/II3740MCBAVD^^^Thisstudy [p.L206W]+[p.E60X]II/I2938MCBAVDPSNo64(1)Thisstudy [p.L206W]+[p.F508del]II/II3536MCBAVDPINo93(1)Thisstudy a Theclassi'cationofmissensemutationswasbasedonfunctionalstudies[Lietal.,1993;Chengetal.,1990;Champignyetal.,1995]. Login to comment
188 D: Endoglycosidase H susceptibility of wild-type, p.F508del, and p.L206W core-glycosylated immature form of the CFTR protein.The asterisk (B*) indicates the shift of band B mobility. Login to comment
191 Both sets of experiments showed that the stability of the mature band C of the p.L206W mutant was nearly unaffected when compared to the wild type. Login to comment
192 Altogether, this indicates that the p.L206W mutation results in decreased conversion to the fully glycosylated protein which accounts for the low amount of band C observed in the steady-state experiments. Login to comment
199 Because polar residues can drive transmembrane helix associations through interhelical hydrogen bonds (H bond) [Choma et al., 2000; Zhou et al., 2000, 2001], aberrant side chain-side chain H bonds between p.L206W and the neighboring TM helices 2 or 4 could account for the misprocessing induced by the p.L206W mutation. Login to comment
200 Inspection of the TM2 and TM4 sequences identified five polar residues that could interact with p.L206W, namely Tyr-122, Cys-128, Thr-135, Cys-225, and Gln-237. Login to comment
201 To test this possibility, these residues were replaced one at a time by Ala (p.T122A, p.C128A, p.S135A, p.C225A, and p.Q237A) together with the p.L206W mutation, and the processing at steady-state was examined. Login to comment
202 None of these double-mutant proteins displayed improved processing when compared to the p.L206W mutation alone (data not shown). Login to comment
203 The overall observations reported here indicated that the p.L206W mutation impaired the CFTR biosynthetic pathway and that a hydrophobic residue at location 206 is necessary for proper CFTR processing. Login to comment
204 Immuno£uorescence Localization of p.L206W CFTR Mutant Figure 3 shows the influence of the p.L206W mutation on the cellular localization of CFTR in transiently transfected HeLa cells evaluated by indirect immunofluorescence using the mouse monoclonal antibody MAB25031, which recognizes the C-terminal portion of the CFTR protein. Login to comment
205 Wild-type CFTR was detectable as a uniform staining over the entire cell surface, and also as a more intense perinuclear pattern, whereas the p.L206W mutation resulted in large decrease in cell surface staining while perinuclear staining remained intense (Fig. 3). Login to comment
206 Hence the relative amount of the mature CFTR band detected in steady-state experiments was consistent with the cell surface staining by indirect immunofluorescence for both the wild-type and the p.L206W CFTR mutant. Login to comment
207 Chloride Channel Function of p.L206W CFTR Mutant To characterize this mutant protein functionally, the cAMP-stimulated Cl-conductance across the entire cell plasma membrane of CFTR-expressing cells was measured using a Cl- - sensitive dye fluorescent assay (Fig. 4A and B). Login to comment
210 Pulse-chase experiments showing the turnover of the immature and mature forms of wild-type and p.L206W CFTR. Login to comment
214 C: Stability of the mature wild-type and p.L206W CFTR determined upon inhibition of protein biosynthesis with cycloheximide (CHX). Login to comment
218 Compared to the wild-type, cells expressing p.L206W exhibited a distribution in fluorescence change that was significantly decreased (Po0.005). Login to comment
219 This decrease in cAMP-dependent Cl-conductance across the entire cell plasma membrane reflected at least in part the p.L206W CFTR misprocessing, and is consistent with the CF phenotype. Login to comment
220 Single-Channel Properties of the p.L206W Mutant Because the p.L206W mutant had altered cAMP-dependent Cl-conductance at the cell plasma membrane and produced some mature protein, single-channel properties were analyzed using excised, inside-out membrane patches. Login to comment
221 None of the membrane patches of mock-transfected cells displayed a Cl- current in the presence of intracellular ATP and PKA, whereas wild-type and p.L206W mutant CFTR channels were reversibly activated (data not shown). Login to comment
222 The single-channel current amplitudes of the p.L206W mutant were not different from those of the wild-type (Fig. 4C). Login to comment
223 By using 120 mM Cl- (symmetrically), wild-type and p.L206W mutant CFTR had a linear i-v relationship under activating conditions (Fig. 4D) and the conductance for p.L206W was 7.6270.61 pS (n=6), which was not significantly different from wild-type (7.1870.36 pS; n=6). Login to comment
225 However, visual inspection suggested that the gating parameters of the p.L206W mutant were not dramatically different from those of the wild-type CFTR. Login to comment
226 DISCUSSION This study provides strong clinical, molecular and functional evidence that the transmembrane CFTR p.L206W mutation should be classified as a mild class II mutation. Login to comment
227 Based on PI incidence in the overall case reports and in the present [p.L206W]+[p.F508del] genotype-phenotype relationships study (PI occurred in o10% of patients), p.L206W should be considered as a mild CF allele. Login to comment
230 Our multicenter cross-sectional study highlights the significantly better nutritional status (absence of diarrhea and meconium ileus) and confirms the presence of pulmonary outcomes in CF patients, further documenting the atypical clinical presentation of compound p.L206W patients from CBAVD to PI cystic fibrosis. Login to comment
232 Of interest, p.L206W arises in a unique haplotype with IVS8 (TG)9(T)9 and the 1540A common variant. Login to comment
233 This has implications concerning the phenotype associated with p.L206W. Login to comment
234 First, IVS8 (TG)9 and IVS8 (T)9 alleles, which are associated with correct splicing of exon 9, result in normal levels of p.L206W CFTR mRNA, and the 1540A allele is described as maintaining normal CFTR function. Login to comment
236 Second, because p.L206W is linked to a unique CFTR genetic background, it can be deduced that these polymorphisms inherited in cis with the p.L206W mutation cannot explain the phenotypic variability observed. Login to comment
237 The data reported here show that p.L206W is a disease-causing mutation by decreasing CFTR processing and subsequently Cl-channel conductance at the cell plasma membrane by approximately 60%. Login to comment
238 The subcellular localization of p.L206W CFTR in transfected HeLa cells differs dramatically from that of the wild-type CFTR, the mutant being mainly located in the cytoplasm. Login to comment
241 We can first confirm that Leu-206 does not line the channel [Akabas, 1998] and second, that cells expressing the p.L206W mutation generate residual cAMP-dependent Cl- currents at the plasma membrane, which is believed to be sufficient to confer a variable or mild clinical phenotype. Login to comment
243 Immuno£uorescence localization of wild-type and p.L206W CFTR in transiently transfected HeLa cells.Cells grown on glass slides were 'xed in methanol, permeabilized in 0.1%Triton X-100 in PBS, and visualized by indirect immuno£uorescence. Login to comment
250 Interestingly, the disease-causing mutation p.P205S, flanking p.L206W in the middle of the TM3, produced nearly no detectable mature protein [Sheppard et al., 1996]. Login to comment
253 Thus, the p.L206W mutation might disturb local hydrophobic constraints, preventing the ''pro-folding`` activity of Pro-205. Login to comment
257 This mechanism seems unlikely to explain p.L206W misprocessing because we did not identify such partners for p.L206W by testing several polar residues in the two helices adjacent to TM3. Login to comment
260 ClÀ channel activity of HeLa cells transiently transfected with wild-type and p.L206W CFTR. Login to comment
275 Unexpectedly, the mechanism of dysfunction of p.L206W resembles that of p.G85E and p.P205S, which are misprocessed without altering ion conductance [Sheppard et al., 1996; Xiong et al., 1997]. Login to comment
283 Environmental and other genetic factors might contribute to this variability [Bronsveld et al., 2000; Garred et al., 1999], and a plausible explanation that we favor is that p.L206W and other class II mutants are associated with a variable clinical phenotype because multiple potential partners could modify the processing of the CFTR protein during its course to the cell surface. Login to comment
287 p.L206W, a misprocessing mutation localized in a transmembrane segment, provides a striking example that functional analysis of CFTR mutations identified in patients is necessary to assign the correct class to each particular mutation. Login to comment

[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]

Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

[hide] Genotype-phenotype correlation for pulmonary funct... Thorax. 2005 Jul;60(7):558-63. de Gracia J, Mata F, Alvarez A, Casals T, Gatner S, Vendrell M, de la Rosa D, Guarner L, Hermosilla E
Genotype-phenotype correlation for pulmonary function in cystic fibrosis.
Thorax. 2005 Jul;60(7):558-63., [PMID:15994263]

Abstract [show]
BACKGROUND: Since the CFTR gene was cloned, more than 1000 mutations have been identified. To date, a clear relationship has not been established between genotype and the progression of lung damage. A study was undertaken of the relationship between genotype, progression of lung disease, and survival in adult patients with cystic fibrosis (CF). METHODS: A prospective cohort of adult patients with CF and two CFTR mutations followed up in an adult cystic fibrosis unit was analysed. Patients were classified according to functional effects of classes of CFTR mutations and were grouped based on the CFTR molecular position on the epithelial cell surface (I-II/I-II, I-II/III-V). Spirometric values, progression of lung disease, probability of survival, and clinical characteristics were analysed between groups. RESULTS: Seventy four patients were included in the study. Patients with genotype I-II/I-II had significantly lower current spirometric values (p < 0.001), greater loss of pulmonary function (p < 0.04), a higher proportion of end-stage lung disease (p < 0.001), a higher risk of suffering from moderate to severe lung disease (odds ratio 7.12 (95% CI 1.3 to 40.5)) and a lower probability of survival than patients with genotype I-II/III, I-II/IV and I-II/V (p < 0.001). CONCLUSIONS: The presence of class I or II mutations on both chromosomes is associated with worse respiratory disease and a lower probability of survival.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
209 To study the decline in pulmonary function between groups the ANOVA method (repeated measures) was used with baseline and current spirometric values as dependent variables, genotype groups as the independent variable, and age and evolution time as Table 1 CFTR mutation according to functional classification Class Molecular dysfunction Mutation I Defective protein production G542X, 711+1GRT, 1609delCA, R1162X, 1717-8GRA, W1282X, 1782delA, Q890X, 1898+3ARG, CFTRdele19, 936delTA II Defective protein processing F508del, N1303K, I507del, R1066C III Defective protein regulation D1270N, G551D IV Defective protein conductance L206W, R334W, R117H, R347H, D836Y, P205S V Partially defective production or processing 2789+5GRA, 1811+1.6kbARG, 3849+10kbCRT, 3272+26GRA Table 2 Groups based on genotype in CF adult patients Functional classes Genotype No of subjects I-I G542X/W1282X 1 R1162X/1898+3ARG 1 R1162X/CFTRdele19 1 I-II F508del/G542X 5 F508del/711+1GRT 2 F508del/1717-8GRA 1 F508del/936delTA 1 F508del/R1162X 1 N1303K/1609delCA 1 I-III G542X/D1270N+R74W 1 711+1G-T/G551D 1 I-IV G542X/P205S 1 Q890X/R334W 1 1609delCA/R347H 1 I-V G542X/2789+5GRT 2 G542X/1811+1.6kbARG 1 1782delA/2789+5GRA 1 1609delCA/1811+1.6kbARG 1 II-II F508del/F508del 21 F508del/N1303K 1 F508del/R1066C 1 II-III F508del/D1270N+R74W 1 I507del/D1270N+R74W 1 II-IV F508del/L206W 4 F508del/R334W 3 F508del/R117H 3 F08del/R347H 2 F508del/D836Y 1 II-V F508del/2789+5GRA 5 F508del/3849+10kbCRT 2 F508del/1811+1.6kbARG 2 F508del/3272+26GRA 1 N1303K/1811+1.6kbARG 1 N1303K/2789+5GRA 1 adjusted variables. Login to comment

[hide] Extensive sequencing of the CFTR gene: lessons lea... Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28. McGinniss MJ, Chen C, Redman JB, Buller A, Quan F, Peng M, Giusti R, Hantash FM, Huang D, Sun W, Strom CM
Extensive sequencing of the CFTR gene: lessons learned from the first 157 patient samples.
Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28., [PMID:16189704]

Abstract [show]
Cystic fibrosis (CF) is one of the most common monogenic diseases affecting Caucasians and has an incidence of approximately 1:3,300 births. Currently recommended screening panels for mutations in the responsible gene (CF transmembrane regulator gene, CFTR) do not detect all disease-associated mutations. Our laboratory offers extensive sequencing of the CFTR (ABCC7) gene (including the promoter, all exons and splice junction sites, and regions of selected introns) as a clinical test to detect mutations which are not found with conventional screening. The objective of this report is to summarize the findings of extensive CFTR sequencing from our first 157 consecutive patient samples. In most patients with classic CF symptoms (18/24, 75%), extensive CFTR sequencing confirmed the diagnosis by finding two disease-associated mutations. In contrast, only 5 of 75 (7%) patients with atypical CF had been identified with two CFTR mutations. A diagnosis of CF was confirmed in 10 of 17 (58%) newborns with either positive sweat chloride readings or positive immunoreactive trypsinogen (IRT) screen results. We ascertained ten novel sequence variants that are potentially disease-associated: two deletions (c.1641AG>T, c.2949_2853delTACTC), seven missense mutations (p.S158T, p.G451V, p.K481E, p.C491S, p.H949L, p.T1036N, p.F1099L), and one complex allele ([p.356_A357del; p.358I]). We ascertained three other apparently novel complex alleles. Finally, several patients were found to carry partial CFTR gene deletions. In summary, extensive CFTR gene sequencing can detect rare mutations which are not found with other screening and diagnostic tests, and can thus establish a definitive diagnosis in symptomatic patients with previously negative results. This enables carrier detection and prenatal diagnosis in additional family members.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 DF508/c.546insCTA CF; lung symptoms; PS; 2 sibs with CF NG Pos p.R1066C/c.3272-26 A>G Mild CF 40 115 [p.V562I;p.A1006E]b /p.R1158X CF, FTT 6 Not done DF508/c.1716G>A Classic CF 21 Not done p.R785X/c.2732insA Classic CF, PI 4 Not done DF508/p.R117C Classic CF 2 Not done DF508/p.R75X CF 19 Pos DF508/p.G451Va Mild CF 23 Pos DF508/p.L206W Classic CF 9 150s DF508/p.G542Xc Classic CF 15 Pos p.T1036N/p.T1036Na CF, PS 9 Pos DF508/c.3272-26 A>G Classic CF 33 Not done DF508/p.R117Hc Classic CF 35 Not done DF508/p.A455Ec CF 3 Pos p.G551D/p.Y275X a Novel CFTR variant b Complex CFTR allele c Both mutations are on the ACMG/ACOG panel Table 5 Diagnosis of CF in infants/newborns with abnormal newborn screening results Patient number Genotype Age at sequencing Sex Newborn screen result Sweat chloride concentration (mmol/l)a Phenotype 1 DF508/c.2789+2insA 3 months F Positive sweat test 88,96,89,84 Dx of CF, being treated prophylactically 2 DF508/c.2949del5b 3 months F IRT positive 105 Dx of CF 3 p.G551D/c.1259insA 14 months M Positive sweat test ?

In reference to DF508 and 1716G>A. Does this mean these two mutation have resulted in "classic CF"? Does this mean 1716G>A is disease causing?
Gibson75 on 2013-08-12 07:00:25

Login to comment

[hide] The cystic fibrosis transmembrane conductance regu... Hum Genet. 2005 Dec;118(3-4):372-81. Epub 2005 Sep 29. Bishop MD, Freedman SD, Zielenski J, Ahmed N, Dupuis A, Martin S, Ellis L, Shea J, Hopper I, Corey M, Kortan P, Haber G, Ross C, Tzountzouris J, Steele L, Ray PN, Tsui LC, Durie PR
The cystic fibrosis transmembrane conductance regulator gene and ion channel function in patients with idiopathic pancreatitis.
Hum Genet. 2005 Dec;118(3-4):372-81. Epub 2005 Sep 29., [PMID:16193325]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations are associated with cystic fibrosis (CF)-related monosymptomatic conditions, including idiopathic pancreatitis. We evaluated prospectively enrolled patients who had idiopathic recurrent acute pancreatitis or idiopathic chronic pancreatitis, healthy controls, CF heterozygotes, and CF patients (pancreatic insufficient or sufficient) for evidence of CFTR gene mutations and abnormalities of ion transport by sweat chloride and nasal potential difference testing. DNA samples from anonymous blood donors were controls for genotyping. At least one CFTR mutation or variant was carried in 18 of 40 patients (45%) with idiopathic chronic pancreatitis and in 6 of 16 patients (38%) with idiopathic recurrent acute pancreatitis but in only 11 of the 50 controls (22%, P=0.005). Most identified mutations were rare and would not be identified in routine genetic screening. CFTR mutations were identified on both alleles in six patient (11%). Ion transport measurements in patients with pancreatitis showed a wide range of results, from the values in patients with classically diagnosed CF to those in the obligate heterozygotes and healthy controls. In general, ion channel measurements correlated with the number and severity of CFTR mutations. Twelve of 56 patients with pancreatitis (21%) fulfilled current clinical criteria for the diagnosis of CF, but CFTR genotyping alone confirmed the diagnosis in only two of these patients. We concluded that extensive genotyping and ion channel testing are useful to confirm or exclude the diagnosis of CF in the majority of patients with idiopathic pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Sex Type of pancreatitis Age, years CFTR genotype TG repeata Sweat chloride, mmol/lb NTPD DClÀ free+ Iso, mVc Normal Borderline Abnormal Normal Abnormal 1 F Chronic 19 F508deld /L206W 63 Not done 2 M Acute 16 F508deld /R117H(7T)d 10 60 5.0 3 F Chronic 43 F508deld /L967S 46 À2.5 4 F Acute 16 W1282Xd /5T 12 38 1.0 5 F Acute 10 F508deld /D1152H 33 17.0 6 F Chronic 19 5T/5T 11/11 6 15.0 7 F Chronic 33 F508deld /À 69 7.4 8 M Chronic 25 F508deld /À 54 7.0 9 M Chronic 15 F508deld /À 33 14.0 10 F Chronic 33 F508deld /À 26 7.0 11 M Chronic 12 F508deld /À 24 6.0 12 M Chronic 21 2183AA fi G/À 124 Not done 13 F Acute 19 5T/À 11 71 11.0 14 M Chronic 71 5T/À 11 39 19.0 15 F Chronic 38 5T/À 11 20 30.0 16 F Chronic 21 5T/À 11 18 Not done 17 F Chronic 17 5T/À 11 17 Not done 18 F Chronic 26 5T/À No DNA 12 38.0 19 F Chronic 45 5T/À 11 5 34.0 20 F Chronic 40 R75Q/À 32 16.0 21 F Chronic 11 S1235R/À 31 46.0 22 F Acute 1 R170H/À 19 Not done 23 F Acute 14 1716G fi A/À 14 26.0 24 F Chronic 23 1716G fi A/À 12 12.0 25 M Acute 8 À/À 51 15.0 26 M Chronic 67 À/À 46 11.0 27 M Acute 13 À/À 44 36.0 28 F Acute 28 À/À 35 3.0 29 F Chronic 21 À/À 22 6.0 TG12. Login to comment

[hide] Diagnostic dilemmas resulting from the immunoreact... J Pediatr. 2005 Sep;147(3 Suppl):S78-82. Parad RB, Comeau AM
Diagnostic dilemmas resulting from the immunoreactive trypsinogen/DNA cystic fibrosis newborn screening algorithm.
J Pediatr. 2005 Sep;147(3 Suppl):S78-82., [PMID:16202789]

Abstract [show]
OBJECTIVE: To quantitate the proportion of infants identified through cystic fibrosis (CF) newborn screening (NBS) by an immunoreactive trypsinogen (IRT)/DNA screening algorithm who have an unclear diagnosis as defined by the findings of an elevated IRT level and either 1) 2 CF gene (CFTR) mutations detected and sweat chloride level <60 mEq/L; or 2) 0 or 1 CFTR mutations and a "borderline" sweat chloride level >or=30 and <60 mEq/L. STUDY DESIGN: Using the 4-year cohort of CF-affected infants recently described by the Massachusetts CF NBS program, we identified and described the number of infants with the diagnostic characteristics (diagnostic dilemmas) aforementioned. RESULTS: Of infants with positive results on CF NBS who had 1 CFTR mutation detected and a borderline sweat chloride concentration, nearly 20% displayed a second CFTR mutation on further evaluation. Of all infants with positive CF NBS results considered affected with CF, 11% had a diagnosis that fell into 1 of the diagnostic dilemma categories aforementioned. CONCLUSIONS: Four problematic diagnostic categories generated by CF NBS are defined. In the absence of data on the natural history of such infants, careful follow-up is recommended for infants in whom a definitive diagnosis is elusive.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 Two infants with DF508/5T and borderline sweat chloride values were not included in the count of the true positive cohort, however follow-up continues Group IRT (mg/ml) IRT % CFTR Allele 1 CFTR Allele 2 [Cl2 ] mEq/L Sex I 64 97 DF508 R117H-7T 34 F 179 100 DF508 R117H-7T 33 F 79 99 DF508 R117H-7T 49 M 97 99 W1282X 3849110kb 54 M II 176 99.8 DF508 R117H-7T 24 F 129 99.7 G85E R117H 21 F 84 99 G551D R117H-7T 27 M III 94 99.1 DF508 unknown 58 M* 142 100 G85E R117C 33 F 72 98 G551D R117C 46 F 100 99.2 DF508 L206W 35 M IV 141 100 G85Ey R117C 41 M *Identified twin sibling has [Cl2 ] > 60 mEq/L. Login to comment

[hide] Identification of CFTR, PRSS1, and SPINK1 mutation... Pancreas. 2006 Oct;33(3):221-7. Keiles S, Kammesheidt A
Identification of CFTR, PRSS1, and SPINK1 mutations in 381 patients with pancreatitis.
Pancreas. 2006 Oct;33(3):221-7., [PMID:17003641]

Abstract [show]
OBJECTIVES: Chronic pancreatitis is a progressive inflammatory disorder leading to irreversible exocrine and/or endocrine impairment. It is well documented that mutations in the cationic trypsinogen (PRSS1) gene can cause hereditary pancreatitis. Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) and the serine protease inhibitor Kazal type 1 (SPINK1) genes are also associated with pancreatitis. METHODS: We analyzed 381 patients with a primary diagnosis of chronic or recurrent pancreatitis using the Ambry Test: Pancreatitis to obtain comprehensive genetic information for the CFTR, SPINK1, and PRSS1 genes. RESULTS: The results identified 32% (122/381) of patients with 166 mutant CFTR alleles, including 12 novel CFTR variants: 4375-20 A>G, F575Y, K598E, L1260P, G194R, F834L, S573C, 2789 + 17 C>T, 621+83 A>G, T164S, 621+25 A>G, and 3500-19 G>A. Of 122 patients with CFTR mutations, 5.5% (21/381) also carried a SPINK1 mutation, and 1.8% (7/381) carried a PRSS1 mutation. In addition, 8.9% (34/381) of all patients had 1 of 11 different SPINK1 mutations. Another 6.3% (24/381) of the patients had 1 of 8 different PRSS1 mutations. Moreover, 1.3% of the patients (5/381) had 1 PRSS1 and 1 SPINK1 mutation. A total 49% (185/381) of the patients carried one or more mutations. CONCLUSIONS: Comprehensive testing of the CFTR, PRSS1, and SPINK1 genes identified genetic variants in nearly half of all subjects considered by their physicians as candidates for genetic testing. Comprehensive test identified numerous novel variants that would not be identified by standard clinical screening panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Patients With 1 CFTR Mutation CFTR Mutation 1 No. of Patients 1717-1 G9A 1 2789+5 G9A 1 3849+10kb C9T 2 3849+45 G9A 1 621+3 A9G 2 A1364V 1 A349V 1 A455E 1 D1152H 1 D1445N 1 deltaF508 16 E217G 1 F1286C 1 F316L 1 G542X 1 G551D 1 I148T 1 I807M 1 L206W 1 L967S 2 L997F 2 P55S 1 Q179K 1 Q220X 1 R117H 3 R1453W 1 R297Q 1 R31C 1 R668C 2 S1235R 1 S573C 1 S945L 1 V562A 1 V754M 2 Y1092X 1 Total patients 58 MutationsinboldfacewouldnothavebeendetectedbytheACOG/ACMGmutationpanel. Login to comment

[hide] Detection of cystic fibrosis transmembrane conduct... Hum Reprod. 2007 May;22(5):1285-91. Epub 2007 Feb 28. Ratbi I, Legendre M, Niel F, Martin J, Soufir JC, Izard V, Costes B, Costa C, Goossens M, Girodon E
Detection of cystic fibrosis transmembrane conductance regulator (CFTR) gene rearrangements enriches the mutation spectrum in congenital bilateral absence of the vas deferens and impacts on genetic counselling.
Hum Reprod. 2007 May;22(5):1285-91. Epub 2007 Feb 28., [PMID:17329263]

Abstract [show]
BACKGROUND: Mutations in the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene have been widely detected in infertile men with congenital bilateral absence of the vas deferens (CBAVD). Despite extensive analysis of the CFTR gene using varied screening methods, a number of cases remain unsolved and could be attributable to the presence of large gene rearrangements, as recently shown for CF patients. METHODS: We carried out a complete CFTR gene study in a group of 222 CBAVD patients with strict diagnosis criteria and without renal anomaly, and searched for rearrangements using a semi-quantitative assay in a subgroup of 61 patients. RESULTS: The overall mutation detection rate was 87.8%, and 82% of patients carried two mutations. Ten out of the 99 different mutations accounted for 74.6% of identified alleles. Four large rearrangements were found in patients who already carried a mild mutation: two known partial deletions (exons 17a to 18 and 22 to 23), a complete deletion and a new partial duplication (exons 11 to 13). The rearrangements accounted for 7% of the previously unknown alleles and 1% of all identified alleles. CONCLUSIONS: Screening for rearrangements should be part of comprehensive CFTR gene studies in CBAVD patients and may have impacts on genetic counselling for the patients and their families.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 CFTR mutations were detected in 387 out of 444 alleles (87.2%), most of them being previously described in patients with CF of varying severity, CBAVD or other CFTR diseases: 45% of identified alleles consisted of severe CF mutations (e.g. F508del, W1282X, 2183AA.G); 13.8% of mild or variable CF mutations (e.g. L206W, 3272-26A.G, R117H, D1152H); 36.7% of mild CFTR defects which are currently not considered CF-causing (e.g. IVS8(T)5, Q1352H, the complex alleles [D443Y;G576A;R668C] and [R74W;D1270N]) and 4.5% of rare missense mutations whose effect is difficult to predict (e.g. A959V, G1069R, V1153E). Login to comment
69 Frequent cystic fibrosis transmembrane conductance regulator (CFTR) defects found in congenital bilateral absence of the vas deferens (CBAVD) patients (above 1% among the identified alleles) Mutation No. of alleles % of the 390 identified alleles F508dela 119 30.5 IVS8(T)5a,b 107 27.4 (TG)12(T)5 82 (TG)13(T)5 16 (TG)11(T)5b 9 R117Ha 25 6.4 R668C 9 2.3 [D443Y;G576A;R668C] 6 [G576A;R668C] 2 R668C 1 L206W 7 1.8 D1152H 6 1.5 W1282Xa 5 1.3 [V562I;(TG)11(T)5] 5 1.3 [R74W;D1270 N] 4 1.0 [R74W;D1270 N] 3 [R74W;V201M;D1270 N] 1 Q1352H(G . Login to comment
149 Some genotypes had already been described in patients with moderate or late CF, such as those combining F508del with L206W, D1152H, 3272-26A.G or 2789 þ 5G.A. Login to comment

[hide] Molecular characterization of the cystic fibrosis ... Genet Med. 2007 Mar;9(3):163-72. Grangeia A, Sa R, Carvalho F, Martin J, Girodon E, Silva J, Ferraz L, Barros A, Sousa M
Molecular characterization of the cystic fibrosis transmembrane conductance regulator gene in congenital absence of the vas deferens.
Genet Med. 2007 Mar;9(3):163-72., [PMID:17413420]

Abstract [show]
PURPOSE: Approximately 20% of patients with congenital absence of the vas deferens remain without two mutations identified. We applied a strategy of serial screening steps to 45 patients with congenital absence of the vas deferens and characterized cystic fibrosis transmembrane conductance regulator gene mutations in all cases. METHODS: DNA samples of 45 patients with congenital absence of the vas deferens were screened by successive different molecular genetics approaches. RESULTS: Initial screening for the 31 most frequent cystic fibrosis mutations, IVS8 poly(TG)m, poly(T)n, and M470V polymorphisms, identified 8 different mutations in 40 patients (88.9%). Extensive cystic fibrosis transmembrane conductance regulator gene analysis by denaturing gradient gel electrophoresis, denaturing high-performance liquid chromatography, and DNA sequencing detected 17 further mutations, of which three were novel. Cystic fibrosis transmembrane conductance regulator gene rearrangements were searched by semiquantitative fluorescent multiplex polymerase chain reaction, which detected a CFTRdele2,3 (21 kb) large deletion and confirmed two homozygous mutations. Overall, 42 patients (93.3%) had two mutations and 3 patients (6.7%) had one mutation detected. CONCLUSIONS: The present screening strategy allowed a higher mutation detection rate than previous studies, with at least one cystic fibrosis transmembrane conductance regulator gene mutation found in all patients with congenital absence of the vas deferens.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 DeltaF508 was the second most common mutation, representing 21 (23.3%) of total alleles, followed by R334W (6, Table 1 CFTR gene mutations and polymorphisms in patients with congenital absence of the vas deferens Mutation Location Nucleotide alteration Effect Method 1 CFTRdele2,3 Exons 2-3 Deletion of exons 2 and 3 Frameshift QFM-PCR 2 R117H Exon 4 G¡A at 482 AA substitution 31 mutation panel 3 P205S Exon 6a C¡T at 745 AA substitution DGGE/dHPLC 4 L206W Exon 6a T¡G at 749 AA substitution DGGE/dHPLC 5 R258G Exon 6b A¡G at 904 AA substitution DGGE/dHPLC 6 R334W Exon 7 C¡T at 1132 AA substitution 31 mutation panel 7 T5 allele Intron 8 Deletion of 2T at 1342-12 to -6 Aberrant splicing DGGE/DNA sequencing 8 P439S Exon 9 C¡T at 1447 AA substitution DGGE/dHPLC 9 D443Ya Exon 9 G¡T at 1459 AA substitution DGGE/dHPLC 10 I507del Exon 10 Deletion of 3 bp at 1648-1653 AA deletion 31 mutation panel 11 DeltaF508 Exon 10 Deletion of 3 bp at 1652-1655 AA deletion 31 mutation panel 12 G542X Exon 11 G¡T at 1756 Truncation 31 mutation panel 13 V562I Exon 12 G¡A at 1816 AA substitution DGGE/dHPLC 14 G576Aa Exon 12 G¡C at 1859 Aberrant splicing DGGE/dHPLC 15 D614G Exon 13 A¡G at 1973 AA substitution DGGE/dHPLC 16 R688Ca Exon 13 C¡T at 2134 AA substitution DGGE/dHPLC 17 V754M Exon 13 G¡A at 2392 AA substitution DGGE/dHPLC 18 E831X Exon 14a G¡T at 2623 Truncation DGGE/dHPLC 19 3272-26AϾG Intron 17a A¡G at 3272-26 Aberrant splicing DGGE/dHPLC 20 2789ϩ5G¡A Intron 14b G¡A at 2789ϩ5 Aberrant splicing 31 mutation panel 21 V1108L Exon 17b G¡C at 3454 AA substitution DGGE/dHPLC 22 L1227S Exon 19 T¡C at 3812 AA substitution DGGE/dHPLC 23 S1235R Exon 19 T¡G at 3837 AA substitution DGGE/dHPLC 24 P1290S Exon 20 C¡T at 4000 AA substitution DGGE/dHPLC 25 N1303K Exon 21 C¡G at 4041 AA substitution 31 mutation panel 26 E1401K Exon 23 G¡A at 4333 AA substitution DGGE/dHPLC Polymorphisms 1 TG repeats Intron 8 9-13 copies at 1342-12 to -35 Sequence variation DGGE/DNA sequencing 2 M470V Exon 10 A or G at 1540 Sequence variation DNA sequencing 3 125G/C Exon 1 G¡C at 125 Sequence variation DGGE/dHPLC 4 1001ϩ11T/C Intron 6b C¡4T at 1001ϩ11 Sequence variation DGGE/dHPLC 5 1716G/A Exon 10 G¡A at 1716 Sequence variation DGGE/dHPLC 6 1899-136T/G Intron 12 T¡G at 1899-136 Sequence variation DGGE/dHPLC 7 T854T Exon 14a T¡G at 2694 Sequence variation DGGE/dHPLC 8 3601-65C/A Intron 18 C¡A at 3601-65 Sequence variation DGGE/dHPLC 9 4521G/A Exon 24 G¡A at 4521 Sequence variation DGGE/dHPLC QFM-PCR, semiquantitative fluorescent multiplex polymerase chain reaction; bp, base pair; DGGE, denaturing gradient gel electrophoresis; dHPLC, denaturing high-performance liquid chromatography. Login to comment
97 The allelic frequency of the other mutations was 4.4% for R117H, G576A, and R668C, 3.3% for S1235R and 3272-26A¡G, and 2.2% for P205S, L206W, D443Y, G542X, D614G, and N1301K, whereas the remaining 12 mutations were present in single patients (Table 3). Login to comment
101 The missense M470V polymorphism was evaluated in all 45 pa- tientswithCAVD(Table2).TheallelicfrequencyoftheM470variant Table 2 CFTR genotypes identified in patients with congenital absence of the vas deferens CFTR mutation genotypes [(TG)mTn] genotype M470V Patients N % DeltaF508 (TG)10T9 (TG)12T5 M V 11 24.4 DeltaF508 (TG)10T9 (TG)11T5 M M 1 2.2 DeltaF508 R117H (TG)10T9 (TG)10T7 M M 2 4.4 G542X (TG)10T9 (TG)12T5 M V 2a 4.4 DeltaF508 R334W (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 D443Y-G576A-R668C (TG)10T9 (TG)10T7 M M 1 2.2 DeltaF508 D614G (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 E831X (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 L1227S (TG)10T9 (TG)11T7 M M 1 2.2 DeltaF508 E1401K (TG)10T9 (TG)11T7 M V 1 2.2 I507del D614G (TG)11T7 (TG)10T7 M V 1 2.2 N1303K L206W (TG)10T9 (TG)9T9 M M 1 2.2 R117H P205S (TG)11T7 (TG)10T7 M V 1 2.2 R117H R334W (TG)10T7 (TG)11T7 M V 1 2.2 R334W P439S (TG)11T7 (TG)11T7 M V 1 2.2 R334W R334Wb (TG)11T7 (TG)11T7 V V 1 2.2 R334W V562I (TG)11T7 (TG)11T5 V M 1 2.2 D443Y-G576A-R668C 3272-26A¡G (TG)10T7 (TG)10T7 M M 1 2.2 G576A-R668C V754Mb (TG)10T7 (TG)11T7 M M 1 2.2 S1235R S1235Rb (TG)13T5 (TG)13T5 M M 1 2.2 2789ϩ5G¡A S1235Rb (TG)10T7 (TG)13T5 M M 1 2.2 3272-26A¡G P1290S (TG)11T7 (TG)10T7 M V 1 2.2 P205S (TG)11T7 (TG)12T5 V V 1 2.2 G576A-R668C b (TG)10T7 (TG)11T5 M M 1 2.2 V1108L b (TG)11T7 (TG)11T5 V M 1 2.2 N1303K (TG)10T9 (TG)12T5 M V 1 2.2 3272-26A¡G b (TG)10T7 (TG)12T5 M V 1 2.2 CFTRdele2,3 b (TG)11T7 (TG)13T5 V M 1 2.2 b (TG)11T5 (TG)12T5 M V 1 2.2 b (TG)13T5 (TG)12T5 M V 1 2.2 DeltaF508 - (TG)10T9 (TG)11T7 M V 1a 2.2 L206W -b (TG)9T9 (TG)11T7 M V 1 2.2 R258G -b (TG)11T7 (TG)11T7 V V 1 2.2 a CUAVD. Login to comment
110 Large Table 3 Allelic frequencies of CFTR mutations in patients with congenital absence of the vas deferens CBAVD CUAVD Total Patients 42 3 45 Alleles 84 6 90 Mutations N % N % N % 1 T5 allele 26a 31 2 33.3 28 31.1 2 DeltaF508 20 23.8 1 16.7 21 23.3 3 R334W 6a 7.1 0 0 6 6.7 4 R117H 4 4.8 0 0 4 4.4 5 G576A 4b 4.8 0 0 4 4.4 6 R688C 4b 4.8 0 0 4 4.4 7 S1235R 3a 3.6 0 0 3 3.3 8 3272-26A¡G 3 3.6 0 0 3 3.3 9 P205S 2 2.4 0 0 2 2.2 10 L206W 2 2.4 0 0 2 2.2 11 D443Y 2b 2.4 0 0 2 2.2 13 D614G 2 2.4 0 0 2 2.2 14 N1303K 2 2.4 0 0 2 2.2 12 G542X 0 0 2 33.3 2 2.2 15 R258G 1 1.2 0 0 1 1.1 16 P439S 1 1.2 0 0 1 1.1 17 I507del 1 1.2 0 0 1 1.1 18 V562I 1 1.2 0 0 1 1.1 19 V754M 1 1.2 0 0 1 1.1 20 E831X 1 1.2 0 0 1 1.1 21 2789ϩ5G¡A 1 1.2 0 0 1 1.1 22 V1108L 1 1.2 0 0 1 1.1 23 L1227S 1 1.2 0 0 1 1.1 24 P1290S 1 1.2 0 0 1 1.1 25 E1401K 1 1.2 0 0 1 1.1 26 CFTRdele2,3 1 1.2 0 0 1 1.1 CBAVD, congenital bilateral absence of the vas deferens; CUAVD, congenital unilateral absence of the vas deferens. Login to comment

[hide] Fenretinide corrects newly found ceramide deficien... Am J Respir Cell Mol Biol. 2008 Jan;38(1):47-56. Epub 2007 Jul 26. Guilbault C, De Sanctis JB, Wojewodka G, Saeed Z, Lachance C, Skinner TA, Vilela RM, Kubow S, Lands LC, Hajduch M, Matouk E, Radzioch D
Fenretinide corrects newly found ceramide deficiency in cystic fibrosis.
Am J Respir Cell Mol Biol. 2008 Jan;38(1):47-56. Epub 2007 Jul 26., [PMID:17656682]

Abstract [show]
Chronic and persistent lung infections cause the majority of morbidity and mortality in patients with cystic fibrosis (CF). Galactosyl ceramide has been previously shown to be involved in Pseudomonas internalization. Therefore, we assessed ceramide levels in the plasma of patients with CF and compared them to healthy volunteers using high-performance liquid chromatography followed by mass spectrometry. Our results demonstrate that patients with CF display significantly lower levels of several ceramide sphingolipid species, specifically C14:0, C20:1, C22:0, C22:1, and C24:0 ceramides, and dihydroxy ceramide (DHC16:0). We report that Cftr-knockout mice display diminished ceramide levels in CF-related organs (lung, pancreas, ileum, and plasma) compared with their littermate controls. Since it has been previously reported that in vitro treatment with fenretinide induced ceramide in neuroblastoma cell lines, we decided to test this drug in vivo using our Cftr-knockout mice in an attempt to correct this newly identified defect in ceramide levels. We demonstrate that treatment with fenretinide is able to increase ceramide concentrations in CF-related organs. We further assessed the biological effect of fenretinide on the ability of Cftr-knockout mice to combat lung infection with P. aeruginosa. Our data show dramatic improvement in the ability of Cftr-knockout mice to control P. aeruginosa infection. Overall, these findings not only document a novel deficiency in several ceramide species in patients with CF, but also demonstrate a pharmacologic means to correct this defect in Cftr-knockout mice. Our data provide a strong rationale for clinical intervention that may benefit patients with CF suffering from CF lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
179 T/L206W CF (n 5 10) 50† 37.2 6 4.2 58.5 6 3.0 166.7 6 3.4 21.0 6 1.0 HC (n 5 10)‡ 50† 34.7 6 4.2 70.1 6 4.3 166.2 6 3.4 25.4 6 1.3 Definition of abbreviations: BMI, body mass index; CF, cystic fibrosis; HC, healthy control. Login to comment

[hide] Negative genetic neonatal screening for cystic fib... Clin Genet. 2007 Oct;72(4):374-7. Girardet A, Guittard C, Altieri JP, Templin C, Stremler N, Beroud C, des Georges M, Claustres M
Negative genetic neonatal screening for cystic fibrosis caused by compound heterozygosity for two large CFTR rearrangements.
Clin Genet. 2007 Oct;72(4):374-7., [PMID:17850636]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 CFTR mutations identified through the neonatal screening of 84 newborns Mutations Frequency (%) p.Phe508del* 59.52 p.Arg117His* 5.35 p.Gly542X* 2.98 [3849110 kbC.T]* 2.39 p.Arg334Trp* 1.19 p.Arg1162X* 1.19 [2183AA.G]* 1.19 [1717-1G.A]* 1.19 p.Arg1066Cys 1.19 p.Glu1104X 1.19 Total 77.38 Mutations found only once 22.62 Mutations found in a single cystic fibrosis allele: p.Arg75X*, p.Tyr122X*, 71111G.T*, 1078delT*, p.Ile507del*, p.Gly551Asp*, p.Ser1251Asn*, p.Trp1282X*, p.Asn1303Lys*, 62113A.G, p.Leu206Trp, p.Gln220X, p.Gln237Glu, 100115G.A, (TG)12T5, p.Ile506Val, p.Ile506Thr, 1717- 3T.C, p.Leu558Ser, 1802delC, p.Lys710X, p.Leu732X, 2380del8, p.Cys832X, 262211G.A, p.Arg851X, 2634delT, 3007delG, p.Leu997Phe, 3041-15T.G, 3121-1G.A, p.Arg1102X, p.Gly1127Glu, 3750delAG, 3850-1G.A, 400511G.A, and two large rearrangements c.54-5811_c. Login to comment

[hide] N-terminal CFTR missense variants severely affect ... Hum Mutat. 2008 May;29(5):738-49. Gene GG, Llobet A, Larriba S, de Semir D, Martinez I, Escalada A, Solsona C, Casals T, Aran JM
N-terminal CFTR missense variants severely affect the behavior of the CFTR chloride channel.
Hum Mutat. 2008 May;29(5):738-49., [PMID:18306312]

Abstract [show]
Over 1,500 cystic fibrosis transmembrane conductance regulator (CFTR) gene sequence variations have been identified in patients with cystic fibrosis (CF) and related disorders involving an impaired function of the CFTR chloride channel. However, detailed structure-function analyses have only been established for a few of them. This study aimed evaluating the impact of eight N-terminus CFTR natural missense changes on channel behavior. By site-directed mutagenesis, we generated four CFTR variants in the N-terminal cytoplasmic tail (p.P5L, p.S50P, p.E60K, and p.R75Q) and four in the first transmembrane segment of membrane-spanning domain 1 (p.G85E/V, p.Y89C, and p.E92K). Immunoblot analysis revealed that p.S50P, p.E60K, p.G85E/V, and p.E92K produced only core-glycosylated proteins. Immunofluorescence and whole cell patch-clamp confirmed intracellular retention, thus reflecting a defect of CFTR folding and/or trafficking. In contrast, both p.R75Q and p.Y89C had a glycosylation pattern and a subcellular distribution comparable to the wild-type CFTR, while the percentage of mature p.P5L was considerably reduced, suggesting a major biogenesis flaw on this channel. Nevertheless, whole-cell chloride currents were recorded for all three variants. Single-channel patch-clamp analyses revealed that the channel activity of p.R75Q appeared similar to that of the wild-type CFTR, while both p.P5L and p.Y89C channels displayed abnormal gating. Overall, our results predict a major impact of the CFTR missense variants analyzed, except p.R75Q, on the CF phenotype and highlight the importance of the CFTR N-terminus on channel physiology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
133 Genotype^Phenotype Correlation in the N-Terminal CFTR MissenseVariants Under StudyÃ Missense varianta Phenotype Second allele (number of patients)b p.P5L CF p.F508del (1), p.P205S (1) p.S50P CBAVD p.F508del (1), p.E115del (1) p.E60K CF p.G542X (1), p.I507del (1) p.R75Q HT p.F508del (3), p.E725K (1) B p.R347H (1), p.R75Q (1), n.i. (4) Br c.1584G4A (2), c.1210-7_1210-6delTT (1), n.i.(3) NT p.F508del (1) CP c.1584G4A (1), n.i. (3) MI n.i. (1) CUAVD n.i. (2) OZ n.i. (2) Normal p.R75Q (1), c.2052_2053insA (1), n.i. (1) p.G85E CF p.F508del (8), p.G542X (2), p.I507del (1), c.580-1G4T (1), p.G85E (1), c.1477_ 1478delCA (1) CBAVD p.G576A (1) HT p.L997F (1),WT (1) p.G85V CF p.F508del (2), p.G542X (2), p.Y1092X (1), c.265715G4A (1), p.A1006E, c.1210-7_1210- 6delTT (1), n.i. (1) p.Y89C CF n.i. (1)c p.E92K CF p.F508del (2), p.Q890X (1), p.L206W (1) CBAVD c.1210-7_1210-6delTT (1) ÃThe recommendations for mutation nomenclature (www.hgvs.org/mutnomen/) were used to name CFTR gene sequence variations at both the nucleotide level and the protein level. Login to comment

[hide] Distribution of CFTR mutations in Saguenay- Lac-Sa... Genet Med. 2008 Mar;10(3):201-6. Madore AM, Prevost C, Dorfman R, Taylor C, Durie P, Zielenski J, Laprise C
Distribution of CFTR mutations in Saguenay- Lac-Saint-Jean: proposal of a panel of mutations for population screening.
Genet Med. 2008 Mar;10(3):201-6., [PMID:18344710]

Abstract [show]
PURPOSE: Saguenay-Lac-Saint-Jean is a region located in the northeastern part of the Province of Quebec, Canada, and is characterized by a founder effect. In this region, it has been documented that the incidence of cystic fibrosis reached 1/902 live births between 1975 and 1988, three times higher than the average incidence of 1/2500 live births reported in other Caucasian populations. This corresponds to a carrier rate of 1/15. METHODS: Using genotyping data from the Canadian Consortium for Cystic Fibrosis Genetic Studies, this article describes the cystic fibrosis transmembrane conductance regulator profile of the cystic fibrosis population living in the Saguenay-Lac-Saint-Jean region and compares it with cystic fibrosis populations living in three other regions of the Province of Quebec. RESULTS: Significant differences in allelic frequencies of common mutations (as DeltaF508, 621 + 1G>T and A455E), and in percentage of covered allele with three or six mutations, were found in Saguenay-Lac-Saint-Jean compared to other regions. Based on this result, two mutation panels exceeding 90% sensitivity threshold are now proposed for cystic fibrosis carrier screening in this region. CONCLUSION: The implementation of the proposed carrier screening program could diminish the incidence of this disease in this region and allow future parents to make informed decisions about family planning.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Altogether, the six mutations represent 95.89% of the CFTR allele of CF patients in the SLSJ population, whereas the proportions are 86.85, 85.27, and Table 2 Cystic fibrosis mutations present in the four populations studied Mutationa Allelic frequency (number of alleles [%]) Populationb 1 2 3 4 „F508 106 (62.35) 55 (72.37) 398 (72.36) 67 (57.78) 621 ؉ 1G>T 42 (24.71) 6 (7.89) 30 (5.45) 1 (0.85) A455E 12 (7.06) 2 (2.63) 14 (2.55) 1 (0.85) 3199del6 1 (0.59) 1 (1.32) 7 (1.27) 1 (0.85) 711 ؉ 1G>T 1 (0.59) 1 (1.32) 15 (2.73) 1 (0.85) Y1092X 1 (0.59) 1 (1.32) 5 (0.91) 0 R117C 2 (1.18) 0 0 0 ‚I507 1 (0.59) 2 (2.63) 10 (1.82) 0 L206W 1 (0.59) 1 (1.32) 9 (1.64) 0 R1158X 1 (0.59) 0 0 0 S489X 1 (0.59) 0 1 (0.18) 0 R553X 0 2 (2.63) 2 (0.36) 0 R334W 0 1 (1.32) 2 (0.36) 0 G542X 0 0 10 (1.82) 0 G85E 0 0 6 (1.09) 5 (4.24) N1303K 0 0 5 (0.91) 1 (0.85) IVS8-5T 0 0 4 (0.73) 0 W1282X 0 0 3 (0.55) 7 (5.93) R347P 0 0 1 (0.18) 2 (1.69) V520F 0 0 1 (0.18) 0 I1027T 0 0 1 (0.18) 0 R1066C/IVS 0 0 1 (0.18) 0 Q1313X 0 0 1 (0.18) 0 1898ϩ3GϾA 0 0 1 (0.18) 0 2183AAϾG 0 0 1 (0.18) 0 2951insA 0 0 1 (0.18) 0 G551D 0 0 0 2 (1.69) 1525-iG-A 0 0 0 2 (1.69) Y109C 0 0 0 1 (0.85) S549N 0 0 0 1 (0.85) 3154del1G 0 0 0 1 (0.85) UNKNOWN 1 (0.59) 4 (5.26) 20 (3.82) 25 (21.19) Number of alleles genotypedc 170 (100) 76 (100) 550 (100) 118 (100) a The six mutations included in the panels proposed are in bold. Login to comment

[hide] Sweat chloride testing in infants identified as he... J Pediatr. 2008 Dec;153(6):857-9. Soultan ZN, Foster MM, Newman NB, Anbar RD
Sweat chloride testing in infants identified as heterozygote carriers by newborn screening.
J Pediatr. 2008 Dec;153(6):857-9., [PMID:19014821]

Abstract [show]
The reference ranges for sweat [C1(-)] were reevaluated in 300 infants referred to our Center as carriers of at least 1 cystic fibrosis mutation identified through newborn screening. The recommended borderline range of 30 to 59 mmol/L failed to identify all individuals who were compound heterozygotes. Our data support using a borderline range of 24 to 59 mmol/L.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Sweat [Cl- ] and the results of genetic screening of 11 patients with [Cl- ] > 24 mmol/L Patients Sweat [Cl- ] mmol/L Mutations Poly T-TG Repeats 1 89 91 R347P CFTRdel 17a-18 7T/9T 2 85 82 ⌬F508 2622ϩ1 GϾT 9T/9T 3 71 - G542X Y1014del 7T/9T 4 69 65 ⌬F508 c.759AϾG 9T/7T 5 58 49 ⌬F508 L206W 9T/9T 6 44 27 ⌬F508 R352W, P750L - 7 38 41 ⌬F508 - 9T-TG10 5T-TG12 8 24 - ⌬F508 - 9T-TG10 5T-TG12 9 25 27 ⌬F508 - 9T-TG10 5T-TG12 10 24 25 ⌬F508 - 9T-TG12 5T-TG12 11 35 26 ⌬F508 - 9T 9T Soultan et al The Journal of Pediatrics • December 2008 should be followed. Login to comment

[hide] Independent contribution of common CFTR variants t... Pancreas. 2010 Mar;39(2):209-15. de Cid R, Ramos MD, Aparisi L, Garcia C, Mora J, Estivill X, Farre A, Casals T
Independent contribution of common CFTR variants to chronic pancreatitis.
Pancreas. 2010 Mar;39(2):209-15., [PMID:19812525]

Abstract [show]
OBJECTIVE: We have assessed whether CFTR gene has a major impact on chronic pancreatitis (CP) pathogenesis than that provided by the CFTR mutations. For this aim, we have evaluated clinical parameters, CFTR mutations, and 3 potential regulatory CFTR variants (coding single-nucleotide polymorphisms): c.1540A>G, c.2694T>G, and c.4521G>A. METHODS: CFTR gene analysis was performed in a cohort of 136 CP patients and 93 controls from Spanish population using current scanning techniques (single-strand conformation polymorphism/heteroduplex, denaturing gradient gel electrophoresis, and denaturing high-performance liquid chromatography) and direct sequencing. RESULTS: A higher frequency of CFTR mutations were observed in patients (39%) than in controls (15%; P < or = 0.001), differences being mostly attributable to the prevalence of the cystic fibrosis (CF)-causing mutations (P = 0.009). The analysis of variants has shown statistically significant differences between patients and controls for c.4521G>A (Pcorrected = 0.036). Furthermore, the multi-marker analysis revealed that the 1540A;2694G;4521A (AGA) haplotype was more prevalent in CP than controls (Pcorrected = 0.042). Remarkably, this association was unrelated to CF-causing mutations (P = 0.006). CONCLUSIONS: Our results corroborate the higher susceptibility of CF carriers to CP and, furthermore, suggest that the AGA haplotype could contribute to an increased risk in the development of CP irrespective of other CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Scanning Methodology Applied in CFTR Gene Analysis Amplicon Name Fragment Size, bp Control Set (n = 93) Patient Set 1 (n = 68) Patient Set 2 (n = 68) Control Sequence Exon 1 192 SSCP/HD SSCP/HD dHPLC 125G9C Exon 2 334 SSCP/HD SSCP/HD dHPLC 296+3insT Exon 3 309 DGGE DGGE dHPLC G85V Exon 4 436 SSCP/HD SSCP/HD dHPLC R117H Exon 5 466 DGGE DGGE dHPLC R170H Exon 6a 345 SSCP/HD SSCP/HD dHPLC L206W Exon 6b 331 SSCP/HD SSCP/HD SSCP/HD TTGA 6/7 Exon 7 410 SSCP/HD SSCP/HD dHPLC R334W Exon 8 328 DGGE DGGE dHPLC 1341+28C9T Exon 9 375 DGGE DGGE DGGE 7T/9T Exon 10 493 SSCP/HD SSCP/HD SSCP/HD F508del; 1540A/A Exon 11 322 DGGE DGGE dHPLC S549R Exon 12 426 DGGE DGGE dHPLC G576A Exon 13a 532 SSCP/HD SSCP/HD dHPLC R668C Exon 13b 498 SSCP/HD SSCP/HD dHPLC I807M Exon 14a 284 DGGE DGGE DGGE 2694T9G Exon 14b 211 DGGE DGGE dHPLC 2789+5G9A Exon 15 487 DGGE DGGE dHPLC D924N Exon 16 294 SSCP/HD SSCP/HD dHPLC 3041-71G9C Exon 17a 294 SSCP/HD SSCP/HD dHPLC L997F Exon 17b 463 DGGE DGGE dHPLC 3272-26A9G Exon 18 451 DGGE DGGE dHPLC N1148K Exon 19 588 SSCP/HD SSCP/HD SSCP/HD 3601-65C9A Exon 20 471 DGGE DGGE dHPLC W1282X Exon 21 477 DGGE DGGE DGGE 4029G9A Exon 22 339 SSCP/HD SSCP/HD dHPLC Q1352H Exon 23 249 DGGE DGGE dHPLC 4374+13A9G Exon 24 362 SSCP/HD SSCP/HD SSCP/HD 4521G9A Control set, general population series analyzed; patient set 1, previous patient series reported in 2004; and patient set 2, new patient series analyzed in this study. Login to comment

[hide] CFTR mutations in cystic fibrosis patients from Mu... Clin Genet. 2009 Dec;76(6):577-9. Epub 2009 Oct 21. Moya-Quiles MR, Mondejar-Lopez P, Pastor-Vivero MD, Gonzalez-Gallego I, Juan-Fita MJ, Egea-Mellado JM, Carbonell P, Casals T, Fernandez-Sanchez A, Sanchez-Solis M, Glover G
CFTR mutations in cystic fibrosis patients from Murcia region (southeastern Spain): implications for genetic testing.
Clin Genet. 2009 Dec;76(6):577-9. Epub 2009 Oct 21., [PMID:19845690]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
17 of chromosomes Frequency (%) F508dela E.10 67 36.8 G542Xa E.11 22 12.1 A1006E E.17a 10 5.5 K710X E.13 10 5.5 2789+5G>Aa I.14b 9 4.9 L206W E.6a 7 3.8 1811+1.6kbA>G I.11 6 3.3 R334Wa E.7 5 2.7 2869insG E.15 5 2.7 I507dela E.10 4 2.2 N1303Ka E.21 4 2.2 R347Pa E.7 3 1.6 711+1G>Ta I.5 3 1.6 3849+10kbC>Ta I.19 3 1.6 Q890X E.15 3 1.6 R117Ha E.4 2 1.1 R1162Xa E.19 2 1.1 2183AA>Ga E.13 2 1.1 A561E E.12 2 1.1 R560G E.11 2 1.1 1717-1G>Aa I.10 1 0.5 E1308X E.21 1 0.5 E585X E.12 1 0.5 L997F E.17a 1 0.5 1677delTA E.10 1 0.5 R1158X E.19 1 0.5 W202X E.6a 1 0.5 R74W+D1270N E.3 + E.20 1 0.5 G576A+R668C E.12 + E.13 1 0.5 Unknown 2 1.1 Total 182 100 aCFTR mutations identified with the PCR OLA CF Genotyping Assay . Login to comment

[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For many of these subjects mutations were identified following DGGE and/or dHPLC analysis, and not through the RDB-based test, as gene alterations are "rare"/uncommon [A238V, R352W, S42F, (V201M, D1270N & R74W) and L206W] or because they have never been identified before [D372E (1251T→G) and L1414S (4373T→C)]. Login to comment
97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction. Login to comment
99 Notes to Tables: (A) CFTR mutations A238V, R352W, 4006-19del3, S42F, D372E (1251T→G), L1414S (4373T→C), (V201M, D1270N & R74W) and L206W are not included in the RDB-based screening. Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment
57 PI prevalence and in silico prediction scores for 13 most frequent missense mutations identified in Canadian CF patients Mutation Total PI Total (PI + PS) PI prevalence Class PANTHER scorea POLYPHENa SIFTa p.R334W 1 9 0.11 CF-PS -7.4419 Possibly damaging 0.01 p.P67L 2 14 0.14 CF-PS -4.1736 Probably damaging 0 p.R347P 2 12 0.17 CF-PS -7.5259 Possibly damaging 0.01 p.R347H 1 5 0.20 CF-PS -6.8327 Possibly damaging 0 p.A455E 8 39 0.21 CF-PS -8.8641 Probably damaging 0 p.L206W 4 19 0.21 CF-PS -8.5817 Possibly damaging 0 p.P574H 4 7 0.57 CF-PI/PSb -8.1252 Probably damaging 0 p.G85E 15 24 0.63 CF-PI/PSb -7.3194 Possibly damaging 0 p.M1101K 22 33 0.67 CF-PI/PSb -5.8849 Probably damaging 0.01 p.R1066C 7 8 0.88 CF-PI -7.7424 Probably damaging 0 p.G551D 56 59 0.95 CF-PI -9.5654 Probably damaging 0 p.N1303K 47 49 0.96 CF-PI -9.7687 Probably damaging 0 p.V520F 7 7 1.00 CF-PI -7.1652 Benign 0 aPANTHER scores range from zero to negative values (maximum -12). Login to comment
122 However, it completely misclassified other well-established mutations with low PI prevalence scores (p.L206W, p.R334W, p.R347P and p.A455E). Login to comment
124 SIFT-generated low (deleterious) scores for missense mutations associated both with the highest (p.N1303K, p.G551D, p.V520F) and the lowest PI prevalence scores (p.A455E, p.P67L, p.L206W). Login to comment

[hide] Association of cystic fibrosis genetic modifiers w... Fertil Steril. 2010 Nov;94(6):2122-7. Epub 2010 Jan 25. Havasi V, Rowe SM, Kolettis PN, Dayangac D, Sahin A, Grangeia A, Carvalho F, Barros A, Sousa M, Bassas L, Casals T, Sorscher EJ
Association of cystic fibrosis genetic modifiers with congenital bilateral absence of the vas deferens.
Fertil Steril. 2010 Nov;94(6):2122-7. Epub 2010 Jan 25., [PMID:20100616]

Abstract [show]
OBJECTIVE: To investigate whether genetic modifiers of cystic fibrosis (CF) lung disease also predispose to congenital bilateral absence of the vas deferens (CBAVD) in association with cystic fibrosis transmembrane conductance regulator (CFTR) mutations. We tested the hypothesis that polymorphisms of transforming growth factor (TGF)-beta1 (rs 1982073, rs 1800471) and endothelin receptor type A (EDNRA) (rs 5335, rs 1801708) are associated with the CBAVD phenotype. DESIGN: Genotyping of subjects with clinical CBAVD. SETTING: Outpatient and hospital-based clinical evaluation. PATIENT(S): DNA samples from 80 subjects with CBAVD and 51 healthy male controls from various regions of Europe. This is one of the largest genetic studies of this disease to date. INTERVENTION(S): None. MAIN OUTCOME MEASURE(S): Genotype analysis. RESULT(S): For single nucleotide polymorphism (SNP) rs 5335, we found increased frequency of the CC genotype among subjects with CBAVD. The difference was significant among Turkish patients versus controls (45.2% vs. 19.4%), and between all cases versus controls (36% vs. 15.7%). No associations between CBAVD penetrance and polymorphisms rs 1982073, rs 1800471, or rs 1801708 were observed. CONCLUSION(S): Our findings indicate that endothelin receptor type A polymorphism rs 5335 may be associated with CBAVD penetrance. To our knowledge, this is the first study to investigate genetic modifiers relevant to CBAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Portuguese CFTR alleles Spanish CFTR alleles Turkish CFTR alleles 5T 22 F508del 11 5T 20 F508del 14 5T 9 D1152H 14 R334W 5 D443Ya 3 D110H 3 R117H 3 G576Aa 3 F508del 2 S1235R 3 R668Ca 3 3041-11del7 2 N1303K 2 G542X 2 1767del6 2 P205S 2 R117H 2 2789þ5G>A 2 D614G 2 V232D 2 CFTRdele2(ins186) 2 G542X 1 L997F 1 3120þ1G>A 1 L206W 1 H609R 1 G1130A 1 V562I 1 N1303H 1 M952I 1 I507del 1 L206W 1 365insT 1 3272-26A>G 1 3272-26A/G 1 E585X 1 2789þ5G>A 1 L15P 1 2752-15C>G 1 G576Aa 1 R347H 1 R334Q 1 R668Ca 1 2689insG 1 R347H 1 CFTRdele2,3 1 R1070W 1 E831X 1 L1227S 1 I 1027T 1 R1070W 1 E831X 1 3272-26A>G 1 L997F 1 I853F 1 A349V 1 6T 1 Note: CFTR ¼ cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] Measurement of nasal potential difference in young... Thorax. 2010 Jun;65(6):539-44. Sermet-Gaudelus I, Girodon E, Roussel D, Deneuville E, Bui S, Huet F, Guillot M, Aboutaam R, Renouil M, Munck A, des Georges M, Iron A, Thauvin-Robinet C, Fajac I, Lenoir G, Roussey M, Edelman A
Measurement of nasal potential difference in young children with an equivocal sweat test following newborn screening for cystic fibrosis.
Thorax. 2010 Jun;65(6):539-44., [PMID:20522854]

Abstract [show]
BACKGROUND: A challenging problem arising from cystic fibrosis (CF) newborn screening is the significant number of infants with hypertrypsinaemia (HIRT) with sweat chloride levels in the intermediate range and only one or no identified CF-causing mutations. OBJECTIVES: To investigate the diagnostic value for CF of assessing CF transmembrane conductance regulator (CFTR) protein function by measuring nasal potential difference in children with HIRT. METHODS: A specially designed protocol was used to assess nasal potential difference (NPD) in 23 young children with HIRT (3 months-4 years) with inconclusive neonatal screening. Results were analysed with a composite score including CFTR-dependent sodium and chloride secretion. Results were correlated with genotype after extensive genetic screening and with clinical phenotype at follow-up 3 years later. RESULTS: NPD was interpretable for 21 children with HIRT: 13 had NPD composite scores in the CF range. All 13 were finally found to carry two CFTR mutations. At follow-up, nine had developed a chronic pulmonary disease consistent with a CF diagnosis. The sweat test could be repeated in nine children, and six had sweat chloride values >or=60 mmol/l. Of the eight children with normal NPD scores, only two had two CFTR mutations, both wide-spectrum mutations. None had developed a CF-like lung disease at follow-up. The sweat test could be reassessed in five of these eight children and all had sweat chloride values <60 mmol/l. CF diagnosis was ruled out in six of these eight children. CONCLUSION: Evaluation of CFTR function in the nasal epithelium of young children with inconclusive results at CF newborn screening is a useful diagnostic tool for CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
130 Table 3 Genotypes of the children with HIRT according to the diagnostic score cut-off in the 21 patients with reliable NPD tests; results after extensive genetic analysis CFTR genotypes Diagnosis score >0.27 (8 patients) £0.27 (13 patients) A/A 0 F508del/621+3A/G F508del/Q1291R A/AB F508del/R347H F508del/R117H;T7 W846X/R117C n¼2 F508del/R1070W 2183AA/G/L206W F508del/3272-26A/G F508del/R117H;T7; n¼4 A/D 0 F508del/R933G G551D/R352Q B/D G622D/3849+45G/A 0 A/0 F508del/0 n¼2 0 0/0 3 0 0, no identified mutation; A, CF-causing mutation; B, mutation associated with cystic CFTR-related disorders; C, mutation with no clinical consequence ; D, mutation of unknown or uncertain clinical relevance; AB, mutation that is associated with a wide phenotypic spectrum that might belong to either group A or B. CFTR, cystic fibrosis transmembrane conductance regulator; HIRT, hypertrypsinaemia; NPD, nasal potential difference. Login to comment

[hide] Clinical phenotype and genotype of children with b... Am J Respir Crit Care Med. 2010 Oct 1;182(7):929-36. Epub 2010 Jun 10. Sermet-Gaudelus I, Girodon E, Sands D, Stremmler N, Vavrova V, Deneuville E, Reix P, Bui S, Huet F, Lebourgeois M, Munck A, Iron A, Skalicka V, Bienvenu T, Roussel D, Lenoir G, Bellon G, Sarles J, Macek M, Roussey M, Fajac I, Edelman A
Clinical phenotype and genotype of children with borderline sweat test and abnormal nasal epithelial chloride transport.
Am J Respir Crit Care Med. 2010 Oct 1;182(7):929-36. Epub 2010 Jun 10., 2010-10-01 [PMID:20538955]

Abstract [show]
RATIONALE: The diagnosis of cystic fibrosis (CF) is based on a characteristic clinical picture in association with a sweat chloride (Cl(-)) concentration greater than 60 mmol/L or the identification of two CF-causing mutations. A challenging problem is the significant number of children for whom no definitive diagnosis is possible because they present with symptoms suggestive of CF, a sweat chloride level in the intermediate range between 30 and 60 mmol/L, and only one or no identified CF-causing mutation. OBJECTIVES: To investigate the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein in the airways of children with intermediate sweat tests and inconclusive genetic findings in correlation with clinical phenotype and genotype. METHODS: We developed a composite nasal potential difference (NPD) diagnostic score to discriminate patients with CF from non-CF patients. We tested NPD in 50 children (age, 6 mo to 18 yr) with equivocal diagnoses and correlated the NPD diagnostic score with clinical phenotypes and genotypes. MEASUREMENTS AND MAIN RESULTS: Fifteen of the 50 children had NPD scores in the CF range. Eight of the 15 carried two CFTR mutations compared with only 5 of the 35 children with normal NPD scores (P = 0.01). They were significantly younger at evaluation and had recurrent lower respiratory tract infections, chronic productive coughs, and chronic Staphylococcus aureus colonization significantly more often than the 35 children with normal NPD results. CONCLUSIONS: Evaluation of CFTR function in the nasal epithelium of children with inconclusive CF diagnoses can be a useful diagnostic tool and help clinicians to individualize therapeutic strategy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
162 CLINICAL CHARACTERISTICS OF CHILDREN WITH EQUIVOCAL DIAGNOSES AND NASAL POTENTIAL DIFFERENCE DIAGNOSTIC SCORE <0.27 Pt Mutation Age (yr) NPD Score Sweat Cl2 Chronic CF Pulmonary Disease CF Pathogens Airway Obstruction CF Lung Imaging FEV1 (%) BMI Others 1 F508del/S977F A-D 8 0.181 43 RLRTI, chronic productive cough S. aureus No Bronchiectasis 80 14.5 No Bronchial thickening Atelectasis 2 0/0 4 0.121 43 No S. aureus Yes Air trapping NA 13 Pancreatic extracts 0-0 Bronchial thickening 3 0/0 15 20.032 46 RLRTI S. aureus, P. aeruginosa Yes Air trapping 74 14 Polyposis 0-0 Bronchiectasis 4 F508del/0 2 20.249 57 RLRTI P. aeruginosa Yes Air trapping NA 16 No A-0 5 N1303K/(TG12)T5 11.8 20.263 47 RLRTI S. aureus, P. aeruginosa No Bronchial thickening ND 20 No A-B 6 F508del/L206W 5.9 20.278 40 RLRTI S. aureus No Bronchial thickening 115 22 Chronic pancreatitis A-AB 7 R668C/0 15 20.403 40 RLRTI None Yes Bronchiectasis 112 20 No B-0 Air trapping 8 F508del/L997F A-B 1 20.594 38 RLRTI, chronic productive cough P. aeruginosa No Bronchial thickening NA 16 CF hepatopathy 9 G576A;R668C/S1235R 8 20.659 31 0 None Wheezing Normal 100 20 No B-B 10 G542X/0 5 20.718 49 RLRTI, chronic productive cough S. aureus No Bronchial thickening NA 18 No A-0 11 0/0 7 20.742 37 RLRTI None No Normal 106 18 No 0-0 12 F508del/D110E 16 20.777 50 No S. aureus No No 100 21 No A-AB 13 F508del/R1070W 7 21.006 40 RLRTI S. aureus Wheezing Bronchial thickening 110 14 No A-AB 14 F508del-L467F/0 12 21.897 55 RLRTI, chronic productive cough S. aureus No Bronchiectasis 109 17 Pansinusitis A-0 15 F508del/H1054D 9 22.327 59 RLRTI, chronic productive cough S. aureus No Bronchial thickening 100 20 DIOS A-D Definition of abbreviations: A, B, AB, and D: A 5 CF-causing mutation; B 5 mutation that results in a CFTR-RD (clinical entities associated with CFTR mutations that do not meet the current diagnostic criteria for CF); AB 5 wide-spectrum mutation that may belong to either group A or group B; D 5 mutation of uncertain clinical relevance; BMI 5 body mass index; CF 5 cystic fibrosis; CFTR 5 gene encoding cystic fibrosis transmembrane conductance regulator; DIOS 5 distal intestinal obstructive syndrome; NA 5 not applicable; ND 5 not determined; NPD 5 nasal potential difference; P. aeruginosa 5 Pseudomonas aeruginosa; Pt 5 patient; RLRTI 5 recurrent lower respiratory tract infection; S. aureus 5 Staphylococcus aureus. Login to comment

[hide] Cystic fibrosis carrier testing in an ethnically d... Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7. Rohlfs EM, Zhou Z, Heim RA, Nagan N, Rosenblum LS, Flynn K, Scholl T, Akmaev VR, Sirko-Osadsa DA, Allitto BA, Sugarman EA
Cystic fibrosis carrier testing in an ethnically diverse US population.
Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7., [PMID:21474639]

Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) and the frequency of specific disease-causing mutations vary among populations. Affected individuals experience a range of serious clinical consequences, notably lung and pancreatic disease, which are only partially dependent on genotype. METHODS: An allele-specific primer-extension reaction, liquid-phase hybridization to a bead array, and subsequent fluorescence detection were used in testing for carriers of 98 CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations among 364 890 referred individuals with no family history of CF. RESULTS: One in 38 individuals carried one of the 98 CFTR mutations included in this panel. Of the 87 different mutations detected, 18 were limited to a single ethnic group. African American, Hispanic, and Asian individuals accounted for 33% of the individuals tested. The mutation frequency distribution of Caucasians was significantly different from that of each of these ethnic groups (P < 1 x 10(1)). CONCLUSIONS: Carrier testing using a broad mutation panel detects differences in the distribution of mutations among ethnic groups in the US.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 The median fluorescent intensity was determined, and the presence or absence of mutant and wild-type alleles was evaluated from the ratio of the mutant signal to the wild-type signal for the following mutations: c.1155_1156dupTA, c.2657ϩ5GϾA, c.3717ϩ12191CϾT, p.A455E, p.D1152H, p.F508del, p.G542X, p.G551D, p.I507del, p.L206W, p.N1303K, p.R117H, p.W1282X, and c.54-5940_ 273ϩ10250del21kb. Login to comment
123 CFTR mutationsa Individuals, n p.F508del/p.R117H 16 5T/9T 1 7T/9T 15 p.F508del/p.D1152H 3 p.R117H/p.R117H, 7T/7T 2 p.D1152H/p.D1152H 2 p.W1282X/p.D1152H 2 p.D1152H/p.G551D 1 c.3717ϩ12191CϾT/p.R352Q 1 c.3717ϩ12191CϾT/c.3717ϩ12191CϾT 1 p.F508del/c.3717ϩ12191CϾT 1 p.F508del/p.L206W 1 p.F508del/p.R117C 1 p.F508del/p.R347H 1 p.F508del/p.R347P 1 p.R117H/p.W1282X, 7T/7T 1 p.R117H/p.G551D, 7T/7T 1 p.R117H/p.G542X, 7T/9T 1 a Human Genome Variation Society nomenclature [Ogino et al. (23)]. Login to comment

[hide] Channel-lining residues in the M3 membrane-spannin... Biochemistry. 1998 Sep 1;37(35):12233-40. Akabas MH
Channel-lining residues in the M3 membrane-spanning segment of the cystic fibrosis transmembrane conductance regulator.
Biochemistry. 1998 Sep 1;37(35):12233-40., 1998-09-01 [PMID:9724537]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) forms a chloride-selective channel. Residues from the 12 putative membrane-spanning segments form at least part of the channel lining. We need to identify the channel-lining residues in order to understand the structural basis for the channel's functional properties. Using the substituted-cysteine-accessibility method we mutated to cysteine, one at a time, 24 consecutive residues (Asp192-Ile215) in the M3 membrane-spanning segment. Cysteines substituted for His199, Phe200, Trp202, Ile203, Pro205, Gln207, Leu211, and Leu214 reacted with charged, sulfhydryl-specific reagents that are derivatives of methanethiosulfonate (MTS). We infer that these residues are on the water-accessible surface of the protein and probably form a portion of the channel lining. When plotted on an alpha-helical wheel the exposed residues from Gln207 to Leu214 lie within an arc of 60 degrees; the exposed residues in the cytoplasmic half (His199-Ile203) lie within an arc of 160 degrees. We infer that the secondary structures of the extracellular and cytoplasmic halves of M3 are alpha-helical and that Pro205, in the middle of the M3 segment, may bend the M3 segment, moving the cytoplasmic end of the segment in toward the central axis of the channel. The bend in the M3 segment may help to narrow the channel lumen near the cytoplasmic end. In addition, unlike full-length CFTR, the current induced by the deletion construct, Delta259, is inhibited by the MTS reagents, implying that the channel structure of Delta259 is different than the channel structure of wild-type CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
222 Several mutations of residues in and flanking the M3 membrane-spanning segment have been identified in patients with CF, including D192G, E193K, H199Y, P205S, and L206W (58, 60-63). Login to comment

[hide] Testicular CFTR splice variants in patients with c... Hum Mol Genet. 1998 Oct;7(11):1739-43. Larriba S, Bassas L, Gimenez J, Ramos MD, Segura A, Nunes V, Estivill X, Casals T
Testicular CFTR splice variants in patients with congenital absence of the vas deferens.
Hum Mol Genet. 1998 Oct;7(11):1739-43., [PMID:9736775]

Abstract [show]
The involvement of the five thymidine (5T) variant in intron 8 of the cystic fibrosis membrane regulator (CFTR) gene in congenital bilateral absence of the vas deferens (CBAVD) phenotype has been extensively demonstrated. This variant leads to alternative splicing of the CFTR gene which results in a wild-type transcript and one without exon 9. Little is known about expression of the CFTR gene in the testis. We analysed the level of the aberrantly spliced transcripts in testicular biopsies and correlated it with disease expression. Quantitative RT-PCR analysis in testicular biopsies from control and CBAVD patients showed a correlation between the length of the IVS8-6(T) n tract and the level of alternatively spliced transcripts. Results from histological analysis also suggest an involvement of the alternative transcript in the spermatogenic status of patients, leading to a decreased number of mature sperm forms in the tubule.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 RESULTS CFTR analysis Eight different mutations (R117H, L206W, V232D, ∆F508, G542X, 711+1G→T, D1270N and 2789+5G→A) were found in nine of the 12 CBAVD patients, yielding a CFTR mutation frequencyof75%.ThreepatientspresentedtwoCFTRmutations, with one of them homozygous for the V232D mutation. Login to comment
26 CFTR genotype, IVS8-6 poly(T) allele and proportion of exon 9+ (E9+) and exon 9- (E9-) CFTR transcripts in testicular and epididymal biopsies Sample Phenotype CF mutation IVS8-6(T) Testis Epididymis n E9+ (%) E9- (%) n E9+ (%) E9- (%) 1 Non-CBAVD N/N 9T/9T 5 99 ± 0 1 ± 0 2 Non-CBAVD N/N 7T/7T 2 96 ± 2 4 ± 2 3 Non-CBAVD N/N 7T/7T 3 98 ± 0 2 ± 0 4 Non-CBAVD N/N 7T/7T 3 97 ± 1.5 3 ± 1.5 5 Non-CBAVD R334W/N 7T/7T 3 94 ± 1 6 ± 1 6 Non-CBAVD N/N 7T/7T 2 95 ± 1 5 ± 1 7 CBAVD V232D/V232D 9T/9T 4 96 ± 1.5 4 ± 1.5 8 CBAVD ∆F508/N 9T/9T 2 99 ± 0 1 ± 0 9 CBAVD ∆F508/D1270N 7T/9T 2 98 ± 1 2 ± 1 10 CBAVD G542X/2789+5G→A 7T/9T 2 96 ± 1 4 ± 1 11 CBAVD N/N 7T/7T 3 96 ± 2 4 ± 2 2 90 ± 3 10 ± 3 12 CBAVD N/N 7T/7T 2 94 ± 2 6 ± 2 5 78 ± 5 22 ± 5 13 CBAVD R117H/N 7T/7T 2 99 ± 0 1 ± 0 4 95 ± 2 5 ± 2 14 CBAVD G542X/5T 5T/9T 3 30 ± 2 70 ± 2 15 CBAVD ∆F508/5T 5T/9T 2 80 ± 5 20 ± 5 16 CBAVD L206W/5T 5T/9T 2 58 ± 2 42 ± 2 17 CBAVD 711+1G→T/5T 5T/7T 3 77 ± 4 23 ± 4 18 CBAVD 5T/N 5T/7T 5 71 ± 2 29 ± 2 The mean proportion of E9+ and E9- CFTR transcripts is calculated as the mean of the proportions found for each sample. Login to comment

[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]

Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 (%) p.F508del # E.10 1009 (51.74) p.G542X # E.11 150 (7.69) p.N1303K # E.21 57 (2.92) c.1811 + 1.6kbA > G I.11 36 (1.84) p.R334W # E.7 35 (1.79) p.L206W E.6a 32 (1.64) c.711 + 1G > T # I.5 31 (1.58) p.Q890X E.15 28 (1.43) p.R1162X # E.19 25 (1.28) c.2789 + 5G > A # I.14b 24 (1.23) p.R1066C E.17b 23 (1.18) p.I507del # E.10 21 (1.07) c.1609delCA E.10 18 (0.92) c.712-1G > T I.5 18 (0.92) c.3272-26A > G I.17a 18 (0.92) c.2183AA > G # E.13 16 (0.82) p.G85E # E.3 15 (0.77) c.2869insG E.15 15 (0.77) p.W1282X # E.20 15 (0.77) p.V232D E.6a 14 (0.71) p.A1006E * E.17a 12 (0.61) c.2184insA E.13 11 (0.56) p.K710X E.13 11 (0.56) TOTAL (n = 23) 1,634 (83.72) * , the complex allele [p.A1006E; p.V562I; IVS8-6(5T)] #, CF mutations identified with the Celera Diagnosis Cystic Fibrosis v2 genotyping assay and the Inno-Lipa CFTR12, CFTR17 + Tn Samples with microsatellite haplotypes 16/45-46-47 (IVS8CA/IVS17bTA) were submitted to direct analysis of the c.1811 + 1.6kbA > G mutation, which was found mainly associated with the 16-46 haplotype. Login to comment
53 #, CF mutations identified with the Celera Diagnosis Cystic Fibrosis v2 genotyping assay and the Inno-Lipa CFTR12, CFTR17 + Tn p.L206W, p.Q890X and p.R1066C, presented with frequencies above 1%, while 51 mutations (42%) were found only once (Table 2). Login to comment
68 In addition, the p.L206W mutation was always found to be associated with the rare haplotype 9T-9TG, and the c.1811 + 1.6kbA > G mutation with the c.3601-111G > C polymorphism. Login to comment
76 It is not surprising that four of the common mutations, presenting with frequencies above 1% (c.1811 + 1.6kbA > G, p.L206W, p.Q890X and p.R1066C), were undetected by these panels (Table 1). Login to comment
84 Comparing this mutation update with our previous report (Casals et al. 1997), we observed that some mild mutations, c.2789 + 5G > A and p.L206W, should now be considered as common mutations (relative frequency >1%). Login to comment
105 Our impression is that Table 3 Common CF mutations identified in this study and in several Latin American populations Mutation This study Hispanic1 Mexico2 Colombia3 Brazil4 Argentina5 Chile6 p.F508del 51.7 51.6 40.7 41.8 48.4 58.6 45.0 p.G542X 7.7 4.0 6.2 3.8 8.8 4.1 7.0 p.N1303K 2.9 0.8 2.0 0.5 2.5 2.7 - c.1811 + 1,6kbA > G 1.8 - - 6.5 - 0.9 - p.R334W 1.8 1.6 - 0.5 2.5 1.1 2.0 p.L206W 1.6 - - - 0.6 - - c.711 + 1G > T 1.6 - - - - - - p.Q890X 1.4 - - - - - - p.R1162X 1.3 0.8 - 1.1 2.5 0.4 2.0 c.2789 + 5G > A 1.2 - - 0.5 0.3 0.7 - p.R1066C 1.2 1.6 - 0.5 - 0.2 - p.I507del 1.0 - 2.6 - - 0.7 - c.2183AA > G 0.8 - 1.0 - 0.2 - p.G85E 0.7 0.8 0.5 - 1.3 0.7 - p.W1282X 0.7 0.8 - 1.1 1.3 2.7 5.0 c.3849 + 10kbC > T 0.4 4.0 0.5 - - 0.9 3.0 p.S549N - 2.4 2.6 - - - - c.3120 + 1G > A - 1.6 - 0.5 - - - c.3876delA - 5.6 - - - - - c.406-1G > A - 1.6 1.5 - - - - c.935delA - 1.6 1.0 - - - - p.R75X - 0.8 1.5 - - - - c.2055del9 - - 1.0 - - - - p.I506T - - 1.0 - - - - c.3199del6 - - 1.0 - - - - p.S549R 0.4 - - 2.2 - 0.2 - c.1717-1G > A 0.2 - - - 0.3 1.1 - p.G551D 0.2 0.8 0.5 - - - 1.0 p.R553X 0.4 - 0.5 - 0.6 0.2 1.0 No. Login to comment

[hide] Clinical outcome of preimplantation genetic diagno... Eur J Hum Genet. 2007 Jul;15(7):752-8. Epub 2007 Apr 18. Keymolen K, Goossens V, De Rycke M, Sermon K, Boelaert K, Bonduelle M, Van Steirteghem A, Liebaers I
Clinical outcome of preimplantation genetic diagnosis for cystic fibrosis: the Brussels' experience.
Eur J Hum Genet. 2007 Jul;15(7):752-8. Epub 2007 Apr 18., [PMID:17440499]

Abstract [show]
Preimplantation genetic diagnosis is an alternative for prenatal diagnosis that makes it possible to perform the diagnosis of a chromosomal or monogenic disorder at the preimplantation embryo level. Cystic fibrosis is one of the monogenic diseases for which PGD can be performed. In this study, we looked at the requests and PGD cycles for this particular disorder over an 11-year period. Sixty-eight percent of the requests eventually led to at least one complete PGD cycle. In 80% of the cycles, an embryo transfer was performed and an ongoing pregnancy was obtained in 22.2% of the cycles with oocyte retrieval. After embryo transfer, a couple had 27.8% chance of giving birth to a liveborn child. No misdiagnosis was recorded. The rate of perinatal deaths/stillborn children was relatively high, but no excess of major congenital anomalies was observed in the surviving children.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 2 p.F508del/- p.N1303K/- 1 p.Q493X/- p.F508del/- 1 p.F508del/- p.R1162X/- 1 p.4218insT/- p.N1303K/- 1 p.G673X/- p.F508del/- 1 p.W1282X/- p.G542X/- 1 p.F508del/- p.W1282X/- 1 p.W1282X/- p.F508del/- 2 p.F508del/- p.G551D/- 1 p.D1168G/- p.L206W/- 1 If we express these results per cycle with oocyte retrieval, this means that in each cycle there was an average of 12.5 COCs, giving 5.1 embryos to be biopsied with an 80% chance of having an embryo transfer and a 22.2% chance of having an ongoing pregnancy with the delivery of a child. Login to comment

[hide] UMD-CFTR: a database dedicated to CF and CFTR-rela... Hum Mutat. 2010 Sep;31(9):1011-9. Bareil C, Theze C, Beroud C, Hamroun D, Guittard C, Rene C, Paulet D, Georges M, Claustres M
UMD-CFTR: a database dedicated to CF and CFTR-related disorders.
Hum Mutat. 2010 Sep;31(9):1011-9., [PMID:20607857]

Abstract [show]
With the increasing knowledge of cystic fibrosis (CF) and CFTR-related diseases (CFTR-RD), the number of sequence variations in the CFTR gene is constantly raising. CF and particularly CFTR-RD provide a particular challenge because of many unclassified variants and identical genotypes associated with different phenotypes. Using the Universal Mutation Database (UMD) software we have constructed UMD-CFTR (freely available at the URL: http://www.umd.be/CFTR/), the first comprehensive relational CFTR database that allows an in-depth analysis and annotation of all variations identified in individuals whose CFTR genes have been analyzed extensively. The system has been tested on the molecular data from 757 patients (540 CF and 217 CBAVD) including disease-causing, unclassified, and nonpathogenic alterations (301 different sequence variations) representing 3,973 entries. Tools are provided to assess the pathogenicity of mutations. UMD-CFTR also offers a number of query tools and graphical views providing instant access to the list of mutations, their frequencies, positions and predicted consequences, or correlations between genotypes, haplotypes, and phenotypes. UMD-CFTR offers a way to compile not only disease-causing genotypes but also haplotypes. It will help the CFTR scientific and medical communities to improve sequence variation interpretation, evaluate the putative influence of haplotypes on mutations, and correlate molecular data with phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Several sequence changes initially reported as causing disease have subsequently been reported to be neutral sequence variants (a typical illustration is the variant p.Ile148Thr) [Claustres et al., 2004; Rohlfs et al., 2004] or mutations with reduced penetrance (only some patients will develop CF or CFTR-related disorder; example: p.Arg117His) [Kiesewetter et al., 1993; Rosenstein and Cutting, 1998; Thauvin-Robinet et al., 2009] or mutations with variable expressivity (some patients develop mild rather than severe symptoms; examples include p.Leu206Trp [Desgeorges et al., 1995; Rozen et al., 1995] or p.Asp1152His [Burgel et al., 2010; Mussaffi et al., 2006]). Login to comment

[hide] Membrane-integration characteristics of two ABC tr... J Mol Biol. 2009 Apr 17;387(5):1153-64. Epub 2009 Feb 21. Enquist K, Fransson M, Boekel C, Bengtsson I, Geiger K, Lang L, Pettersson A, Johansson S, von Heijne G, Nilsson I
Membrane-integration characteristics of two ABC transporters, CFTR and P-glycoprotein.
J Mol Biol. 2009 Apr 17;387(5):1153-64. Epub 2009 Feb 21., [PMID:19236881]

Abstract [show]
To what extent do corresponding transmembrane helices in related integral membrane proteins have different membrane-insertion characteristics? Here, we compare, side-by-side, the membrane insertion characteristics of the 12 transmembrane helices in the adenosine triphosphate-binding cassette (ABC) transporters, P-glycoprotein (P-gp) and the cystic fibrosis transmembrane conductance regulator (CFTR). Our results show that 10 of the 12 CFTR transmembrane segments can insert independently into the ER membrane. In contrast, only three of the P-gp transmembrane segments are independently stable in the membrane, while the majority depend on the presence of neighboring loops and/or transmembrane segments for efficient insertion. Membrane-insertion characteristics can thus vary widely between related proteins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ΔM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
109 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ƊM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment

[hide] beta-Adrenergic Sweat Secretion as a Diagnostic Te... Am J Respir Crit Care Med. 2012 Oct 15;186(8):732-9. doi: 10.1164/rccm.201205-0922OC. Epub 2012 Aug 2. Quinton P, Molyneux L, Ip W, Dupuis A, Avolio J, Tullis E, Conrad D, Shamsuddin AK, Durie P, Gonska T
beta-Adrenergic Sweat Secretion as a Diagnostic Test for Cystic Fibrosis.
Am J Respir Crit Care Med. 2012 Oct 15;186(8):732-9. doi: 10.1164/rccm.201205-0922OC. Epub 2012 Aug 2., [PMID:22859523]

Abstract [show]
Rationale: beta-Adrenergically induced sweat secretion offers an expedient method to assess native cystic fibrosis transmembrane conductance regulator (CFTR) secretory function in vivo. Objectives: To evaluate the sensitivity, specificity, and reliability of a test based on the activity and secretory function of CFTR in the sweat gland. Methods: Primary and validation trials with prospectively ascertained healthy control subjects, obligate heterozygotes, and patients with a CFTR-related disorder and CF (pancreatic sufficient and insufficient). Measurements and Main Results: Diagnostic accuracy and reliability of beta-adrenergic sweat secretory rates using an evaporimeter was assessed and compared with sweat chloride concentrations. The cholinergically stimulated mean sweat rate did not differ among groups. The mean maximal beta-adrenergically stimulated sweat rate in heterozygotes was about half the rate of healthy control subjects, and completely absent in pancreatic-insufficient patients with CF and pancreatic-sufficient patients with CF (P < 0.0001). Subjects with a CFTR-related disorder showed reduced or absent beta-adrenergic sweat secretion. The beta-adrenergic secretory response demonstrated high diagnostic accuracy (area under a characteristic receiver-operator curve = 0.99; 95% confidence interval, 0.97-1.00) and reliability (intraclass correlation, 0.90; 95% confidence interval, 0.81-0.95). The diagnostic cutoff level for CF, derived from the primary trial, correctly identified all control subjects, heterozygotes, and patients with CF in the validation cohort, whereas concurrent sweat chloride measurements misclassified one heterozygote and five subjects with CF. The cholinergic and beta-adrenergic sweat secretion rates were lower in women compared with men (P < 0.001). Conclusions: beta-Adrenergic sweat secretion rate determined by evaporimetry is an accurate and reliable technique to assess different levels of CFTR function and to identify patients with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 DIAGNOSTIC CHARACTERISTICS OF PARTICIPANTS IN THE VALIDATION COHORT Group Age (yr) Sex Genotype Sweat Cl2 (mmol/L) Cholinergic b-Adrenergic Ratio b/Chol Healthy 38 M 2/2 15 64.45 72.79 1.13 Healthy 39 M 2/2 18 81.61 86.08 1.05 Healthy 54 F 2/2 29 48.90 47.30 0.97 Healthy 64 F 2/2 28 50.64 57.54 1.14 Healthy 54 F 2/2 11 68.63 52.30 0.76 Hetero. 64 M F508del/2 16 68.21 36.78 0.54 Hetero. 56 M F508del/2 53 82.44 59.57 0.72 Hetero. 27 F F508del/2 11 78.30 46.30 0.59 Hetero. 29 F F508del/2 16 65.63 26.13 0.40 Hetero. 51 F G551D/2 62 39.13 16.50 0.42 CFTR-RD CBAVD 41 M W1282X/5T 55 84.61 20.69 20.01 CFTR-RD CBAVD 52 M F508del/R117H (7T) 57 70.39 20.61 20.01 CFTR-RD CBAVD 41 M F508del/5T 40 68.00 22.29 20.03 CFTR-RD CBAVD 47 M G551D/R117H (7T) 57 65.93 10.08 0.15 CFTR-RD CBAVD 40 M L206W/W216C 42 67.80 17.00 0.25 CFTR-RD CBAVD 26 M 36599delC15T/7T 55 91.55 0.18 0.00 CFTR-RD Sinopulm 65 F F508del/c.876-9_876-6delGATT 51 74.30 32.20 0.43 CFTR-RD Sinopulm 39 F R764X/2 12 24.64 3.49 0.14 CFTR-RD Sinopulm 17 F 5T/2 50 52.95 14.24 0.27 CFPS 21 M F508del/2 97 46.19 0.56 0.01 CFPS 33 M F508del/3849110kbC.T 50 76.22 22.94 20.04 CFPS 58 M 71111G.T/A455E 72 70.19 23.06 20.04 CFPS 41 M G551D/3849110kbC.T 88 87.37 0.08 0.00 CFPS 54 F F508del/R117C 59 36.74 1.06 0.03 CFPS 23 F F508del/A455E 82 64.85 3.46 0.05 CFPS 30 F D1152H/D1152H 31 41.52 23.54 20.09 CFPS 55 F G551D/2 99 67.62 21.78 20.03 CFPS 42 F F508del/1002-2A.G 94 27.64 2.63 0.10 CFPS 46 F 3849110kbC.T/3849110kbC.T 53 24.43 21.16 20.05 CFPS 14 F R1162X/3849110kbC.T 46 50.19 20.49 20.01 CFPI 32 M F508del/F508del 108 73.93 1.41 0.02 CFPI 28 M F508del/F508del 84 95.13 3.45 0.04 CFPI 24 F F508del/F508del 109 60.48 4.06 0.07 CFPI 34 F F508del/F508del 115 79.24 0.99 0.01 CFPI 35 F F508del/F508del 87 79.79 23.02 20.04 CFPI 44 F F508del/F508del 112 80.60 1.23 0.02 CFPI 23 F F508del/G551D 90 45.80 0.80 0.02 Definition of abbreviations: CBAVD ¼ congenital bilateral absence of vas deference; CF ¼ cystic fibrosis; CFPI ¼ pancreatic-insufficient patients with CF; CFPS ¼ pancreatic-sufficient patients with CF; CFTR ¼ CF transmembrane regulator; CFTR-RD ¼ CFTR-related disorder; hetero ¼ heterozygotes; sinopulm ¼ chronic sinopulmonary disease. Login to comment
82 Four men with congenital bilateral absence of vas deference (CBAVD) (W1282X/5T, F508del/R117H [7T], F508del/5T, and 36599delC17T/5T) showed no b-adrenergic secretory response; one woman with chronic sinopulmonary disease (F508del/c.876-9_876-6delGATT) responded comparably with heterozygotes; two men with CBAVD (G551D/ R117H and L206W/W216C) and two women with chronic sinopulmonary disease (5T/2 and R764X/2) demonstrated b-adrenergic sweat secretion that was reduced compared with heterozygotes (Figure 3A, Table 1). Login to comment
43 DIAGNOSTIC CHARACTERISTICS OF PARTICIPANTS IN THE VALIDATION COHORT Group Age (yr) Sex Genotype Sweat Cl2 (mmol/L) Cholinergic b-Adrenergic Ratio b/Chol Healthy 38 M 2/2 15 64.45 72.79 1.13 Healthy 39 M 2/2 18 81.61 86.08 1.05 Healthy 54 F 2/2 29 48.90 47.30 0.97 Healthy 64 F 2/2 28 50.64 57.54 1.14 Healthy 54 F 2/2 11 68.63 52.30 0.76 Hetero. 64 M F508del/2 16 68.21 36.78 0.54 Hetero. 56 M F508del/2 53 82.44 59.57 0.72 Hetero. 27 F F508del/2 11 78.30 46.30 0.59 Hetero. 29 F F508del/2 16 65.63 26.13 0.40 Hetero. 51 F G551D/2 62 39.13 16.50 0.42 CFTR-RD CBAVD 41 M W1282X/5T 55 84.61 20.69 20.01 CFTR-RD CBAVD 52 M F508del/R117H (7T) 57 70.39 20.61 20.01 CFTR-RD CBAVD 41 M F508del/5T 40 68.00 22.29 20.03 CFTR-RD CBAVD 47 M G551D/R117H (7T) 57 65.93 10.08 0.15 CFTR-RD CBAVD 40 M L206W/W216C 42 67.80 17.00 0.25 CFTR-RD CBAVD 26 M 36599delC15T/7T 55 91.55 0.18 0.00 CFTR-RD Sinopulm 65 F F508del/c.876-9_876-6delGATT 51 74.30 32.20 0.43 CFTR-RD Sinopulm 39 F R764X/2 12 24.64 3.49 0.14 CFTR-RD Sinopulm 17 F 5T/2 50 52.95 14.24 0.27 CFPS 21 M F508del/2 97 46.19 0.56 0.01 CFPS 33 M F508del/3849110kbC.T 50 76.22 22.94 20.04 CFPS 58 M 71111G.T/A455E 72 70.19 23.06 20.04 CFPS 41 M G551D/3849110kbC.T 88 87.37 0.08 0.00 CFPS 54 F F508del/R117C 59 36.74 1.06 0.03 CFPS 23 F F508del/A455E 82 64.85 3.46 0.05 CFPS 30 F D1152H/D1152H 31 41.52 23.54 20.09 CFPS 55 F G551D/2 99 67.62 21.78 20.03 CFPS 42 F F508del/1002-2A.G 94 27.64 2.63 0.10 CFPS 46 F 3849110kbC.T/3849110kbC.T 53 24.43 21.16 20.05 CFPS 14 F R1162X/3849110kbC.T 46 50.19 20.49 20.01 CFPI 32 M F508del/F508del 108 73.93 1.41 0.02 CFPI 28 M F508del/F508del 84 95.13 3.45 0.04 CFPI 24 F F508del/F508del 109 60.48 4.06 0.07 CFPI 34 F F508del/F508del 115 79.24 0.99 0.01 CFPI 35 F F508del/F508del 87 79.79 23.02 20.04 CFPI 44 F F508del/F508del 112 80.60 1.23 0.02 CFPI 23 F F508del/G551D 90 45.80 0.80 0.02 Definition of abbreviations: CBAVD &#bc; congenital bilateral absence of vas deference; CF &#bc; cystic fibrosis; CFPI &#bc; pancreatic-insufficient patients with CF; CFPS &#bc; pancreatic-sufficient patients with CF; CFTR &#bc; CF transmembrane regulator; CFTR-RD &#bc; CFTR-related disorder; hetero &#bc; heterozygotes; sinopulm &#bc; chronic sinopulmonary disease. Login to comment
83 Four men with congenital bilateral absence of vas deference (CBAVD) (W1282X/5T, F508del/R117H [7T], F508del/5T, and 36599delC17T/5T) showed no b-adrenergic secretory response; one woman with chronic sinopulmonary disease (F508del/c.876-9_876-6delGATT) responded comparably with heterozygotes; two men with CBAVD (G551D/ R117H and L206W/W216C) and two women with chronic sinopulmonary disease (5T/2 and R764X/2) demonstrated b-adrenergic sweat secretion that was reduced compared with heterozygotes (Figure 3A, Table 1). Login to comment

[hide] Management of male infertility due to congenital b... Andrologia. 2012 Oct;44(5):358-62. doi: 10.1111/j.1439-0272.2012.01288.x. Epub 2012 Mar 6. Grzegorczyk V, Rives N, Sibert L, Dominique S, Mace B
Management of male infertility due to congenital bilateral absence of vas deferens should not ignore the diagnosis of cystic fibrosis.
Andrologia. 2012 Oct;44(5):358-62. doi: 10.1111/j.1439-0272.2012.01288.x. Epub 2012 Mar 6., [PMID:22390181]

Abstract [show]
Microsurgical or percutaneous epididymal sperm aspiration and intracytoplasmic sperm injection (ICSI) are proposed to overcome male infertility due to congenital bilateral absence of vas deferens (CBAVD). CBAVD has been associated with mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and consequently, genetic counselling has to be addressed before beginning ICSI procedure. However, management of male infertility due to CBAVD should not ignore a mild form of cystic fibrosis. We describe the case of cystic fibrosis late diagnosis performed in a 49-year-old infertile men with CBAVD. CFTR molecular testing detected two mutations F508del and A455E corresponding to a cystic fibrosis genotype. Pneumological evaluation revealed a severe obstructive respiratory disease, bronchiectasis and high sweat chloride levels. Symptoms consistent with a cystic fibrosis have to be identified in infertile men with CBAVD before beginning assisted reproductive procedures.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
49 Some genotypes had been described in patients with moderate or late CF, such as those with F508del/L206W, F508del/D1152H, F508del/A455E like in our patient. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]

Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]

Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

[hide] Improvement of defective cystic fibrosis airway ep... Eur Respir J. 2012 Apr 10. Trinh NT, Bardou O, Prive A, Maille E, Adam D, Lingee S, Ferraro P, Desrosiers MY, Coraux C, Brochiero E
Improvement of defective cystic fibrosis airway epithelial wound repair after CFTR rescue.
Eur Respir J. 2012 Apr 10., [PMID:22496330]

Abstract [show]
Airway damage and remodelling are important components of lung pathology progression in cystic fibrosis (CF). Although repair mechanisms are engaged to restore the epithelial integrity, these processes are obviously insufficient to maintain lung function in CF airways. Our aims were therefore to study how the basic CFTR defect could impact epithelial wound-healing and to determine if CFTR correction could improve it.Wound-healing experiments, as well as cell migration and proliferation assays, were performed to study the early phases of epithelial repair in human CF and non-CF airway cells. CFTR function was evaluated using CFTR siRNA and inhibitor GlyH101 in non-CF cells, and conversely after CFTR rescue with the CFTR corrector VRT-325 in CF cells.Wound-healing experiments first showed that airway cells from CF patients repaired slower than non-CF cells. CFTR inhibition or silencing in non-CF primary airway cells significantly inhibited wound-closure. GlyH101 also decreased cell migration and proliferation. Interestingly, wt-CFTR transduction in CF airway cell lines or CFTR correction with VRT-325 in CFBE-DeltaF508 and primary CF bronchial monolayers significantly improved wound-healing.Altogether our results demonstrated that functional CFTR plays a critical role in wound-repair, and CFTR correction may represent a novel strategy to promote the airway repair processes in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Primary human bronchial cells were isolated from CF homozygous F508/F508 lung transplants (median age 31 years, mean FEV1 23.6±2.1%) and non-CF donors, while primary human nasal cells were recovered after polypectomy procedures from non-CF and CF patients (with various genotypes, i.e. 2 homozygous F508/F508, 1 F508/A555E and 1 C621+1GT/P-L206W, median age 16 years, mean FEV1 of 81.6±14.2%), according to ethically-approved protocols. Login to comment

[hide] Frequency of the hyperactive W493R ENaC variant in... J Cyst Fibros. 2012 Jan;11(1):53-5. Epub 2011 Sep 13. Handschick M, Hedtfeld S, Tummler B
Frequency of the hyperactive W493R ENaC variant in carriers of a CFTR mutation.
J Cyst Fibros. 2012 Jan;11(1):53-5. Epub 2011 Sep 13., [PMID:21917531]

Abstract [show]
BACKGROUND: The basic defect of the autosomal recessive disorder cystic fibrosis (CF) manifests in chloride hyposecretion and sodium hyperabsorption. CF-like disease has been reported in a heterozygous carrier of F508del CFTR and the hyperactive variant p.W493R-SCNN1A of the epithelial sodium channel (ENaC). METHODS: The hypothesis that heterozygosity for p.W493R-SCNN1A and one loss-of-function CFTR mutation causes or predisposes to CF or CF-like disease was tested in 441 parents of a child with CF. RESULTS: p.W493R-SCNN1A was detected in three female carriers of F508del CFTR who did not show any symptoms of respiratory or intestinal disease that could be interpreted as the manifestation of CF or CFTR-related disorder. Frequency of p.W493R was lower in CF parents than in Caucasian control subjects. CONCLUSIONS: A hyperactive ENaC does not necessarily cause CF-like disease in a CF gene carrier, but its low frequency in CF parents suggests that it is a risk factor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 A. Caucasians a F508del 378 2184delA 2 CFTRdele2,3(21 kb) 4 2789+5 G-A 1 R117H 1 I1005R 1 405+1 G-A 1 L1077P 1 H199Y 1 Y1092X 1 L206W 1 3601-111 G-C 1 R347P 3 3849+10 kb C-T 1 Q414X 1 3850-3 T-G 1 G551D 4 W1282X 1 R553X 8 N1303K 2 1717-1 G-A 1 4374+1 G-T 1 2143delT 1 Unknown 9 B. Turks K68N 1 1525-1 G-A 1 G85E 1 F508del 2 E92K 1 1677delTA 1 CFTRdele2(ins186) 2 2184delA 1 CFTRdele2,3(21 kb) 2 3601-2 A-G 1 435insA 1 Unknown 1 a The subjects were born in Austria (N=9 subjects), Belgium (2), France (4), Germany (374), Greece (4), Italy (12), The Netherlands (7), Poland (2), Spain (5), Sweden (2) and United Kingdom (5). Login to comment

[hide] Measurements of CFTR-Mediated Cl(-) Secretion in H... PLoS One. 2012;7(10):e47708. doi: 10.1371/journal.pone.0047708. Epub 2012 Oct 17. Sousa M, Servidoni MF, Vinagre AM, Ramalho AS, Bonadia LC, Felicio V, Ribeiro MA, Uliyakina I, Marson FA, Kmit A, Cardoso SR, Ribeiro JD, Bertuzzo CS, Sousa L, Kunzelmann K, Ribeiro AF, Amaral MD
Measurements of CFTR-Mediated Cl(-) Secretion in Human Rectal Biopsies Constitute a Robust Biomarker for Cystic Fibrosis Diagnosis and Prognosis.
PLoS One. 2012;7(10):e47708. doi: 10.1371/journal.pone.0047708. Epub 2012 Oct 17., [PMID:23082198]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is caused by approximately 1,900 mutations in the CF transmembrane conductance regulator (CFTR) gene encoding for a cAMP-regulated chloride (Cl(-)) channel expressed in several epithelia. Clinical features are dominated by respiratory symptoms, but there is variable organ involvement thus causing diagnostic dilemmas, especially for non-classic cases. METHODOLOGY/PRINCIPAL FINDINGS: To further establish measurement of CFTR function as a sensitive and robust biomarker for diagnosis and prognosis of CF, we herein assessed cholinergic and cAMP-CFTR-mediated Cl(-) secretion in 524 freshly excised rectal biopsies from 118 individuals, including patients with confirmed CF clinical diagnosis (n = 51), individuals with clinical CF suspicion (n = 49) and age-matched non-CF controls (n = 18). Conclusive measurements were obtained for 96% of cases. Patients with "Classic CF", presenting earlier onset of symptoms, pancreatic insufficiency, severe lung disease and low Shwachman-Kulczycki scores were found to lack CFTR-mediated Cl(-) secretion (<5%). Individuals with milder CF disease presented residual CFTR-mediated Cl(-) secretion (10-57%) and non-CF controls show CFTR-mediated Cl(-) secretion >/=30-35% and data evidenced good correlations with various clinical parameters. Finally, comparison of these values with those in "CF suspicion" individuals allowed to confirm CF in 16/49 individuals (33%) and exclude it in 28/49 (57%). Statistical discriminant analyses showed that colonic measurements of CFTR-mediated Cl(-) secretion are the best discriminator among Classic/Non-Classic CF and non-CF groups. CONCLUSIONS/SIGNIFICANCE: Determination of CFTR-mediated Cl(-) secretion in rectal biopsies is demonstrated here to be a sensitive, reproducible and robust predictive biomarker for the diagnosis and prognosis of CF. The method also has very high potential for (pre-)clinical trials of CFTR-modulator therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 Functional classification of rarer mutations also results from these analyses, namely (Table S1): 3120+1G.A as class I (2 siblings with 3120+1G.A/R1066C, absence of CFTR-function and severe phenotypes); 1716+18672A.G as class V (2 other siblings with F508del/1716+18672A.G, residual CFTR function 228-34%- and mild CF); I618T as class IV (in a patient with G542X/I618T, 37% CFTR function and mild disease); and L206W as class IV or CFTR-RD mutation (in a patient with F508del/L206W and the highest CFTR function 257%- and very mild disease). Login to comment
209 Rectal biopsies from (A) Non-CF individual showing large cholinergic (carbachol, CCH, 100 mM, basolateral) and cAMP-dependent (3-isobutyl-1-methylxantine, IBMX, 100 mM, and forskolin, Fsk, 2 mM, basolateral) Chloride (Cl2 ) secretion (lumen-negative responses); (B) CF patient homozygous for F508del-CFTR mutation with absence of Cl2 secretion (only lumen-positive responses, reflecting potassium (K+ ) secretion, were observed); (C) CF patient (genotype: F508del/G85E-CFTR) showing very little (,12%) cAMP-dependent Cl2 secretion (biphasic responses observed upon co-cholinergic stimulation with CCH); and (D) CF patient (genotype: 3120+1G.A/L206W-CFTR) presenting larger CFTR residual function (,57%) and milder phenotype than in (C). Login to comment
208 Rectal biopsies from (A) Non-CF individual showing large cholinergic (carbachol, CCH, 100 mM, basolateral) and cAMP-dependent (3-isobutyl-1-methylxantine, IBMX, 100 mM, and forskolin, Fsk, 2 mM, basolateral) Chloride (Cl2 ) secretion (lumen-negative responses); (B) CF patient homozygous for F508del-CFTR mutation with absence of Cl2 secretion (only lumen-positive responses, reflecting potassium (K+ ) secretion, were observed); (C) CF patient (genotype: F508del/G85E-CFTR) showing very little (,12%) cAMP-dependent Cl2 secretion (biphasic responses observed upon co-cholinergic stimulation with CCH); and (D) CF patient (genotype: 3120+1G.A/L206W-CFTR) presenting larger CFTR residual function (,57%) and milder phenotype than in (C). Login to comment

[hide] Validation of high-resolution DNA melting analysis... J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7. Audrezet MP, Dabricot A, Le Marechal C, Ferec C
Validation of high-resolution DNA melting analysis for mutation scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7., [PMID:18687795]

Abstract [show]
High-resolution melting analysis of polymerase chain reaction products for mutation scanning, which began in the early 2000s, is based on monitoring of the fluorescence released during the melting of double-stranded DNA labeled with specifically developed saturation dye, such as LC-Green. We report here the validation of this method to scan 98% of the coding sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. We designed 32 pairs of primers to amplify and analyze the 27 exons of the gene. Thanks to the addition of a small GC-clamp at the 5' ends of the primers, one single melting domain and one identical annealing temperature were obtained to co-amplify all of the fragments. A total of 307 DNA samples, extracted by the salt precipitation method, carrying 221 mutations and 21 polymorphisms, plus 20 control samples free from variations (confirmed by denaturing high-performance liquid chromatography analysis), was used. With the conditions described in this study, 100% of samples that carry heterozygous mutations and 60% of those with homozygous mutations were identified. The study of a cohort of 136 idiopathic chronic pancreatitis patients enabled us to prospectively evaluate this technique. Thus, high-resolution melting analysis is a robust and sensitive single-tube technique for screening mutations in a gene and promises to become the gold standard over denaturing high-performance liquid chromatography, particularly for highly mutated genes such as CFTR, and appears suitable for use in reference diagnostic laboratories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Sequences of the Primers Used for CFTR Analysis by HRM, GC Size, Amplicon Length, Number of Positive Controls Validated for Each Exon, and Positive Controls for Routine Analysis Exon Primer Sequences GC length Amplicon length (bp) Introns Number of heterozygous- positive controls Number of homozygous- positive controls Recommended control 1 LSCFE1Fmod 5Ј-CCGCCGCCGTTGAGCGGCAGGCACC-3Ј 8 200 bp 74 4 125GϾC LSCFE1Rmod 5Ј-CCGCCGCCGGCACGTGTCTTT CCGAAGCT-3Ј 8 19 M1I 2 2i5b 5Ј-CAAATCTGTATGGAGACC-3Ј 0 194 bp 39 5 R31C 2i3Љ 5Ј-CAACTAAACAATGTACATGAAC-3Ј 0 4 296ϩ1GϾT 3 LSCFe3Fmod LSCFe3Rmod 5Ј-CGCCGTTAAGGGAAATAGGACAA CTAAAATA-3Ј 5 276 bp 44 10 2 R75Q 5Ј-CCGCCGATTCACCAGATTTCGTAGTC-3Ј 6 66 G85V 4 LSCFe4FmodC 5Ј-CCGCCGCCGCCCGTGTTGAAATT CTCAGGGT-3Ј 12 361 bp 52 14 1 R117H LSCFe4RmodC 5Ј-CCGCCGCCCACATGTACGATAC AGAATATATGTGCC-3Ј 9 26 574delA 5 LSCFE5Fmod 5Ј-CCGCCGGTTGAAATTATCTAACTTTCC-3Ј 6 201 bp 13 8 624delT LSCFE5Rmod 5Ј-CCGAACTCCGCCTTTCCAGTTGT-3Ј 3 48 711ϩ1GϾT 6a LSCF6aFmod2 5Ј-CCGCCGGGGTGGAAGAT ACAATGACACCTG-3Ј 5 317 bp 25 8 C225X LSCF6aRmod2 5Ј-CCGCCGCCGCGATGCATAGAG CAGTCCTGGTT-3Ј 11 66 L206W 6b LSCFE6bFmod 5Ј-CGCGCCGCCGGATTTAC AGAGATCAGAGAG-3Ј 10 239 bp 0 2 1 R258G LSCFE6Brmod 5Ј-CCGCCGCCGAGGTGGA GTCTACCATGA-3Ј 8 66 1001ϩ11CϾT 7 LSCFE7Fmod2 5Ј-CCGCCGCCCTCTCCCTGAATTT TATTGTTATTGTTT-3Ј 13 326 bp 7 11 1078delT LSCFE7Rmod2 5Ј-CCCGCCGCCCTATAATGCAG CATTATGGT-3Ј 10 7 1248ϩ1GϾT 8 LSCFE8Fmod 5Ј-CCGGAATGCATTAATGCTAT TCTGATTC-3Ј 4 199 bp 32 7 W401X LSCFE8Rmod 5Ј-CCCGCAGTTAGGTGTTTAG AGCAAACAA-3Ј 4 18 1249-5AϾG 9 LSCFe9Fmod2 5Ј-CCGCCGCCGGGAATTATTTGAGAA AGCAAAACA-3Ј 8 279 bp 0 3 D443Y LSCFe9Rmod2 5Ј-CCGCCGCGAAAATACCTTCCAG CACTACAAACTAGAAA-3Ј 8 57 A455E 10 LSCF10FmodD 5Ј-CGCCGTTATGGGAGAACTGG AGCCTTCAGAG-3Ј 5 275 bp 0 15 1 F508del LSCF10RmodD 5Ј-CCGCAGACTAACCGATTGAAT ATGGAGCC-3Ј 4 68 E528E 11 h11i5 5Ј-TGCCTTTCAAATTCAGATTGAGC-3Ј 0 197 bp 42 13 2 G542X 11i3ter 5Ј-ACAGCAAATGCTTGCTAGACC-3Ј 0 17 G551D 12 LSCFE12Fmod 5Ј-CGCGTCATCTACACTAGATGACCAG-3Ј 4 244 bp 43 15 G576A 1898 ϩ 1GϾALSCFE12Rmod 5Ј-CCGGAGGTAAAATGCAATCTATGATG-3Ј 3 63 13 LSCF13AFmod 5Ј-CCGCCGCCGGAGACATATTG CAATAAAGTAT-3Ј 9 38 20 I601F LSCF13ARmod 5Ј-GCCTGTCCAGGAGACAGGA GCATCTC-3Ј 2 R668C LSCF13BFmod 5Ј-CCGCCGCAATCCTAACTGAG ACCTTACACCG-3Ј 2 R668C LSCF13BRmod 5Ј-CCGCCGATCAGGTTCAGGA CAGACTGC-3Ј 3 346 bp 2184insA LSCF13CFmod 5Ј-CCGCGGTGATCAGCACTGGCCC-3Ј 6 301 bp 77 L749L LSCF13CRmod 5Ј-CCGCGCGCGCGGCCAGTTTCTTG AGATAACCTTCT-3Ј 13 259 bp V754M LSCF13DFmod 5Ј-CGTGTCACTGGCCCCTCAGGC-3Ј 1 221 bp I807M LSCF13DRmof 5Ј-CCGCCGCCGCTAATCCTATGA TTTTAGTAAAT-3Ј 9 220 bp 2622ϩ1GϾA LSCf13FFmod 5Ј-CGCGGTGCAGAAAGAAGAAAT TCAATCCTAACTG-3Ј 4 R668C LSCF13FRmod 5Ј-CCGCCGTGCCATTCATTTGT AAGGGAGTCT-3Ј 6 2184insA 14a LSCF14aFmodB 5Ј-CCGACCACAATGGTGGCAT GAAACTG-3Ј 3 239 bp 35 7 1 T854T LSCF14aRmodB 5Ј-CCGCCGACTTTAAATCCAGTAAT ACTTTACAATAGAACA-3Ј 6 7 W846X 14b LSCF14bFmod 5Ј-CCGGAGGAATAGGTGAAGAT-3Ј 2 179 bp 38 4 2752-5GϾT LSCF14bRmodb 5Ј-CCGTACATACAAACATAGTGGATT-3Ј 3 59 2789ϩ5GϾT 15 LSCFE15Fmod 5Ј-CGCGCCGTGTATTGGAAA TTCAGTAAGTAACTTTGG-3Ј 7 412 bp 33 16 T908S LSCFE15Rmod 5Ј-CCGCAGCCAGCACTGCCAT TAGAAA-3Ј 4 68 S945L (table continues) phisms that we have chosen to exclude. Login to comment

[hide] Consensus on the use and interpretation of cystic ... J Cyst Fibros. 2008 May;7(3):179-96. Castellani C, Cuppens H, Macek M Jr, Cassiman JJ, Kerem E, Durie P, Tullis E, Assael BM, Bombieri C, Brown A, Casals T, Claustres M, Cutting GR, Dequeker E, Dodge J, Doull I, Farrell P, Ferec C, Girodon E, Johannesson M, Kerem B, Knowles M, Munck A, Pignatti PF, Radojkovic D, Rizzotti P, Schwarz M, Stuhrmann M, Tzetis M, Zielenski J, Elborn JS
Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice.
J Cyst Fibros. 2008 May;7(3):179-96., [PMID:18456578]

Abstract [show]
It is often challenging for the clinician interested in cystic fibrosis (CF) to interpret molecular genetic results, and to integrate them in the diagnostic process. The limitations of genotyping technology, the choice of mutations to be tested, and the clinical context in which the test is administered can all influence how genetic information is interpreted. This paper describes the conclusions of a consensus conference to address the use and interpretation of CF mutation analysis in clinical settings. Although the diagnosis of CF is usually straightforward, care needs to be exercised in the use and interpretation of genetic tests: genotype information is not the final arbiter of a clinical diagnosis of CF or CF transmembrane conductance regulator (CFTR) protein related disorders. The diagnosis of these conditions is primarily based on the clinical presentation, and is supported by evaluation of CFTR function (sweat testing, nasal potential difference) and genetic analysis. None of these features are sufficient on their own to make a diagnosis of CF or CFTR-related disorders. Broad genotype/phenotype associations are useful in epidemiological studies, but CFTR genotype does not accurately predict individual outcome. The use of CFTR genotype for prediction of prognosis in people with CF at the time of their diagnosis is not recommended. The importance of communication between clinicians and medical genetic laboratories is emphasized. The results of testing and their implications should be reported in a manner understandable to the clinicians caring for CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1236 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment
1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 Other than ⌬F508 itself and I1027T, typically occurring in cis-, only two individual mutations, W1204X and L206W, were observed with ⌬F508 more than once (twice each) in this study. Login to comment
98 Spectrum of CFTR Sequence Variants in 257 Hispanic Patients Who Underwent Diagnostic DNA Testing for CF Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) ACMG/ACOG recommended 25 mutation panel* DeltaF508 53 28.96 10.31 G542X 7 3.83 1.36 R334W 2 1.09 0.39 R553X 2 1.09 0.39 DeltaI507 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 3120 ϩ 1 GϾA 1 0.55 0.19 7 different mutations 67 36.61 13.04 All mutations included ACMG/ACOG 1248 ϩ 1 GϾA 1 0.55 0.19 1249 - 29delAT 1 0.55 0.19 1288insTA1288insTA 1 0.55 0.19 1341 ϩ 80 GϾA1341 ϩ 80 GϾA 1 0.55 0.19 1429del71429del7 1 0.55 0.19 1525 - 42 GϾA1525 - 42 GϾA 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 1717 - 8 GϾA 2 1.09 0.39 1811 ϩ 1 GϾA1811 ϩ 1 GϾA 1 0.55 0.19 2055del9-ϾA 3 1.64 0.58 2105-2117del13insAGAAA 1 0.55 0.19 2215insG 1 0.55 0.19 2585delT2585delT 1 0.55 0.19 2752 - 6 TϾC 1 0.55 0.19 296 ϩ 28 AϾG 1 0.55 0.19 3120 ϩ 1 GϾ A 1 0.55 0.19 3271 ϩ 8 AϾG3271 ϩ 8 AϾG 1 0.55 0.19 3271delGG 1 0.55 0.19 3272 - 26 AϾG 2 1.09 0.39 3876delA 2 1.09 0.39 4016insT 1 0.55 0.19 406 - 1 GϾA 6 3.28 1.17 406 - 6 TϾC 1 0.55 0.19 4374 ϩ 13 A ϾG 1 0.55 0.19 663delT 1 0.55 0.19 874insTACA874insTACA 1 0.55 0.19 A1009T 2 1.09 0.39 A559T 1 0.55 0.19 D1152H 1 0.55 0.19 D1270N 3 1.64 0.58 D1445N 2 1.09 0.39 D836Y 1 0.55 0.19 DeltaF311 1 0.55 0.19 DeltaF508 53 28.96 10.31 DeltaI507 1 0.55 0.19 E116K 2 1.09 0.39 E585X 1 0.55 0.19 E588VE588V 2 1.09 0.39 E831X 1 0.55 0.19 F311L 1 0.55 0.19 F693L 1 0.55 0.19 G1244E 1 0.55 0.19 G542X 7 3.83 1.36 G576A 1 0.55 0.19 H199Y 3 1.64 0.58 I1027T 3 1.64 0.58 I285FI285F 1 0.55 0.19 L206W 3 1.64 0.58 L320V 1 0.55 0.19 L967S 1 0.55 0.19 L997F 3 1.64 0.58 P1372LP1372L 1 0.55 0.19 P205S 1 0.55 0.19 P439SP439S 1 0.55 0.19 Q1313X 1 0.55 0.19 Q890X 2 1.09 0.39 Q98R 1 0.55 0.19 R1066C 1 0.55 0.19 R1066H 1 0.55 0.19 (Table continues) missense variant, I1027T (3212TϾC), in exon 17a.25 Family studies have not been performed to identify which allele carries two mutations. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment
201 Comparison of Relative Frequencies of CFTR Sequence Variants in Comprehensive CFTR Studies in US and Mexican Hispanics This study % Orozco 2000 % US/ Mexican % deltaF508 28.96 54.48 43.72 G542X 3.83 8.28 5.19 406 - 1GϾA 3.28 2.07 2.38 W1204X 2.19 Ͻ1 1.08 R74W 1.64 Ͻ1 R75X 1.64 2.07 1.51 H199Y 1.64 Ͻ1 Ͻ1 L206W 1.64 Ͻ1 L997F 1.64 Ͻ1 I1027T 1.64 Ͻ1 2055del9ϾA 1.64 1.38 1.27 D1270N 1.64 Ͻ1 E116K 1.09 Ͻ1 V232D 1.09 Ͻ1 R334W 1.09 Ͻ1 S492F 1.09 Ͻ1 T501A 1.09 Ͻ1 R553X 1.09 Ͻ1 Ͻ1 E588V 1.09 Ͻ1 R668C 1.09 Ͻ1 Q890X 1.09 Ͻ1 W1089X 1.09 Ͻ1 S1235R 1.09 Ͻ1 D1445N 1.09 Ͻ1 3876delA 1.09 3.24 1717 - 8GϾA 1.09 Ͻ1 3272 - 26AϾG 1.09 Ͻ1 A1009T 1.09 Ͻ1 deltaI507 Ͻ1 3.45 1.30 S549N Ͻ1 3.45 1.95 G567A Ͻ1 Ͻ1 I148T 2.07 1.08 I506T 1.38 Ͻ1 N1303K 2.76 1.08 935delA 1.38 1.30 2183AAϾG 1.38 Ͻ1 3199del6 1.38 Ͻ1 3849 ϩ 10kbCϾT Ͻ1 1.30 ACMG/ACOG italicized. Login to comment

[hide] High heterogeneity of CFTR mutations and unexpecte... J Cyst Fibros. 2004 Dec;3(4):265-72. des Georges M, Guittard C, Altieri JP, Templin C, Sarles J, Sarda P, Claustres M
High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France.
J Cyst Fibros. 2004 Dec;3(4):265-72., [PMID:15698946]

Abstract [show]
In this report, we present updated spectrum and frequency of mutations of the CFTR gene that are responsible for cystic fibrosis (CF) in Languedoc-Roussillon (L-R), the southwestern part of France. A total of 75 different mutations were identified by DGGE in 215 families, accounting for 97.6% of CF genes and generating 88 different mutational genotypes. The frequency of p.F508del was 60.23% in L-R versus 67.18% in the whole country and only five other mutations (p.G542X, p.N1303K, p.R334W, c.1717-1G>A, c.711+1G>T) had a frequency higher than 1%. The mutations were scattered over 20 exons or their border. This sample representing only 5.7% of French CF patients contributed to 24% of CFTR mutations reported in France. This is one of the highest molecular allelic heterogeneity reported so far in CF. We also present the result of a neonatal screening program based on a two-tiered approach "IRT/20 mutations/IRT" analysis on blood spots, implemented in France with the aim to improve survival and quality of life of patients diagnosed before clinical onset. This 18-month pilot project showed an unexpected low incidence of CF (1/8885) in South of France, with only six CF children detected among 43,489 neonates born in L-R, and 13 among 125,339 neonates born in Provence-Alpes-Cote-d'Azur (PACA).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 of chromosomes (frequency %) p.M1V 1 1 (0.23) p.M1K 1 1 (0.23) c.300delA 3 1 (0.23) p.P67L 3 1 (0.23) c.359insT 3 1 (0.23) p.G85E 3 3 (0.70) c.394delTT 3 1 (0.23) p.Q98R 4 1 (0.23) p.R117H 4 2 (0.47) p.Y122X 4 2 (0.47) p.Y161N 4 1 (0.23) c.621+1GNT intron 4 1 (0.23) c.621+2TNG intron 4 1 (0.23) p.I175V 5 2 (0.47) c.711+1GNT intron 5 5 (1.16) p.L206W 6 3 (0.70) p.Q220X 6 1 (0.23) p.L227R 6 1 (0.23) c.1078delT 7 2 (0.47) p.R334W 7 7 (1.63) p.R347P 7 2 (0.47) c.1215delG 7 1 (0.23) c.T5 intron 8 1 (0.23) p.D443Y 9 1 (0.23) p.I506T 10 1 (0.23) p.I507del 10 4 (0.93) p.F508del 10 259 (60.23) p.F508C 10 1 (0.23) c.1677delTA 10 1 (0.23) c.1717-8GNA intron 10 1 (0.23) c.1717-1GNA intron 10 6 (1.40) p.G542X 11 23 (5.35) p.S549R 11 1 (0.23) p.G551D 11 2 (0.47) p.R553X 11 1 (0.23) c1811+1.6kbANG intron 11 4 (0.93) c.1812-1GNA intron 11 1 (0.23) p.T582I 12 1 (0.23) p.E585X 12 2 (0,47) c.1898+1GNA intron 12 1 (0.23) [c.1898+5GNA ;p.E725K] intron 12 1 (0.23) c.1898+73TNG intron 12 1 (0.23) c.2183AANG 13 4 (0.93) c.2184insA 13 1 (0.23) p.K710X 13 4 (0.93) c.2423delG 13 1 (0.23) p.S776X 13 1 (0.23) c.2493ins8 13 1 (0.23) p.R792X 13 1 (0.23) p.K830X 13 1 (0.23) p.D836Y 14a 1 (0.23) p.W846X1 14a 1 (0.23) c.2711delT 14a 1 (0.23) c.2789+5GNA intron 14b 3 (0.70) p.S945L 15 3 (0.70) p.D993Y 16 1 (0.23) c.3129del4 17a 1 (0.23) c.3195del6 17a 1 (0.23) c.3272-26ANG intron 17a 1 (0.23) [c.3395insA ;pI148T] 17b/4 1 (0,23) p.Y1092X 17b 3 (0.70) Table 1 (continued) Mutation Location exon/intron No. Login to comment

[hide] Genotype and phenotype correlations in patients wi... Gastroenterology. 2002 Dec;123(6):1857-64. Durno C, Corey M, Zielenski J, Tullis E, Tsui LC, Durie P
Genotype and phenotype correlations in patients with cystic fibrosis and pancreatitis.
Gastroenterology. 2002 Dec;123(6):1857-64., [PMID:12454843]

Abstract [show]
BACKGROUND & AIMS: Pancreatitis is known to occur in some patients with cystic fibrosis (CF), but the prevalence, natural history, and genotypic basis are unclear. We examined a well-defined cohort of patients with CF to answer these questions. METHODS: Patients with CF were identified from a computerized database (1966-1996). Chart audit identified all patients with CF and pancreatitis. RESULTS: Among 1075 patients with CF, 937 (87%) were pancreatic insufficient at diagnosis, 28 (3%) were pancreatic sufficient but developed pancreatic insufficiency after diagnosis, and 110 (10%) have remained pancreatic sufficient. No patients with pancreatic insufficiency developed pancreatitis. Nineteen patients (17.3%) with pancreatic sufficiency experienced one or more attacks of pancreatitis. The mean age at diagnosis of pancreatitis was 22.7 +/- 10.3 years (range, 10-35 years), and pancreatitis was recognized before the diagnosis of CF in 6 patients (32%). The diagnosis of CF in pancreatic-sufficient patients, with and without pancreatitis, was established at a significantly older age than in those with pancreatic insufficiency (P < 0.0001). Genotyped patients with pancreatic insufficiency carried 2 severe mutant alleles. All genotyped patients with pancreatic sufficiency and pancreatitis carried at least one mild mutation. No specific genotype was predictive of pancreatitis. CONCLUSIONS: Patients with CF with pancreatic sufficiency carry at least one mild mutant allele and are at a significant risk of developing pancreatitis. Symptoms of pancreatitis may precede the diagnosis of CF. Pancreatitis is associated with an otherwise mild CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 CFTR Genotypes Among CF Patients With PS With and Without Pancreatitis Two mutations (n) ⌬F508/R117H (9) ⌬F508/(5T) (6) ⌬F508/3272-26A 3 G (4) ⌬F508/R347H (2) ⌬F508/P574H (2) ⌬F508/875 ϩ 1G Ͼ C (2) ⌬F508/3849 ϩ 10kb C 3 T (1) ⌬F508/A455E (1) ⌬F508/D614G (1) ⌬F508/G85E (1) ⌬F508/R347P (1) ⌬F508/S1251N (1) ⌬F508/⌬F508a (1) ⌬F508/3120G Ͼ A (1) ⌬F508/G551Da (1) G542X/R117H (1) R560T/L206W (1) R117H/R117H (1) R31L/P67L (1) 1461ins4 (AGAT)/G85E (1) G551D/(5T) (1) R1066C/3849 ϩ 10kb C Ͼ T (1) G551D/3849 ϩ 10kb C Ͼ T (1) R334W/R334W (1) R334W/681delC (1) W1282X/3489 ϩ 10kb C Ͼ T (1) One mutation (n) ⌬F508/- (18) L1077P/- (1) W1282X/- (1) M1137V/- (1) G551D/- (1) R347H/- (1) Q30X1/- (1) G1244E/- (1) R117H/- (1) 621 ϩ 2G621 ϩ 1G 3 T/- (1) NOTE. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 Distribution of 310 CF Mutations in France With Respect to Relative Frequencies (Total Number of CF Chromosomes = 7,420) Group Mutations Number of alleles % Cum. % A F508del 4,985 67.18 G542X 212 2.86 N1303K 156 2.10 73.45 1717-1G>A 97 1.31 B G551D 73 0.98 2789+5G>A 72 0.97 W1282X 68 0.91 R553X 66 0.89 I507del 52 0.70 1078delT 49 0.66 7.47 2183AA>G 48 0.64 711+1G>T 33 0.44 R1162X 33 0.44 Y1092X 30 0.40 3849+10kbC>T 30 0.40 C 12 mutationsa 29 to 15 (239) 0.39-0.20 19 mutationsb 14 to 8 (190) 0.19-0.10 11 mutationsc 7 to 6 (71) 0.09-0.08 11 mutationsd 5 (55) 0.06 10.57 15 mutationse 4 (60) 0.05 23 mutationsf 3 (69) 0.04 50 mutationsg 2 (100) 0.02 D 154 mutationsh 1 (154) 0.01 2.07 6,942 93.56 a 3659delC, R347P, 3272-26A>G, R334W, W846X, 621+1G>T, G85E, R1066C, L206W, 394delTT, 4055+1G>A, R347H. Login to comment
153 Four mutations were detected on a 7T or a 9T background: L206W, R347H, D1152H, 3272-26A>G. Login to comment
171 CFTR Mutation Genotypes Identified Both in Cystic Fibrosis (CF) and in Congenital Bilateral Absence of the Vas Deferens (CBAVD) CF CBAVD F508del/5T 3 143 F508del/2789+5G>A 53 1 F508del/3272-26A>G 17 4 F508del/R117H* 10 39 F508del/R117C 2 2 F508del/L206W 12 4 F508del/R347H 10 5 F508del/R347L 1 1 F508del/D443Y 1 5 F508del/Y569C 1 1 F508del/P574H 3 1 F508del/G628R(G>A) 2 1 F508del/V920M 1 1 F508del/R1070W 2 3 F508del/D1152H 6 8 F508del/S1235R 3 1 F508del/T1246I 1 1 F508del/D1270N+R74W 2 3 F508delN1303I 1 1 3659delC/R347H 1 1 G542X/T338I 2 2 R347H/R1066H 1 1 *The only case with CF whose alleles at IVS8(T)n were reported had mutation R117H associated with a 5T allele. Login to comment

[hide] Respiratory epithelial ion transport in patients w... Eur Respir J. 1999 Jun;13(6):1276-80. Danner I, Boisseau P, Chailleux E, Escande D
Respiratory epithelial ion transport in patients with disseminated bronchiectasis.
Eur Respir J. 1999 Jun;13(6):1276-80., [PMID:10445601]

Abstract [show]
The nosological limits between disseminated bronchiectasis and cystic fibrosis (CF) remain unclear. In patients with isolated congenital bilateral absence of the vas deferens, a forme fruste of the CF disease, a normal baseline nasal transepithelial potential difference (PD) but an impaired response to pharmacological interventions have been reported. The purpose of the present study was to explore ion transport in respiratory epithelium from patients with disseminated bronchiectasis. The PD under both baseline and pharmacological interventions was investigated in 13 healthy subjects, six patients with genetically proven CF and 15 patients with disseminated bronchiectasis as confirmed by computed tomography scan. Baseline PD was similar in the control and bronchiectasis groups but, as expected, was significantly more negative in the CF group. Patients with bronchiectasis responded to pharmacological tests (sequential perfusion with amiloride, chloride-free solution, isoprenaline and uridine triphosphate (UTP) similarly to healthy subjects. In contrast, CF patients exhibited an increased response to amiloride and an impaired response to chloride-free solution and isoprenaline. The data show that patients with disseminated bronchiectasis exhibit normal electrophysiological properties in their nasal epithelium. Nasal transepithelial potential difference including pharmacological tests may appear a valuable diagnostic procedure for cystic fibrosis with disseminated bronchiectasis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 Age yrs Mutations Sweat chloride mEq.L-1 PI/PS Heart±Lung Transplantation 1 22 DF508/DF508 88 PI No 2 21 DF508/3659delC NA PI Yes 3 26 DF508/DF508 NA PI Yes 4 24 DF508/DF508 190 PI No 5 28 DF508/DF508 NA PI No 6 23 DF508/DF508 NA PI Yes 7 61 DF508/L206W 100 PS No PI: pancreatic insufficiency; PS: pancreatic sufficiency; NA: not available. Login to comment
116 This revealed DF508/L206W CFTR gene mutations. Login to comment
140 L206W mutations. Login to comment
141 The L206W mutation, located in exon 6a, is usually associated with a mild CF phenotype (bronchiectasis or CBAVD alone) or even asymptomatic presentations of CF [12, 13]. Login to comment
115 This revealed DF508/L206W CFTR gene mutations. Login to comment
139 L206W mutations. Login to comment

[hide] Genetic findings in congenital bilateral aplasia o... Hum Mutat. 1998;11(6):480. de Meeus A, Guittard C, Desgeorges M, Carles S, Demaille J, Claustres M
Genetic findings in congenital bilateral aplasia of vas deferens patients and identification of six novel mutatations. Mutations in brief no. 138. Online.
Hum Mutat. 1998;11(6):480., [PMID:10200050]

Abstract [show]
Congential bilateral aplasia of vas deferens (CBAVD), a form of male sterility, has been suggested to represent a "genital" form of cystic fibrosis (CF), as mutations in the CFTR gene have been identified in most patients with this condition. Interestingly, the 5T allele in intron 8 appeared to be the most frequent mutation associated with CBAVD. However, the molecular basis of CBAVD is not completely understood. We have analysed the complete coding and flanking CFTR sequences by PCR-DGGE in 64 men with CBAVD from southern France with the aim to list any sequence alteration. Fourty-two of the 64 patients (65.6%) had mutations on both copies of the CFTR gene, including one patient with two mutations in the same copy (DF508 + A1067T). The 5T allele was present in 21/64 cases (33%). Six of the 28 different mutations identified in this study had never been described previously, and appeared to be specific to CBAVD (P111L, M244K, A1364V, G544V, 2896insAG,-33G->A).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 However, some genotypes (DF508/L206W, DF508/R347H, DF508/D1152H, DF508/R117H, W1282X/D1152H and even DF508/5T) can induce both CF and CBAVD phenotypes. Login to comment
83 Phenotype CFTRamutations Intron 8, Poly(T) tract 1 3 crisis of acute pancreatitis F508 / L206W 9/7 2 F508 / L206W 9/9 3 frequent bronchitis F508 / R347H 9/9 4 F508 / R347H 9/9 5 F508 / M244K 9/7 6 F508 / A1364V 9/7 7 F508 / D1152H 9/7 8 chronic sinusitis and bronchitis F508 / D1152H 9/7 9 F508 / R117H 9/7 10 F508 / R117H 9/7 11 F508 / M952I 9/7 12 D443Y / G542X 7/9 13 D443Y / G542X 7/9 14 2184delA / D443Y 7/7 15 2184delA / D443Y 7/7 16 R347H / D443Y 9/7 17 seminal vesicles agenesia R117H / G1349D 7/7 18 R117H / G1244E 7/7 19 N1303K / P111L 9/7 20 chronic sinusitis, nasal polyps W1282X / D1152H 7/7 21 chronic sinusitis R347H / Y1092X 7/7 22 seminal vesicles agnesia 297-3C-GTT / 4279insA 7/7 23 G544V / F508C 7/7 24 D1152H / 2896insAG 7-9 25 F508 / - 9/5 26 F508 / - 9/5 27 F508 / - 9/5 28 F508 / - 9/5 29 F508 / - 9/5 30 chronic sinusitis, bronchitis F508 / - 9/5 31 sinusitis and allergy F508 / - 9/5 32 allergy F508 / - 9/5 33 F508 / - 9/5 34 F508 / - 9/5 35 F508 / - 9/5 36 F508 / - 9/5 37 bronchitis, asthma F508 / - 9/5 38 chronic sinusitis F508+A1067T / - 9/5 39 chronic sinusitis D1152H / - 7/5 40 2184delA / - 7/5 41 R764X / - 7/5 42 711+1G-GTT / - 7/5 43 F508 / - 9/7 44 F508 / - 9/7 45 F508 / - 9/7 46 F508 / - 9/9 47 R553X / - 7/7 48 -33G-GTA / - 7/7 49 K710X / - 7/7 50 - / - 5/5 51 - / - 5/7 52 - / - 5/7 53 - / - 7/7 54 - / - 7/7 55 - / - 7/7 56 - / - 7/7 57 - / - 7/7 58 - / - 7/7 59 - / - 7/7 60 - / - 7/7 61 - / - 7/9 62 - / - 7/9 63 NIDDb - / - 7/9 64 - / - 7/9 a : Cystic Fibrosis Transmembrane Regulator gene b : Non Insulino-Dependant Diabetis References Anguiano A, Oates RD, Amos JA, Dean M, Gerrard B, Stewart C, Maher TA, White MB, Milunsky A (1992) Congenital absence of the vas deferens: a primarily genital form of cystic fibrosis. Login to comment

[hide] High heterogeneity for cystic fibrosis in Spanish ... Hum Genet. 1997 Dec;101(3):365-70. Casals T, Ramos MD, Gimenez J, Larriba S, Nunes V, Estivill X
High heterogeneity for cystic fibrosis in Spanish families: 75 mutations account for 90% of chromosomes.
Hum Genet. 1997 Dec;101(3):365-70., [PMID:9439669]

Abstract [show]
We have analyzed 640 Spanish cystic fibrosis (CF) families for mutations in the CFTR gene by direct mutation analysis, microsatellite haplotypes, denaturing gradient gel electrophoresis, single-strand conformation analysis and direct sequencing. Seventy-five mutations account for 90.2% of CF chromosomes. Among these we have detected seven novel CFTR mutations, including four missense (G85V, T582R, R851L and F1074L), two nonsense (E692X and Q1281X) and one splice site mutation (711+3A-->T). Three variants, two in intronic regions (406-112A/T and 3850-129T/C) and one in the coding region (741C/T) were also identified. Mutations G85V, T582R, R851L, E692X and Q1281X are severe, with lung and pancreatic involvement; 711+3A-->T could be responsible for a pancreatic sufficiency/insufficiency variable phenotype; and F1074L was associated with a mild phenotype. These data demonstrate the highest molecular heterogeneity reported so far in CF, indicating that a wide mutation screening is necessary to characterize 90% of the Spanish CF alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Eight mutations have frequencies 366 Table 1 Seventy-five CFTR mutations identified in 640 Spanish families with cystic fibrosis (CF) Mutation Exon/intron CF alleles % ∆F508 E.10 681 53.20 G542X E.11 108 8.43 N1303K E.21 34 2.65 1811+1.6kbA→Ga I.11 24 1.87 711+1G→T I.5 22 1.71 R1162Xa E.19 21 1.64 R334Wa E.7 21 1.64 R1066C E.17b 14 1.09 1609delCAa E.10 13 1.01 Q890X E.15 13 1.01 G85E E.3 12 0.94 712-1G→Ta I.5 11 0.86 2789+5G→A I.14b 11 0.86 ∆I507 E.10 10 0.78 W1282X E.20 10 0.78 2869insGa E.15 9 0.70 L206W E.6a 7 0.54 R709X E.13 7 0.54 621+1G→T I.4 6 0.47 3272-26A→G I.17a 6 0.47 R347H E.7 5 0.39 2183AA→G E.13 5 0.39 K710X E.13 5 0.39 2176insC E.13 5 0.39 3849+10kbC→T I.19 5 0.39 P205Sa E.6a 4 0.31 1078delT E.7 4 0.31 R553X E.11 4 0.31 G551D E.11 4 0.31 1812-1G→Aa I.11 4 0.31 CFdel#1a E.4-7/11-18 4 0.31 V232D E.6a 3 0.23 936delTAa E.6b 3 0.23 1717-8G→A I.10 3 0.23 1949del84 E.13 3 0.23 W1089X E.17b 3 0.23 R347P E.7 3 0.23 del E.3a E.3 2 0.16 R117H E.4 2 0.16 L558S E.11 2 0.16 A561E E.12 2 0.16 2603delT E.13 2 0.16 Y1092X E.17b 2 0.16 Q1100Pa E.17b 2 0.16 M1101K E.17b 2 0.16 delE.19a E.19 2 0.16 G1244E E.20 2 0.16 P5La E.1 1 0.08 Q30Xa E.2 1 0.08 G85Va E.3 1 0.08 E92Ka E.4 1 0.08 A120Ta E.4 1 0.08 I148T E.4 1 0.08 711+3A→Ta I.5 1 0.08 H199Y E.6a 1 0.08 875+1G→A I.6a 1 0.08 Table 1 (continued) Mutation Exon/intron CF alleles % 1717-1G→A I.10 1 0.08 L571S E.12 1 0.08 T582Ra E.12 1 0.08 E585X E.12 1 0.08 1898+3A→G I.12 1 0.08 G673X E.13 1 0.08 E692Xa E.13 1 0.08 R851X E.14a 1 0.08 R851La E.14a 1 0.08 A1006E E.17a 1 0.08 L1065Ra E.17b 1 0.08 F1074La E.17b 1 0.08 R1158X E.19 1 0.08 3667del4a E.19 1 0.08 3860ins31a E.20 1 0.08 3905insT E.20 1 0.08 4005+1G→A I.20 1 0.08 Q1281Xa E.20 1 0.08 Q1313X E.21 1 0.08 Known mutations (75) 1155 90.23 Unknown mutations 125 9.77 a Mutations discovered by the CF group of the Medical and Molecular Genetics Centre - IRO, Barcelona, Spain that range between 0.5% and 0.9%, representing 6.0% of the CF chromosomes. Login to comment

[hide] Distinct spectrum of CFTR gene mutations in congen... Hum Genet. 1997 Sep;100(3-4):365-77. Dork T, Dworniczak B, Aulehla-Scholz C, Wieczorek D, Bohm I, Mayerova A, Seydewitz HH, Nieschlag E, Meschede D, Horst J, Pander HJ, Sperling H, Ratjen F, Passarge E, Schmidtke J, Stuhrmann M
Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens.
Hum Genet. 1997 Sep;100(3-4):365-77., [PMID:9272157]

Abstract [show]
Congenital absence of the vas deferens (CAVD) is a frequent cause for obstructive azoospermia and accounts for 1%-2% of male infertility. A high incidence of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has recently been reported in males with CAVD. We have investigated a cohort of 106 German patients with congenital bilateral or unilateral absence of the vas deferens for mutations in the coding region, flanking intron regions and promotor sequences of the CFTR gene. Of the CAVD patients, 75% carried CFTR mutations or disease-associated CFTR variants, such as the "5T" allele, on both chromosomes. The distribution of mutation genotypes clearly differed from that observed in cystic fibrosis. None of the CAVD patients was homozygous for delta F508 and none was compound heterozygous for delta F508 and a nonsense or frameshift mutation. Instead, homozygosity was found for a few mild missense or splicing mutations, and the majority of CAVD mutations were missense substitutions. Twenty-one German CAVD patients were compound heterozygous for delta F508 and R117H, which was the most frequent CAVD genotype in our study group. Haplotype analysis indicated a common origin for R117H in our population, whereas another frequent CAVD mutation, viz. the "5T allele" was a recurrent mutation on different intragenic haplotypes and multiple ethnic backgrounds. We identified a total of 46 different mutations and variants, of which 15 mutations have not previously been reported. Thirteen novel missense mutations and one unique amino-acid insertion may be confined to the CAVD phenotype. A few splice or missense variants, such as F508C or 1716 G-->A, are proposed here as possible candidate CAVD mutations with an apparently reduced penetrance. Clinical examination of patients with CFTR mutations on both chromosomes revealed elevated sweat chloride concentrations and discrete symptoms of respiratory disease in a subset of patients. Thus, our collaborative study shows that CAVD without renal malformation is a primary genital form of cystic fibrosis in the vast majority of German patients and links the particular expression of clinical symptoms in CAVD with a distinct subset of CFTR mutation genotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 The V938G substitution was identified in two unrelated patients, one homozygote with unilateral ab- 368 Table 1A Frequency distribution and haplotypes of CFTR mutations in 106 CAVD patients Mutationa Nucleotide changesb Locationc Frequencyd Haplotypee Referencef 174delA deletion of A at 174 exon 1 1 D3 This study E56K G→A at 298 exon 3 1 B3 This study D58N G→A at 304 exon 3 1 C2 This study D110H G→A at 460 exon 4 2 C2 Dean et al. (1990) R117H G→A at 482 exon 4 24 B6 Dean et al. (1990) A120T G→A at 490 exon 4 1 n.p. Chillón et al. (1994) ̃L138 insertion of CTA after 546 exon 4 1 A2 This study L206W T→G at 749 exon 6a 1 B8 Claustres et al. (1993) M265R T→G at 926 exon 6b 1 A2 Schwarz et al. (pers. comm.) R297W C→T at 1021 exon 7 1 C2 This study 1078delT deletion of T at 1078 exon 7 1 C2 Claustres et al. (1992) R334W C→T at 1132 exon 7 1 B1 Gasparini et al. (1991) R334L G→T at 1133 exon 7 1 D3 This study I336K T→A at 1139 exon 7 1 A2 Cuppens et al. (1993) R347H G→A at 1172 exon 7 3 D1 Cremonesi et al. (1992) L375F A→C at 1257 exon 8 1 B3 Jézéquel et al. (1996) ∆F508 deletion of 3 bp between 1652-1655 exon 10 57 B1 Kerem et al. (1989) G542X G→T at 1756 exon 11 2 B1 Kerem et al. (1990) R553X C→T at 1789 exon 11 1 A4 Cutting et al. (1990) L568F G→T at 1836 exon 12 1 B3 This study 2184insA insertion of A at 2184 exon 13 1 D3 Dörk et al. (1994b) 2789+5 G→A G→A at 2789+5 intron 14b 4 D3 Highsmith et al. (1997) R933S A→T at 2931 exon 15 1 n.p. Login to comment
137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level. Login to comment

[hide] Missense mutation R1066C in the second transmembra... Hum Mutat. 1997;10(5):387-92. Casals T, Pacheco P, Barreto C, Gimenez J, Ramos MD, Pereira S, Pinheiro JA, Cobos N, Curvelo A, Vazquez C, Rocha H, Seculi JL, Perez E, Dapena J, Carrilho E, Duarte A, Palacio AM, Nunes V, Lavinha J, Estivill X
Missense mutation R1066C in the second transmembrane domain of CFTR causes a severe cystic fibrosis phenotype: study of 19 heterozygous and 2 homozygous patients.
Hum Mutat. 1997;10(5):387-92., [PMID:9375855]

Abstract [show]
We report the clinical features of 21 unrelated cystic fibrosis (CF) patients from Portugal and Spain, who carry the mutation R1066C in the CFTR gene. The current age of the patients was higher in the R1066C/any mutation group (P < 0.01), as compared to the deltaF508/deltaF508 group. Poor values for lung radiological involvement (Chrispin-Norman) and general status (Shwachman-Kulcycki) were observed in the R1066C/any mutation group (P < 0.005 and P < 0.0004). A slightly, but not significantly worse lung function was found in the R1066C/any mutation group when compared with the deltaF508/deltaF508 patients. No significant differences were detected regarding the age at diagnosis, sweat Cl-values, or percentiles of height and weight between the two groups. Neither were significant differences observed regarding sex, meconium ileus (4.7% vs. 11.1%), dehydration (10.5% vs. 14.7%), or pancreatic insufficiency (PI) (100% vs. 97.8%). The proportion of patients with lung colonization by bacterial pathogens was slightly, but not significantly higher in the R1066C/any mutation group (70.0%), as compared with the deltaF508/deltaF508 group (57.5%). Other clinical complications were significantly more frequent in the R1066C/any mutation patients(P < 0.02) than in the deltaF508/deltaF508 group. The two homozygous R1066C/R1066C patients died at the ages of 3 months and 7 years. The data presented in this study clearly demonstrate that the R1066C mutation is responsible for a severe phenotype similar to that observed in homozygous deltaF508 patients. The poor clinical scores and complications of patients with the R1066C mutation are probably related to their slightly longer survival.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 The current clinical data for missense mutations derived from a relatively large number of cases are limited to a few mutations: N1303K (Osborne et al., 1992; CF genotype-phenotype Consortium 1993), R117H (CF genotype-phenotype Consortium 1993), P205S (Chillón et al., 1993), A455E (Gan et al., 1995), L206W (Desgeorges et al., 1995), R334W (Estivill et al., 1995), and G85E (Vázquez et al., 1996). Login to comment

[hide] Thirteen cystic fibrosis patients, 12 compound het... J Med Genet. 1996 Oct;33(10):820-2. Vazquez C, Antinolo G, Casals T, Dapena J, Elorz J, Seculi JL, Sirvent J, Cabanas R, Soler C, Estivill X
Thirteen cystic fibrosis patients, 12 compound heterozygous and one homozygous for the missense mutation G85E: a pancreatic sufficiency/insufficiency mutation with variable clinical presentation.
J Med Genet. 1996 Oct;33(10):820-2., [PMID:8933333]

Abstract [show]
To study the severity of mutation G85E, located in the first membrane spanning domain of the CFTR gene, we studied the clinical features of 13 Spanish patients with cystic fibrosis (CF) carrying this mutation. G85E accounts for about 1% of Spanish CF alleles. One patient was homozygous G85E/G85E and the rest were compound heterozygotes for G85E and other mutations (delta F508 nine patients, delta I507 two patients, and 712-1G > T one patient). The characteristics of the pooled G85E/any mutation group were compared with those of 30 delta F508 homozygotes. Mean age at diagnosis and percentage of ideal height for age were higher in the G85E/any mutation group (4.2 (SD 4.7) v 2.4 (SD 2.3), p < 0.05, and 102.8 (SD 4.7) v 97.8 (SD 4.1), p < 0.01), both probably related to the greater prevalence of pancreatic sufficiency (70% v 0%, p < 0.01). The G85E homozygote was pancreatic sufficient. Sweat sodium levels were slightly higher, and salt loss related problems more frequent, in the G85E/any group. Two of the G85E patients died of respiratory failure aged 6 and 14 years. Striking discordance in the phenotype was observed in two pairs of sibs, one of them dizygotic twins, suggesting that factors, genetic and environmental, other than CFTR genotype are important in determining CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 10 Rozen R, Ferreira-Rajabi L,Robb L, Colman N. L206W mutation of the cystic fibrosis gene, relatively frequent in French Canadians, is associated with atypical presentations of cystic fibrosis. Login to comment
95 10 Rozen R, Ferreira-Rajabi L, Robb L, Colman N. L206W mutation of the cystic fibrosis gene, relatively frequent in French Canadians, is associated with atypical presentations of cystic fibrosis. Login to comment

[hide] Mutation characterization of CFTR gene in 206 Nort... Hum Mutat. 1996;8(4):340-7. Hughes DJ, Hill AJ, Macek M Jr, Redmond AO, Nevin NC, Graham CA
Mutation characterization of CFTR gene in 206 Northern Irish CF families: thirty mutations, including two novel, account for approximately 94% of CF chromosomes.
Hum Mutat. 1996;8(4):340-7., [PMID:8956039]

Abstract [show]
A variety of mutation detection techniques, including restriction endonuclease digestion, allele specific oligonucleotides, and automated fluorescent sequencing, were used in the identification of 15 CFTR mutations representing 86.7% of CF chromosomes in 206 Northern Irish cystic fibrosis (CF) families. A systematic analysis of the 27 exons and intron/exon boundaries of the CFTR gene was performed using denaturing gradient gel electrophoresis (DGGE) in an attempt to characterise the 55 unknown CF mutations in 51 patients. Twenty different mutations were detected by DGGE on 30 chromosomes accounting for a further 7.3% of CF alleles. Fifteen of these mutations had not previously been found in Northern Ireland, and two are novel, M1I(G > T) and V562L. In total, 30 CFTR mutations account for 93.9% of the 412 Northern Irish CF chromosomes tested. The three major CF mutations in Northern Ireland are delta F508, G551D, and R117H with respective frequencies of 68.0%, 5.1%, and 4.1%. The efficacy of the DGGE technique was proven by the detection of 77 out of 77 control variants from all the CFTR exons. DGGE is a highly efficient and sensitive method for mutation screening especially in large genes where the mutation spectrum is known to be heterogeneous.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 35%) PAGE (278) Kerem et al.. 1989AF508 G551D R117H R560T G542X 621+1G>T A1507 E60X 3659delC R553X 3120G>A 1l54insTC 2789+5G>A N1303K MlI(G>T) QW P67L 557delT 711+3A>G L206W R297Q V520F V562L Y563N Y917C R1162X 3849G>A 3849 +10kbC>T 3850-1GBA W1282X 280 21 17 12 9 9 7 3 2 1 68.0 5.1 4.1 2.9 2.2 2.2 1.7 0.7 0.5 0.24 17-32-13 (38;27%j 17-31-13(24,17%) 16-07-17 16-30-13 plus14 rare haplotypes (29) 16-07-17 23-33-13 (4) 22-31-13 (2) 21-31-13 17-07-17 (5) 16-31-13 16-35-13 17-58-13 17-35-13 16-07-17 17-07-17 23-29-13 (1) 23-31-13 (1) 16-07-17 16-31-13 16-07-17 15-29-13 16-33-13 16-07-17 17-07-17 16-07-17 16-07-17 16-30-13 16-32-17 17-31-13 16-31-14 16-46-13 16-30-14 17-07-17 DGGE(2) ' RD ASO's (11) DGGE(6) RD AR (8) DGGE (1) RD PAGE (5) DGGE (2) SEQ SEQ (2) DGGE (1) RD DGGE DGGE DGGE SEQ DGGE DGGE DGGE SEQ DGGE DGGE SEQ DGGE DGGE DGGE DGGE DGGE SEQ RD DGGE DGGE Cutting et al.. 1990 Dean et al.. 1990 Kerem et al., 1990 Kerem et al.. 1990 Zielenski et al., 1991 Kerem et al.. 1990 Malone et al., CFGAC Kerem et al., 1990 Cutting et al., 1990 Zielenski et al., CFGAC lannuzzi et al., 1991 Highsmith et al., 1990 Osborne et al., 1991 this study Savov et al., 1994 Hamosh et al., CFGAC Graham et al., 1992 Petreska et al., CFGAC Claustres et al., 1993 Graham et al., 1991 Jones et al.. 1992 this study Kerem et al.. 1990 Edkins & Creegan, CFGAC Gasparini et al., 1991 Cutting et al.. 1992 Highsmith et al., 1994 Audriizet et al., 1993 Vidaud et al., 1990 "Numbers in parentheses after the microsatellite haplotypes refer to the number of alleles haplotyped when not all of the available chromosomeswere typed. Login to comment
74 441delA, 557delT 711+1G>T, 711+3A>G H199Y, L206W 977insA R297Q 1078delT,R334W, 1154insTC, R347P W401X l46linsAGAT 1525- 1G>A, A1507, AI5071AF508. Login to comment

[hide] Fluorescent multiplex microsatellites used to defi... Hum Mutat. 1996;8(3):229-35. Hughes D, Wallace A, Taylor J, Tassabehji M, McMahon R, Hill A, Nevin N, Graham C
Fluorescent multiplex microsatellites used to define haplotypes associated with 75 CFTR mutations from the UK on 437 CF chromosomes.
Hum Mutat. 1996;8(3):229-35., [PMID:8889582]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene contains three highly informative microsatellites: IVS8CA, IVS17bTA, and IVS17bCA. Their analysis improves prenatal/ carrier diagnosis and generates haplotypes from CF chromosomes that are strongly associated with specific mutations. Microsatellite haplotypes were defined for 75 CFTR mutations carried on 437 CF chromosomes (220 for delta F508, 217 for other mutations) from Northern Ireland and three English regions: the North-West, East Anglia, and the South. Fluorescently labelled microsatellites were amplified in a triplex PCR reaction and typed using an ABI 373A fluorescent fragment analyser. These mutations cover all the common and most of the rare CF defects found in the UK, and their corresponding haplotypes and geographic region are tabulated here. Ancient mutations, delta F508, G542X, N1303K, were associated with several related haplotypes due to slippage during replication, whereas other common mutations were associated with the one respective haplotype (e.g., G551D and R560T with 16-7-17, R117H with 16-30-13, 621 + 1G > T with 21-31-13, 3659delC with 16-35-13). This simple, fast, and automated method for fluorescent typing of these haplotypes will help to direct mutation screening for uncharacterised CF chromosomes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 CF 8CA-17bTA-17bCA Mutation chromosomes % Normal Laboratoryb Reference' HaplotVpe 1)15-29-13 557delT Nl Graham et al.. 1992 21 16-07-17 MU (G>T) 3) 16-24-13 4) 16-25-13 5) 16-29-13 6) 16-30-13 7) 16-30-14 8) 16-31-13 9) 16-31-14 10) 16-32-13 12) 16-33-13 13) 16-34-13 14) 16-35-13 11)16-32-17 15)1645-13 16) 1646-13 17) 1646-14 19) 17-07-17 18)16-53-13 20)17-29-14 21) 17-31-13 22) 17-32-13 23) 17-35-13 24) 17-51-11 25) 17-55-13 27) 17-58-13 28) 21-31-13 29) 22-31-13 31)23-22-17 26) 17-56-13 30) 22-33-13 32) 23-29-13 33)23-31-13 34)23-32-13 35)23-33-13 36)23-34-13 37) 23-36-13 38)24-22-17 39) 24-31-13 182delT P67L R75X L206W 1154insTC 146linsAGAT Q493x V520F 1717-1G>A G551D R560T V562L R709X S1196X L1254X R1283M G85E 2184insA 711+lG>T 3495delA 4279insA SlOR L88S R117C R117H G178R 1717-1G>A Y563N W1098R G1123R 3850- 1G>A E6OX %%deIT 1138insG R34P 2183AA>G 2184delA R1158X 1078delT R1162X 3849G>A Q141W R347P Y917C G2iX 711+3A>G 441delA 3130de115 3659delC 1898+1G>A R709X 2711delT R1158X E92K 3849+lOkbC>T 2118delAACT 4048insCC 296+1 2 T S Q22OX R297Q A1507 2789+5G>A 3120+1G>A W128W 1811+lG>C AF508 E831X R116W AF508 W846X1 3120G>A R785X R553X R553X R553X 621+1G>T G542X G542X Y1182X N1303K AF508 G54W 3041delG 1525-1G>A N1303K G542X G542X G542X 394delTT R709X N1303K 1 1 1 2 1 1 4 2 3 4 2 26 8 1 1 1 1 1 8 1 1 1 1 1 1 1 19 1 2 1 1 1 1 7 1 1 2 1 1 2 1 1 1 1 1 1 1 1 2 1 1 7 4 1 2 1 1 2 1 1 4 Asian 1 2 1Asian 5 4 i Afro-Caribbean 5 1 42 (19%) 1 1 57 (26%) 1 2 1 1 1 2 12 2 11.4 0.4 4.9 16.3 1.1 3.8 1.9 10.6 2.3 1.5 2.3 1.5 2.7 4.5 0.4 0.8 0.8 0.4 0.8 0.4 1 2 1 7 1 1 1Asian 1 1.5 0.8 0.8 NI G NI, M M NI NI. Login to comment

[hide] Four adult patients with the missense mutation L20... Hum Genet. 1995 Dec;96(6):717-20. Desgeorges M, Rodier M, Piot M, Demaille J, Claustres M
Four adult patients with the missense mutation L206W and a mild cystic fibrosis phenotype.
Hum Genet. 1995 Dec;96(6):717-20., [PMID:8522333]

Abstract [show]
We report molecular and clinical analyses in four unrelated patients with cystic fibrosis (CF) with compound heterozygosity for the L206W mutation in the cystic fibrosis transmembrane conductance regulator gene (CFTR). This uncommon missense mutation (frequency less than 1% in a sample of 336 CF chromosomes from Southern France) replaces a leucine by a tryptophan residue in the middle of the third transmembrane domain of CFTR. On the basis of the clinical features presented by the four patients, we postulate that the L206W might be associated with pancreatic sufficiency and residual transmembrane transport of chloride in lung.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Hum Genet (1995) 96:717-720 9 Springer-Verlag 1995 Marie Desgeorges 9 Michel Rodier 9 Michel Piot Jacques Demaille 9 Mireille Claustres Four adult patients with the missense mutation L206W and a mild cystic fibrosis phenotype Received: 28 February 1995 / Revised: 17 April 1995 Abstract We report molecular and clinical analyses in four unrelated patients with cystic fibrosis (CF) with compound heterozygosity for the L206W mutation in the cystic fibrosis transmembrane conductance regulator gene (CFTR). Login to comment
2 On the basis of the clinical features presented by the four patients, we postulate that the L206W might be associated with pancreatic sufficiency and residual transmembrane transport of chloride in lung. Login to comment
10 We had previously identified in our population one of the four missense mutations found in TM3, named L206W (Claustres et al. 1993). Login to comment
12 As clinical and genetic analysis of CF patients help in our understanding of the genotype-phenotype relations and of the physiopathology of CF, we report the clinical features of four patients who were found to carry the putative mild mutation L206W. Login to comment
14 Materials and methods Clinical report The genotypes and the main clinical features presented by the four patients heterozygous for L206W are summarized in Table 1. Login to comment
23 At 22 years of age, Table 1 Clinical and laboratory features of individuals with L206W P S V A Ethnicity Andalusia Southern France Southern France Southern France Genotype G524X/L206W AI507/L206W AF508/L206W AFS08/L206W lntron 8 9T/9T 7T/9T 9T/9T 9T/gT Haplotype :' 6-B/g-B 6-D/8-B 6-B/8-B 6-B/8-B Sex Male Male Female Female Age at diagnosis 22 years 34 years 15 years 5 years Current age~' 29 years (1966) 40 years (1955) 17 years (1978) 15 years (1980) Professional activity Bricklayer Seasonal country worker Student Student Circumstances of Hypokaliemia, Hypokaliemia, DNA study Chronic bronchitis diagnosis diffuse muscle cramps, diffuse muscle cramps, extracellular depletion extracellular depletion Sweat chloride (mmol/l) 58, 78, 60 71, 58, 51 180, 200 60, 62 Meconium ileus No No No No Growth retardation No No Yes No Pancreatic sufficiency Yes Yes Yes Enzyme supplemented Respiratory function Normal course Repetitive upper airway Asthma, allergy Mild symptoms infections during infancy Other Azoospermia, Azoospermia, Obstructive uropathy, bilateral aplasia of vas bilateral aplasia of vas renal cyst (right) deferens deferens, alcoholism, nicotine addiction ~'6 or 8 is the number of (gatt) copies in intron 6a, B or D is the haplotype defined by the extragenic markers KM 19 and XV-2c h Birth date in parentheses Fig. 1 Structure of the families 1.206W studied. Login to comment
24 Open symbols, and J~ 0 halJ:filled symbols, healthy individuals filled symbols, CF (cystic fibrosis) G542X G542X G542X G542X L206W 1.,206W AI507 S L206W L206W A1507 O L206W AF508 AF508 V #, g g g AF508 L206W L206W AF508 AF508 while working in the sun in the hot and arid climate of southern France, he presented with two severe acute dehydration episodes, with excessive sweating and salt crystals on the skin. Login to comment
41 As L206W creates an StyI site, a simple PCR restriction test was designed to screen DNAs for this mutation: a site was not found among 100 non-CF alleles (data not shown). Login to comment
47 Results and discussion In this paper we present four patients with the L206W mutation in one of their CFTR genes; this condition has not been described to date in other populations. Login to comment
48 The missense mutation L206W replaces a leucine by a tryptophan residue at position 206 in exon 6a, in the middle of the third transmembrane domain (TM3) of the CFTR molecule. Login to comment
49 Several arguments suggest that L206W is a CF allele and not a neutral sequence variation. Login to comment
53 The study of DNA polymorphic sites revealed that, in each case, L206W is associated with haplotype 1-2-1-2-2 defined by the bi-allelic markers (XV2c-KM19-M470V- T854T-J.311), and with haplotype 16-7-17 defined by the three intragenic microsatellites (IVS8CA-IVS17BTA- IVS 17BCA). Login to comment
54 Interestingly, L206W was found on a chromosome carrying eight copies of the (gatt) repeat in front of exon 6b; this has not been reported so far for other mutations. Login to comment
55 Since L206W is associated with a 9T allele in intron 8, it can be deduced that exon 9 is correctly spliced into the corresponding CFTR mRNA (Kiesewetter et al. 1993). Login to comment
56 In the light of previous studies on a genotype-phenotype correlation between CFTR mutations and pancreatic function in CF patients (Kristidis et al. 1992), the L206W mutation may be considered as a mild allele, as it confers a pancreatic sufficient phenotype to patients. Login to comment
60 Based on previous studies on missense mutations in the first membrane-spanning domain (Sheppard et al. 1993), it is tempting to speculate that L206W might affect the function of the channel pore, resulting only in a reduction of the amount of C1- current. Login to comment

[hide] Mutations in the cystic fibrosis gene in patients ... N Engl J Med. 1995 Jun 1;332(22):1475-80. Chillon M, Casals T, Mercier B, Bassas L, Lissens W, Silber S, Romey MC, Ruiz-Romero J, Verlingue C, Claustres M, et al.
Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens.
N Engl J Med. 1995 Jun 1;332(22):1475-80., [PMID:7739684]

Abstract [show]
BACKGROUND: Congenital bilateral absence of the vas deferens (CBAVD) is a form of male infertility in which mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene have been identified. The molecular basis of CBAVD is not completely understood. Although patients with cystic fibrosis have mutations in both copies of the CFTR gene, most patients with CBAVD have mutations in only one copy of the gene. METHODS: To investigate CBAVD at the molecular level, we have characterized the mutations in the CFTR gene in 102 patients with this condition. None had clinical manifestations of cystic fibrosis. We also analyzed a DNA variant (the 5T allele) in a noncoding region of CFTR that causes reduced levels of the normal CFTR protein. Parents of patients with cystic fibrosis, patients with types of infertility other than CBAVD, and normal subjects were studied as controls. RESULTS: Nineteen of the 102 patients with CBAVD had mutations in both copies of the CFTR gene, and none of them had the 5T allele. Fifty-four patients had a mutation in one copy of CFTR, and 34 of them (63 percent) had the 5T allele in the other CFTR gene. In 29 patients no CFTR mutations were found, but 7 of them (24 percent) had the 5T allele. In contrast, the frequency of this allele in the general population was about 5 percent. CONCLUSIONS: Most patients with CBAVD have mutations in the CFTR gene. The combination of the 5T allele in one copy of the CFTR gene with a cystic fibrosis mutation in the other copy is the most common cause of CBAVD: The 5T allele mutation has a wide range of clinical presentations, occurring in patients with CBAVD or moderate forms of cystic fibrosis and in fertile men.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 OF PATIENTS POLYT GENOTYPE† ⌬F508/R668C ⌬F508/D1152H ⌬F508/D1270N ⌬;F508/R75L ⌬F508/R117H ⌬F508/L206W ⌬F508/R258G ⌬F508/S1235R ⌬F508/R347H ⌬F508/R347H R117H/G1349D R117H/712-1G→T G149R/R668C R347H/R1066H R553X/R668C R1070W/2869insG ⌬F508/- G542X/- W1282X/- R334W/- K1060T/- R1162X/- N1303K/- A800G/- ⌬F508/- ⌬F508/- ⌬F508/- ⌬E115/- R117H/- R347H/- G542X/- R553X/- 1677delTA/- 2184delA/- 2789ϩ5G→Α/- S1235R/- W1282X/- -/- -/- -/- -/- 2 2 2 1 1 1 1 1 1 1 1 1 1 1 1 1 22 4 3 1 1 1 1 1 7 1 1 1 1 2 1 1 1 1 1 1 1 3 3 1 19 9T/7T 9T/7T 9T/7T 9T/7T 9T/7T 9T/9T 9T/7T 9T/7T 9T/7T 9T/9T 7T/7T 7T/9T 9T/7T 9T/7T 7T/7T 7T/7T 9T/5T 9T/5T 7T/5T 7T/5T 7T/5T 7T/5T 9T/5T 5T/5T 9T/7T 9T/9T 7T/7T 7T/7T 7T/7T 9T/7T 9T/7T 7T/7T 7T/7T 7T/7T 7T/7T 7T/9T 7T/7T 9T/5T 7T/5T 5T/5T 7T/7T -/- 3 7T/9T *Data were obtained from the Spanish population analyzed in this study. Login to comment

[hide] Increased incidence of cystic fibrosis gene mutati... Hum Mol Genet. 1995 Apr;4(4):635-9. Pignatti PF, Bombieri C, Marigo C, Benetazzo M, Luisetti M
Increased incidence of cystic fibrosis gene mutations in adults with disseminated bronchiectasis.
Hum Mol Genet. 1995 Apr;4(4):635-9., [PMID:7543317]

Abstract [show]
In order to identify a possible hereditary predisposition to the development of obstructive pulmonary disease of unknown origin, we have looked for the presence of Cystic Fibrosis Transmembrane Regulator (CFTR) gene mutations in unrelated patients with no signs of Cystic Fibrosis (CF). We screened for 70 common mutations, and also for rare mutations by denaturing gradient gel electrophoresis analysis. In this search, different CFTR gene mutations (R75Q, delta F508, R1066C, M1137V and 3667ins4) were found in five out of 16 adult Italian patients with disseminated bronchiectasis, a significant increase over the expected frequency of carriers. Moreover, three rare CFTR gene DNA polymorphisms (G576A, R668C, and 2736 A-->G), not deemed to be the cause of CF, were found in two patients, one of which was a compound heterozygote with R1066C. These results indicate that CFTR gene mutations, and perhaps also DNA polymorphisms, may be involved in the etiopathogenesis of at least some cases of bronchiectasis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 List of CFTR gene mutations and DNA polymorphisms screened Mutations R75Q/X/L, G85E, 394deITT 457TAT->G, R117H 621 + 1G->T 711 + 5G->A L206W 875 + 40 A->G 936 del TA 1001 + 11C->T R334W, R347 P/H/L, 1154insTC A455E, V456F DF5O8 1717-IG->A, 1717-8G->A G542X, G551D, Q552X, R553X P574H 1898 + 3A->G 2183 AA->G, 2184delA, R709X D836Y, 2694 T/G 2752-22 A/G 2789 + 5 G->A, 2790-2 A-»G Q890X 3041-71 G/C 3132delTG 3271 + 18 C-»T, 3272-26 A->G H1054D, G1061R, R1066C/H, A1067T, H1085R, Y1092X, 3320 ins5 D1152H R1162X, 3667ins4, 3737delA, 11234V 3849 + 10 kb C-»T, 3850-1 G-»A SI25IN, S1255P, 3905insT, 3898insC, D127ON, W1282X, R1283M, 4002 A/G 4005 + 1 G-»A N1303 K/H, 4029 A/G D1377H Q1411 X 4404 C/T, 4521 G/A Location e 3 e 4 i 4 i 5 e 6a i 6a e 6b i 6b e 7 e 9 e 10 i 10 e 11 e 12 i 12 e 13 e 14a i 14a i 14b e 15 i 15 e 17a i 17a e 17b e 18 e 19 i 19 e 20 i 20 e2l e 22 e 23 e24 Listing is in order of location along the CFTR gene, e = exon; i = intron. Login to comment

[hide] Extensive analysis of 40 infertile patients with c... Hum Genet. 1995 Feb;95(2):205-11. Casals T, Bassas L, Ruiz-Romero J, Chillon M, Gimenez J, Ramos MD, Tapia G, Narvaez H, Nunes V, Estivill X
Extensive analysis of 40 infertile patients with congenital absence of the vas deferens: in 50% of cases only one CFTR allele could be detected.
Hum Genet. 1995 Feb;95(2):205-11., [PMID:7532150]

Abstract [show]
Mutations in the cystic fibrosis (CF) conductance transmembrane regulator (CFTR) gene have been detected in patients with CF and in males with infertility attributable to congenital bilateral absence of the vas deferens (CBAVD). Thirty individuals with CBAVD and 10 with congenital unilateral absence of the vas deferens (CUAVD) were analyzed by single-strand conformation analysis and denaturing gradient gel electrophoresis for mutations in most of the CFTR gene. All 40 individuals were pancreatic sufficient, but twenty patients had recurrent or sporadic respiratory infections, asthma/asthmatic bronchitis, and/or rhino-sinusitis. Agenesia or displasia of one or both seminal vesicles was detected in 30 men and other urogenital malformations were present in six subjects. Among the 40 samples, we identified 13 different CFTR mutations, two of which were previously unknown. One new mutation in exon 4 was the deletion of glutamic acid at codon 115 (delta E115). A second new mutation was found in exon 17b, viz., an A --> C substitution at position 3311, changing lysine to threonine at codon 1060 (K1060T). CFTR mutations were detected in 22 out of 30 (73.3%) CBAVD patients and in one out of 10 (10%) CUAVD individuals, showing a significantly lower incidence of CFTR mutations in CBAVD/CUAVD patients (P << 0.0001), compared with that found in the CF patient population. Only three CBAVD patients were found with more than one CFTR mutation (delta F508/L206W, delta F508/R74W + D1270N, R117H/712-1G --> T), highlighting L206W, R74W/D1270N, and R117H as benign CF mutations. Sweat electrolyte values were increased in 76.6% of CBAVD patients, but three individuals without CFTR mutations had normal sweat electrolyte levels (10% of the total CBAVD patients), suggesting that factors other than CFTR mutations are involved in CBAVD. The failure to identify a second mutation in exons and their flanking regions of the CFTR gene suggests that these mutations could be located in introns or in the promoter region of CFTR. Such mutations could result in CFTR levels below the minimum 6%-10% necessary for normal protein function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
9 Only three CBAVD patients were found with more than one CFFR mutation (AF508/L206W, AF508/R74W + D 1270N, R 117H/712-1G--~T), highlighting L206W, R74W/ T. Casals -M. Chill6n. Login to comment
59 Direct sequencing of these two abnormal fragments identified mutation R ll7H, a known Table 1 Semen analysis of patients with CAVD, given as the mean (range) CBAVD CUAVD (n = 27) (n = 10) Sperm (x 106/ml) 0 10.6 (0-90) Seminal volume (ml) 0.9 (0.2-3.1) 2.5 (0.4 5.4) pH 6.7 (6.0-8.0) 7.3 (6.4-7.7) Fructose (retool/l) 2.6 (0-9) 10.3 (3-) '~Citrate (mmol/l) 77.5 (11-188) 48.6 (36-88) ~Reference values: fructose, 8 28 retool/l; citrate, 10 35 retool/1 Table 2 CFTR mutation analysis in 30 CBAVD and 10 CUAVD patients (CBAVD congenital bilateral absence of the vas deferens, CUAVD congenital unilateral absence of the vas deferens, ND not determined, - absence of mutations, RRI recurrent respiratory infection, R rhinitis, RS rhino-sinusitis, BR.ASTH bronchitis asthmatic) Table 3 Congenital malformations associated with CAVD in 40 patients 207 Patient Age Phenotype Sweat test Mutation Other clinical (years) (mEq/l) features 1 37 CBAVD 108 1677delTA 2 28 CBAVD 50 G542X 3 28 CBAVD 118 - 4 33 CBAVD 90 AF508/L206W RRI, R 5 26 CBAVD 118 R117H/712-1G-+T 6 42 CBAVD 66 - RS 7 31 CBAVD 170 AF508 R 8 27 CBAVD 100 AF508/R74W + D1270N RRI, R 9 32 CBAVD 74 AE115 RS 10 35 CBAVD 90 - Nasal polyps 11 33 CBAVD 78 KI060T RI, family history 12 45 CBAVD 150 R334W RS 13 42 CBAVD 60 - 14 40 CBAVD 110 R 1070W RS 15 29 CBAVD 110 G542X 16 37 CBAVD 80 R117H RI, RS, BR.ASTH 17 37 CBAVD 85 - Asthma 18 46 CBAVD 15 R1162X 19 37 CBAVD 110 AF508 RS, diarrhoea 20 42 CBAVD 45 2789+5G--)A RI 21 49 CBAVD 95 AF508 22 36 CBAVD 70 AF508 RRI, RS 23 42 CBAVD 90 - 24 15 CBAVD 150 AF508 25 26 CBAVD 60 - 26 39 CBAVD 100 AF508 RRI, RS 27 33 CBAVD 57 AF508 RRI 28 33 CBAVD 80 G542X 29 34 CBAVD 78 - 30 32 CBAVD 113 G542X 31 33 CUAVD ND AF508 RS, pancreatitis 32 37 CUAVD ND - 33 31 CUAVD 77 - BR.ASTH 34 39 CUAVD ND - 35 40 CUAVD 40 - 36 33 CUAVD 59 - 37 40 CUAVD 90 - 38 47 CUAVD 40 - RRI 39 39 CUAVD 50 - 40 35 CUAVD 100 - No. Login to comment
83 The analysis of this specific mutation/haplotype association allowed us to identify mutations L206W (167-17), 712-1G-+T (23-31-13), R334W (17-46-13), and 2789 + 5G--->A (17-7-17), on one mutated chromosome each. Login to comment
96 One patient was heterozygous AF508/L206W and had recurrent pulmonary infection and rhinitis episodes from the age of 24. Login to comment
97 Our data on Spanish CF patients with the mutation L206W (Claustres et al. 1993) suggest that L206W is a mild mutation associated with a benign CF phenotype (T. Casals, unpublished). Login to comment

[hide] Identification of seven rather infrequent and one ... Hum Mol Genet. 1994 Dec;3(12):2249-50. Teng H, Cuppens H, De Boeck C, Cassiman JJ
Identification of seven rather infrequent and one novel CFTR mutation in the Belgian population.
Hum Mol Genet. 1994 Dec;3(12):2249-50., [PMID:7881429]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Seven of these were described previously: R117H (2), G551D (3), R553X (3), 394delTT (4), L206W (4), G85E (5) and D1152H (6). Login to comment

[hide] Sensitivity of single-strand conformation polymorp... Hum Mol Genet. 1994 May;3(5):801-7. Ravnik-Glavac M, Glavac D, Dean M
Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene.
Hum Mol Genet. 1994 May;3(5):801-7., [PMID:7521710]

Abstract [show]
The gene responsible for cystic fibrosis (CF) contains 27 coding exons and more than 300 independent mutations have been identified. An efficient and optimized strategy is required to identify additional mutations and/or to screen patient samples for the presence of known mutations. We have tested several different conditions for performing single-stranded conformation polymorphism (SSCP) analysis in order to determine the efficiency of the method and to identify the optimum conditions for mutation detection. Each exon and corresponding exon boundaries were amplified. A panel of 134 known CF mutations were used to test the efficiency of detection of mutations. The SSCP conditions were varied by altering the percentage and cross-linking of the acrylamide, employing MDE (an acrylamide substitute), and by adding sucrose and glycerol. The presence of heteroduplexes could be detected on most gels and in some cases contributed to the ability to distinguish certain mutations. Each analysis condition detected 75-98% of the mutations, and all of the mutations could be detected by at least one condition. Therefore, an optimized SSCP analysis can be used to efficiently screen for mutations in a large gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 Exon 1: S4X (24), 186-13C-G (F£rec et al., pers. comm.); Exon 2: G27X (Shacldeton and Harris, pers. comm.), Q30X (Chilldn aal., pers. comm.), R31L (Zielenski et al., pers. comm.), Q39X (25); Exon 3: 300delA (Malone et al., pers. comm.), W57G (Ferrari et al., pers. comm.), W57X (26), E60X (Malone et al., pers. comm.), R74W (Claustres et al., pers. comm.), R75Q (27), G85E (28), 394delTT (Claustres et al., pers. comm.), L88X (Maceketal., pers. comm.), L88S (Malone et al., pers. comm.), 405 + 1G-A (Dork and Tummler, pers. comm.); Exon 4: E92K (Chillon et al., pers. comm.), E92X (D6rk a al., pers. comm.), P99L (Schwartz and Holmberg, pers. comm.), 441delA (Zielenski et al., pers. comm.), 444delA (29), 457TAT-C- (F£rec et al., pers. comm., (21), Dl 10H (14), Rl 17C (D6rk et al., pers. comm.), Rl 17H (14), A120T (Chillon et al., pers. comm.), 541delC (30), 556delA (28), I148T (Rininsland et al., pers. comm.), Q151X (Shacldeton et al., pers. comm.), 621 + 1C-T (28), 622-2A-C (31); Exon5:G178R (28), 681delC (Zielenski a al., pers. comm.), 711 + 1G-T (28); Exon 6a: H199Y (Dork and Tummler, pers. comm.), H199Q (Dean etal., pers. comm.), L206W (Claustres et al., pers. comm.), Q220X (Shacldeton and Harris, pers. comm., Schwartz and Holmberg, pers. comm.), 852del22 (32); Exon 6b: 977insA (33); Exon7:F311L(34). Login to comment

[hide] Analysis of the CFTR gene confirms the high geneti... Hum Genet. 1994 Apr;93(4):447-51. Chillon M, Casals T, Gimenez J, Ramos MD, Palacio A, Morral N, Estivill X, Nunes V
Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes.
Hum Genet. 1994 Apr;93(4):447-51., [PMID:7513293]

Abstract [show]
We have analysed 972 unrelated Spanish cystic fibrosis patients for 70 known mutations. Analysis was performed on exons 1, 2, 3, 4, 5, 6a, 6b, 7, 10, 11, 12, 13, 14a, 14b, 15, 16, 17b, 18, 19, 20 and 21 of the cystic fibrosis transmembrane regulator gene using single strand conformation polymorphism analysis and denaturing gradient gel electrophoresis. The major mutation delta F508 accounts for 50.6% of CF chromosomes, whereas another 42 mutations account for 27.6% of CF chromosomes, with 21.8% of Spanish CF chromosomes remaining uncharacterized. At present, we have identified 36 mutations that have frequency of less than 1% and that are spread over 15 different exons. This indicates that, in the Spanish population, with the exception of delta F508 (50.6%) and G542X (8%), the mutations are not concentrated in a few exons of the gene nor are there any predominating mutations. This high degree of genetic heterogeneity is mainly a result of the different ethnic groups that have populated Spain and of the maintenance of separated population sets (Basques, Arab-Andalusian, Mediterranean, Canarian and Gallician). The high proportion of CF chromosomes still unidentified (21.8%) together with association analysis with intragenic markers suggest that at least 100 different mutations causing CF are present in our population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 A Exon 13 4 0.41 621-1 G--~T Intron 4 3 0.31 P205S Exon 6a 3 0.31 936 del TA Exon 6b 3 0.31 1949 del 84 Exon 13 3 0.31 K710X Exon 13 3 0.31 CF del #1 Exon 4-7/11-18 3 0.31 L206W Exon 6a 2 0.20 R347H Exon 7 2 0.20 Y1092X Exon 17b 2 0.20 Q1100P Exon 17b 2 0.20 Q30X Exon 2 1 0.10 E92K Exon 4 1 0.10 A120T Exon 4 1 0.10 I148T Exon 4 1 0.10 H199Y Exon 6a 1 0.10 1078 del T Exon 7 1 0.10 1717-1 G--+A Intron 10 1 0.10 T582R Exon 12 1 0.10 E585X Exon 12 1 0.10 1898+3 A~---G Intron 12 1 0.10 W1098X Exon 17b 1 0.10 R1158X Exon 19 1 0.10 3667 del 4 Exon 19 1 0.10 3860 ins 31 Exon 20 1 0.10 3905 ins T Exon 20 1 0.10 Unknown 212 21.81 The Basque subset The Basques have a different genetic background with respect to other ethnic groups (Pancorbo et al. 1989) as they are the only pre-Indoeuropean group in Spain. Login to comment

[hide] Analysis of the 27 exons and flanking regions of t... Hum Mol Genet. 1993 Aug;2(8):1209-13. Claustres M, Laussel M, Desgeorges M, Giansily M, Culard JF, Razakatsara G, Demaille J
Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France.
Hum Mol Genet. 1993 Aug;2(8):1209-13., [PMID:7691344]

Abstract [show]
In order to characterize the non-delta F508 mutations that account for 36% of cystic fibrosis (CF) chromosomes in Southern France in a sample of 137 patients, we have systematically screened the entire coding region and adjacent sequences of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by the single strand conformation polymorphism (SSCP) technique followed by direct sequencing of the mutant DNAs. We identified 13 novel mutations (9 reported in this paper) and 4 novel rare nucleotide sequence variations. Forty different mutations including delta F508, located in 15 exons, account for only 91.2% of mutants in a population originating from Southern France, in contrast with a recent report on the Celtic population of Brittany demonstrating that 90% of mutations can be detected with only three mutations. We present a very large spectrum of different CF mutations identified in a small geographical area.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation? Login to comment
38 L206W. Login to comment
66 The (gatt)^ repeats in intron 6a were found associated to L206W in the three unrelated patients carrying this mutation (Figure 5). Login to comment
72 As the sensitivity of SSCP in detecting point Sequence -T-G SSCP SSCP <*M L206W L206W Sequence (gatt) repeats intron 6a 6x 7x 8x / 6x 7x / 6x 7x / 7x intron 6a (gatt) repeats Figure 5. Login to comment
73 Single stranded conformatkmal and sequence analysis of both the mutation L206W in exon 6a and the sequence repeat (gatt) immediately preceding exon 6b. Login to comment
74 The familial segregations of L206W together with the (gatt) 8x repeats are shown in two unrelated pedigrees. Login to comment
75 The SSCP analysis of L206W has been performed on 385-bp PCR fragments; the (gatt) repeats have been analyzed after digestion of PCR fragments containing exon 6b by Ddel. Login to comment

[hide] Variation in a repeat sequence determines whether ... Am J Hum Genet. 2004 Jan;74(1):176-9. Epub 2003 Dec 18. Groman JD, Hefferon TW, Casals T, Bassas L, Estivill X, Des Georges M, Guittard C, Koudova M, Fallin MD, Nemeth K, Fekete G, Kadasi L, Friedman K, Schwarz M, Bombieri C, Pignatti PF, Kanavakis E, Tzetis M, Schwartz M, Novelli G, D'Apice MR, Sobczynska-Tomaszewska A, Bal J, Stuhrmann M, Macek M Jr, Claustres M, Cutting GR
Variation in a repeat sequence determines whether a common variant of the cystic fibrosis transmembrane conductance regulator gene is pathogenic or benign.
Am J Hum Genet. 2004 Jan;74(1):176-9. Epub 2003 Dec 18., [PMID:14685937]

Abstract [show]
An abbreviated tract of five thymidines (5T) in intron 8 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene is found in approximately 10% of individuals in the general population. When found in trans with a severe CFTR mutation, 5T can result in male infertility, nonclassic cystic fibrosis, or a normal phenotype. To test whether the number of TG repeats adjacent to 5T influences disease penetrance, we determined TG repeat number in 98 patients with male infertility due to congenital absence of the vas deferens, 9 patients with nonclassic CF, and 27 unaffected individuals (fertile men). Each of the individuals in this study had a severe CFTR mutation on one CFTR gene and 5T on the other. Of the unaffected individuals, 78% (21 of 27) had 5T adjacent to 11 TG repeats, compared with 9% (10 of 107) of affected individuals. Conversely, 91% (97 of 107) of affected individuals had 12 or 13 TG repeats, versus only 22% (6 of 27) of unaffected individuals (P<.00001). Those individuals with 5T adjacent to either 12 or 13 TG repeats were substantially more likely to exhibit an abnormal phenotype than those with 5T adjacent to 11 TG repeats (odds ratio 34.0, 95% CI 11.1-103.7, P<.00001). Thus, determination of TG repeat number will allow for more accurate prediction of benign versus pathogenic 5T alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 Each of the 98 patients with CBAVD had 5T with one of the following mutations: DF508 (78), G542X (6), N1303K (3), 711af9;1GrT (2), R1066C (2), R1162X (2), R764X (1), Y563X (1), H609R (1), L206W (1), or R334W (1). Login to comment

[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Some have concentrated in the search of specific mutations that are Table 1 Mutations found in the Latin American CF patients Exon 1 p.L6VÌe; Exon 3 p.W57X, p.R75X, p.G85E Exon 4 p.R117H Exon 6a p.H199Y, p.V201M, p.L206W, p.Q220X, p.V232D, c.846delTÌe; Exon 6b p.Y275XÌe;, c.935delA Exon 7 p.R334W, p.R347P, p.Y362XÌe;, c.1078delT, c.1215delG Exon 8 c.1323_1324insAÌe; Exon 9 c.1460_1461delATÌe;, c.1353_1354insTÌe;,# Exon 10 p.I506T, p.I507del, p.F508del Exon 11 p.G542X, p.S549N, p.S549R, p.G551D, p.G551S, p.R553X, p.L558S, p.A559T, c.1782delA Exon 12 p.S589I Exon 13 p.H609RÌe;, p.P750L, p.V754M, c.1924_1930del, c.2055_2063del, c.2183AA NG;c.2184delA, c.2184delA, c.2185_2186insC, c.2347delG, c.2566_2567insTÌe;, c.2594_2595delGTÌe; Exon 14a p.R851L, c.2686_2687insTÌe; Exon 15 c.2869_2870insG Exon 16 c.3120+1GNA Exon 17a p.I1027T, c.3171delC, c.3199_3204del Exon 17b p.G1061R, p.R1066C, p.W1069X#, p.W1089X, p.Y1092X, p.W1098CÌe; Exon 19 p.R1162X, p.W1204X, p.Q1238X, c.3617_3618delGAÌe;#, c.3659delC Exon 20 p.W1282X, p.R1283M Exon 21 p.N1303K, c.4016_4017insT Exon 22 c.4160_4161insGGGGÌe; 5' flanking c.-834GNT Intron 2 c.297-1GNAÌe;, c.297-2ANG Intron 3 c.406-1GNA Intron 4 c.621+1GNT Intron 5 c.711+1GNT Intron 8 c.IVS8-5T Intron 10 c.1716GNA, c.1717-1GNA Intron 11 c.1811+1.6KbANG, c.1812-1GNA Intron 12 c.1898+1GNA, c.1898+3ANG Intron 14 c.2789+2_2789+3insA, c.2789+5GNA Intron 17a c.3272-26ANG Intron 17b c.3500-2ANGÌe; Intron 19 c.3849+1GNA, c.3849+10KbCNT Intron 20 c.4005+1GNA, c.4005-1GNA# Mutations are listed according to their position in the gene. Login to comment
46 of chromosomes analysed p.F508del p.G542X p.W1282X p.N1303K p.R1162X p.L6VÌe; p.W57X p.R75X p.G85E p.R117H p.H199Y p.V201M p.L206W p.Q220X p.V232D p.Y275XÌe; p.R334W p.R347P p.Y362XÌe; p.I506T Argentina 98 61 440 258 18 12 12 2 1 1 3 1 5 1 310 181 20 7 5 5 7 0 5 0 222 135 15 7 5 1 26 14 2 1 1 150 88 6 6 1 2 3 Subtotal and frequency (%) 1246 100 737 59.15 61 4.90 27 2.17 28 2.25 9 0.72 1 0.08 1 0.08 13 1.04 1 0.08 13 1.04 1 0.08 Brazil 468 221 26 11 74 38 2 1 320 155 28 3 8 8 4 1 2 1 1 8 122 62 120 38 10 3 148 38 4 0 0 48 15 154 75 5 1 0 2 0 386 154 24 6 10 17 9 0 10 1 18 4 0 0 2 0 0 0 0 Subtotal and frequency (%) 1858 100 800 43.06 99 5.33 11 0.59 34 1.83 25 1.35 13 0.70 1 0.05 2 0.11 1 0.05 1 0.05 20 1.07 1 0.05 Chile 72 21 36 11 3 0 44 22 4 3 1 1 100 45 7 5 0 2 0 2 0 Subtotal and frequency (%) 252 100 99 41.28 14 5.55 8 3.17 3 1.19 3 1.19 Colombia 184 77 7 2 1 2 1 34 13 2 1 1 Subtotal and frequency (%) 218 100 90 41.28 9 4.13 3 1.38 2 0.92 2 0.92 1 0.46 Costa Rica Frequency (%) 48 100 11 22.91 12 25.00 0 0 0 0 0 Cuba Frequency (%) 144 100 49 34.03 Ecuador 32 11 1 50 16 2 2 20 5 0 0 0 Subtotal and frequency (%) 102 100 32 31.37 2 1.96 1 0.98 2 1.96 Mexico 194 79 12 4 3 1 1 1 2 80 36 4 1 Subtotal and frequency (%) 274 100 115 41.97 16 5.84 5 1.82 3 1.09 1 0.36 1 0.36 1 0.36 2 0.73 Uruguay Frequency (%) 76 100 43 56.58 6 7.89 2 2.63 3 3.95 3 3.95 2 2.63 Venezuela 54 16 2 82 41 Subtotal and frequency (%) 136 100 57 41.91 2 1.47 Total 4354 2033 221 49 72 42 1 1 3 32 1 1 1 2 1 1 1 39 1 1 2 Frequency (%) 100 46.69 5.08 1.13 1.65 0.96 0.02 0.02 0.07 0.73 0.02 0.02 0.02 0.05 0.02 0.02 0.02 0.90 0.02 0.02 0.05 The five most frequent mutations are shown on the left-hand side, followed by the rest of the mutations in 5'-3' and exon-intron order. Login to comment
98 As an example, in the case of Argentina and Uruguay, the p.F508del mutation shows the highest frequencies (59% and Table 5 Mutations with frequencies less than 0.1% Panel A Mutation Number of chromosomes % Country p.R75X 3 0.07 Mexico c.W1089X 3 0.07 Argentina, Brazil c.406-1GNA 3 0.07 Mexico c.1898+1GNA 3 0.07 Argentina, Brazil c.2686_2687insTÌe; 3 0.07 Argentina, Brazil p.L206W 2 0.05 Brazil p.I506T 2 0.05 Mexico p.S589I 2 0.05 Argentina c.711+1GNT 2 0.05 Argentina c.935delA 2 0.05 Mexico c.2055_2063del 2 0.05 Mexico c.2347delG 2 0.05 Brazil c.2566_2567insTÌe; 2 0.05 Argentina c.2789+2_2789+3insA 2 0.05 Argentina c.3199_3204del 2 0.05 Mexico c.3272-26ANG 2 0.05 Argentina c.4016_4017insT 2 0.05 Argentina Panel B Mutation N % each Country p.L6VÌe;, p.W57X, p.Q220X, p.Y362XÌe;, p.I1027T, p.G1061R, p.R1283M, c.297-2ANG, c.1353_1354insTÌe;, c.1460_1461delATÌe;, c.1782delA, c.1898+3ANG, c.2184delA, c.2594_2595delGTÌe;, c.2869_2870insG, c.4005Ìe;1GNA, c.4005-1GNA# 17 0.02 Argentina p.R117H, p.H199Y, p.G551S, p.L558S, p.P750L, p.V754M, p.W1069X#, p.W1098CÌe;, p.W1204X, c.297-1GNAÌe;, c.846delTÌe;, c.1078delT, c.1716GNA, c.1924_1930del, c.4160_4161insGGGGÌe; 15 0.02 Mexico p.V201M, p.V232D, p.Y275XÌe;, p.R347P, p.R851L, p.Q1238X, c.3171delC, c.3617_3618delGAÌe;# 8 0.02 Brazil p.A559T, p.H609RÌe;, c.1215delG, c.1323_1324insAÌe;, c.2185_2186insC, c.3500-2ANGÌe;, c.3849+1GNA, 7 0.02 Colombia c.-834GNT 1 0.02 Uruguay The upper part (Panel A) shows the mutations found in more than one patient, whereas the lower part (Panel B) of the table shows all the mutations that are present only once in each country. Login to comment

[hide] Newborn screening for cystic fibrosis in Alberta: ... Paediatr Child Health. 2010 Nov;15(9):590-4. Lilley M, Christian S, Hume S, Scott P, Montgomery M, Semple L, Zuberbuhler P, Tabak J, Bamforth F, Somerville MJ
Newborn screening for cystic fibrosis in Alberta: Two years of experience.
Paediatr Child Health. 2010 Nov;15(9):590-4., [PMID:22043142]

Abstract [show]
On April 1, 2007, Alberta became the first province in Canada to introduce cystic fibrosis (CF) to its newborn screening program. The Alberta protocol involves a two-tier algorithm involving an immunoreactive trypsinogen measurement followed by molecular analysis using a CF panel for 39 mutations. Positive screens are followed up with sweat chloride testing and an assessment by a CF specialist. Of the 99,408 newborns screened in Alberta during the first two years of the program, 221 had a positive CF newborn screen. The program subsequently identified and initiated treatment in 31 newborns with CF. A relatively high frequency of the R117H mutation and the M1101K mutation was noted. The M1101K mutation is common in the Hutterite population. The presence of the R117H mutation has created both counselling and management dilemmas. The ability to offer CF transmembrane regulator full sequencing may help resolve diagnostic dilemmas. Counselling and management challenges are created when mutations are mild or of unknown clinical significance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
125 Predicted splice site mutation 14780 35 69 F508del R352W Rare, no clinical data published 17316 53/35 74 F508del L206W Variable, ranging from classic CF to isolated CBAVD (8) 16053 26/62 72 F508del 5T Associated with atypical CF and CBAVD (9) 21739 N/A 98 F508del G458V Associated with classic CF (17) 16229 31/32 62 F508del - N/A 16369 38/48 79 711+G࢐T - N/A 12468 NSQ/30 103 F508del - N/A 5T 5 thymine; CBAVD Congenital bilateral absence of the vas deferens; CF Cystic fibrosis; IRT Immunoreactive trypsinogen; N/A Not available; NSQ Not sufficient quantity or absent phenotype, individuals with the R117H mutation may be underdiagnosed and the mutation frequency may be under-represented. Login to comment
142 Three mutations (D110H, L206W and 5T) were identified that are associated with a mild or variable phenotype. Login to comment

[hide] Consequences of partial duplications of the human ... J Cyst Fibros. 2013 Jul;12(4):407-10. doi: 10.1016/j.jcf.2012.11.006. Epub 2012 Dec 21. El-Seedy A, Pasquet MC, Bienvenu T, Bieth E, Audrezet MP, Kitzis A, Ladeveze V
Consequences of partial duplications of the human CFTR gene on cf diagnosis: mutations or ectopic variations.
J Cyst Fibros. 2013 Jul;12(4):407-10. doi: 10.1016/j.jcf.2012.11.006. Epub 2012 Dec 21., [PMID:23261175]

Abstract [show]
CFTR exon 10 and its flanking regions are duplicated in the human genome. These duplications present mutations compared to the normal exon 10 sequence. Due to the polymorphic sequence of the 3' intron 9 sequence, it may appear difficult to sequence exon 10 and some mutations described in this exon could, in fact, be variations observed in an ectopic duplicated sequence. In our previous work we described a methodology to carry out PCR only of exon 10 and not of ectopic regions. In this work, we analyzed mutations described in the CF data base as being CFTR mutations but also found in ectopic regions: c.1392G>T, c.1338_1339delAT, c.1235delC, and c.1247A>G. We have shown that these mutations appear to be authentic mutations in CFTR exon 10 and not ectopic variations in analyzed patients. These mutations validate the usefulness of our new strategy in the mutation analysis of this region of CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 He revealed the heterozygous presence of c.1521_1523delCTT (p.Phe508del, F508del) and c.617TNG (p.Leu206Trp, L206W) mutations (Bienvenue T, personal communication). Login to comment

[hide] CFTR p.Arg117His associated with CBAVD and other C... J Med Genet. 2013 Apr;50(4):220-7. doi: 10.1136/jmedgenet-2012-101427. Epub 2013 Feb 1. Thauvin-Robinet C, Munck A, Huet F, de Becdelievre A, Jimenez C, Lalau G, Gautier E, Rollet J, Flori J, Nove-Josserand R, Soufir JC, Haloun A, Hubert D, Houssin E, Bellis G, Rault G, David A, Janny L, Chiron R, Rives N, Hairion D, Collignon P, Valeri A, Karsenty G, Rossi A, Audrezet MP, Ferec C, Leclerc J, Georges Md, Claustres M, Bienvenu T, Gerard B, Boisseau P, Cabet-Bey F, Cheillan D, Feldmann D, Clavel C, Bieth E, Iron A, Simon-Bouy B, Izard V, Steffann J, Viville S, Costa C, Drouineaud V, Fauque P, Bi
CFTR p.Arg117His associated with CBAVD and other CFTR-related disorders.
J Med Genet. 2013 Apr;50(4):220-7. doi: 10.1136/jmedgenet-2012-101427. Epub 2013 Feb 1., [PMID:23378603]

Abstract [show]
BACKGROUND: The high frequency of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene mutation p.Arg117His in patients with congenital bilateral absence of the vas deferens (CBAVD) and in newborns screened for CF has created a dilemma. METHODS: Phenotypic and genotypic data were retrospectively collected in 179 non-newborn French individuals carrying p.Arg117His and a second CFTR mutation referred for symptoms or family history, by all French molecular genetics laboratories, referring physicians, CF care centres and infertility clinics. RESULTS: 97% of the patients had the intronic T7 normal variant in cis with p.Arg117His. 89% patients were male, with CBAVD being the reason for referral in 76%. In 166/179 patients with available detailed clinical features, final diagnoses were: four late-onset marked pulmonary disease, 83 isolated CBAVD, 67 other CFTR-related phenotypes, including 44 CBAVD with pulmonary and/or pancreatic symptoms and 12 asymptomatic cases. Respiratory symptoms were observed in 30% of the patients, but the overall phenotype was mild. No correlation was observed between sweat chloride concentrations and disease severity. Five couples at risk of CF offspring were identified and four benefited from prenatal or preimplantation genetic diagnoses (PND or PGD). Eight children were born, including four who were compound heterozygous for p.Arg117His and one with a severe CF mutation. CONCLUSIONS: Patients with CBAVD carrying p.Arg117His and a severe CF mutation should benefit from a clinical evaluation and follow-up. Depending on the CBAVD patients' genotype, a CFTR analysis should be considered in their partners in order to identify CF carrier couples and offer PND or PGD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
126 (Leu206Trp);( Arg117His) p.Ser1235Arg 2000 2 ICSI cycles, no pregnancy Offer of donor sperm - CFTR-RD p. Login to comment

[hide] PGD for cystic fibrosis patients and couples at ri... Reprod Biomed Online. 2013 May;26(5):420-30. doi: 10.1016/j.rbmo.2013.01.006. Epub 2013 Jan 29. Rechitsky S, Verlinsky O, Kuliev A
PGD for cystic fibrosis patients and couples at risk of an additional genetic disorder combined with 24-chromosome aneuploidy testing.
Reprod Biomed Online. 2013 May;26(5):420-30. doi: 10.1016/j.rbmo.2013.01.006. Epub 2013 Jan 29., [PMID:23523379]

Abstract [show]
Preimplantation genetic diagnosis (PGD) for inherited disorders is presently applied for more than 300 different conditions. The most frequent PGD indication is cystic fibrosis (CF), the largest series of which is reviewed here, totalling 404 PGD cycles. This involved testing for 52 different CFTR mutations with almost half of the cases (195/404 cycles) performed for DeltaF508 mutation, one-quarter (103/404 cycles) for six other frequent mutations and only a few for the remaining 45 CFTR mutations. There were 44 PGD cycles performed for 25 CF-affected homozygous or double-heterozygous CF patients (18 male and seven female partners), which involved testing simultaneously for three mutations, resulting in birth of 13 healthy CF-free children and no misdiagnosis. PGD was also performed for six couples at a combined risk of producing offspring with CF and another genetic disorder. Concomitant testing for CFTR and other mutations resulted in birth of six healthy children, free of both CF and another genetic disorder in all but one cycle. A total of 96 PGD cycles for CF were performed with simultaneous aneuploidy testing, including microarray-based 24-chromosome analysis, as a comprehensive PGD for two or more conditions in the same biopsy material.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 Mutation Region Legacy name cDNA name Protein name # of Patient Number of cycles Number of transfers Number of embryos transferred Pregnancy Birth 125G/C c.-8G>C NA Promoter 1 2 2 2 1 (1) 0 E60X c.178G>T p.Glu60X Exon 3 1 1 1 1 0 0 G85E c.254G>A p.Gly85Glu Exon 3 1 1 1 2 1 1 R75Q c.224G>A p.Arg75Gln Exon 3 1 1 1 1 1 1 R75X c.223C>T p.Arg75X Exon 3 1 1 1 2 1 2 A120T c.358G>A p.Ala120Thr Exon 4 1 1 1 1 0 0 R117C c.349C>T p.Arg117Cys Exon 4 2 6 3 5 1 1 R117H c.350G>A p.Arg117His Exon 4 14 22 19 38 8 6 621+1G-T c.489 &#b1; 1G>T - Intron 4 4 7 4 6 2 1 852del22 c.720_741 p.Gly241GlufsX13 Exon 6 1 1 0 0 0 0 L206W c.617T>G p.Leu206Trp Exon 6 1 2 1 2 0 0 A349V c.1046C>T p.Ala349Val Exon 8 1 2 2 4 2 4 1078delT c.948delT p.Phe316LeufsX12 Exon 8 1 1 1 1 1 0 1154ins-TC c.1022_1023insTC p.Phe342HisfsX28 Exon 8 1 2 1 2 0 0 Q359K/T360K c. Login to comment

[hide] Quantification of major urinary metabolites of PGE... Prostaglandins Leukot Essent Fatty Acids. 2013 Aug;89(2-3):121-6. doi: 10.1016/j.plefa.2013.06.001. Epub 2013 Jun 20. Jabr S, Gartner S, Milne GL, Roca-Ferrer J, Casas J, Moreno A, Gelpi E, Picado C
Quantification of major urinary metabolites of PGE2 and PGD2 in cystic fibrosis: correlation with disease severity.
Prostaglandins Leukot Essent Fatty Acids. 2013 Aug;89(2-3):121-6. doi: 10.1016/j.plefa.2013.06.001. Epub 2013 Jun 20., [PMID:23791427]

Abstract [show]
Cystic fibrosis transmembrane conductance (CFTR) alterations are involved in the overproduction of prostaglandins (PG) in CF in vitro. We assessed the relationship between PGE-M and PGD-M urinary metabolites of PGE2 and PGD2 and CF severity. Twenty-four controls and 35 CF patients were recruited. PGE-M and PGD-M levels were measured by liquid chromatography/mass spectrometry and results were expressed as median and 25th-75th interquartile of ng/mg creatinine (Cr). PGE-M (15.63; 9.07-43.35ng/mg Cr) and PGD-M (2.16; 1.43-3.53ng/mg Cr) concentrations were higher in CF than in controls: PGE-M, (6.63; 4.35-8.60ng/mg Cr); PGD-M (1.23; 0.96-1.54ng/mg Cr). There was no correlation between metabolite levels and spirometric values. Patients with pancreatic insufficiency (n=29) had higher PGE-M levels (19.09; 9.36-52.69ng/mg Cr) than those with conserved function (n=6) (9.61; 5.78-14.34ng/mg Cr). PGE-M levels were associated with genotype severity: mild (7.14; 5.76-8.76, n=8), moderate (16.67; 13.67-28.62ng/mg Cr, n=5) and severe (22.82; 10.67-84.13ng/mg Cr). Our study confirms the key role of CFTR in the regulation of the cyclooxygenase pathway of arachidonic acid metabolism found in in vitro studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 Mutations Mutation class Severity Number Pancreatic sufficiency (n) W128X/W128X I/I Severe 1 0 I507/Q890X I/I Severe 1 0 F508del/G542X II/I Severe 2 0 F508del/2188AA4G II/I Severe 1 0 F508del/N1303K II/I Severe 3 0 F508del/1677delTA II/I Severe 1 0 F508del/2188AA4G II/I Severe 1 0 F508del/F508del II/II Severe 10 0 F508del/Q890X II/II Severe 1 0 F508del/E1308X II/II Severe 1 0 F508del/5T-12TG II/III Moderate 2 0 G542X/G85V I/III Moderate 1 0 F508del/124del23kbp II/III Moderate 1 0 G542X/M1137V I/III Moderate 1 1 I507/L206W I/IV Mild 1 0 F508del/L206W I/IV Mild 4 2 711+1G4L206W I/IV Mild 1 1 N1303K/3272-26A4G I/IV Mild 1 1 F508del/F587I II/V Mild 1 1 n&#bc;Number. Login to comment

[hide] Novel CFTR variants identified during the first 3 ... J Mol Diagn. 2013 Sep;15(5):710-22. doi: 10.1016/j.jmoldx.2013.05.006. Epub 2013 Jun 28. Prach L, Koepke R, Kharrazi M, Keiles S, Salinas DB, Reyes MC, Pian M, Opsimos H, Otsuka KN, Hardy KA, Milla CE, Zirbes JM, Chipps B, O'Bra S, Saeed MM, Sudhakar R, Lehto S, Nielson D, Shay GF, Seastrand M, Jhawar S, Nickerson B, Landon C, Thompson A, Nussbaum E, Chin T, Wojtczak H
Novel CFTR variants identified during the first 3 years of cystic fibrosis newborn screening in California.
J Mol Diagn. 2013 Sep;15(5):710-22. doi: 10.1016/j.jmoldx.2013.05.006. Epub 2013 Jun 28., [PMID:23810505]

Abstract [show]
California uses a unique method to screen newborns for cystic fibrosis (CF) that includes gene scanning and DNA sequencing after only one California-40 cystic fibrosis transmembrane conductance regulator (CFTR) panel mutation has been identified in hypertrypsinogenemic specimens. Newborns found by sequencing to have one or more additional mutations or variants (including novel variants) in the CFTR gene are systematically followed, allowing for prospective assessment of the pathogenic potential of these variants. During the first 3 years of screening, 55 novel variants were identified. Six of these novel variants were discovered in five screen-negative participants and three were identified in multiple unrelated participants. Ten novel variants (c.2554_2555insT, p.F1107L, c.-152G>C, p.L323P, p.L32M, c.2883_2886dupGTCA, c.2349_2350insT, p.K114del, c.-602A>T, and c.2822delT) were associated with a CF phenotype (42% of participants were diagnosed at 4 to 25 months of age), whereas 26 were associated with CFTR-related metabolic syndrome to date. Associations with the remaining novel variants were confounded by the presence of other diseases or other mutations in cis or by inadequate follow-up. These findings have implications for how CF newborn screening and follow-up is conducted and will help guide which genotypes should, and which should not, be considered screen positive for CF in California and elsewhere.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
170 Participant 11 was identified with novel variant c.-448A>G in cis with p.A559T and in trans with p.L206W. Login to comment
182 Participant 11, who was diagnosed as having CF, also carries known mutation p.L206W (case described earlier). Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
86 For example, the baseline level of chloride transport and ivacaftor response was higher for mutant CFTR forms associated with mild defects in CFTR processing (e.g., E56K, P67L, L206W, A455E, D579G, S945L, S977F, A1067T, R1070Q, R1070W, F1074L, and D1270N) than for those associated with severe defects in CFTR processing (e.g., F508del, H1054D, R1066H). Login to comment
92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3. Login to comment

[hide] VX-809 corrects folding defects in cystic fibrosis... Mol Biol Cell. 2013 Oct;24(19):3016-24. doi: 10.1091/mbc.E13-05-0240. Epub 2013 Aug 7. Ren HY, Grove DE, De La Rosa O, Houck SA, Sopha P, Van Goor F, Hoffman BJ, Cyr DM
VX-809 corrects folding defects in cystic fibrosis transmembrane conductance regulator protein through action on membrane-spanning domain 1.
Mol Biol Cell. 2013 Oct;24(19):3016-24. doi: 10.1091/mbc.E13-05-0240. Epub 2013 Aug 7., [PMID:23924900]

Abstract [show]
Cystic fibrosis (CF) is a fatal genetic disorder associated with defective hydration of lung airways due to the loss of chloride transport through the CF transmembrane conductance regulator protein (CFTR). CFTR contains two membrane-spanning domains (MSDs), two nucleotide-binding domains (NBDs), and a regulatory domain, and its channel assembly requires multiple interdomain contacts. The most common CF-causing mutation, F508del, occurs in NBD1 and results in misfolding and premature degradation of F508del-CFTR. VX-809 is an investigational CFTR corrector that partially restores CFTR function in people who are homozygous for F508del-CFTR. To identify the folding defect(s) in F508del-CFTR that must be repaired to treat CF, we explored the mechanism of VX-809 action. VX-809 stabilized an N-terminal domain in CFTR that contains only MSD1 and efficaciously restored function to CFTR forms that have missense mutations in MSD1. The action of VX-809 on MSD1 appears to suppress folding defects in F508del-CFTR by enhancing interactions among the NBD1, MSD1, and MSD2 domains. The ability of VX-809 to correct F508del-CFTR is enhanced when combined with mutations that improve F508del-NBD1 interaction with MSD2. These data suggest that the use of VX-809 in combination with an additional CFTR corrector that suppresses folding defects downstream of MSD1 may further enhance CFTR function in people with F508del-CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 There are several CF-associated mutations in MSD1 that cause defects in CFTR processing and function: N-terminal tail (E56K and P67L), TM1 (E92K), TM2 (L206W), and TM4 (V232D) (Figure 4, A-E). Login to comment
61 The severe folding (Figure 4, A-B) and functional (Figure 4E) defects exhibited by E56L, P67L and L206W were completely corrected by 5 bc;M VX-809. Login to comment
194 (C-D): n = 3 &#b1; SE. _ _ _ _ + + + _ + E56K P67L E92K L206W Wt _ _ + V232D Wt -C- -BC- BTub- CFTR . Login to comment
196 D. E92K F508 -B C -B C VX-809 0 3 10 30 M CFTR CFTR B17 15 14 17 C0 25 66 95 B18 30 28 27 C 1 8 9 8 % Norm VX-809 0 3 10 30 M C-100 1 81 1 83 N.D. 24 5 78 100 N.D. 15 B14 4 6 4 7 1 1 6 12 16 3 2 C. B11 10 11 12 C 1 1 1 7 VX-809 0 3 10 30 M -B C F508 CFTR E92K % Norm % Norm E. VX-809 0 50 100 150 200 250 -10 -9 -8 -7 -6 -5 -4 Chloride Transport ( A/cm 2 ) VX-809 (Log M) E92K-CFTR Normal 0 50 100 150 200 250 DMSO VX-809 Corr-4a Chloride Transport ( A/cm2) E92K-CFTR 0 100 200 300 400 E56K P67L E92K L206W V232V dF508 I SC ( A/cm 2 ) DMSO VX-809 Normal VX-809 on MSD1 has potential to promote high-level functional correction of CFTR in people with CF who harbor mutations other than F508del (Bobadilla et al., 2002). Login to comment

[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]

Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 The variants D1152H (4.0%) and L206W (2.4%), each associated with a variable CF phenotype, were the most common variants not present on the ACMG/ACOG 23-mutation panel. Login to comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment
86 Two variants, L206W and D1152H, accounted for 19.1% of the mutant alleles detected in this ethnic group. Login to comment
99 Several alleles not found on the ACMG/ACOG panel were found at relatively high frequency (Table 2), including D1152H (4.0%), L206W (2.4%), c.3744delA (0.9%), F311del (0.8%), R117C (0.7%), and S549N (0.6%). Login to comment
118 Two variants, D1152H and L206W, account for 19.1% of all mutations identified in the Hispanic group and deserve special attention. Login to comment
121 Strom et al.7 advocate against adding these variants to CF panels, stating that detection of D1152H and L206W during carrier screening may increase the rate of pregnancy termination among parents who fear having a child with classic CF, not to mention inflating the mutation detection rate among Hispanic Americans.7 It is acknowledged now in the literature that the D1152H variant belongs to both the CF-causing and CFTR-related disorder groups,19-21 and, in conjunction with an established CF-causing mutation, it could still manifest as typical CF.19,22 Burgel et al.23 studied 42 patients with D1152H mutations and reported that the variant, in conjunction with a CF-causing mutation, can cause significant pulmonary disease, albeit with longer survival. Login to comment
125 The same disagreement exists with regard to the L206W variant. Login to comment
126 Clain et al.25 analyzed 36 clinical cases of CF patients who were compound heterozygous for L206W and a severe CF mutation. Login to comment
128 Using clinical and functional studies, the group demonstrated that L206W is a disease-causing mutation with variable phenotype ranging from CF with pancreatic insufficiency to congenital bilateral absence of the vas deferens. Login to comment
129 Data from the CFTR2 project indicated that the L206W variant was observed in 82 CF patients worldwide and should be considered a disease-causing mutation.26 As such, we support this conclusion. Login to comment

[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]

Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

[hide] Genetics of cystic fibrosis: CFTR mutation classif... Int J Biochem Cell Biol. 2014 Jul;52:94-102. doi: 10.1016/j.biocel.2014.02.023. Epub 2014 Mar 12. Fanen P, Wohlhuter-Haddad A, Hinzpeter A
Genetics of cystic fibrosis: CFTR mutation classifications toward genotype-based CF therapies.
Int J Biochem Cell Biol. 2014 Jul;52:94-102. doi: 10.1016/j.biocel.2014.02.023. Epub 2014 Mar 12., [PMID:24631642]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes an epithelial anion channel. Since the identification of the disease in 1938 and up until 2012, CF patients have been treated exclusively with medications aimed at bettering their respiratory, digestive, inflammatory and infectious symptoms. The identification of the CFTR gene in 1989 gave hopes of rapidly finding a cure for the disease, for which over 1950 mutations have been identified. Since 2012, recent approaches have enabled the identification of small molecules targeting either the CFTR protein directly or its key processing steps, giving rise to novel promising therapeutic tools. This review presents the current CFTR mutation classifications according to their clinical consequences and to their effect on the structure and function of the CFTR channel. How these classifications are essential in the establishment of mutation-targeted therapeutic strategies is then discussed. The future of CFTR-targeted treatment lies in combinatory therapies that will enable CF patients to receive a customized treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 Depending on the mutation, one may observe either a partial reduction (p.Leu206Trp, third transmembrane segment) or a complete absence (p.Arg1066Cys, fourth intracellular loop or p.Phe508del, NBD1) of mature CFTR. Login to comment
111 Initially, mutations belonging to this class were thought to cause severe CF similarly to p.Phe508del or p.Arg1066Cys, but p.Leu206Trp was shown to be associated with variable phenotype (Clain et al., 2005a). Login to comment

[hide] Function, pharmacological correction and maturatio... J Cyst Fibros. 2015 Jan;14(1):34-41. doi: 10.1016/j.jcf.2014.06.008. Epub 2014 Jul 16. Sharma H, Jollivet Souchet M, Callebaut I, Prasad R, Becq F
Function, pharmacological correction and maturation of new Indian CFTR gene mutations.
J Cyst Fibros. 2015 Jan;14(1):34-41. doi: 10.1016/j.jcf.2014.06.008. Epub 2014 Jul 16., [PMID:25042876]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is rare in India. Most CF mutations identified are not yet functionally characterized. Hence, genetic counseling and adoption of therapeutic approach are particularly difficult. Our aim was to study the function and maturation of a spectrum of eleven Indian CFTR mutations from classical CF and infertile male patients with CBAVD. METHODS: We used Western blot, pharmacology and iodide efflux to study CFTR maturation and chloride transport in BHK cells expressing pEGFP-CFTR constructs for L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F and D1270E. RESULTS: Among these CFTR mutants, only L69H is not processed as a c-band and not functional at 37 degrees C. However, the functions of L69H and S549N and the maturation of L69H are corrected at 27 degrees C and by the investigational drug VX809. CONCLUSION: These data should help in developing counseling and therapeutic approaches in India. We identified L69H as a novel class II CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
116 Supporting this hypothesis is the fact that VX-809 has been shown to act on MSD1 folding and that it also rescues functional defects in CFTR caused by disease-related mutations in the vicinity of the three amino acids highlighted here (P67L, L206W) [16]. Login to comment

[hide] Comprehensive CFTR gene analysis of the French cys... Genet Med. 2015 Feb;17(2):108-16. doi: 10.1038/gim.2014.113. Epub 2014 Aug 14. Audrezet MP, Munck A, Scotet V, Claustres M, Roussey M, Delmas D, Ferec C, Desgeorges M
Comprehensive CFTR gene analysis of the French cystic fibrosis screened newborn cohort: implications for diagnosis, genetic counseling, and mutation-specific therapy.
Genet Med. 2015 Feb;17(2):108-16. doi: 10.1038/gim.2014.113. Epub 2014 Aug 14., [PMID:25122143]

Abstract [show]
PURPOSE: Newborn screening (NBS) for cystic fibrosis (CF) was implemented throughout France in 2002. It involves a four-tiered procedure: immunoreactive trypsin (IRT)/DNA/IRT/sweat test [corrected] was implemented throughout France in 2002. The aim of this study was to assess the performance of molecular CFTR gene analysis from the French NBS cohort, to evaluate CF incidence, mutation detection rate, and allelic heterogeneity. METHODS: During the 8-year period, 5,947,148 newborns were screened for cystic fibrosis. The data were collected by the Association Francaise pour le Depistage et la Prevention des Handicaps de l'Enfant. The mutations identified were classified into four groups based on their potential for causing disease, and a diagnostic algorithm was proposed. RESULTS: Combining the genetic and sweat test results, 1,160 neonates were diagnosed as having cystic fibrosis. The corresponding incidence, including both the meconium ileus (MI) and false-negative cases, was calculated at 1 in 4,726 live births. The CF30 kit, completed with a comprehensive CFTR gene analysis, provides an excellent detection rate of 99.77% for the mutated alleles, enabling the identification of a complete genotype in 99.55% of affected neonates. With more than 200 different mutations characterized, we confirmed the French allelic heterogeneity. CONCLUSION: The very good sensitivity, specificity, and positive predictive value obtained suggest that the four-tiered IRT/DNA/IRT/sweat test procedure may provide an effective strategy for newborn screening for cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Some molecular defects that could belong to either the CF-causing group or the CFTR-related disorders group (group A/B) were reported in patients presenting a broad spectrum of phenotypes from classic CF to mild monosymptomatic presentations.16 These are four missense mutations (p.Leu206Trp (L206W), p.Arg347His (R347H), p.Asp1152His (D1152H), and p.Ser945Leu (S945L)) and three splice mutations (c.2657+5G>A (2789+5G>A), c.3718-2477C>T (3849+10kbC>T), and c.1210-34TG(13);1210-12T(5) (TG13T5)). Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
348 In addition, L206W and H199Y are situated nearby P205S, orientated toward the lipid bilayer. Login to comment

[hide] The p.Gly622Asp (G622D) mutation, frequently found... J Cyst Fibros. 2015 May;14(3):305-9. doi: 10.1016/j.jcf.2014.11.001. Epub 2014 Nov 28. Marion H, Natacha G, Brigitte M, Francois C, Michel R, Corinne T, Emmanuelle G, Thierry B
The p.Gly622Asp (G622D) mutation, frequently found in Reunion Island and in black populations, is associated with a wide spectrum of CF and CFTR-RD phenotypes.
J Cyst Fibros. 2015 May;14(3):305-9. doi: 10.1016/j.jcf.2014.11.001. Epub 2014 Nov 28., [PMID:25443471]

Abstract [show]
Examination of genotype-phenotype correlations along with functional evaluation of CFTR mutations may not be straightforward. The c.1865G>A, p.Gly622Asp (G622D), located at the NBD1 C terminus of the CFTR protein, was initially reported in patients with male infertility. However, the substitution of Gly622 by an aspartic acid in vitro would perturb the local structure or even affect the CFTR folding itself. In order to determine whether p.Gly622Asp affects the risk of developing a CFTR-Related disorder (CFTR-RD) or cystic fibrosis (CF), we analyzed the phenotype of subjects bearing the p.Gly622Asp mutation. We report molecular and clinical analyses in eleven unrelated patients with CF or CFTR-RD with compound heterozygosity for the p.Gly622Asp mutation. On the basis of the clinical features presented by the eleven patients, we postulate that the p.Gly622Asp might be associated with a wide spectrum of phenotypes including classical cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 Other CFTR mutations have been associated with a large spectrum of phenotypes, such as c.3454G N C, p.Asp1152His (D1152H), c.617T N G, p.Leu206Trp (L206W), c.579 + 3A N G (621 + 3A N G). Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment
424 The three actually discrepant alleles were L997F (p.Leu997Phe), without the R117L (p.Arg117Leu) in cis, L206W (p.Leu206Trp) and T338I (p.Thr338Ile). Login to comment
426 The L206W (p.Leu206Trp), which in our study was classified as a CFTR-RD-causing mutation, was classified as CF-causing in the CFTR2 study. Login to comment

[hide] Inconclusive diagnosis of cystic fibrosis after ne... Pediatrics. 2015 Jun;135(6):e1377-85. doi: 10.1542/peds.2014-2081. Epub 2015 May 11. Ooi CY, Castellani C, Keenan K, Avolio J, Volpi S, Boland M, Kovesi T, Bjornson C, Chilvers MA, Morgan L, van Wylick R, Kent S, Price A, Solomon M, Tam K, Taylor L, Malitt KA, Ratjen F, Durie PR, Gonska T
Inconclusive diagnosis of cystic fibrosis after newborn screening.
Pediatrics. 2015 Jun;135(6):e1377-85. doi: 10.1542/peds.2014-2081. Epub 2015 May 11., [PMID:25963003]

Abstract [show]
OBJECTIVES: To prospectively study infants with an inconclusive diagnosis of cystic fibrosis (CF) identified by newborn screening (NBS; "CF screen positive, inconclusive diagnosis" [CFSPID]) for disease manifestations. METHODS: Infants with CFSPID and CF based on NBS from 8 CF centers were prospectively evaluated and monitored. Genotype, phenotype, repeat sweat test, serum trypsinogen, and microbiology data were compared between subjects with CF and CFSPID and between subjects with CFSPID who did (CFSPID-->CF) and did not (CFSPID-->CFSPID) fulfill the criteria for CF during the first 3 years of life. RESULTS: Eighty-two subjects with CFSPID and 80 subjects with CF were enrolled. The ratio of CFSPID to CF ranged from 1:1.4 to 1:2.9 in different centers. CFTR mutation rates did not differ between groups; 96% of subjects with CFSPID and 93% of subjects with CF had 2 mutations. Subjects with CFSPID had significantly lower NBS immunoreactive trypsinogen (median [interquartile range]:77 [61-106] vs 144 [105-199] mug/L; P < .0001) than did subjects with CF. Pseudomonas aeruginosa and Stenotrophomonas maltophilia were isolated in 12% and 5%, respectively, of subjects with CFSPID. CF was diagnosed in 9 of 82 (11%) subjects with CFSPID (genotype and abnormal sweat chloride = 3; genotype alone = 4; abnormal sweat chloride only = 2). Sweat chloride was abnormal in CFSPID-->CF patients at a mean (SD) age of 21.3 (13.8) months. CFSPID-->CF patients had significantly higher serial sweat chloride (P < .0001) and serum trypsinogen (P = .009) levels than did CFSPID-->CFSPID patients. CONCLUSIONS: A proportion of infants with CFSPID will be diagnosed with CF within the first 3 years. These findings underscore the need for clinical monitoring, repeat sweat testing at age 2 to 3 years, and extensive genotyping.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 TABLE 3 Characteristics of Subjects With CFSPID Who Later Met Diagnostic Criteria of CF Subject Number Allele 1 Allele 2 Ethnicity NBS IRT, mg/L Initial Sweat Chloride, mmol/L Highest Sweat Chloride, mmol/L Country 1 F508del R117C White 105.8 36 61 Canada 2 F508del S1455X White 66.6 46 74 Canada 3 F508del P67L White 151.2 38 38 Canada 4 F508del L206W White 83.8 58 64 Canada 5 G542X L206W White 67 49 66 Canada 6 F508del L206W White 59.9 45 45 Canada 7 R1162X R117H-7T White 126 36 70 Italy 8 2183AA.G R117C White 129 32 32 Italy 9 F508del R117C White 80.4 48 56 Canada e OOI et al including in newborn-screened infants with equivocal CF diagnosis and in older individuals with single-organ manifestations of CF.17,18,20-22 As in the case of the 7 subjects who were initially classified as CFSPID but who were subsequently recognized to carry 2 disease-causing mutations on the basis of the CFTR2 project, the diagnostic consequences (benign versus disease-causing) of the CFTR mutations identified in all of the other subjects with CFSPID may not be apparent until later on, when new genetic information becomes available and classification of CFTR mutations currently considered to be of "unknown" consequences is updated. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment
92 Well known examples include missense variants D110H, R117C, L206W, R347P, R347H, R1066H, or splice variants that produce both aberrant and full-length transcript such as 3849+10kbC4T, 2789+5G4A, 3272-26 A4G, 711+3 A4G. Login to comment
126 Prenatal diagnosis, Preimplantation genetic diagnosis, offered to Parents of a CF patient Carrier couples identified through carrier testing Carrier couples identified through investigations for fetal bowel anomalies Couples with one individual affected with CF and a carrier partner Couples with one individual affected with CBAVD and a carrier partner Table 4 Inclusion and exclusion criteria for CF-PGD according to countries France Italy Spain Belgium Greece UK USA Parents 1 affected+1 carrier S/LS A A A A A A A 1 affected+1 carrier M R A A A A A A 1 affected+1 carrier U A A A A R Aਭ A 2 carriers S/LS A A A A A A A 1 carrier S/LS+1 carrier M R A A A A A A 1 carrier S/LS+1 carrier U A A A A R Aਭ A Abbreviations: S, severe CF-causing variant (p.Phe508del, p.Gly542ਭߪ); LS, large spectrum variant (p.Leu206Trp, c.2657+5G4A ߪ); M, mild variant with variable disease penetrance (IVS8-5 T allele, p.Arg117His-7 T ߪ); U, variants of unproven or uncertain CF clinical relevance (p.Pro1013His, p.Arg1162Leu ߪ); A, accepted; R, refused. Login to comment

[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]

Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented. Login to comment
109 While non-CFTR modifier genes as well as environmental factors largely influence the development and progression of lung disease and nutritional decline,33-36 we demonstrate that the severity of the underlying CFTR genotype Table 2ߒ Meconium ileus prevalence scores and CFTR function CFTR mutation MIP score CFTR function (%wt) High MIP score ߓ V520F 0.38 0.2 ߓ N1303K 0.25 0.5 ߓ F508del 0.27 0.4 ߓ R560T 0.27 0.1 ߓ A559T 0.24 0 ߓ G551D 0.15 1 ߓ G85E 0.14 0.8 ߓ R1066C 0.13 0 Low MIP score ߓ R347P 0.1 0 ߓ R117C 0.1 2.9 ߓ R117H 0.07 33 ߓ R347H 0.06 5 ߓ R334W 0.05 1.3 ߓ A455E 0.05 6 ߓ L206W 0.04 5 ߓ M1101K 0.04 0 ߓ P67L 0.0 8 The table compares meconium ileus prevalence (MIP) scores and measured cystic fibrosis transmembrane conductance regulator (CFTR) function in Fisher rat thyroid determined by VanGoor et al.24 for the major and missense cystic fibrosis-causing variants for which patient group size was ࣙ10 in at least the US group. Login to comment

[hide] Identification and frequencies of cystic fibrosis ... Clin Biochem. 2015 Oct 21. pii: S0009-9120(15)00473-7. doi: 10.1016/j.clinbiochem.2015.10.007. Pepermans X, Mellado S, Chialina S, Wagener M, Gallardo L, Lande H, Bordino W, Baran D, Bours V, Leal T
Identification and frequencies of cystic fibrosis mutations in central Argentina.
Clin Biochem. 2015 Oct 21. pii: S0009-9120(15)00473-7. doi: 10.1016/j.clinbiochem.2015.10.007., [PMID:26500004]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 rs name HGVS p. name HGVS c. name Legacy name n (%) Screening panel CFTR1 database CFTR2 database rs199826652 p.Phe508del c.1521_1523delCTT F508del 94 (56.6) Yes Yes CF-causing rs113993959 p.Gly542* c.1624G N T G542X 7 (4.2) Yes Yes CF-causing No p.Asn1303Lys c.3909C N G N1303K 5 (3) Yes Yes CF-causing rs74767530 p.Arg1162* c.3484C N T R1162X 4 (2.4) Yes Yes CF-causing rs75961395 p.Gly85Glu c.254G N A G85E 3 (1.8) Yes Yes CF-causing rs78756941 NA c.489 + 1G N T 621 + 1G N T 3 (1.8) Yes Yes CF-causing rs76713772 NA c.1585-1G N A 1717-1G N A 3 (1.8) Yes Yes CF-causing No p.Lys684Serfs*38 c.2051_2052delAAinsG 2183AA N G 3 (1.8) Yes Yes CF-causing rs397508173 p.Ser4* c.11C N A S4X 2 (1.2) No Yes No rs121909011 p.Arg334Trp c.1000C N T R334W 2 (1.2) Yes Yes CF-causing rs77010898 p.Trp1282* c.3846G N A W1282X 2 (1.2) Yes Yes CF-causing rs397508141 p.Leu34_Gln39del c.100_117delTTGTCAGACATATACCAA 232del18 1 (0.6) No Yes No No p.Leu49Pro c.146 T N C L49P &#a7; 1 (0.6) No No No rs77834169 p.Arg117Cys c.349C N T R117C 1 (0.6) Yes Yes CF-causing No p.Arg117Pro c.350G N C R117P 1 (0.6) No Yes No rs80282562 p.Gly178Arg c.532G N A G178R 1 (0.6) Yes Yes CF-causing rs121908803 p.Pro205Ser c.613C N T P205S 1 (0.6) No Yes CF-causing rs121908752 p.Leu206Trp c.617 T N G L206W 1 (0.6) Yes Yes CF-causing No p.Arg347Pro c.1040G N C R347P 1 (0.6) Yes Yes CF-causing rs397508155 p.Tyr362* c.1086 T N A Y362X 1 (0.6) No Yes No rs74597325 p.Arg553* c.1657C N T R553X 1 (0.6) Yes Yes CF-causing rs1800098 + rs1800100 p.[Gly576Ala(;)Arg668Cys] c. Login to comment
126 Genotype N Frequency (%) Total N Total frequency (%) Category I: p.Phe508del/p.Phe508del p.Phe508del/p.Phe508del 30 36.1 30 36.1 Category II: p.Phe508del/Other p.Phe508del/p.Gly542* 5 6 p.Phe508del/p.Asn1303Lys 3 3.6 p.Phe508del/p.Gly85Glu 2 2.4 p.Phe508del/c.1585-1G N A 2 2.4 p.Phe508del/c.2051_2052delAAinsG 2 2.4 p.Phe508del/p.Trp1282* 2 2.4 p.Phe508del/p.Arg117Pro 1 1.2 p.Phe508del/p.Pro205Ser 1 1.2 p.Phe508del/p.Leu206Trp 1 1.2 p.Phe508del/p.Arg553* 1 1.2 p.Phe508del/p.Ser589Ile 1 1.2 p.Phe508del/p.Ser737Phe 1 1.2 p.Phe508del/p.Arg1162* 1 1.2 p.Phe508del/c.1766 + 1G N A 1 1.2 p.Phe508del/p.Leu34_Gln39del 1 1.2 p.Phe508del/p.Leu812Phefs*11 1 1.2 p.Phe508del/c.3140-26A N G 1 1.2 p.Phe508del/c.3873 + 1G N A 1 1.2 p.Phe508del/p.Ser1297Phefs*5 1 1.2 p.Phe508del/c.4242_4242 + 1delGGinsTT 1 1.2 p.Phe508del/c.489 + 1G N T 1 1.2 31 37.5 Category III: Other/other p.Gly542*/p.Asn1303Lys 1 1.2 p.Asn1303Lys/p.Gly85Glu 1 1.2 c.489 + 1G N T/p.Lys684Serfs*38 1 1.2 c.489 + 1G N T/p.Gly542* 1 1.2 p.Arg1162*/p.Ser4* 1 1.2 p.Arg1162*/p.Tyr362* 1 1.2 p.Arg334Trp/c.1585-1G N A 1 1.2 p.Arg334Trp/p.Ser821Argfs*4 1 1.2 p.Arg347Pro/p.Ser4* 1 1.2 c.2657 + 5G N A/p.Tyr852Leufs*44 # 1 1.2 p.Arg1162*/p.Leu49Pro # 1 1.2 11 13.2 Category IV: A single mutation p.Phe508del/WT 3 3.6 c.2988 + 1G N A/WT 1 1.2 p.Arg117Cys/WT 1 1.2 p.Gly178Arg/WT 1 1.2 p.[Gly576Ala(;)Arg668Cys]/TG11-5T 1 1.2 7 8.4 Category V: Wild type 4 4.8 #: new mutation submitted to CFTR1 database [1]; other = other mutation than p.Phe508del. Login to comment

[hide] Newborn Screening for Cystic Fibrosis in Californi... Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16. Kharrazi M, Yang J, Bishop T, Lessing S, Young S, Graham S, Pearl M, Chow H, Ho T, Currier R, Gaffney L, Feuchtbaum L
Newborn Screening for Cystic Fibrosis in California.
Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16., [PMID:26574590]

Abstract [show]
OBJECTIVES: This article describes the methods used and the program performance results for the first 5 years of newborn screening for cystic fibrosis (CF) in California. METHODS: From July 16, 2007, to June 30, 2012, a total of 2 573 293 newborns were screened for CF by using a 3-step model: (1) measuring immunoreactive trypsinogen in all dried blood spot specimens; (2) testing 28 to 40 selected cystic fibrosis transmembrane conductance regulator (CFTR) mutations in specimens with immunoreactive trypsinogen values >/=62 ng/mL (top 1.6%); and (3) performing DNA sequencing on specimens found to have only 1 mutation in step 2. Infants with >/=2 mutations/variants were referred to CF care centers for diagnostic evaluation and follow-up. Infants with 1 mutation were considered carriers and their parents offered telephone genetic counseling. RESULTS: Overall, 345 CF cases, 533 CFTR-related metabolic syndrome cases, and 1617 carriers were detected; 28 cases of CF were missed. Of the 345 CF cases, 20 (5.8%) infants were initially assessed as having CFTR-related metabolic syndrome, and their CF diagnosis occurred after age 6 months (median follow-up: 4.5 years). Program sensitivity was 92%, and the positive predictive value was 34%. CF prevalence was 1 in 6899 births. A total of 303 CFTR mutations were identified, including 78 novel variants. The median age at referral to a CF care center was 34 days (18 and 37 days for step 2 and 3 screening test-positive infants, respectively). CONCLUSIONS: The 3-step model had high detection and low false-positive levels in this diverse population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
124 [1210-12[5]];[1210-34TG[13]] (IVS 8 (TG)13-5T) 34 / c.1521_1523delCTT (F508del)/ c.933_935delCTT (F311del) 48 / c.1521_1523delCTT (F508del)/ c.1521_1523delCTT (F508del) 51 / c.1521_1523delCTT (F508del)/ c.1521_1523delCTT (F508del) 52 / (mutations not identified) 54 / c.1521_1523delCTT (F508del)/ c.1792_1798delAAAACTA (1924del7) 58 / c.303_304insA (435insA)/ c.617T.G (L206W) 2. Login to comment