ABCMdb

ABCC7 p.Arg117Leu

ClinVar:	c.350G>C , p.Arg117Pro ? , not provided c.349C>G , p.Arg117Gly ? , not provided c.350G>T , p.Arg117Leu ? , not provided c.349C>T , p.Arg117Cys D , Pathogenic c.350G>A , p.Arg117His D , Pathogenic
CF databases:	c.350G>A , p.Arg117His ? , Varying clinical consequence ; CFTR1: c.349C>T , p.Arg117Cys D , CF-causing ; CFTR1: The haplotype is 2-1-1-2 (XV2c-KM19-D9-J44) with seven GATT repeats. The mutation creates a new Bsml site. c.349C>G , p.Arg117Gly (CFTR1) ? , Was reported previously in one study of CBAVD. R117G/UND 7T/9T (Daudin et al., Fertility and Sterility, 74:1164-1174, 2000). c.350G>C , p.Arg117Pro (CFTR1) ? , A new missense mutation was found in exon 4 : R 117 P. The mutation was detected by DGGE analysis and identified by remplacement of an arginine residue by a proline at codon 117. The mutation creates new MnlI and NlaIV sites. The mutation was identified in one french CF chromosome. The patient has a mild lung disease and is sufficient pancreatic. c.350G>T , p.Arg117Leu (CFTR1) ? , This mutation was identified by DGGE and direct sequencing and was identified on one CF chromosome of Italian origin.
Predicted by SNAP2:	A: D (91%), C: D (63%), D: D (95%), E: D (95%), F: D (91%), G: D (95%), H: N (53%), I: D (85%), K: D (95%), L: D (63%), M: D (85%), N: D (95%), P: D (66%), Q: D (95%), S: D (95%), T: D (95%), V: D (91%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: N, C: D, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, S: N, T: N, V: N, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Proportion of cystic fibrosis gene mutations not d... JAMA. 1999 Jun 16;281(23):2217-24. Mak V, Zielenski J, Tsui LC, Durie P, Zini A, Martin S, Longley TB, Jarvi KA
Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia.
JAMA. 1999 Jun 16;281(23):2217-24., 1999-06-16 [PMID:10376575]

Abstract [show]
CONTEXT: Infertile men with obstructive azoospermia may have mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, many of which are rare in classic cystic fibrosis and not evaluated in most routine mutation screening. OBJECTIVE: To assess how often CFTR mutations or sequence alterations undetected by routine screening are detected with more extensive screening in obstructive azoospermia. DESIGN: Routine screening for the 31 most common CFTR mutations associated with the CF phenotype in white populations, testing for the 5-thymidine variant of the polythymidine tract of intron 8 (IVS8-5T) by allele-specific oligonucleotide hybridization, and screening of all exons through multiplex heteroduplex shift analysis followed by direct DNA sequencing. SETTING: Male infertility clinic of a Canadian university-affiliated hospital. SUBJECTS: Of 198 men with obstructive (n = 149) or nonobstructive (n = 49; control group) azoospermia, 64 had congenital bilateral absence of the vas deferens (CBAVD), 10 had congenital unilateral absence of the vas deferens (CUAVD), and 75 had epididymal obstruction (56/75 were idiopathic). MAIN OUTCOME MEASURE: Frequency of mutations found by routine and nonroutine tests in men with obstructive vs nonobstructive azoospermia. RESULTS: Frequency of mutations and the IVS8-5T variant in the nonobstructive azoospermia group (controls) (2% and 5.1% allele frequency, respectively) did not differ significantly from that in the general population (2% and 5.2%, respectively). In the CBAVD group, 72 mutations were found by DNA sequencing and IVS8-5T testing (47 and 25, respectively; P<.001 and P = .002 vs controls) vs 39 by the routine panel (P<.001 vs controls). In the idiopathic epididymal obstruction group, 24 mutations were found by DNA sequencing and IVS8-5T testing (12 each; P=.01 and P=.14 vs controls) vs 5 by the routine panel (P=.33 vs controls). In the CUAVD group, 2 mutations were found by routine testing (P=.07 vs controls) vs 4 (2 each, respectively; P=.07 and P=.40 vs controls) by DNA sequencing and IVS8-5T testing. The routine panel did not identify 33 (46%) of 72, 2 (50%) of 4, and 19 (79%) of 24 detectable CFTR mutations and IVS8-5T in the CBAVD, CUAVD, and idiopathic epididymal obstruction groups, respectively. CONCLUSIONS: Routine testing for CFTR mutations may miss mild or rare gene alterations. The barrier to conception for men with obstructive infertility has been overcome by assisted reproductive technologies, thus raising the concern of iatrogenically transmitting pathogenic CFTR mutations to the progeny.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 (%) Men With 2 Mutations ⌬F508/IVS8-5T 7 (11) ⌬F508/IVS8-5T 1 (10) ⌬F508/IVS8-5T 1 (1.8) ⌬F508/R117H 6 (9) W1282X/IVS8-5T 1 (1.8) ⌬F508/L206W 1 (1.6) G544S/IVS8-5T 1 (1.8) ⌬F508/M952T 1 (1.6) V754M/-741T→G 1 (1.8) ⌬F508/P67L 1 (1.6) R75Q/R258G 1 (1.8) ⌬F508/S549R 1 (1.6) R334W/R334W 1 (1.6) R117H/R117H 1 (1.6) R117H/IVS8-5T 1 (1.6) R347P/IVS8-5T 1 (1.6) N1303K/IVS8-5T 1 (1.6) 1677delTA/IVS8-5T 1 (1.6) R117L/IVS8-5T 1 (1.6) D979A/IVS8-5T 1 (1.6) IVS8-5T/IVS8-5T 1 (1.6) Men With 1 Mutation IVS8-5T/N 10 (16) ⌬F508/N 1 (10) IVS8-5T/N 9 (16) ⌬F508/N 1 (2) ⌬F508/N 6 (9) IVS8-5T/N 1 (10) ⌬F508/N 1 (1.8) G542X/N 1 (2) W1282X/N 2 (3) R75Q/N 1 (1.8) IVS8-5T/N 5 (10) L206W/N 1 (1.6) W1282X/N 1 (1.8) 4016insT/N 1 (1.6) R117H/N 1 (1.8) 2423delG/N 1 (1.8) Men With No Mutations 18 (28) 7 (70) 37 (66) 42 (86) *N indicates that no CFTR mutations or variants were detected. Login to comment
50 Of the 8 additional CFTR gene sequence alterations detected using extensive CFTR exon screening, 5 have been described rarely in the CF population (L206W [identified in 2 subjects], P67L, 1677delTA, R117L, and 4016insT).60 One mutation, D979A, was previously identified in a Vietnamese CBAVD patient.60 Interestingly, our CBAVD subject with D979A (also a carrier of IVS8-5T) was of Vietnamese descent as well. Login to comment
58 (%) 31 Mutation panel† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1 (1) R117H 9 (7) W1282X 2 (1.8) G542X 1 (1) W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) Extensive screen† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1Mutations included in R117H 9 (7) W1282X 2 (1.8) G542X 131 mutation panel W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) L206W 2 (1.6)‡ R75Q 2 (1.8)‡Mutations not included in P67L 1 (0.8)‡ G544S 1 (0.9)‡31 mutation panel 1677delTA 1 (0.8)‡ 2423delG 1 (0.9)‡ R117L 1 (0.8)‡ V754M 1 (0.9)‡ 4016insT 1 (0.8)‡ -741T→G 1 (0.9)‡ D979A 1 (0.8)§ R258G 1 (0.9)§ M952T 1 (0.8)¶ IVS8-5T 25 (20)# 2 (10) 12 (11) 5 (5) Detectable mutations 72 (56)# 4 (20) 24 (21)# 7 (7) Detectable mutations missed by 31 mutation panel 33 (46) 2 (50) 19 (79) Detectable non-IVS8-5T mutations missed by 31 mutation panel 8 (17) 0 (0) 7 (58) *Percentages indicate allele frequency. Login to comment
83 These severe CFTR gene mutations are associated with pancreatic insufficiency and are generally class 1 through 3 mutations: ⌬F508, W1282X, N1303K, S549R, 1677delTA, R117L, 4016insT, G544S, 2423delG, V754M, and 741T→G. Login to comment

[hide] Many deltaF508 heterozygote neonates with transien... J Med Genet. 2000 Jul;37(7):543-7. Boyne J, Evans S, Pollitt RJ, Taylor CJ, Dalton A
Many deltaF508 heterozygote neonates with transient hypertrypsinaemia have a second, mild CFTR mutation.
J Med Genet. 2000 Jul;37(7):543-7., [PMID:10970190]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
538 These have been reported in patients with presenting phenotypes ranging from "cystic fibrosis" to oligospermia, but there have been too few cases Table 2 Compound heterozygotes detected Domain and mutation type Genotype Exon 1st IRT 2nd IRT Transmembrane, missense F508/P67L 3 129 34* F508/R117H 4 110 21* F508/R117H 4 84 34 F508/R117H 4 95 39 F508/R117H 4 104 40 F508/R117H 4 146 41 F508/R117H 4 104 48* F508/R117H 4 120 53 F508/R117H 4 111 54 F508/R117H 4 175 72* F508/R117L 4 129 70 F508/L967S 15 122 15 F508/F1052V 17b 189 29 F508/R1066H 17b 94 18 Transmembrane, nonsense F508/R75X 3 86 26 F508/R75X 3 171 27 F508/R851X 14a 112 76 Regulatory, missense F508/F693L 13 109 29 Alternate splice site F508/3849+10KB C→T i19 99 26* F508/3849+10KB C→T i19 112 36* None of these samples had the IVS8-5T variant sequence. Login to comment

[hide] Unilateral renal agenesis associated with congenit... Hum Reprod. 2001 Feb;16(2):282-8. McCallum T, Milunsky J, Munarriz R, Carson R, Sadeghi-Nejad H, Oates R
Unilateral renal agenesis associated with congenital bilateral absence of the vas deferens: phenotypic findings and genetic considerations.
Hum Reprod. 2001 Feb;16(2):282-8., [PMID:11157821]

Abstract [show]
An association between congenital bilateral absence of the vas deferens (CBAVD), normal renal anatomy and cystic fibrosis (CF) gene mutations is well established (CF/CBAVD). We postulate that unilateral renal agenesis (URA) and CBAVD (URA/CBAVD) may have a non-CF mutation-mediated genetic basis that leads to abnormal development of the entire mesonephric duct at a very early stage in embryo development (< or =7 weeks). The physical, laboratory and radiographic findings of men with URA/CBAVD (n = 17) and CF/CBAVD (n = 97) were compared; the fertilization and pregnancy rates in the URA/CBAVD population calculated, and the incidence of renal agenesis in immediate family members and offspring of men with URA/CBAVD analysed. No statistical differences could be identified within any of the above comparisons. The fertilization rate for the URA/CBAVD group was 58.2 +/- 26.3%. Eight infants and two fetuses had normal renal anatomy, while one terminated male fetus had bilateral renal and vasal agenesis. Thirty first-order relatives had normal renal units. Anatomical expression of the reproductive ductal derivatives in men with URA/CBAVD and CF/CBAVD was similar, but the phenotypic outcome of the renal portion of the mesonephric duct was different. The potential for transmission of this fatal anomaly reinforces the need for prenatal ultrasounds with all pregnancies involving URA/CBAVD men.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 ThereW1282X; ∆F508; R553X; N1303K; 3849ϩ10 kb C-T; R117L; I506; R553G; R560K; 1811ϩ1G-C; 1774delCT; S549R; S549I; R1283K; were no significant correlations with ethnic origin. Login to comment

[hide] Disease-associated mutations in the extracytoplasm... J Biol Chem. 2001 May 4;276(18):14848-54. Epub 2001 Feb 6. Hammerle MM, Aleksandrov AA, Riordan JR
Disease-associated mutations in the extracytoplasmic loops of cystic fibrosis transmembrane conductance regulator do not impede biosynthetic processing but impair chloride channel stability.
J Biol Chem. 2001 May 4;276(18):14848-54. Epub 2001 Feb 6., 2001-05-04 [PMID:11278813]

Abstract [show]
Consistent with its function as a chloride channel regulated entirely from the cytoplasmic side of the plasma membrane, the cystic fibrosis transmembrane conductance regulator (CFTR) glycoprotein exposes little of its mass on the exterior surface of cells. The first and fourth extracytoplasmic loops (ELs) contain approximately 15 and 30 residues, respectively; the other four ELs are extremely short. To examine the influence of missense mutants in ELs detected in patients with cystic fibrosis, we have expressed them in mammalian (baby hamster kidney (BHK21)) cells and assessed their biosynthetic processing and chloride channel activity. In contrast to previous findings that 18 of 30 disease-associated missense mutations in cytoplasmic loops caused retention of the nascent polypeptides in the endoplasmic reticulum, all the EL mutants studied matured and were transported to the cell surface. This pronounced asymmetry is consistent with the notion that endoplasmic reticulum quality control of nascent CFTR is exerted primarily on the cytoplasmic side of the membrane. Although this set of EL mutations has little effect on CFTR maturation, most of them seriously compromise its chloride channel activity. Substitutions at six different positions in EL1 and single positions in EL2 and EL4 all destabilized the open state, some of them severely, indicating that the ELs contribute to the stability of the CFTR ion pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 TABLE I Oligonucleotide primers used to generate mutations Mutation Primer S108F GGAAGAATCATAGCTTtCTATGACCCGGATAAC Y109C AGAATCATAGCTTCCTgTGACCCGGATAACAAG D110H ATCATAGCTTCCTATcACCCGGATAACAAGGAG P111A ATAGCTTCCTATGACgCGGATAACAAGGAGGAA P111L ATAGCTTCCTATGACCtGGATAACAAGGAGGAA E116K CCGGATAACAAGGAGaAACGCTCTATCGCGATT R117C GATAACAAGGAGGAAtGCTCTATCGCGATTTAT R117H GATAACAAGGAGGAACaCTCTATCGCGATTTAT R117L GATAACAAGGAGGAACtCTCTATCGCGATTTAT R117P GATAACAAGGAGGAACcCTCTATCGCGATTTAT E217G ATGGGGCTAATCTGGGgGTTGTTACAGGCGTCT T908N TATGCAGTGATTATCAaCAGCACCAGTTCGTAT P1013L GTCGCAGTTTTACAACtCTACATCTTTGTTGCA FIG. 2. Login to comment
119 C, squares, R117C; circles, R117H; triangles, R117L; diamonds, R117P. Login to comment
142 Both R117C and R117L had very unstable open states like S108F and E116K with the cysteine substitution able to maintain openings FIG. 4. Login to comment
171 For example a nucleotide binding domain mutation, G551D, precludes virtually all TABLE II Relative charge transport capacity of mutants Mutants S108F Y109C D110H P111L P111A E116K R117H R117C R117L R117P E217G T908N P1013L Imutant/Iwt 100% 11 15 27 173 105 12 80 27 5 11 10 48 170 FIG. 5. Login to comment

[hide] Genetic and clinical features of false-negative in... Acta Paediatr. 2002;91(1):82-7. Padoan R, Genoni S, Moretti E, Seia M, Giunta A, Corbetta C
Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis.
Acta Paediatr. 2002;91(1):82-7., [PMID:11883825]

Abstract [show]
A study was performed on the delayed diagnosis of cystic fibrosis (CF) in infants who had false-negative results in a neonatal screening programme. The genetic and clinical features of false-negative infants in this screening programme were assessed together with the efficiency of the screening procedure in the Lombardia region. In total, 774,687 newborns were screened using a two-step immunoreactive trypsinogen (IRT) (in the years 1990-1992), IRT/IRT + delF508 (1993-1998) or IRT/IRT + polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) protocol (1998-1999). Out of 196 CF children born in the 10 y period 15 were false negative on screening (7.6%) and molecular analysis showed a high variability in the genotypes. The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E. In three patients no mutation was identified after denaturing gradient gel electrophoresis of the majority of CFTR gene exons. Conclusion: The clinical phenotypes of CF children diagnosed by their symptoms at different ages were very mild. None of them presented with a severe lung disease. The majority of them did not seem to have been damaged by the delayed diagnosis. The combination of IRT assay plus genotype analysis (1998-1999) appears to be a more reliable method of detecting CF than IRT measurement alone or combined with only the delF508 mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 Mutation Frequency (%) DelF508 54 N1303K 8 G542X 6.25 1717-1G ® A 2.50 R334W 1.75 2183AA ® G 1.50 R117H, L1077P, W1282X 1.25 D110E, R347P, E585X, 2789 ‡ 5G ® A 0.75 R352Q, R553X, R1066H, D1152H, R1158X, 1782delA, 1898 ‡ 1G ® A, 3659delC 0.50 G85E, R117L, G178R, D579G, H609R, Y1032C, V1153E, R1162X, 621 ‡ 1G ® T, 711 ‡ 1G ® T, 1845delAG o 1846delGA, 2143delT 0.25 Table2.Differencesinthethreestrategiesofneonatalscreening(audit1990-1999). Login to comment

[hide] Negative sweat test in hypertrypsinaemic infants w... Eur J Pediatr. 2002 Apr;161(4):212-5. Padoan R, Bassotti A, Seia M, Corbetta C
Negative sweat test in hypertrypsinaemic infants with cystic fibrosis carrying rare CFTR mutations.
Eur J Pediatr. 2002 Apr;161(4):212-5., [PMID:12014388]

Abstract [show]
Persistent hypertrypsinaemia in newborn screening for cystic fibrosis (CF) recognises subjects at high risk to be affected. Diagnosis is confirmed by a positive sweat test and/or by the presence of two mutations in the cystic fibrosis transmembrane regulator gene. The aim of the present study was to evaluate the occurrence of a negative sweat test (chloride < 60 mmol/l) during the first months of life, in hypertrypsinaemic infants, which would lead to a delayed diagnosis. We reviewed clinical charts of CF patients born between January 1993 and September 1998, when the neonatal screening programme consisted of an immunoreactive trypsinogen (IRT)/DNA (F508del) + IRT strategy. Laboratory and clinical data were collected for patients diagnosed after 12 months of life. Out of 446,492 newborns, 104 CF patients were diagnosed giving an overall incidence of 1:4293. Of these, six had a blood IRT level above the cut off value (99th percentile) and a negative sweat test in the first trimester of life. At a mean age of 3.5years, the patients were again referred to our CF Centre for re-evaluation in order to confirm or exclude the disorder. Molecular analysis identified the following genotypes: F508del/A309D, F508del/3849 + 10kbC-->T, F508del/R117H (in two patients), R117H/ L997F, and F508del/R117L. CONCLUSION: Infants with cystic fibrosis bearing a spectrum of mild cystic fibrosis transmembrane regulator gene mutations may present as hypertrypsinaemic newborns with a sweat chloride within the normal range. Reference values for normal sweat test during the first months of life should be revised. A wide molecular genetic analysis is recommended for newborns presenting persistent hypertrypsinaemia and a sweat test result > 30 mmol/l in order to diagnose atypical forms of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 Molecular analysis identified the following genotypes: F508del/A309D, F508del/3849+ 10kbCfiT, F508del/R117H (in two patients), R117H/ L997F, and F508del/R117L. Login to comment
35 A subsequent expanded analysis of the CFTR gene, by means of DGGE analysis and sequencing, was performed on the remaining three chromosomes and identified the following CFTR alterations: R117L, L997F, and A309D. Login to comment
42 Table 1 Diagnostic features of patients Patient number Sex First IRT (ng/ml) (cut-off) Second IRT (ng/ml) (cut-off) Sweat test chloride (mmol/l) Age at sweat test Age at re-evaluation Symptoms Repeat sweat test chloride (mmol/l) Genotype 1 M 47 (40) 39 (30) 43 4 months 3 years and 3 months Chronic respiratory 64 DF508/A309D 2 M 174 (55) 112 (40) <60 4 months 6 years and 6 months Severe nasal polyposis 68 DF508/3849+ 10kbCfiT 3 F 56 (55) 64 (40) 34 4 months 5 years and 4 months Recurrent upper airways infections 55 DF508/R117H-7T 4 F 84 (80) 102 (40) 55 4 months 4 years No symptoms Not determined R117H-5T/L997F 5 F 142 (80) 81 (40) 37 3 months 20 months Recurrent upper airways infections 47 DF508/R117H-7T 6 F 90 (80) 55 (40) 36 2 months 18 months No symptoms 49 DF508/R117L Discussion Our retrospective evaluation of patients diagnosed beyond 1 year of age at our centre over a ca. 6-year period shows that hypertrypsinaemic newborns carrying at least one ''mild`` CFTR mutation may have a chloride sweat test below 60 mmol/l and a delayed CF diagnosis. Login to comment
43 Rare mutations in the CFTR gene were identified in six patients showing increased b-IRT on newborn screening and a normal sweat test: R117H (three cases), R117L, A309D, L997F and the intronic alteration 3849+10kbCfiT. Login to comment
44 In the whole CF population followed at the Milan CF Centre (580 patients), R117L, A309D and L997F have never been identified before, whereas R117H and 3849+10kbCfiT account for only 0.51% and 0.68% of alleles, respectively. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment
34 The mutations in the 25 mutation panel were: ∆F508, G542X, N1303K, G551D, W1282X, 1717-1G→A, R553X, 621ϩ1G→T, R1162X, 2183AA→G, R117H, ∆I507, R560T, 3849ϩ10kbC→T, S549N, S549I, S549R, R1283M, R1283K, R553G, R560K, R117L, 1774delCT, 1811ϩ1G→C, and 4006-61del14. Login to comment

[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 These mutations included S4X (143 C to A), exon 1; S42F (257 C to T), exon 2; R117L (482 G to T), exon 4; S549R (1779 T to G), exon 11; 3667ins4, exon 19; A1006E (3149 C to A), exon17a; L1065P (3326 T to C), R1066C (3328 C to T), L1077P (3362 T to C), exon 17b. Login to comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]

Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

[hide] A new complex allele of the CFTR gene partially ex... Genet Med. 2010 Sep;12(9):548-55. Lucarelli M, Narzi L, Pierandrei S, Bruno SM, Stamato A, d'Avanzo M, Strom R, Quattrucci S
A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation.
Genet Med. 2010 Sep;12(9):548-55., [PMID:20706124]

Abstract [show]
PURPOSE: To evaluate the role of complex alleles, with two or more mutations in cis position, of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in the definition of the genotype-phenotype relationship in cystic fibrosis (CF), and to evaluate the functional significance of the highly controversial L997F CFTR mutation. METHODS: We evaluated the diagnosis of CF or CFTR-related disorders in 12 unrelated subjects with highly variable phenotypes. According to a first CFTR mutational analysis, subjects appeared to be compound heterozygotes for a classic mutation and the L997F mutation. A further CFTR mutational analysis was conducted by means of a protocol of extended sequencing, particularly suited to the detection of complex alleles. RESULTS: We detected a new [R117L; L997F] CFTR complex allele in the four subjects with the highest sweat test values and CF. The eight subjects without the complex allele showed the most varied biochemical and clinical outcome and were diagnosed as having mild CF, CFTR-related disorders, or even no disease. CONCLUSIONS: The new complex allele partially explains the variable phenotype in CF subjects with the L997F mutation. CFTR complex alleles are likely to have a role in the definition of the genotype-phenotype relationship in CF. Whenever apparently identical CFTR-mutated genotypes are found in subjects with divergent phenotypes, an extensive mutational search is mandatory.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 Results: We detected a new [R117L; L997F] CFTR complex allele in the four subjects with the highest sweat test values and CF. Login to comment
55 RESULTS Genetic analysis, biochemical features of the mutations found, and state of conservation of L997F and R117L residues Five different CFTR mutations were found (those included in the CF-OLA panel were confirmed by sequencing) on one allele of the subjects analyzed (Table 1). Login to comment
63 The R117L (c.350GϾT) was found in four subjects on the same allele as L997F (as assessed by parents` analysis); it is a nonconservative Table1CFTRgenotypes,sweattestvalues,andclinicalassessmentofthesubjectsstudied SubjectGenotypeSex Averagesweat testvaluea (mEq/L) Semen analysis Uponenrollment AgeCause Clinicalsymptoms (withouttherapy) Respiratory manifestations Pulmonarybacterial isolatesByFEV1Byrx 1F508del/͓R117L;L997F͔M90Ϯ9OA5yrSymptomsDehydrationevents, bronchopneumonia, rhinosinusitis ModerateModerateAbsent 2c F508del/L997FF56Ϯ8ND2moNeonatalscreeningAbsentTooyoungMildAbsent 3F508del/L997FM42Ϯ5Tooyoung5moNeonatalscreeningAbsentTooyoungAbsentAbsent 4c F508del/L997FF35Ϯ4ND1moNeonatalscreeningAbsentTooyoungMildAbsent 5c F508del/L997FM32Ϯ1Tooyoung2moNeonatalscreeningAbsentTooyoungAbsentAbsent 6F508del/L997FM22Ϯ3Tooyoung8yrSymptomsBronchopneumonia,bronchitis, rhinosinusitis AbsentMildAbsent 7G85E/͓R117L;L997F͔M102Ϯ10OA7yrSymptomsProductivecoughTooyoungMildS.aureus 8G85E/L997FM21Ϯ4Tooyoung11moNeonatalscreeningProductivecoughTooyoungMildS.aureus(sporadic) 9W1282X/͓R117L;L997F͔M96Ϯ4OA33yrSymptomsCholelithiasis,productive cough,bronchopneumonia MildModerateS.aureus,P.aeruginosa 10W1282X/͓R117L;L997F͔F80Ϯ5ND36yrSymptomsBronchopneumoniaModerateModerateP.aeruginosa 11L320V/L997FM77Ϯ5Tooyoung3yrSymptomsRhinosinusitisTooyoungAbsentAbsent 12c S549R(AϾC)/L997FM39Ϯ6Tooyoung2moNeonatalscreeningAbsentTooyoungAbsentAbsent Nosubjecthadeitherpancreatitisorliverdisease.ClassificationofpulmonarysymptomsbyFEV1isasfollows:absent,Ͼ90%;mild,from70%to90%;moderate,from40%to70%;severe,Ͻ40%.Classificationofpulmonary symptomsbychestx-rayisasfollows:absent,noradiologicalsigns;mild,limitedairtrappingorperibronchialinfiltration;moderate,denseareasorbronchiectasisrestrictedtoonelobe;severe,denseareasorbronchiectasisin bothhemithoraxes.Theseverityofcysticfibrosiswasclassifiedasreportedin"MaterialsandMethods-Biochemical,microbiologic,andclinicalcharacterization"section. a Eachsweattestvalueisthemeanofrepeatedsweattestmeasurements(from2to4)onenrollmentandduringfollow-up. b TheBransfieldscorerangesfrom25,nodisease,to0,highlyseveredisease(forreferencesee"MaterialsandMethods"section).27 c Thesefoursubjectshavealreadybeenpartiallydescribed14andareincludedheremerelyforcomparisonpurposes. d AllthesubjectshadpancreaticsufficiencywiththeexceptionofSubject1whohadinitialPS,whichgraduallyevolvedintopancreaticinsufficiencyfrom12yearsofage. OA,obstructiveazoospermia;ND,notdetermined;PI,pancreaticinsufficiency;PS,pancreaticsufficiency. Login to comment
66 Because the position of R117L is in the first extracellular loop exposed to the aqueous extracellular environment, the substituting amino acid will have a lower fit than the original one. Login to comment
70 Both the isolated L997F and the [R117L; L997F] complex allele were associated with the 470V allele in all subjects. Login to comment
79 However, the extended genetic analysis detected the R117L mutation on the same allele as the L997F mutation in Subjects 1, 7, 9, and 10, thereby revealing a new complex allele of the CFTR gene (an example of the sequencing analysis is shown in Fig. 1). Login to comment
81 The four subjects with the [R117L; L997F] complex Fig. 1. Login to comment
89 Subject 1, with a F508del/[R117L; L997F] genotype and the highest sweat test value, displayed clinically severe CF with late pancreatic insufficiency, whereas the five subjects with the F508del/L997F genotype and lower sweat test values displayed either a milder form of CF (Subject 6) or CFTR-RD (Subjects 2, 3, and 4) or no disease at all (Subject 5). Login to comment
108 Five different CFTR mutations of the 117 CFTR amino acid are known: R117C, R117G, R117H, R117L, and R117P.37 All these mutations have previously been reported to be more likely to cause CFTR-RD than CF.13,37,46,56 However, R117H and R117C have been shown to yield high sweat test values and CF, even severe, if cis-acting with the T5 variant tract in CFTR intron 8.45,46 If we bear in mind that the pH range of airway surface fluid is pH 6.7-7.0,57,58 these mutations of the R117 CFTR residue represent both conservative and nonconservative substitutions. Login to comment
109 In particular, the R117L is a nonconservative substitution that changes the basic residue to a hydrophobic residue. Login to comment
111 A possible molecular mechanism for the reduced effect of the isolated R117L mutation may be that only 11 of the 15 amino acids that constitute the first extracellular loop domain in which the R117 residue is located have a charged or a polar side chain, whereas the other four are hydrophobic. Login to comment
114 In these four cases, the mild effects of the isolated L997F and R117L mutations cumulate in the complex allele with a cis-acting effect, thereby inducing a well-defined, strong effect on both the Cl-transport (producing the highest sweat test values in the entire case series) and clinical outcome, resulting in CF (from mild to severe). Login to comment
145 Whenever a L997F mutation is found, the search for the R117L mutation must be undertaken (and vice versa); if the complex allele is found, the onset of CF (in a mild or severe form) with high sweat test value is likely. Login to comment

[hide] Newborn screening for cystic fibrosis: Polish 4 ye... Eur J Hum Genet. 2012 Aug 15. doi: 10.1038/ejhg.2012.180. Sobczynska-Tomaszewska A, Oltarzewski M, Czerska K, Wertheim-Tysarowska K, Sands D, Walkowiak J, Bal J, Mazurczak T
Newborn screening for cystic fibrosis: Polish 4 years' experience with CFTR sequencing strategy.
Eur J Hum Genet. 2012 Aug 15. doi: 10.1038/ejhg.2012.180., [PMID:22892530]

Abstract [show]
Newborn screening for cystic fibrosis (NBS CF) in Poland was started in September 2006. Summary from 4 years' experience is presented in this study. The immunoreactive trypsin/DNA sequencing strategy was implemented. The group of 1 212 487 newborns were screened for cystic fibrosis during the programme. We identified a total of 221 CF cases during this period, including, 4 CF cases were reported to be omitted by NBS CF. Disease incidence in Poland based on the programme results was estimated as 1/4394 and carrier frequency as 1/33. The frequency of the F508del was similar (62%) to population data previously reported. This strategy allowed us to identify 29 affected infants with rare genotypes. The frequency of some mutations (eg, 2184insA, K710X) was assessed in Poland for the first time. Thus, sequencing assay seems to be accurate method for screening programme using blood spots in the Polish population.European Journal of Human Genetics advance online publication, 15 August 2012; doi:10.1038/ejhg.2012.180.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Mutations D537N and P731L have not been Period of NBS CF Method The most frequent mutations in Polish population under analysis September 2006 - December 2007 Estonia Asper Biotech assay E60X, G85E, 394delTT, R117H, R117P, R117L, I148T, 621G>A, 711+1G>T, 711+5G>A, 1078delT, R334W, R347H, R347P, R347L, IVS8-T, A455E, I507del, F508del, 1717-1G>A, G542X, p.G551D, Q552X, R553X, R553G, R560T, R560K, 1898+1G>A, 1898+1G>T, 1898+1G>C, 2143delT, 2184delA, 2183AA>G, 2789+5G>A, 3120+1G>A, 3199del6, 3272-26A>G, R1162X, 3659delC, 3849+10kbC>T, 3905insT, S1235R, S1251N, W1282X, W1282C, N1303K, CFTRdele2,3 January 2007 - June 2009 Sanger sequencing of exons: 4, 7, 10, 11, 13, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R117H+IVS8-T*, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K July 2009 - currently Sanger sequencing of exons: 7, 10, 11, 13, 17b, 20, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K, 3272-26A>G**, W1282X** * removed from DNA analysis since July 2009 , **added into DNA analysis since July 2009 Figure 1 NBS CF in Poland. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b. Login to comment

[hide] Independent origins of cystic fibrosis mutations R... Am J Hum Genet. 1994 Nov;55(5):890-8. Morral N, Llevadot R, Casals T, Gasparini P, Macek M Jr, Dork T, Estivill X
Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene.
Am J Hum Genet. 1994 Nov;55(5):890-8., [PMID:7526685]

Abstract [show]
Microsatellite analysis of chromosomes carrying particular cystic fibrosis mutations has shown different haplotypes in four cases: R334W, R347P, R1162X, and 3849 + 10kbC-->T. To investigate the possibility of recurrence of these mutations, analysis of intra- and extragenic markers flanking these mutations has been performed. Recurrence is the most plausible explanation, as it becomes necessary to postulate either double recombinations or single recombinations in conjunction with slippage at one or more microsatellite loci, to explain the combination of mutations and microsatellites if the mutations arose only once. Also in support of recurrence, mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T involve CpG dinucleotides, which are known to have an increased mutation rate. Although only 15.7% of point mutations in the coding sequence of CFTR have occurred at CpG dinucleotides, approximately half of these CpG sites have mutated at least once. Specific nucleotide positions of the coding region of CFTR, distinct from CpG sequences, also seem to have a higher mutation rate, and so it is possible that the mutations observed are recurrent. G-->A transitions are the most common change found in those positions involved in more than one mutational event in CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 1990 G--*-T R117L G. Novelli, personal communication 1171 ......... CT R347C C. Ferec, personal communication 1172 ......... G--A R347H Cremonesi et al. 1992 G I. Login to comment

[hide] Impaired CFTR function in mild cystic fibrosis ass... J Cyst Fibros. 2013 Dec;12(6):821-5. doi: 10.1016/j.jcf.2012.12.014. Epub 2013 Jan 27. Sorio C, Angiari C, Johansson J, Verze G, Ettorre M, Buffelli M, Castellani C, Assael BM, Melotti P
Impaired CFTR function in mild cystic fibrosis associated with the S977F/T5TG12complex allele in trans with F508del mutation.
J Cyst Fibros. 2013 Dec;12(6):821-5. doi: 10.1016/j.jcf.2012.12.014. Epub 2013 Jan 27., [PMID:23361109]

Abstract [show]
BACKGROUND: The S977F mutation (c.2930C>T) in the CFTR gene (CFTR/ABCC7) is extremely rare. We describe the case of an adult patient carrying the complex allele S977F/T5TG12 in trans with the F508del mutation. Mild respiratory manifestations arose in adulthood associated with azoospermia, acute pancreatitis, minor hemoptysis and Cl(-) levels ranging from 40 to 42 mEq/L. METHOD: Diagnosis was confirmed by repeated NPD measurements, genetic DHPLC analysis and a recently described functional assay measuring cAMP-dependent cell depolarization in peripheral blood monocytes. RESULTS: NPD measurements, DHPLC and monocyte functional assay (CF index=-18). Results were consistent with a CF phenotype. CONCLUSIONS: The combined application of DHPLC and NPD analysis in the algorithm for CF diagnosis appears useful for the management of similar cases. In addition, the novel monocyte functional assay might contribute to improve our diagnostic capability, counseling and better treatment of these challenging clinical cases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 L977F has been associated with CF and a complex allele (R117L,L977F) has recently been described that could account for the variable phenotype [10]. Login to comment
42 The presence of R117L was excluded in our patient. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... PLoS One. 2013 Apr 17;8(4):e61176. doi: 10.1371/journal.pone.0061176. Print 2013. Schippa S, Iebba V, Santangelo F, Gagliardi A, De Biase RV, Stamato A, Bertasi S, Lucarelli M, Conte MP, Quattrucci S
Cystic fibrosis transmembrane conductance regulator (CFTR) allelic variants relate to shifts in faecal microbiota of cystic fibrosis patients.
PLoS One. 2013 Apr 17;8(4):e61176. doi: 10.1371/journal.pone.0061176. Print 2013., [PMID:23613805]

Abstract [show]
INTRODUCTION: In this study we investigated the effects of the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene variants on the composition of faecal microbiota, in patients affected by Cystic Fibrosis (CF). CFTR mutations (F508del is the most common) lead to a decreased secretion of chloride/water, and to mucus sticky secretions, in pancreas, respiratory and gastrointestinal tracts. Intestinal manifestations are underestimated in CF, leading to ileum meconium at birth, or small bowel bacterial overgrowth in adult age. METHODS: Thirty-six CF patients, fasting and under no-antibiotic treatment, were CFTR genotyped on both alleles. Faecal samples were subjected to molecular microbial profiling through Temporal Temperature Gradient Electrophoresis and species-specific PCR. Ecological parameters and multivariate algorithms were employed to find out if CFTR variants could be related to the microbiota structure. RESULTS: Patients were classified by two different criteria: 1) presence/absence of F508del mutation; 2) disease severity in heterozygous and homozygous F508del patients. We found that homozygous-F508del and severe CF patients exhibited an enhanced dysbiotic faecal microbiota composition, even within the CF cohort itself, with higher biodiversity and evenness. We also found, by species-specific PCR, that potentially harmful species (Escherichia coli and Eubacterium biforme) were abundant in homozygous-F508del and severe CF patients, while beneficial species (Faecalibacterium prausnitzii, Bifidobacterium spp., and Eubacterium limosum) were reduced. CONCLUSIONS: This is the first report that establishes a link among CFTR variants and shifts in faecal microbiota, opening the way to studies that perceive CF as a 'systemic disease', linking the lung and the gut in a joined axis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 Patient Sex Age (years) CFTR allele, = CFTR allele, R Criterion I(a) Criterion II (1 = severe, 0 = mild)(b) Pancreatic status(d) FEV1% BMI 1 M 17 F508del M1V 2 (1) 1 65 17.91 2 F 23 F508del Y569D 2 (1) 0 97 18.66 3 (s1)(c) F 20 P1013L F508del 2 (0) 0 87 18.67 4 M 11 F508del L997F (without R117L) 2 0 0 110 21.33 5 (s1)(c) M 11 P1013L F508del 2 (0) 0 100 23.14 6 M 8 R553X F508del 2 1 0 80 15.87 7 M 3 F508del unknown 2 (0) 0 nd nd 8 F 33 F508del F508del 1 1 1 73 18.61 9 M 10 F508del L1077P 2 1 0 94 19.79 10 M 9 F508del G542X 2 1 1 100 16.00 11 F 9 4167delCTAAGCC L1065P 3 nd 1 76 14.57 12 F 14 R117C (without (TG)12T5) F508del 2 0 0 94 18.44 13 F 11 F508del 991del5 2 1 1 109 17.80 14 M 42 (TG)12T5 F508del 2 0 0 106 23.78 15 (s2)(c) M 9 F508del F508del 1 1 1 82 15.45 16 M 10 F508del R347P 2 (0) 0 89 15.91 17 (s2)(c) F 6 F508del F508del 1 1 1 110 15.20 18 (s3)(c) M 39 2789+5G.A N1303K 3 nd 0 105 19.33 19 (s3)(c) F 41 2789+5G.A N1303K 3 nd 0 80 19.47 20 F 26 N1303K W1282X 3 nd 1 90 19.57 21 M 7 CFTRdele2,3 (21 kb) N1303K 3 nd 1 107 12.85 22 F 9 F508del L997F (without R117L) 2 0 0 113 25.21 23 M 7 P5L W1282X 3 nd 0 89 22.31 24 M 9 2789+5G.A F508del 2 (1) 1 97 15.60 25 F 2 F508del F508del 1 1 1 nd nd 26 F 32 N1303K N1303K 3 nd 1 107 21.22 27 M 14 L1065R T338I 3 nd 0 116 21.50 28 M 12 711+3A.G S549R(A.C) 3 nd 0 97 20.00 29 M 13 unknown R117H (without (TG)12T5) 3 nd 0 104 19.36 30 M 14 F508del G542X 2 1 1 84 21.87 31 F 13 F508del F508del 1 1 1 85 18.00 32 F 41 2789+5G.A N1303K 3 nd 1 84 21.08 33 F 21 L1065P F508del 2 (0) 0 62 18.29 34 F 50 D1152H F508del 2 (0) 0 63 23.74 35 M 29 F508del 2790-2A.G 2 (1) 0 92 24.46 36 F 45 unknown W1282X 3 nd 0 69 23.42 a (Hm = 1; Ht = 2; N = 3). Login to comment

[hide] Benign outcome among positive cystic fibrosis newb... J Cyst Fibros. 2015 Nov;14(6):714-9. doi: 10.1016/j.jcf.2015.03.006. Epub 2015 Mar 29. Salinas DB, Sosnay PR, Azen C, Young S, Raraigh KS, Keens TG, Kharrazi M
Benign outcome among positive cystic fibrosis newborn screen children with non-CF-causing variants.
J Cyst Fibros. 2015 Nov;14(6):714-9. doi: 10.1016/j.jcf.2015.03.006. Epub 2015 Mar 29., [PMID:25824995]

Abstract [show]
BACKGROUND: The Clinical and Functional Translation of CFTR project (CFTR2) classified some cystic fibrosis transmembrane conductance regulator (CFTR) gene variants as non-cystic fibrosis (CF)-causing. To evaluate this, the clinical status of children carrying these mutations was examined. METHODS: We analyzed CF disease-defining variables over 2-6 years in two groups of California CF screen- positive neonates born from 2007 to 2011: (1) children with two CF-causing variants and (2) children with one CF-causing and one non-CF-causing variant, as defined by CFTR2. RESULTS: Children carrying non-CF-causing variants had significantly higher birth weight, lower immunoreactive trypsinogen and sweat chloride values, higher first year growth curves, and a lower rate of persistent Pseudomonas aeruginosa colonization compared to children with two CF-causing variants. CONCLUSIONS: The outcomes in children 2-6 years of age with the L997F, G576A, R1162L, V754M, R668C, R31C, and S1235R variants are consistent with the CFTR2 non-CF-causing classification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 In another example, the combination of R117L and L997F on the same allele causes a more severe phenotype than L997F alone, though this combination was not observed in this study [23]. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
294 The [R117L;L997F] (p. Login to comment
295 [Arg117Leu; Leu997Phe]) complex allele (28) was found in 6 patients (1 CF-PI and 5 CF-PS). Login to comment
298 The R117L (p.Arg117Leu) was only found in the complex allele. Login to comment
299 The L997F (p.Leu997Phe), with no R117L (p.Arg117Leu) in cis, was found in 13 patients (2 CF-PS, 8 CFTR-RD and 3 CBAVD). Login to comment
366 [227_228insT;1210-14TG[12];1210-12T[5]] uncertain: CF-PI and/or CF-PS and/or CFTR-RD 359insT nd; T5 varying clinical consequence G85E c.254G>A CF-PI,CF-PS CF-causing p.Gly85Glu D110H c.328G>C CF-PS CF-causing p.Asp110His R117C c.349C>T CF-PS CF-causing p.Arg117Cys R117H c.350G>A CFTR-RD varying clinical consequence p.Arg117His [R117L;L997F] c. Login to comment
367 [350G>T;2991G>C] CF-PI,CF-PS R117L nd; L997F non CF-causing p. Login to comment
368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment
424 The three actually discrepant alleles were L997F (p.Leu997Phe), without the R117L (p.Arg117Leu) in cis, L206W (p.Leu206Trp) and T338I (p.Thr338Ile). Login to comment