ABCMdb

ABCC7 p.Leu1065Pro

Admin's notes:	Class II (maturation defect) Veit et al.
ClinVar:	c.3194T>C , p.Leu1065Pro D , Pathogenic c.3193C>T , p.Leu1065Phe ? , not provided c.3194T>G , p.Leu1065Arg ? , not provided
CF databases:	c.3194T>C , p.Leu1065Pro D , CF-causing ; CFTR1: This mutation was detected in a single French family. The patient is PS and has a mild pulmonary disease. She carries the [delta]F508 deletion on the second allele. The mutation creates a MnII restriction site. c.3193C>T , p.Leu1065Phe (CFTR1) D , This mutation was detected by DGGE and direct sequencing. L1065F was found once (1/ 500chromosomes) in a male CF patient of Greek origin; his other CF mutation is [delta]F508. The patient is PI. c.3194T>G , p.Leu1065Arg (CFTR1) D , L1065R was observed by direct sequencing after detection of an abnormal DGGE pattern. The CF patient is a 6-year old girl with PI, carrying [delta]F508 mutation in the other chromosome.
Predicted by SNAP2:	A: D (91%), C: D (91%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (66%), K: D (95%), M: D (91%), N: D (95%), P: D (59%), Q: D (95%), R: D (53%), S: D (95%), T: D (95%), V: D (71%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: N, G: D, H: D, I: N, K: D, M: N, N: D, P: D, Q: D, R: D, S: D, T: D, V: N, W: D, Y: D,

[switch to compact view]
Comments [show]

II (maturation defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Detection of five rare cystic fibrosis mutations p... Clin Chem. 1999 Jul;45(7):957-62. Castaldo G, Fuccio A, Cazeneuve C, Picci L, Salvatore D, Raia V, Scarpa M, Goossens M, Salvatore F
Detection of five rare cystic fibrosis mutations peculiar to Southern Italy: implications in screening for the disease and phenotype characterization for patients with homozygote mutations.
Clin Chem. 1999 Jul;45(7):957-62., [PMID:10388469]

Abstract [show]
BACKGROUND: The search for the eight most frequent mutations (i.e., DeltaF508, G542X, W1282X, N1303K, 1717-1G-->A, R553X, 2183AA-->G, and I148T) by allele-specific oligonucleotide dot-blot analysis revealed 78% of 396 cystic fibrosis alleles in Southern Italy. The observation of frequent haplotypes on the unidentified cystic fibrosis alleles suggested that a few mutations could account for a large number of unidentified alleles. METHODS: We screened most of the coding sequence of the cystic fibrosis transmembrane regulator gene by denaturing gradient gel electrophoresis to determine the spectrum of these mutations in 68 unrelated cystic fibrosis patients bearing one or both unidentified mutations. RESULTS: The screening revealed five mutations, R1158X, 711+1G-->T, 4016insT, L1065P, and G1244E, each of which had a frequency of 1.3-1.8% (7% collectively). The 7% increase in the detection rate (85% vs 78%) reduces by >50% the residual risk of being cystic fibrosis carriers for couples who had tested negative by molecular analysis. We therefore designed a second allele-specific oligonucleotide set to analyze the five mutations. Among the patients analyzed, one patient homozygous for the L1065P mutation expressed a mild pulmonary and intestinal form of the disease with pancreatic insufficiency. Two other patients, homozygous for mutations R1158X and 4016insT, both expressed a severe cystic fibrosis phenotype. CONCLUSIONS: Five cystic fibrosis mutations are peculiar to patients from Southern Italy. The method described for their analysis is efficient, inexpensive, and can be semi-automated by use of a robotic workstation. The results obtained in patients from Southern Italy may have an impact on laboratories in other countries, given the large migrations of populations from Southern Italy to other countries in the last two centuries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 aso dot-blot procedure for the analysis of the five "rare" cf mutations To analyze routinely the five mutations (i.e., L1065P, 711ϩ1G3T, R1158X, 4016insT, and G1244E) we set up a procedure based on a single multiplex PCR amplification followed by ASO dot-blot hybridization. Login to comment
49 Mutation Forward primer (5؅) Reverse primer (3؅) Wild-type oligo for ASO dot blota Mutated oligo for ASO dot blota L1065P (exon 17b) 5ЈTTCAAAGAATGGCACCAGTGT 3ЈATAACCTATAGAATGCAGCA 5ЈATGGACACTTCGTGCCT (52 °C) 5ЈTGGACACCTCGTGCCT (52 °C) 4016insT (exon 21) 5ЈAATGTTCACAAGGGACTCCA 3ЈCAAAAGTACCTGTTGCTCCA 5ЈAGTATTTATTTTTTCTGGAAC (52 °C) 5ЈGTATTTATTTTTTTCTGGAAC (52 °C) 711ϩ1G3T (intron 5) 5ЈATTTCTGCCTAGATGCTGGG 3ЈAACTCCGCCTTTCCAGTTGT 5ЈTTGATGAAGTATGTACCTAT (52 °C) 5ЈTTTGATGAATTATGTACCTAT (52 °C) R1158X (exon 19) 5ЈGCCCGACAAATAACCAAGTGA 3ЈGCTAACATTGCTTCAGGCT 5ЈTTCAGATGCGATCTGTGA (52 °C) 5ЈTTTCAGATGTGATCTGTGA (52 °C) G1244E (exon 20) 5ЈGGTCAGGATTGAAAGTGTGCA 3ЈCTATGAGAAAACTGCACTGGA 5ЈCCTCTTGGGAAGAACTGGA (53 °C) 5ЈCCTCTTGGAAAGAACTGGA (51 °C) a For each oligonucleotide, the optimal washing temperature of the filter is reported. Login to comment
53 Results The DGGE screening allowed us to identify 20 different mutations; five of these, i.e., R1158X, G1244E, 4016insT, 711ϩ1G3T, and L1065P, were observed with a frequency Ͼ1.0% among 396 CF alleles from Southern Italy. Login to comment
55 The homozygote (Fig. 1A) and heterozygote (Fig. 1B) patterns of exon 17b are clearly altered; sequence analysis revealed the L1065P mutation. Login to comment
57 The incidence of the L1065P mutation in our series of 396 CF chromosomes was 1.3%. Login to comment
58 One patient homozygous for L1065P showed a mild pulmonary and gastrointestinal form of CF, with a moderate pancreatic insufficiency and mild liver involvement. Login to comment
70 The sequence analysis revealed the L1065P mutation. Login to comment
87 An example of the improved ASO dot-blot procedure used to analyze the five mutations is shown in Fig. 3 for R1158X (Fig. 3A), L1065P (Fig. 3B), 4016insT (Fig. 3C), 711ϩ1G3T (Fig. 3D), and G1244EG3A (Fig. 3E). Login to comment
97 Mutation L1065P has been reported in ϳ3% of CF chromosomes (24) from Sicily (Southern Italy). Login to comment
107 Genotype 4016insT/4016insT R1158X/R1158X L1065P/L1065P Ethnic origin Southern Italy Southern Italy Southern Italy Present age 23 years Death at 20 years 18 years Age at diagnosis 2 years 3 months 1 year Meconium ileus No No No Nasal polyposis No No No Lung involvement Severe Very severe Mild FEV 1, % of predicted 38 18 62 Liver involvement Cholestasis Moderate Mild Pancreatic insufficiency Moderate Moderate Moderate Sweat chloride 70 mEq/L 98 mEq/L 93 mEq/L Table 3. Login to comment
109 CF mutation XV2c KM19 IVS18CA IVS17bTA IVS17bCA M470V R1158X 1 2 16 7 17 M L1065P 1 1 16 30 13 V 711ϩ1G3T 1 1 16 25 13 V 4016insT 2 1 16 30 13 V G1244EG3T 1 1 16 34 13 V showed haplotype 2, 2, 16, 45, 13, suggesting the recurrent origin of the mutation or a recombinant event (18, 22). Login to comment
129 The patient homozygous for R1158X (a nonsense mutation) and the patient homozygous for 4016insT (a frameshift mutation) showed very severe expression of CF (because the synthesis of the wild-type protein was suppressed) compared with the patient homozygous for L1065P, a missense mutation associated with the synthesis of a protein with a single amino acid substitution. Login to comment
135 For R1158X (A) and L1065P (B), 1 and 2 are heterozygotes for the mutation, 3 is a homozygote for the mutation, and 4 is a healthy control. Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
110 Germany ∆F508 (71.8%) 1789+5G→A (0.9%) 87.6 76.7 17 5662/1316 Dörk et al. [1992]; Dörk et al. R553X (2.0%) 3272-26A→G (0.9%) [1994]; Tümmler et al. [1996]; N1303K (1.8%) W1282X (0.7%) Estivill et al. [1997]; Dörk et G542X (1.2%) 2143delT (0.7%) al. [2000] R347P (1.2%) 1078delT (0.6%) CFTRdele2,3 (1.2%) 2183AA→G (0.6%) 3849+10KbC→T (1.0%) 2184insA (0.6%) G551D (0.9% 3659delC (0.6%) 1717-1G→A (0.9%) Greece ∆F508 (52.9%) 3272-26A→G (0.8%) 82.2 67.6 22 2097/718 Kanavakis et al. [1995]; Estivill 621+1G→T (5.0%) R1070Q (0.8%) et al. [1997]; Tzetis et al. G542X (4.1%) W496X (0.7%) [1997]; Macek et al. [2002] N1303K (3.3%) 621+3A→G (0.7%) 2183AA→G (1.8%) ∆I507 (0.7%) 2789+5G→A (1.7%) W1282X (0.7%) E822X (1.6%) 574delA (0.7%) R117H (1.2%) 1677delTA (0.7%) R334W (1.1%) A46D (0.6%) R1158X (1.0%) 3120+1G→A (0.6%) G85E (1.0%) G551D (0.5%) Hungary ∆F508 (54.9%) W1282X (1.8%) 68.3 46.6 9 1133/976 CFGAC [1994]; Estivill et al. 1717-1G→A (1.9%) G542X (1.7%) [1997]; Macek et al. [2002] R553X (2.1%) N1303K (1.3%) Y1092X (1.8%) G551D (1.0%) S1196X (1.8%) Ireland ∆F508 (70.4%) G542X (1.0%) 82.1 67.4 7 801/509 CFGAC [1994]; Estivill et al. G551D (5.7%) 621+1G→T (0.8%) [1994] R117H (2.4%) 1717-1G→A (0.6%) R560T (1.2%) Italy ∆F508 (50.9%) ∆I507 (0.65%) 60.3 36.4 9 3524 Estivill et al. [1997] (total) G542X (3.1%) W1282X (0.62%) 1717-1G→A (1.6%) Y122K (0.59%) N1303K (1.4%) G551D (0.53%) R553X (0.94%) Italy ∆F508 (47.6%) R553X (1.3%) 87.1 75.9 15 225 Bonizzato et al. [1995] (Northeast) R1162X (9.8%) 2789+G→A (1.3%) 2183AA→G (9.3%) Q552X (1.3%) N1303K (4.0%) 621+1G→T (0.9%) G542X (2.7%) W1282X (0.9%) 711+5G→A (2.7%) 3132delTG (0.9%) 1717-1G→A (2.2%) 2790-2A→G (0.9%) G85E (1.3%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS583 Italy ∆F508 (56.4%) 711+1G→T (1.3%) 85.7 73.4 13 660/396 Castaldo et al. [1996]; Castaldo (southern) N1303K (6.8%) G1244E (1.3%) et al. [1999] G542X (5.7%) R1185X (1.3%) W1282X (3.8%) L1065P (1.3%) 1717-1G→A (2.3%) R553X (1.1%) 2183AA→G (1.9%) I148T (0.7%) 4016insT (1.8%) Latvia 1) DF508 (58.3%) 4) CFTRdele2,3 (2.8%) - - 6 36 Dörk et al. [2000]; Macek et al. 2) 3849+10KbC®T (8.3%) 5) W1282X (2.8%) [2002] 3) N1303K (5.6%) 6) 394delTT (2.8%) Lithuania ∆F508 (31.0%) N1303K (2.0%) 39.0 15.2 4 94 Dörk et al. [2000]; Macek et al. R553X (4.0%) CFTRdele2,3 (2.0%) [2002] Macedonia ∆F508 (54.3%) 711+3A→G (1.0%) 69.2 47.9 12 559/226 Petreska et al. [1998]; Dörk et G542X (4.2%) 3849G→A (1.0%) al. [2000]; Macek et al. N1303K (2.0%) 2184insA (0.9%) [2002] CFTRdele2,3 (1.3%) 457TAT→G (0.7%) 621+1G→T (1.3%) V139E (0.7%) 611-1G→T (1.2%) 1811+1G→C (0.6%) Netherlands ∆F508 (74.2%) R1162X (0.9%) 86.8 75.3 9 3167/1442 Gan et al. [1995]; Estiville et al. A455E (4.7%) S1251N (0.9%) [1997]; Collee et al. [1998] G542X (1.8%) N1303K (0.9%) 1717-1G→A (1.5%) W1282X (0.7%) R553X (1.2%) Norway ∆F508 (60.2%) G551D (1.2%) 69.8 48.7 6 410/242 Schwartz et al. [1994]; Estivill 394delTT (4.2%) G542X (0.6%) et al. [1997] R117H (3.0%) N1303K (0.6%) Poland ∆F508 (57.1%) CFTRdele2,3 (1.8%) 73.5 54.0 11 4046/1726 CFGAC [1994]; Estivill et al. 3849+10Kb C→T (2.7%) R560T (1.5%) [1997]; Dörk et al [2000]; G542X (2.6%) W1282X (0.7%) Macek et al. [2002] 1717-1G→A (2.4%) ∆I507 (0.5%) R553X (1.9%) G551D (0.5%) N1303K (1.8%) Portugal ∆F508 (44.7%) R334W (0.7%) 49.7 24.7 5 739/454 CFGAC [1994]; Estivill et al. G542X (1.6%) N1303K (0.7%) [1997] R1066C (2.0%) Romania ∆F508 (36.6%) G542X (1.4%) 51.5 26.5 11 224/74 CFGAC [1994]; Estivill et al. 2043delG (2.0%) R553X (1.4%) [1997]; Popa et al. [1997]; W1282X (1.7%) G576X (1.4%) Macek et al. [2002] 1717-2A→G (1.4%) 1898+1G→A (1.4%) I148T (1.4%) 2183AA→G (1.4%) 621+1G→T (1.4%) Russia ∆F508 (54.4%) 552insA (0.9%) 70.7 50.0 12 5073/2562 CFGAC [1994]; Estivill et al. CFTRdele2,3 (5.0%) G542X (0.9%) [1997]; Dörk et al. [2000]; R553X (3.5%) R334W (0.9%) Macek et al. [2002] 2183AA→G (1.3%) 1677delTA (0.8%) W1282X (1.0%) Y122X (0.5%) 394delTT (1.0%) 1367del5 (0.5%) (Continued) BOBADILLAETAL. Login to comment

[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 These mutations included S4X (143 C to A), exon 1; S42F (257 C to T), exon 2; R117L (482 G to T), exon 4; S549R (1779 T to G), exon 11; 3667ins4, exon 19; A1006E (3149 C to A), exon17a; L1065P (3326 T to C), R1066C (3328 C to T), L1077P (3362 T to C), exon 17b. Login to comment
70 The microdeletion 4167delCTAAGCC in exon 22 was identified by DHPLC analysis in a CF patient who presents the L1065P (3326 T to C) mutation on the maternal chromosome. Login to comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

[hide] Genotype/phenotype correlation of the G85E mutatio... Eur Respir J. 2004 May;23(5):679-84. Decaestecker K, Decaestecker E, Castellani C, Jaspers M, Cuppens H, De Boeck K
Genotype/phenotype correlation of the G85E mutation in a large cohort of cystic fibrosis patients.
Eur Respir J. 2004 May;23(5):679-84., [PMID:15176679]

Abstract [show]
In this European study, the phenotype in 68 patients, homozygous or compound heterozygous for the G85E mutation, was investigated. Each index case was compared with two cystic fibrosis (CF) patients from the same clinic, matched for age and sex: one with pancreatic sufficiency (PS) and one with pancreatic insufficiency (PI). When comparing 31 G85E/F508del and F508del/F508del patients, there were no differences in median age at diagnosis, mean sweat chloride value, most recent weight for height, most recent forced expiratory volume in one second % predicted, prevalence of chronic Pseudomonas aeruginosa colonisation and typical CF complications. However, PI was less frequent in the G85E/F508del group. Comparison of 55 G85E patients (with second mutation known and not classified as mild) with PS controls (n=44) showed that the G85E patients had a significantly higher sweat chloride, more often failure to thrive at diagnosis, higher prevalence of PI, worse current weight for height, higher prevalence of chronic P. aeruginosa colonisation and liver cirrhosis. Pulse-chase experiments revealed that G85E cystic fibrosis transmembrane conductance regulator failed to mature on a M470 as well as on a V470 background. Therefore, G85E is a class II mutation. Although there is variability in its clinical presentation, G85E mutation results in a severe phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 - Cystic fibrosis transmembrane conductance regulator genotypes of patients in the three study groups G85E PI PS Genotype Subjects n Genotype Subjects n Genotype Subjects n G85E/F508del# 34 F508del# /F508del# 58 F508del# /unknown 15 G85E/unknown 8 F508del# /unknown 2 F508del# /3849z10 kbCRT} 5 G85E/G542X# 5 F508del# /1717-1GR A 1 F508del# /R117H} 3 G85E/W1282X# 4 F508del# /N1303K# 1 T338I/L1065P 2 G85E/I507del# 3 F508del*/H139R 1 E585X/3272-26ARG} 2 G85E/R1162X# 3 F508del# /R1066C # 1 2183AARG/2789z5GRA 2 G85E/2183AARG 2 F508del# /G542X# 1 F508del# /711z5GRA 1 G85E/G85E 1 F508del# /712-1GRT 1 F508del# /D1152H} 1 G85E/E585X# 1 F508del# /621z1GRT 1 F508del# /1898z3ARG 1 G85E/711z1GRT# 1 F508del# /1898z1 1 F508del# /R347H} 1 G85E/712-1GRT# 1 Total 68 F508del# /2789z5GRA 1 G85E/621z1GRT# 1 2789z5GRA/? Login to comment

[hide] Comprehensive cystic fibrosis mutation epidemiolog... Ann Hum Genet. 2005 Jan;69(Pt 1):15-24. Castaldo G, Polizzi A, Tomaiuolo R, Cazeneuve C, Girodon E, Santostasi T, Salvatore D, Raia V, Rigillo N, Goossens M, Salvatore F
Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population.
Ann Hum Genet. 2005 Jan;69(Pt 1):15-24., [PMID:15638824]

Abstract [show]
We screened the whole coding region of the cystic fibrosis transmembrane regulator (CFTR) gene in 371 unrelated cystic fibrosis (CF) patients from three regions of southern Italy. Forty-three mutations detected 91.5% of CF mutated chromosomes by denaturing gradient gel electrophoresis analysis, and three intragenic CFTR polymorphisms predicted a myriad of rare mutations in uncharacterized CF chromosomes. Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711 + 1G > T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Several mutations frequently found in northern Italy (e.g., R1162X, 711 + 5G > T) and northern Europe (e.g., G551D, I507del and 621 + 1G > T) are absent from the studied population. The I148T-3195del6 complex allele was present in two CF chromosomes, whereas I148T was present in both alleles (as a single mutation) in another CF patient and in five CF carriers; this could result from crossover events. The haplotype analysis of three intragenic polymorphisms (IVS8CA, IVS17bTA and IVS17bCA) compared with data from other studies revealed that several mutations (3849 + 10kbC > T, 1717-1G > A, E585X, 3272-26G > A, L558S, 2184insA and R347P) originated from multiple events, whereas others (R1158X and S549R) could be associated with one or more intragenic recombinant events. Given the large population migration from southern Italy, knowledge of the CF molecular epidemiology in this area is an important contribution to diagnosis, counselling and interlaboratory quality control for molecular laboratories worldwide.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711+1G>T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Login to comment
33 The 13 mutations in this panel are: F508del, N1303K, G542X, W1282X, 2183AA>G, 1717-1G>A, R553X, I148T, R1158X, 711+1G>T, 4016insT, L1065P and G1244E. Login to comment
49 In particular, 4016insT, R1158X, 711+1 G>T and L1065P had a cumulative frequency of 6.3% in CF chromosomes from Campania; G1244E and 852del22 a cumulative frequency of 9.6% in CF chromosomes from Basilicata; and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D a cumulative frequency of 19.6% in CF chromosomes from Puglia. Login to comment
52 We also identified three homozygotes for G542X, three for 852del22, two for 2183AA>G, and one each for N1303K, 1717-1G>A, 4016insT, R553X, R1158X and L1065P. Login to comment
62 A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n. Login to comment
85 Present study case (n) Mutation references* Haplotype (n. of repeats) Other studies case (n) W1282X 16 17-7-17 26 1, 2, 3 1259insA 11 16-33-13 852del22 11 16-33-13 4016insT 11 16-30-13 I502T 8 16-30-13 L1065P 4 16-30-13 2522insC 4 23-30-13 2789+5G>A 2 17-7-17 9 1, 2, 3 D1152H 2 16-7-13 2711delT 1 16-45-13 2 3 D110H 1 16-32-13 Y849X 1 16-30-13 * References: 1: Morral et al., 1996 2: Claustres et al., 1996 3: Hughes et al., 1996b peculiar to Sardinia, is absent in our population (Rendine et al. 1997). Login to comment
86 However, 12 mutations (4016insT, R1158X, 711+1G>T, L1065P, G1244E, 4382delA, 1259insA, I502T, 852del22, D579G, L1077P and G1349D) have not been found (or have a low incidence) in populations from the British Isles (Cheadle et al. 1993; Ferec et al. 1992), Spain (Chillon et al. 1994; Casals et al. Login to comment
89 Other mutations appear to have originated in southern Italy and their frequency has probably been amplified through consanguineous marriages; for instance, 852del22, L1065P and others were identified in homozygosity in several CF patients in whom the haplotypes for the three polymorphisms analyzed were also homozygous. Login to comment

[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]

Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]

Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T. Login to comment

[hide] The chemical chaperone CFcor-325 repairs folding d... Biochem J. 2006 May 1;395(3):537-42. Loo TW, Bartlett MC, Wang Y, Clarke DM
The chemical chaperone CFcor-325 repairs folding defects in the transmembrane domains of CFTR-processing mutants.
Biochem J. 2006 May 1;395(3):537-42., 2006-05-01 [PMID:16417523]

Abstract [show]
Most patients with CF (cystic fibrosis) express a CFTR [CF TM (transmembrane) conductance regulator] processing mutant that is not trafficked to the cell surface because it is retained in the endoplasmic reticulum due to altered packing of the TM segments. CL4 (cytoplasmic loop 4) connecting TMs 10 and 11 is a 'hot-spot' for CFTR processing mutations. The chemical chaperone CFcor-325 (4-cyclohexyloxy-2-{1-[4-(4-methoxy-benezenesulphonyl)piperazin-1-yl]-ethy l}-quinazoline) rescued most CL4 mutants. To test if CFcor-325 promoted correct folding of the TMDs (TM domains), we selected two of the CL4 mutants (Q1071P and H1085R) for disulphide cross-linking analysis. Pairs of cysteine residues that were cross-linked in mature wild-type CFTR were introduced into mutants Q1071P and H1085R. The cross-linking patterns of the Q1071P or H1085R double cysteine mutants rescued with CFcor-325 were similar to those observed with mature wild-type double cysteine proteins. These results show that CFcor-325 rescued CFTR mutants by repairing the folding defects in the TMDs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 EXPERIMENTAL Construction and expression of mutants The cDNAs of wild-type and CL4 mutants (H1054D, G1061R, L1065P, R1066H, Q1071P, L1077P, H1085R and W1098R) were inserted into pcDNA3 vector (Invitrogen, Oakville, ON, Canada) as described previously [2]. Login to comment
51 Accordingly, HEK-293 cells were transfected with mutants H1054D, G1061R, L1065P, R1066H, Q1071P, L1077P, H1085R or W1098R cDNAs. Login to comment
62 Mutant L1065P was the only mutant that could not be rescued with CFcor-325 (Figure 2B). Login to comment

[hide] Misfolding of the cystic fibrosis transmembrane co... Biochemistry. 2008 Feb 12;47(6):1465-73. Epub 2008 Jan 15. Cheung JC, Deber CM
Misfolding of the cystic fibrosis transmembrane conductance regulator and disease.
Biochemistry. 2008 Feb 12;47(6):1465-73. Epub 2008 Jan 15., 2008-02-12 [PMID:18193900]

Abstract [show]
Understanding the structural basis for defects in protein function that underlie protein-based genetic diseases is the fundamental requirement for development of therapies. This situation is epitomized by the cystic fibrosis transmembrane conductance regulator (CFTR)-the gene product known to be defective in CF patients-that appears particularly susceptible to misfolding when its biogenesis is hampered by mutations at critical loci. While the primary CF-related defect in CFTR has been localized to deletion of nucleotide binding fold (NBD1) residue Phe508, an increasing number of mutations (now ca. 1,500) are being associated with CF disease of varying severity. Hundreds of these mutations occur in the CFTR transmembrane domain, the site of the protein's chloride channel. This report summarizes our current knowledge on how mutation-dependent misfolding of the CFTR protein is recognized on the cellular level; how specific types of mutations can contribute to the misfolding process; and describes experimental approaches to detecting and elucidating the structural consequences of CF-phenotypic mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
90 In some additional examples, a number of mutations found in the fourth intracellular loop (H1054D, G1061R, L1065P, R1066C/H/L, Q1071P, L1077P, H1085R, W1098R, M1101K/ R) also affect the biosynthetic processing of CFTR (although function was not tested) (73); some intracellular loop 4 mutants (F1052V, K1060T, A1067T, G1069R, R1070Q/W) can process CFTR to the complex-glycosylated ("Band C") form but have altered channel activity compared to wild type. Login to comment

[hide] Phenylalanine-508 mediates a cytoplasmic-membrane ... Proc Natl Acad Sci U S A. 2008 Mar 4;105(9):3256-61. Epub 2008 Feb 27. Serohijos AW, Hegedus T, Aleksandrov AA, He L, Cui L, Dokholyan NV, Riordan JR
Phenylalanine-508 mediates a cytoplasmic-membrane domain contact in the CFTR 3D structure crucial to assembly and channel function.
Proc Natl Acad Sci U S A. 2008 Mar 4;105(9):3256-61. Epub 2008 Feb 27., 2008-03-04 [PMID:18305154]

Abstract [show]
Deletion of phenylalanine-508 (Phe-508) from the N-terminal nucleotide-binding domain (NBD1) of the cystic fibrosis transmembrane conductance regulator (CFTR), a member of the ATP-binding cassette (ABC) transporter family, disrupts both its folding and function and causes most cystic fibrosis. Most mutant nascent chains do not pass quality control in the ER, and those that do remain thermally unstable, only partially functional, and are rapidly endocytosed and degraded. Although the lack of the Phe-508 peptide backbone diminishes the NBD1 folding yield, the absence of the aromatic side chain is primarily responsible for defective CFTR assembly and channel gating. However, the site of interdomain contact by the side chain is unknown as is the high-resolution 3D structure of the complete protein. Here we present a 3D structure of CFTR, constructed by molecular modeling and supported biochemically, in which Phe-508 mediates a tertiary interaction between the surface of NBD1 and a cytoplasmic loop (CL4) in the C-terminal membrane-spanning domain (MSD2). This crucial cytoplasmic membrane interface, which is dynamically involved in regulation of channel gating, explains the known sensitivity of CFTR assembly to many disease-associated mutations in CL4 as well as NBD1 and provides a sharply focused target for small molecules to treat CF. In addition to identifying a key intramolecular site to be repaired therapeutically, our findings advance understanding of CFTR structure and function and provide a platform for focused biochemical studies of other features of this unique ABC ion channel.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 The wild-type peptide bound strongly, whereas the two mutations (L1065P and R1066C) that prevent conformational maturation (24) reduced this binding to control levels (Fig. 2B). Login to comment
73 CL4 peptide was nearly completely ablated by a folding mutation (L1065P) but only slightly diminished by one influencing channel function (G1069R). Login to comment
86 (A) Location of disease-associated mutations (L1065P, R1066C, and G1069R) at the NBD1/CL4 interface. Login to comment

[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT. Login to comment

[hide] Restoration of domain folding and interdomain asse... FASEB J. 2010 Aug;24(8):3103-12. Epub 2010 Mar 16. He L, Aleksandrov LA, Cui L, Jensen TJ, Nesbitt KL, Riordan JR
Restoration of domain folding and interdomain assembly by second-site suppressors of the DeltaF508 mutation in CFTR.
FASEB J. 2010 Aug;24(8):3103-12. Epub 2010 Mar 16., [PMID:20233947]

Abstract [show]
Deletion of PHE508 (DeltaF508) from the first nucleotide-binding domain (NBD1) of CFTR, which causes most cystic fibrosis, disrupts the folding and assembly of the protein. Although the folding pathways and yield of isolated NBD1 are altered, its global structure is not, and details of the changes in the rest of the protein remain unclear. To gain further insight into how the whole mutant protein is altered, we have determined the influence of known second-site suppressor mutations in NBD1 on the conformation of this domain and key interfaces between domains. We found that the suppressors restored maturation of only those processing mutations located in NBD1, but not in other domains, including those in the C-terminal cytoplasmic loop of the second membrane-spanning domain, which forms an interface with the NBD1 surface. Nevertheless, the suppressors promoted the formation of this interface and others in the absence of F508. The suppressors restored maturation in a DeltaF508 construct from which NBD2 was absent but to a lesser extent than in the full-length, indicating that DeltaF508 disrupts interactions involving NBD2, as well as other domains. Rescue of DeltaF508-CFTR by suppressors required the biosynthesis of the entire full-length protein in continuity, as it did not occur when N- and C-terminal "halves" were coexpressed. Simultaneous with these interdomain perturbations, DeltaF508 resulted in suppressor reversed alterations in accessibility of residues both in the F508-containing NBD1 surface loop and in the Q loop within the domain core. Thus, in the context of the full-length protein, DeltaF508 mutation causes detectable changes in NBD1 conformation, as well as interdomain interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Therefore, we tested whether the suppressor mutations could also reverse the processing defects caused by disease-associated mutations (R1066C and L1065P; ref. 24) on the CL4 side of the NBD1/CL4 interface. Login to comment
98 Introduction of the 4S mutations into R1066C or the 3S mutations into L1065P did not promote CFTR maturation (Fig. 1B). Login to comment

[hide] Identification of the second CFTR mutation in pati... Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26. Giuliani R, Antonucci I, Torrente I, Grammatico P, Palka G, Stuppia L
Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols.
Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26., [PMID:20657600]

Abstract [show]
Congenital bilateral absence of vas deferens (CBAVD) is a manifestation of the mildest form of cystic fibrosis (CF) and is characterized by obstructive azoospermia in otherwise healthy patients. Owing to the availability of assisted reproductive technology, CBAVD patients can father children. These fathers are at risk of transmitting a mutated allele of the CF transmembrane conductance regulator (CFTR) gene, responsible for CF, to their offspring. The identification of mutations in both CFTR alleles in CBAVD patients is a crucial requirement for calculating the risk of producing a child with full-blown CF if the female partner is a healthy CF carrier. However, in the majority of CBAVD patients, conventional mutation screening is not able to detect mutations in both CFTR alleles, and this difficulty hampers the execution of correct genetic counselling. To obtain information about the most represented CFTR mutations in CBAVD patients, we analysed 23 CBAVD patients, 15 of whom had a single CFTR mutation after screening for 36 mutations and the 5T allele. The search for the second CFTR mutation in these cases was performed by using a triplex approach: (i) first, a reverse dot-blot analysis was performed to detect mutations with regional impact; (ii) next, multiple ligation-dependent probe amplification assays were conducted to search for large rearrangements; and (iii) finally, denaturing high-performance liquid chromatography was used to search for point mutations in the entire coding region. Using these approaches, the second CFTR mutation was detected in six patients, which increased the final detection rate to 60.8%.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] Intragenic suppressing mutations correct the foldi... J Biol Chem. 2010 Nov 19;285(47):36304-14. Epub 2010 Sep 13. Pagant S, Halliday JJ, Kougentakis C, Miller EA
Intragenic suppressing mutations correct the folding and intracellular traffic of misfolded mutants of Yor1p, a eukaryotic drug transporter.
J Biol Chem. 2010 Nov 19;285(47):36304-14. Epub 2010 Sep 13., 2010-11-19 [PMID:20837481]

Abstract [show]
ATP-binding cassette (ABC) transporters play pivotal physiological roles in substrate transport across membranes, and defective assembly of these proteins can cause severe disease associated with improper drug or ion flux. The yeast protein Yor1p is a useful model to study the biogenesis of ABC transporters; deletion of a phenylalanine residue in the first nucleotide-binding domain (NBD1) causes misassembly and retention in the endoplasmic reticulum (ER) of the resulting protein Yor1p-DeltaF670, similar to the predominant disease-causing allele in humans, CFTR-DeltaF508. Here we describe two novel Yor1p mutants, G278R and I1084P, which fail to assemble and traffic similar to Yor1p-DeltaF670. These mutations are located in the two intracellular loops (ICLs) that interface directly with NBD1, and thus disrupt a functionally important structural module. We isolated 2 second-site mutations, F270S and R1168M, which partially correct the folding injuries associated with the G278R, I1084P, and DeltaF670 mutants and reinstate their trafficking. The position of both corrective mutations at the cytoplasmic face of a transmembrane helix suggests that they restore biogenesis by influencing the behavior of the transmembrane domains rather than by direct restoration of the ICL1-ICL4-NBD1 structural module. Given the conserved topology of many ABC transporters, our findings provide new understanding of functionally important inter-domain interactions and suggest new potential avenues for correcting folding defects caused by abrogation of those domain interfaces.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 We selected two mutations (G149R, located at the start of ICL1, and L1065P, located in ICL4 and predicted to participate directly in the NBD1-ICL4 interface) and introduced the equivalent mutations into Yor1p (Fig. 1A): Yor1p-G278R and Yor1p-I1084P, respectively. Login to comment

[hide] Preconceptional identification of cystic fibrosis ... J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22. Coiana A, Faa' V, Carta D, Puddu R, Cao A, Rosatelli MC
Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program.
J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22., [PMID:21429822]

Abstract [show]
BACKGROUND: In Sardinia the mutational spectrum of CFTR gene is well defined. A mutation detection rate of 94% can be achieved by screening for 15 CFTR mutations with a frequency higher than 0.5%. The efficiency of this molecular test suggests that Sardinians may represent a suitable population for a preconceptional screening. METHODS: Five hundred couples of Sardinia descent were screened for 38 mutations using a semi-automated reverse-dot blot and PCR-gel electrophoresis assays. This mutation panel included the 15 most frequent CF alleles in Sardinia. RESULTS: We identified 38 CF carriers, revealing an overall frequency of 1/25 (4%). The most common CF allele was the p.Thr338Ile (T338I) (65%), followed by the p.Phe508del (F508del) (22.5%). We also identified one couple at risk and an asymptomatic female homozygote for the p.Thr338Ile allele. CONCLUSIONS: In spite of the low number of the couples tested, the results herein reported demonstrate the efficacy and efficiency of the preconceptional screening program and the high participation rate of the Sardinian population (99%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 Mutation nomenclaturea Alleles (%) T338I (p.Thr338Ile) 26 (65.0) F508del (p.Phe508del) 9 (22.5) N1303K (p.Asn1303Lys) 1 (2.5) 2183AANG (c.2051_2052delAAinsG) 1 (2.5) 621+1GNT (c.489+1GNT) 1 (2.5) exon 2 del (c.54-5811_164+2187del8108ins182) 1 (2.5) R347P (p.Arg347Pro) 1 (2.5) The 3849+10kbCNT (c.3717+12191CNT), G85E (p.Gly85Glu), 2789+5GNA (c.2657+5GNA), W1282X (p.Trp1282X), G1244E (p.Gly1244Glu), 711+5GNA (c.579+5GNA), 711+1GNT (c.579+1GNA), 4016insT (p.Ser1297PhefsX5), G542X (p.Gly542X), 1717-1GNA (c.1585-1GNA), R553X (p.Arg553X), Q552X (p.Gln552X), G551D (p.Gly551Asp), S549R (ANC) (p.Ser549Arg), I507del (p.Ile507del), F508C (p.Phe508Cys), I502T (p.Ile502Thr), 1706del17 (p.Gln525LeufsX37), 1677delTA (p.Tyr515X), R117H (p.Arg117His), D1152H (p.Asp1152His), L1065P (p.Leu1065Pro), R1066H (p.Arg1066His), L1077P (p.Leu1077Pro), 4382delA (p.Glu1418ArgfsX14), R1162X (p.Arg1162X), R1158X (p.Arg1158X), 1259 insA (p.Gln378AlafsX4), 852del22 (p.Gly241GlufsX13), S912X (p.Ser912X), and 991del5bp (p.Asn287LysfsX19) mutations included in the CF panel were not detected in the population tested. Login to comment

[hide] The W232R suppressor mutation promotes maturation ... Biochemistry. 2011 Feb 8;50(5):672-85. Epub 2011 Jan 11. Loo TW, Bartlett MC, Clarke DM
The W232R suppressor mutation promotes maturation of a truncation mutant lacking both nucleotide-binding domains and restores interdomain assembly and activity of P-glycoprotein processing mutants.
Biochemistry. 2011 Feb 8;50(5):672-85. Epub 2011 Jan 11., 2011-02-08 [PMID:21182301]

Abstract [show]
ATP-binding cassette (ABC) proteins contain two nucleotide-binding domains (NBDs) and two transmembrane (TM) domains (TMDs). Interdomain interactions and packing of the TM segments are critical for function, and disruption by genetic mutations contributes to disease. P-glycoprotein (P-gp) is a useful model to identify mechanisms that repair processing defects because numerous arginine suppressor mutations have been identified in the TM segments. Here, we tested the prediction that a mechanism of arginine rescue was to promote intradomain interactions between TM segments and restore interdomain assembly. We found that suppressor W232R(TM4/TMD1) rescued mutants with processing mutations in any domain and restored defective NBD1-NBD2, NBD1-TMD2, and TMD1-TMD2 interactions. W232R also promoted packing of the TM segments because it rescued a truncation mutant lacking both NBDs. The mechanism of W232R rescue likely involved intradomain hydrogen bond interactions with Asn296(TM5) since only N296A abolished rescue by W232R and rescue was only observed when Trp232 was replaced with hydrogen-bonding residues. In TMD2, suppressor T945R(TM11) also promoted packing of the TM segments because it rescued the truncation mutant lacking the NBDs and suppressed formation of alternative topologies. We propose that T945R rescue was mediated by interactions with Glu875(TM10) since T945E/E875R promoted maturation while T945R/E875A did not.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
122 In a recent study of four of the CFTR suppressor mutations located in NBD1 (I539T, G550E, R553M, and R555K), it was found that they only restored maturation of mutants that had processing mutations in NBD1 but not those that had processing mutations in other domains such as NBD2 (N1303K) or TMD2 (L1065P or R1066C) (66). Login to comment

[hide] The use of DHPLC (Denaturing High Performance Liqu... J Prenat Med. 2010 Jul;4(3):45-8. Mesoraca A, Di Natale M, Cima A, Di Giacomo G, Sarti M, Barone MA, Bizzoco D, Cignini P, Mobili L, D'emidio L, Giorlandino C
The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis.
J Prenat Med. 2010 Jul;4(3):45-8., [PMID:22439061]

Abstract [show]
OBJECTIVE: The aim of the study is to evaluate the role of Denaturing High Performance Liquid Chromatography (DHPLC) in the second level screening of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene. METHODS: A 9-month prospective study, between June 2008 and March 2009 at Artemisia Fetal Medical Centre, included 3829 samples of amniotic fluid collected from women undergoing mid-trimester amniocentesis.The genetic diagnosis of CF was based on research of the main mutations of the CFTR gene on fetal DNA extracted from the amniocytes, (first level screening) using different commercial diagnostic systems. A second level screening using DHPLC, on the amniotic fluid and on a blood sample from the couple, was offered in case of fetuses heterozygous at first level screening. RESULTS: Of 3829 fetuses, 134 were found to be positive, 129 heterozygous and 5 affected. Of the 129 couples, following appropriate genetic counselling, 53 requested a second level screening. Through the use of DHPLC, 44 couples were found to be negative, and in nine couples, nine rare mutations were identified. CONCLUSIONS: The first level screening can be useful to evidence up to 75% of the CF mutations. The second level screening can identify a further 10% of mutant alleles. DHPLC was found to be a reliable and specific method for the rapid identification of the rare CFTR mutations which were not revealed in initial first level screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Through the use of DHPLC, all the exonic regions of the CFTR gene were analysed and through the technique 44 of the 53 couples were found to be negative, while for 9 couples, 9 rare mutations were identified which were not revealed in I level screening: R1066C, L1065P, L1077P (exon 17b), A1006E (exon 19), R75Q (exon 3), D537E (exon 11), W1134X (exon 18), R1145X (exon 18), C524X (exon 11). Login to comment
100 48 Journal of Prenatal Medicine 2010; 4 (3): 45-50 Table III Mutations found with II level screening through DHPLC Mutations of mutated alleles DF508 29 W1282X 3 N1303K 8 1717-1G®A 2 3659delC 1 G85E 1 2789 +5G®A 2 R553X 2 R1162X 1 R117H 1 G542X 3 Total 53Table I Mutations found through I level screeningMutations analysed with I level screening through OLA CFTR Mutations Position on the CFTR gene DF508 Exon 10 3849+10KbC®T Intron 19 R334W Exon 7 W1282X Exon 10 V520F Exon 10 3905insT Exon 20 N1303K Exon 21 3876delA Exon 20 1717-1G®A Exon 11 3659delC Exon 19 DI507 Exon 10 A455E Exon 9 G85E Exon 3 2789 +5G®A Exon 14 / Intron 14 2183AA®G Exon 13 1898+1G®A Exon 12 / Intron 12 R347P Exon 7 R347H Exon 7 R560T Exon 11 1078delT Exon 7 R553X Exon 11 711+1G®T Exon 5 / Intron 5 G551D Exon 11 R1162X Exon 19 S549R Exon 11 R117H Exon 4 S549N Exon 11 621+1G®T Exon 4 G542X Exon 11 394delTT Exon 3 3120+1G®ðA Exon 16/ Intron 16 2184delA Exon 13 Table II Mutations found through I level screening Mutations Positions on CFTR gene R1066C Exon 17 b L1065P Exon 17 b A1006E Exon 19 R75Q Exon 3 D537E Exon 11 W1134X Exon 18 W1145X Exon 18 L1077P Exon 17b C524X Exon 11 Total 9 The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis Journal of Prenatal Medicine 2010; 4 (3): 45-50 49 tion was to provide the couple with adequate counselling in order to better understand the genotype-phenotype correlation in the various associations of mutations. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 f 306insA, W79X, R117C, P205S, L227R, I336K, 1248+1G>A, 1609delCA, 1717-8G>A, S549R(T>G), S549N, 1812-1G>A, P574H, 2176insC, R709X, E827X, D836Y, 3007delG, L1065P, L1077P, H1085R, M1101K, 4021insT. Login to comment

[hide] Effect of cystic fibrosis-associated mutations in ... J Biol Chem. 1996 Aug 30;271(35):21279-84. Cotten JF, Ostedgaard LS, Carson MR, Welsh MJ
Effect of cystic fibrosis-associated mutations in the fourth intracellular loop of cystic fibrosis transmembrane conductance regulator.
J Biol Chem. 1996 Aug 30;271(35):21279-84., [PMID:8702904]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) contains multiple membrane spanning sequences that form a Cl- channel pore and cytosolic domains that control the opening and closing of the channel. The fourth intracellular loop (ICL4), which connects the tenth and eleventh transmembrane spans, has a primary sequence that is highly conserved across species, is the site of a preserved sequence motif in the ABC transporter family, and contains a relatively large number of missense mutations associated with cystic fibrosis (CF). To investigate the role of ICL4 in CFTR function and to learn how CF mutations in this region disrupt function, we studied several CF-associated ICL4 mutants. We found that most ICL4 mutants disrupted the biosynthetic processing of CFTR, although not as severely as the most common DeltaF508 mutation. The mutations had no discernible effect on the channel's pore properties; but some altered gating behavior, the response to increasing concentrations of ATP, and stimulation in response to pyrophosphate. These effects on activity were similar to those observed with mutations in the nucleotide-binding domains, suggesting that ICL4 might help couple activity of the nucleotide-binding domains to gating of the Cl- channel pore. The data also explain how these mutations cause a loss of CFTR function and suggest that some patients with mutations in ICL4 may have a milder clinical phenotype because they retain partial activity of CFTR at the cell membrane.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 For example, levels of mature F1052V were similar to wild-type, whereas L1065P, R1070Q, and H1085R were similar to ⌬F508 in that they produced little mature protein (Fig. 2, A and B). Login to comment
80 For example, levels of mature F1052V were similar to wild-type, whereas L1065P, R1070Q, and H1085R were similar to DF508 in that they produced little mature protein (Fig. 2, A and B). Login to comment

[hide] Disease-associated mutations in the fourth cytopla... J Biol Chem. 1996 Jun 21;271(25):15139-45. Seibert FS, Linsdell P, Loo TW, Hanrahan JW, Clarke DM, Riordan JR
Disease-associated mutations in the fourth cytoplasmic loop of cystic fibrosis transmembrane conductance regulator compromise biosynthetic processing and chloride channel activity.
J Biol Chem. 1996 Jun 21;271(25):15139-45., [PMID:8662892]

Abstract [show]
A cluster of 18 point mutations in exon 17b of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has been detected in patients with cystic fibrosis. These mutations cause single amino acid substitutions in the most C-terminal cytoplasmic loop (CL4, residues 1035-1102) of the CFTR chloride channel. Heterologous expression of the mutants showed that 12 produced only core-glycosylated CFTR, which was retained in the endoplasmic reticulum; the other six mutants matured and reached the cell surface. In some cases substitution of one member of pairs of adjacent residues resulted in misprocessing, whereas the other did not. Thus, the secondary structure of CL4 may contribute crucially to the proper folding of the entire CFTR molecule. Cyclic AMP-stimulated iodide efflux was not detected from cells expressing the misprocessed variants but was from the other six, indicating that their mutations cause relatively subtle channel defects. Consistent with this, these latter mutations generally are present in patients who are pancreatic-sufficient, while the processing mutants are mostly from patients who are pancreatic-insufficient. Single-channel patch-clamp analysis demonstrated that the processed mutants had the same ohmic conductance as wild-type CFTR, but a lower open probability, generally due to an increase in channel mean closed time and a reduction in mean open time. This suggests that mutations in CL4 do not affect pore properties of CFTR, but disrupt the mechanism of channel gating.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
129 C: छ, WT; छϩ, R1066C; E, H1054D; µ, L1065P; Ⅺ, control; Ç, G1061R, Q, R1066H; É, R1066L. Login to comment
135 C: L, WT; L 1, R1066C; E, H1054D; &#b5;, L1065P; M, control; &#c7;, G1061R, Q, R1066H; &#c9;, R1066L. Login to comment

[hide] Screening Young syndrome patients for CFTR mutatio... Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7. Friedman KJ, Teichtahl H, De Kretser DM, Temple-Smith P, Southwick GJ, Silverman LM, Highsmith WE Jr, Boucher RC, Knowles MR
Screening Young syndrome patients for CFTR mutations.
Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7., [PMID:7551394]

Abstract [show]
Young syndrome is characterized by obstructive azoospermia associated with chronic sinobronchial disease of an infectious nature, but normal sweat-gland and pancreatic function as well as normal nasal potential differences. Congenital bilateral absence of the vas deferens (CBAVD) in some patients arises from mutations within the cystic fibrosis (CF) transmembrane regulator (CFTR) gene. Because of some similarities between Young syndrome, CF, and CBAVD, we evaluated 13 patients with Young syndrome, including screening for more than 30 different mutations within the CFTR gene. The mean age of the patients was 43 yr (range, 32 to 50 yr), and all were of northern European extraction. The sweat chloride concentration was normal in all patients (mean = 29 mEq/L; range, 8 to 43 mEq/L). Most had intermittent bronchial and sinus infections, but none was chronically colonized with Staphylococcus aureus or Pseudomonas aeruginosa. The FEV1 was normal or only mildly reduced in most patients (mean = 74%; range, 48 to 100% predicted). Of 26 Young syndrome chromosomes, we identified one with the recognized CF mutation delta F508. The incidence of CFTR mutations (1 in 26) did not differ significantly from the expected carrier frequency in this population. In summary, it is unlikely that the typical Young syndrome patient has a clinical disease associated with CFTR mutation on both alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No. Login to comment

[hide] Prenatal diagnosis of cystic fibrosis: a case of t... Clin Chim Acta. 2000 Aug;298(1-2):121-33. Castaldo G, Martinelli P, Massa C, Fuccio A, Grosso M, Rippa E, Paladini D, Salvatore F
Prenatal diagnosis of cystic fibrosis: a case of twin pregnancy diagnosis and a review of 5 years' experience.
Clin Chim Acta. 2000 Aug;298(1-2):121-33., [PMID:10876009]

Abstract [show]
We performed prenatal diagnoses for cystic fibrosis in 32 high risk (1:4) couples (including a dizygotic pregnancy). Chorionic villi sampling did not cause abortion or fetal malformation in any case. The preliminary analysis of 9 short tandem repeats always excluded maternal contamination of the DNA extracted from chorionic villi and confirmed paternity. Twenty-two prenatal diagnoses were made by direct analysis of the mutations. In seven cases diagnosis was made by the analysis of intragenic polymorphisms; in three cases, we analyzed two extragenic polymorphisms. The prenatal diagnosis (including genetic counselling) was completed within 24 h from the sampling. Seven prenatal diagnoses revealed an affected fetus; all couples opted for therapeutic abortion. In 17 cases the fetus was heterozygote, and in seven cases it was non carrier of mutated alleles. In the twin pregnancy, mutations were DeltaF508/N1303K. Direct analysis of the DNA extracted from the two independent samples of chorionic villi revealed one fetus non carrier of mutated alleles and the other a carrier of the N1303K mutation. Analysis of the HPRT locus predicted both the fetuses as males. Furthermore, the genotype of each fetus was defined after birth. The prenatal diagnosis with chorionic villi sampling plays a key role in the prevention of cystic fibrosis. The laboratories must be equipped for both the direct analysis of mutations and for the analysis of a large number of polymorphisms. The preliminary analysis of short tandem repeats is recommended both to exclude maternal contamination and to confirm parentage.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 G, L1065P, 711 1 1G . Login to comment

[hide] A 96-well formatted method for exon and exon/intro... Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5. Lucarelli M, Narzi L, Piergentili R, Ferraguti G, Grandoni F, Quattrucci S, Strom R
A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene.
Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5., [PMID:16635477]

Abstract [show]
Full genotypic characterization of subjects affected by cystic fibrosis (CF) is essential for the definition of the genotype-phenotype correlation as well as for the enhancement of the diagnostic and prognostic value of the genetic investigation. High-sensitivity diagnostic methods, capable of full scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, are needed to enhance the significance of these genetic assays. A method for extensive sequencing of the CFTR gene was optimized. This method was applied to subjects clinically positive for CF and to controls from the general population of central Italy as well as to a single subject heterozygous for a mild mutation and with an uncertain diagnosis. Some points that are crucial for the optimization of the method emerged: a 96-well format, primer project and purification, and amplicon purification. The optimized method displayed a high degree of diagnostic sensitivity; we identified a subset of 13 CFTR mutations that greatly enhanced the diagnostic sensitivity of common methods of mutational analysis. A novel G1244R disease causing mutation, leading to a CF phenotype with pancreatic sufficiency but early onset of pulmonary involvement, was detected in the subject with an uncertain diagnosis. Some discrepancies between our results and previously published CFTR sequence were found.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 In this work, we found a limited subset of 13 mutations (not included in the PCR/OLA/SCS assay) in 7 CFTR exons, significantly improving the sensitivity of standard assays: D110H, R117C, and H139R (exon 4); R334L, T338I, and A349V (exon 7); S549R(A->C) (exon 11); Y849X (exon 14a); L997F (exon 17a); L1065P, R1066C, and L1077P (exon 17b); and G1244E (exon 20). Login to comment

[hide] Development of CFTR Structure. Front Pharmacol. 2012 Sep 6;3:162. doi: 10.3389/fphar.2012.00162. eCollection 2012. Patrick AE, Thomas PJ
Development of CFTR Structure.
Front Pharmacol. 2012 Sep 6;3:162. doi: 10.3389/fphar.2012.00162. eCollection 2012., [PMID:22973227]

Abstract [show]
Cystic fibrosis is a lethal genetic disease caused by lack of functional cystic fibrosis transmembrane conductance regulator (CFTR) proteins at the apical surface of secretory epithelia. CFTR is a multidomain protein, containing five domains, and its functional structure is attained in a hierarchical folding process. Most CF-causing mutations in CFTR, including the most common mutation, a deletion of phenylalanine at position 508 (DeltaF508), are unable to properly fold into this functional native three dimensional structure. Currently, no high-resolution structural information about full length CFTR exists. However, insight has been gained through examining homologous ABC transporter structures, molecular modeling, and high-resolution structures of individual, isolated CFTR domains. Taken together, these studies indicate that the prevalent DeltaF508 mutation disrupts two essential steps during the development of the native structure: folding of the first nucleotide binding domain (NBD1) and its later association with the fourth intracellular loop (ICL4) in the second transmembrane domain (TMD2). Therapeutics to rescue DeltaF508 and other mutants in CFTR can be targeted to correct defects that occur during the complex folding process. This article reviews the structural relationships between CFTR and ABC transporters and current knowledge about how CFTR attains its structure-with a focus on how this process is altered by CF-causing mutations in a manner targetable by therapeutics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
155 For instance, in the NBD-ICL4 interface, mutants in ICL4 including L1065P, R1066C, and A1067T alter trafficking and chloride channel function (Cotten et al., 1996; Seibert et al., 1996). Login to comment

[hide] Functional Rescue of F508del-CFTR Using Small Mole... Front Pharmacol. 2012 Sep 26;3:160. doi: 10.3389/fphar.2012.00160. eCollection 2012. Molinski S, Eckford PD, Pasyk S, Ahmadi S, Chin S, Bear CE
Functional Rescue of F508del-CFTR Using Small Molecule Correctors.
Front Pharmacol. 2012 Sep 26;3:160. doi: 10.3389/fphar.2012.00160. eCollection 2012., [PMID:23055971]

Abstract [show]
High-throughput screens for small molecules that are effective in "correcting" the functional expression of F508del-CFTR have yielded several promising hits. Two such compounds are currently in clinical trial. Despite this success, it is clear that further advances will be required in order to restore 50% or greater of wild-type CFTR function to the airways of patients harboring the F508del-CFTR protein. Progress will be enhanced by our better understanding of the molecular and cellular defects caused by the F508del mutation, present in 90% of CF patients. The goal of this chapter is to review the current understanding of defects caused by F508del in the CFTR protein and in CFTR-mediated interactions important for its biosynthesis, trafficking, channel function, and stability at the cell surface. Finally, we will discuss the gaps in our knowledge regarding the mechanism of action of existing correctors, the unmet need to discover compounds which restore proper CFTR structure and function in CF affected tissues and new strategies for therapy development.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Disease-causing mutations in the coupling helix of ICL4 that cause ER retention have been described (L1065P, R1066C, and G1069R), supporting the idea that this region mediates important interactions during folding (Mendoza et al., 2012). Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... PLoS One. 2013 Apr 17;8(4):e61176. doi: 10.1371/journal.pone.0061176. Print 2013. Schippa S, Iebba V, Santangelo F, Gagliardi A, De Biase RV, Stamato A, Bertasi S, Lucarelli M, Conte MP, Quattrucci S
Cystic fibrosis transmembrane conductance regulator (CFTR) allelic variants relate to shifts in faecal microbiota of cystic fibrosis patients.
PLoS One. 2013 Apr 17;8(4):e61176. doi: 10.1371/journal.pone.0061176. Print 2013., [PMID:23613805]

Abstract [show]
INTRODUCTION: In this study we investigated the effects of the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene variants on the composition of faecal microbiota, in patients affected by Cystic Fibrosis (CF). CFTR mutations (F508del is the most common) lead to a decreased secretion of chloride/water, and to mucus sticky secretions, in pancreas, respiratory and gastrointestinal tracts. Intestinal manifestations are underestimated in CF, leading to ileum meconium at birth, or small bowel bacterial overgrowth in adult age. METHODS: Thirty-six CF patients, fasting and under no-antibiotic treatment, were CFTR genotyped on both alleles. Faecal samples were subjected to molecular microbial profiling through Temporal Temperature Gradient Electrophoresis and species-specific PCR. Ecological parameters and multivariate algorithms were employed to find out if CFTR variants could be related to the microbiota structure. RESULTS: Patients were classified by two different criteria: 1) presence/absence of F508del mutation; 2) disease severity in heterozygous and homozygous F508del patients. We found that homozygous-F508del and severe CF patients exhibited an enhanced dysbiotic faecal microbiota composition, even within the CF cohort itself, with higher biodiversity and evenness. We also found, by species-specific PCR, that potentially harmful species (Escherichia coli and Eubacterium biforme) were abundant in homozygous-F508del and severe CF patients, while beneficial species (Faecalibacterium prausnitzii, Bifidobacterium spp., and Eubacterium limosum) were reduced. CONCLUSIONS: This is the first report that establishes a link among CFTR variants and shifts in faecal microbiota, opening the way to studies that perceive CF as a 'systemic disease', linking the lung and the gut in a joined axis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 Patient Sex Age (years) CFTR allele, = CFTR allele, R Criterion I(a) Criterion II (1 = severe, 0 = mild)(b) Pancreatic status(d) FEV1% BMI 1 M 17 F508del M1V 2 (1) 1 65 17.91 2 F 23 F508del Y569D 2 (1) 0 97 18.66 3 (s1)(c) F 20 P1013L F508del 2 (0) 0 87 18.67 4 M 11 F508del L997F (without R117L) 2 0 0 110 21.33 5 (s1)(c) M 11 P1013L F508del 2 (0) 0 100 23.14 6 M 8 R553X F508del 2 1 0 80 15.87 7 M 3 F508del unknown 2 (0) 0 nd nd 8 F 33 F508del F508del 1 1 1 73 18.61 9 M 10 F508del L1077P 2 1 0 94 19.79 10 M 9 F508del G542X 2 1 1 100 16.00 11 F 9 4167delCTAAGCC L1065P 3 nd 1 76 14.57 12 F 14 R117C (without (TG)12T5) F508del 2 0 0 94 18.44 13 F 11 F508del 991del5 2 1 1 109 17.80 14 M 42 (TG)12T5 F508del 2 0 0 106 23.78 15 (s2)(c) M 9 F508del F508del 1 1 1 82 15.45 16 M 10 F508del R347P 2 (0) 0 89 15.91 17 (s2)(c) F 6 F508del F508del 1 1 1 110 15.20 18 (s3)(c) M 39 2789+5G.A N1303K 3 nd 0 105 19.33 19 (s3)(c) F 41 2789+5G.A N1303K 3 nd 0 80 19.47 20 F 26 N1303K W1282X 3 nd 1 90 19.57 21 M 7 CFTRdele2,3 (21 kb) N1303K 3 nd 1 107 12.85 22 F 9 F508del L997F (without R117L) 2 0 0 113 25.21 23 M 7 P5L W1282X 3 nd 0 89 22.31 24 M 9 2789+5G.A F508del 2 (1) 1 97 15.60 25 F 2 F508del F508del 1 1 1 nd nd 26 F 32 N1303K N1303K 3 nd 1 107 21.22 27 M 14 L1065R T338I 3 nd 0 116 21.50 28 M 12 711+3A.G S549R(A.C) 3 nd 0 97 20.00 29 M 13 unknown R117H (without (TG)12T5) 3 nd 0 104 19.36 30 M 14 F508del G542X 2 1 1 84 21.87 31 F 13 F508del F508del 1 1 1 85 18.00 32 F 41 2789+5G.A N1303K 3 nd 1 84 21.08 33 F 21 L1065P F508del 2 (0) 0 62 18.29 34 F 50 D1152H F508del 2 (0) 0 63 23.74 35 M 29 F508del 2790-2A.G 2 (1) 0 92 24.46 36 F 45 unknown W1282X 3 nd 0 69 23.42 a (Hm = 1; Ht = 2; N = 3). Login to comment
62 Class I, II or III: G542X, W1282X, F508del, N1303K, L1065P, L1077P, Y569D, S549R(A.C). Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment

[hide] On the structural organization of the intracellula... Int J Biochem Cell Biol. 2014 Jul;52:7-14. doi: 10.1016/j.biocel.2014.01.024. Epub 2014 Feb 7. Moran O
On the structural organization of the intracellular domains of CFTR.
Int J Biochem Cell Biol. 2014 Jul;52:7-14. doi: 10.1016/j.biocel.2014.01.024. Epub 2014 Feb 7., [PMID:24513531]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is a multidomain membrane protein forming an anion selective channel. Mutations in the gene encoding CFTR cause cystic fibrosis (CF). The intracellular side of CFTR constitutes about 80% of the total mass of the protein. This region includes domains involved in ATP-dependent gating and regulatory protein kinase-A phosphorylation sites. The high-resolution molecular structure of CFTR has not yet been solved. However, a range of lower resolution structural data, as well as functional biochemical and electrophysiological data, are now available. This information has enabled the proposition of a working model for the structural architecture of the intracellular domains of the CFTR protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1378 Two mutations in ICL4, L1065P and R1066C, prevent correct CFTR maturation (Seibert et al., 1996; Cotten et al., 1996). Login to comment

[hide] Mechanisms of CFTR functional variants that impair... PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul. LaRusch J, Jung J, General IJ, Lewis MD, Park HW, Brand RE, Gelrud A, Anderson MA, Banks PA, Conwell D, Lawrence C, Romagnuolo J, Baillie J, Alkaade S, Cote G, Gardner TB, Amann ST, Slivka A, Sandhu B, Aloe A, Kienholz ML, Yadav D, Barmada MM, Bahar I, Lee MG, Whitcomb DC
Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.
PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul., [PMID:25033378]

Abstract [show]
CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
357 Moreover, a large ''hot spot`` region for natural CFTR mutations is located at the NBD1:ICL4 interface, involving (1) six ICL4 positions (H1054D, G1061R, L1065P, R1066H/R1066C, F1074L, and L1077P), which line the path followed by F508 during the MD1 conformational transition from its initial to its final position, and (2) seven positions in NBD1 (S492F, I507del, F508del, V520F, A559T, R560K/R560T, and A561E) (Fig. 7c). Login to comment

[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]

Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17]. Login to comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

[hide] Clinical expression of patients with the D1152H CF... J Cyst Fibros. 2015 Jul;14(4):447-52. doi: 10.1016/j.jcf.2014.12.012. Epub 2015 Jan 10. Terlizzi V, Carnovale V, Castaldo G, Castellani C, Cirilli N, Colombo C, Corti F, Cresta F, D'Adda A, Lucarelli M, Lucidi V, Macchiaroli A, Madarena E, Padoan R, Quattrucci S, Salvatore D, Zarrilli F, Raia V
Clinical expression of patients with the D1152H CFTR mutation.
J Cyst Fibros. 2015 Jul;14(4):447-52. doi: 10.1016/j.jcf.2014.12.012. Epub 2015 Jan 10., [PMID:25583415]

Abstract [show]
BACKGROUND: Discordant results were reported on the clinical expression of subjects bearing the D1152H CFTR mutation, and also for the small number of cases reported so far. METHODS: A retrospective review of clinical, genetic and biochemical data was performed from individuals homozygous or compound heterozygous for the D1152H mutation followed in 12 Italian cystic fibrosis (CF) centers. RESULTS: 89 subjects carrying at least D1152H on one allele were identified. 7 homozygous patients had very mild clinical expression. Over half of the 74 subjects compound heterozygous for D1152H and a I-II-III class mutation had borderline or pathological sweat test and respiratory or gastrointestinal symptoms; one third had pulmonary bacteria colonization and 10/74 cases had complications (i.e. diabetes, allergic bronchopulmonary aspergillosis, and hemoptysis). However, their clinical expression was less severe as compared to a group of CF patients homozygous for the F508del mutation. Finally, 8 subjects compound heterozygous for D1152H and a IV-V class mutation showed very mild disease. CONCLUSIONS: The natural history of subjects bearing the D1152H mutation is widely heterogeneous and is influenced by the mutation in trans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Legacy name Protein name CDNA name Patients Homozygous for the D1152Ha D1152H p.Asp1152His c.3454GNC 7 Compound heterozygous for class I-II-III mutationsa : 74 F508del p.Phe508del c.1521_1523delCTT 43 G542X p.Gly542X c.1624GNT 7 N1303K p.Asn1303Lys c.3909CNG 4 1717-1GNA No protein name c.1585-1GNA 4 R1158X p.Arg1158X c.3472CNT 4 2183AANG p.Lys684SerfsX38 c.2051_2052delAAinsG 2 W1282X p.Trp1282X c.3846GNA 2 711 + 1GNT No protein name c.579 + 1GNT 1 Y849X p.Tyr849X c.2547CNA 1 L1065P p.Leu1065Pro c.3194 TNC 1 4016insT p.Ser1297PhefsX5 c.3884_3885insT 1 R1066H p.Arg1066His c.3197GNA 2 R1066C p.Arg1066Cys c.3196CNT 1 4382delA p.Glu1418ArgfsX14 c.4251delA 1 Compound heterozygous for class IV-V mutationsa : 8 (TG)12T5 No protein name Not available 2 2789 + 5GNA No protein name c.2657 + 5GNA 1 D579G p.Asp579Gly c.1736ANG 1 [R74W;V201M; D1270N] No protein name Not available 1 3849 + 10KbCNT No protein name c.3717 + 12191CNT 1 R347H p.Arg347His c.1040GNA 1 R347P p.Arg347Pro c.1040GNC 1 a Protein name and cDNA name from the CFTR2 database (http://www.http. com//www.cftr2) and http://www.genet.sickkids.on.ca/Home.html. Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] Mutation analysis of PRSS1, SPINK1 and CFTR gene i... Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287. Sisman G, Tugcu M, Ayla K, Sebati O, Senturk H
Mutation analysis of PRSS1, SPINK1 and CFTR gene in patients with alcoholic and idiopathic chronic pancreatitis: A single center study.
Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287., [PMID:25835118]

Abstract [show]
BACKGROUND/AIMS: A relation between some genetic mutations and chronic pancreatitis (CP) has been reported. However, the relation of genetic mutation to alcoholic CP (ACP) and idiopathic CP (ICP) still remains controversial. In this study, we investigated the prevalence of protease serine 1 (PRSS1), serine protease inhibitor, Kazal type 1 (SPINK1) SPINK1 and cystic fibrosis transmembrane conductance regulator (CFTR) mutations in ACP and ICP patients in Turkey. MATERIALS AND METHODS: Forty-one patients with ACP and 38 patients with ICP were enrolled, and 35 healthy individuals served as controls. The PRSS1 and SPINK1 mutations were investigated by the polymerase chain reaction (PCR)-restriction fragment-length polymorphism (RFLP) technique. The CFTR mutation was examined with PCR direct sequencing. RESULTS: The mean ages of the ACP, ICP and healthy control groups were 53.2, 40.4 and 46.3 years, respectively. A CFTR F508 mutation was detected as a heterozygote in one (2.4%) patient with ACP. In the ICP and control populations, PRSS1, SPINK1 and CFTR mutations were not detected. CONCLUSION: This study shows that PRSS1, SPINK1 and CFTR mutations do not play a role in ACP and ICP patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 DNA samples were multiplied by multiplex PCR with a CF 22Mut and CF 14Mut+Tn strip assay kit which has 36 common mutations of the CFTR gene (DF508, DI507, F508C, I502T, 1706del17, 1677del TA, G542X, 1717-1G>A, R553X, Q552X, G551D, S549R(A>C), N1303K, 4016insT, R1162X, R1158X, W1282X, G1244E, 2789+5G>A, 2183AA>G, 711+5G>A, 711+1G>T, G85E, 3849+10kbC>T, 621+1G>T, R117H, D1152H, L1065P, R1066H, L1077P, 4382delA, 1259insA, 852del22, R347P, T338I, S912X and Allele5T-7T-9T). Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
385 [Gly576Ala;Arg668Cys] D579G c.1736A>G CF-PS varying clinical consequence p.Asp579Gly E585X c.1753G>T CF-PI CF-causing p.Glu585* H609L c.1826A>T CFTR-RD nd p.His609Leu A613T c.1837G>A CF-PS nd p.Ala613Thr D614G c.1841A>G CF-PS unknown significance p.Asp614Gly 2143delT c.2012delT CF-PS CF-causing p.Leu671* 2183AA>G c.2051_2052delAAinsG CF-PI,CF-PS CF-causing p.Lys684SerfsX38 2184insA c.2052_2053insA CF-PI CF-causing p.Gln685ThrfsX4 R709X c.2125C>T CF-PI CF-causing p.Arg709* L732X c.2195T>G CF-PI CF-causing p.Leu732* R764X c.2290C>T CF-PI CF-causing p.Arg764* Q779X c.2335C>T uncertain: CF-PI and/or CF-PS nd p.Gln779* E831X c.2491G>T CF-PS CF-causing p.Glu831* Y849X c.2547C>A CF-PI CF-causing p.Tyr849* ex14b-17bdel c.2620-674_3367+198del9858 CF-PI nd 2789+5G>A c.2657+5G>A CF-PI,CF-PS CF-causing 2790-2A>G c.2658-2A>G CF-PS nd S912L c.2735C>T uncertain: found only with an unknown allele in trans nd p.Ser912Leu S945L c.2834C>T CF-PS CF-causing p.Ser945Leu S977F c.2930C>T CFTR-RD varying clinical consequence p.Ser977Phe L997F c.2991G>C CF-PS,CFTR-RD,CBAVD non CF-causing p.Leu997Phe ex17a-18del c.2988+1173_3468+2111del8600 CF-PI nd P1013L c.3038C>T CFTR-RD nd p.Pro1013Leu Y1032C c.3095A>G CFTR-RD nd p.Tyr1032Cys 3272-26A>G c.3140-26A>G CF-PS CF-causing L1065P c.3194T>C CF-PI,CF-PS CF-causing p.Leu1065Pro L1065R c.3194T>G uncertain: CF-PI and/or CF-PS nd p.Leu1065Arg R1066C c.3196C>T CF-PI CF-causing p.Arg1066Cys R1066H c.3197G>A CF-PI CF-causing p.Arg1066His G1069R c.3205G>A uncertain: found only with an unknown allele in trans varying clinical consequence p.Gly1069Arg Continued on next page of 0.021). Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 In several countries, when at least one Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name 3121-1G4A c.2989-1G4A 3199del6 (3195del6) c.3067_3072delATAGTG p.Ile1023_Val1024del 3272-26 A4G c.3140-26 A4G L1065P c.3194 T4C p.Leu1065Pro R1066C c.3196C4T p.Arg1066Cys R1066H c.3197G4A p.Arg1066His L1077P c.3230 T4C p.Leu1077Pro W1089X c.3266G4A p.Trp1089* Y1092X c.3276C4A p.Tyr1092* E1104X c.3310G4T p.Glu1104* R1158X c.3472C4T p.Arg1158* S1196X c.3587C4G p.Ser1196* W1204X(3743G4A) c.3611G4A p.Trp1204* W1204X(3744G4A) c.3612G4A p.Trp1204* 3791delC c.3659delC p.Thr1220Lysfs*8 3849+10kbC4T c.3718-2477C4T p.(?) Login to comment

[hide] Murine and human CFTR exhibit different sensitivit... Am J Physiol Lung Cell Mol Physiol. 2015 Oct 1;309(7):L687-99. doi: 10.1152/ajplung.00181.2015. Epub 2015 Jul 24. Cui G, McCarty NA
Murine and human CFTR exhibit different sensitivities to CFTR potentiators.
Am J Physiol Lung Cell Mol Physiol. 2015 Oct 1;309(7):L687-99. doi: 10.1152/ajplung.00181.2015. Epub 2015 Jul 24., [PMID:26209275]

Abstract [show]
Development of therapeutic molecules with clinical efficacy as modulators of defective CFTR includes efforts to identify potentiators that can overcome or repair the gating defect in mutant CFTR channels. This has taken a great leap forward with the identification of the potentiator VX-770, now available to patients as "Kalydeco." Other small molecules with different chemical structure also are capable of potentiating the activity of either wild-type or mutant CFTR, suggesting that there are features of the protein that may be targeted to achieve stimulation of channel activity by structurally diverse compounds. However, neither the mechanisms by which these compounds potentiate mutant CFTR nor the site(s) where these compounds bind have been identified. This knowledge gap partly reflects the lack of appropriate experimental models to provide clues toward the identification of binding sites. Here, we have compared the channel behavior and response to novel and known potentiators of human CFTR (hCFTR) and murine (mCFTR) expressed in Xenopus oocytes. Both hCFTR and mCFTR were blocked by GlyH-101 from the extracellular side, but mCFTR activity was increased with GlyH-101 applied directly to the cytoplasmic side. Similarly, glibenclamide only exhibited a blocking effect on hCFTR but both blocked and potentiated mCFTR in excised membrane patches and in intact oocytes. The clinically used CFTR potentiator VX-770 transiently increased hCFTR by approximately 13% but potentiated mCFTR significantly more strongly. Our results suggest that mCFTR pharmacological sensitivities differ from hCFTR, which will provide a useful tool for identifying the binding sites and mechanism for these potentiators.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
306 However, recent data indicating that VX-770 potentiates channels bearing multiple disease-causing mutations, spread across CFTR, and that VX-770 potentiates one mutant but not another one in the same domain (for example, VX-770 potentiated TM mutants T338I- and R347H- but not S341P- and E92K-CFTR and potentiated cytoplasmic loop mutants E193K- and K1060T- but not R1066M- and L1065P-CFTR) do not support this conclusion (30, 38). Login to comment