ABCMdb

ABCC7 p.Gly1244Glu

Admin's notes:	Class III (gating defect) Veit et al.
ClinVar:	c.3731G>A , p.Gly1244Glu D , Pathogenic c.3730G>A , p.Gly1244Arg ? , not provided c.3731G>T , p.Gly1244Val ? , not provided
CF databases:	c.3731G>A , p.Gly1244Glu D , CF-causing ; CFTR1: This missense mutation was detected in an Italian PI patient through DGGE screening and direct sequencing. The nucleotide changeis G3863-A and generates a Gly to Glu substitution in codon 1244. As a result the recognition site for MboII starting at nucleotide 3863 is destroyed. The mutation was found only once out of 110 non-[delta]F508 Italian CF chromosomes analyzed in Paris by the DGGE technique and it was not found in 45 non-[delta]F508 CF French chromosomes. c.3730G>A , p.Gly1244Arg (CFTR1) ? , This mutation was identified on one Italian CF chromosome, applying a protocol of extended mutational search (5?-flanking region, all the exons and adjacent intronic regions) by direct sequencing. No other mutations were found on the same allele. The mutation 3849+10KbCtoT was found on the other allele. The G1244R mutation was not found in 232 alleles from the general population. c.3731G>T , p.Gly1244Val (CFTR1) ? , This mutation in exon 20 reults in the substitution of valine for glycine at amino acid position 1244 (G1244V). The mutation was detected by SSCP analysis of exon 20 followed by direct sequencing. The nucleotide substitution abolishes an MboII restriction site. G1244V was detected in a single CF allele out of 105 non-[delta]F508 CF chromosomes screened. It has not been found on any of the 50 normal alleles screened. The mutation was found in the maternal CF allele in a patient of Bulgarian ehtnic background. The chromosomal haplotype is 2/1/1/16/31/13 (XV-2c/KM.19/d9/IVS8-CA/IVS17b-TA/IVS17b-CA). The paternal CF chromosome carries the G542X mutation.
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (66%), F: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

III (gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Polymorphisms of MRP1 (ABCC1) and related ATP-depe... Pharmacogenet Genomics. 2005 Aug;15(8):523-33. Conseil G, Deeley RG, Cole SP
Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters.
Pharmacogenet Genomics. 2005 Aug;15(8):523-33., [PMID:16006996]

Abstract [show]
Genetic variations in drug metabolizing enzymes and targets are established determinants of adverse drug reactions and interactions, but less is known about the role of genetic polymorphisms in membrane transport proteins. MRP1 (ABCC1) is one of 13 polytopic membrane proteins that comprise the 'C' subfamily of the ATP-binding cassette (ABC) superfamily of transport proteins. MRP1 and related ABCC family members, including MRP2, 3, 4 and 5 (ABCC2, 3, 4 and 5), each have a distinctive pattern of tissue expression and substrate specificity. Together, these five transporters play important roles in the disposition and elimination of drugs and other organic anions, and in maintenance of blood-tissue barriers, as confirmed by enhanced chemosensitivity of respective knockout mice. Moreover, Mrp2 (Abcc2) deficient animals display mild conjugated hyperbilirubinemia, corresponding to a human condition known as Dubin-Johnson syndrome (DJS). Naturally occurring mutations in MRP/ABCC-related drug transporters have been reported, some of which are non-synonymous single nucleotide polymorphisms. The consequences of the resulting amino acid changes can sometimes be predicted from in vitro site-directed mutagenesis studies or from knowledge of mutations of analogous (conserved) residues in ABCC proteins that cause DJS, Pseudoxanthoma elasticum (ABCC6), cystic fibrosis (CFTR/ABCC7) or persistent hyperinsulinemic hypoglycemia of infancy (SUR1/ABCC8). Continual updating of databases of sequence variants and haplotype analysis, together with in vitro biochemical validation assays and pharmacological studies in knockout animals, should make it possible to determine how genetic variation in the MRP-related transporters contributes to the range of responses to drugs and chemicals observed in different human populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 In the kidney, glomeruli and distal collecting tubules express MRP1, and, in the brain, MRP1 appears to form part of the drug permeability barrier Fig. 1 CF (CFTR/ABCC7) Q1291R E1228G Q1238R G1244E/V G1247R G1249R S1251N S1255P/L W1282G/R/C R1283K/M N1303K Y1307C E1321Q K1351E Q1352H R1268Q V1298F T1301I G1302R A1303P R1314W/Q G1321S R1339C Q1347H I1350L G1354R D1361N Q1382R A1450T R1347E R1351P V1359G/M S1368A G1377R G1382S R1392H R1419C R1435Q G1477R G1479R R1492W E1505K DJS (MRP2/ABCC2) NBD1 NBD2 COOH MEMBRANE MSD MSD MSD 12131415161710116 7 8 91 23 4 5TM H2 N Extracellular Intracellular PXE (ABCC6) PHHI (SUR1/ABCC8) Two-dimensional structure of MRP-related proteins. Login to comment

[hide] Novel pharmacologic therapies for cystic fibrosis. J Clin Invest. 1999 Feb;103(4):447-52. Zeitlin PL
Novel pharmacologic therapies for cystic fibrosis.
J Clin Invest. 1999 Feb;103(4):447-52., [PMID:10021451]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
125 These mutants sustain a reduced response to ATP-examples include S1255P, G551S, G1244E, and G1349D. Login to comment

[hide] Detection of five rare cystic fibrosis mutations p... Clin Chem. 1999 Jul;45(7):957-62. Castaldo G, Fuccio A, Cazeneuve C, Picci L, Salvatore D, Raia V, Scarpa M, Goossens M, Salvatore F
Detection of five rare cystic fibrosis mutations peculiar to Southern Italy: implications in screening for the disease and phenotype characterization for patients with homozygote mutations.
Clin Chem. 1999 Jul;45(7):957-62., [PMID:10388469]

Abstract [show]
BACKGROUND: The search for the eight most frequent mutations (i.e., DeltaF508, G542X, W1282X, N1303K, 1717-1G-->A, R553X, 2183AA-->G, and I148T) by allele-specific oligonucleotide dot-blot analysis revealed 78% of 396 cystic fibrosis alleles in Southern Italy. The observation of frequent haplotypes on the unidentified cystic fibrosis alleles suggested that a few mutations could account for a large number of unidentified alleles. METHODS: We screened most of the coding sequence of the cystic fibrosis transmembrane regulator gene by denaturing gradient gel electrophoresis to determine the spectrum of these mutations in 68 unrelated cystic fibrosis patients bearing one or both unidentified mutations. RESULTS: The screening revealed five mutations, R1158X, 711+1G-->T, 4016insT, L1065P, and G1244E, each of which had a frequency of 1.3-1.8% (7% collectively). The 7% increase in the detection rate (85% vs 78%) reduces by >50% the residual risk of being cystic fibrosis carriers for couples who had tested negative by molecular analysis. We therefore designed a second allele-specific oligonucleotide set to analyze the five mutations. Among the patients analyzed, one patient homozygous for the L1065P mutation expressed a mild pulmonary and intestinal form of the disease with pancreatic insufficiency. Two other patients, homozygous for mutations R1158X and 4016insT, both expressed a severe cystic fibrosis phenotype. CONCLUSIONS: Five cystic fibrosis mutations are peculiar to patients from Southern Italy. The method described for their analysis is efficient, inexpensive, and can be semi-automated by use of a robotic workstation. The results obtained in patients from Southern Italy may have an impact on laboratories in other countries, given the large migrations of populations from Southern Italy to other countries in the last two centuries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 aso dot-blot procedure for the analysis of the five "rare" cf mutations To analyze routinely the five mutations (i.e., L1065P, 711ϩ1G3T, R1158X, 4016insT, and G1244E) we set up a procedure based on a single multiplex PCR amplification followed by ASO dot-blot hybridization. Login to comment
49 Mutation Forward primer (5؅) Reverse primer (3؅) Wild-type oligo for ASO dot blota Mutated oligo for ASO dot blota L1065P (exon 17b) 5ЈTTCAAAGAATGGCACCAGTGT 3ЈATAACCTATAGAATGCAGCA 5ЈATGGACACTTCGTGCCT (52 °C) 5ЈTGGACACCTCGTGCCT (52 °C) 4016insT (exon 21) 5ЈAATGTTCACAAGGGACTCCA 3ЈCAAAAGTACCTGTTGCTCCA 5ЈAGTATTTATTTTTTCTGGAAC (52 °C) 5ЈGTATTTATTTTTTTCTGGAAC (52 °C) 711ϩ1G3T (intron 5) 5ЈATTTCTGCCTAGATGCTGGG 3ЈAACTCCGCCTTTCCAGTTGT 5ЈTTGATGAAGTATGTACCTAT (52 °C) 5ЈTTTGATGAATTATGTACCTAT (52 °C) R1158X (exon 19) 5ЈGCCCGACAAATAACCAAGTGA 3ЈGCTAACATTGCTTCAGGCT 5ЈTTCAGATGCGATCTGTGA (52 °C) 5ЈTTTCAGATGTGATCTGTGA (52 °C) G1244E (exon 20) 5ЈGGTCAGGATTGAAAGTGTGCA 3ЈCTATGAGAAAACTGCACTGGA 5ЈCCTCTTGGGAAGAACTGGA (53 °C) 5ЈCCTCTTGGAAAGAACTGGA (51 °C) a For each oligonucleotide, the optimal washing temperature of the filter is reported. Login to comment
53 Results The DGGE screening allowed us to identify 20 different mutations; five of these, i.e., R1158X, G1244E, 4016insT, 711ϩ1G3T, and L1065P, were observed with a frequency Ͼ1.0% among 396 CF alleles from Southern Italy. Login to comment
137 For 711ϩ1G3T (D) and G1244E (E), 1 and 2 are healthy controls, and 3 and 4 are heterozygotes for the mutation. Login to comment

[hide] Three common CFTR mutations should be included in ... Clin Genet. 1999 Oct;56(4):318-22. Schaedel C, Hjelte L, de Monestrol I, Johannesson M, Kollberg H, Kornfalt R, Holmberg L
Three common CFTR mutations should be included in a neonatal screening programme for cystic fibrosis in Sweden.
Clin Genet. 1999 Oct;56(4):318-22., [PMID:10636451]

Abstract [show]
Children with cystic fibrosis (CF) diagnosed by neonatal screening have a better nutritional development and other advantages compared with those in a nonscreened group. The two-tier immunoreactive trypsinogen (IRT)/DNA screening protocol has been found superior to the single-tier IRT approach, improving the positive predictive value and thus reducing the false-positive rate. However, variations of the DNA test are required for different populations. In this study we examined CFTR (cystic fibrosis transmembrane conductance regulator) mutations in 331 CF patients attending the centres in Stockholm, Lund and Uppsala, comprising about 75% of the CF population in Sweden. The frequency of deltaF508 among CF alleles was 68.3%. There were two other mutations, 394delTT and 3659delC, found to be fairly frequent, amounting to 8.5 and 7.9%, respectively. Other mutations were comparatively rare. A simple and effective method of analysing the three mutations from Guthrie cards has been developed. Assuming Hardy-Weinberg equilibrium, 90% of our CF patients will be expected to carry at least one deltaF508 allele and 97.6% to carry at least one deltaF508, 394delTT or 3659delC copy. Including the latter two in a screening programme would thus substantially reduce the risk of a false-negative outcome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 patients 1 S549I/S549I Lebanon I148T/unknown1 Turkey 1 711+3GA/ Italy G1244E R553X/G551D1 France 2 R553X/unknown Sweden, Germany 175insT/175insT Sweden2 R117H/unknown2 Sweden 3 Unknown/unknown Sweden, Syria, Turkey early intervention (1, 3). Login to comment

[hide] Pharmacologic restoration of delta F508 CFTR-media... Kidney Int. 2000 Mar;57(3):832-7. Zeitlin PL
Pharmacologic restoration of delta F508 CFTR-mediated chloride current.
Kidney Int. 2000 Mar;57(3):832-7., [PMID:10720936]

Abstract [show]
Cystic fibrosis (CF) is an autosomal inherited disorder caused by over 800 different mutations in the CFTR gene. The most common mutation, delta F508, causes a trafficking arrest in the endoplasmic reticulum and the CFTR protein is degraded. Restoration of CFTR trafficking in vitro restores cAMP-mediated chloride transport at the cell surface. The hypothesis of this discussion is that the short chain fatty acids, butyrate and 4-phenylbutyrate, up-regulate mature CFTR at the plasma membrane. Evidence that these compounds regulate CFTR production and maturation in part through effects on molecular chaperones in CF cells in culture is discussed. The oral drug, 4-phenylbutyrate, was tested in a Phase I clinical trial in CF subjects and further trials are underway. Other new therapeutic approaches directed at different classes of mutations in CFTR are also discussed. Chemical and pharmacologic agents that regulate endogenous gene expression at different steps in the biosynthetic processing pathway of a membrane glycoprotein will be needed to comprehensively treat a complex inherited disorder like cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 These mutants sus- ment of CF cells with 4-phenylbutyrate or low tempera- tain a reduced response to adenosine 5Ј-triphosphate ture to induce ⌬F508 trafficking to the plasma mem- (ATP); examples include S1255P, G551S, G1244E, and brane, allowed genistein to activate chloride transport G1349D. Login to comment

[hide] A novel mutation in the CFTR gene correlates with ... J Med Genet. 2000 Mar;37(3):215-8. Wang J, Bowman MC, Hsu E, Wertz K, Wong LJ
A novel mutation in the CFTR gene correlates with severe clinical phenotype in seven Hispanic patients.
J Med Genet. 2000 Mar;37(3):215-8., [PMID:10777364]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
320 Since ATP hydrolysis at NBD2 terminates a burst of activities associated with opening the channel, loss of NBD2 would confer a loss of the gating control.21 A recent study shows that the Walker A motif in NBD2 is more solvent accessible than that in NBD1, suggesting a diVerence in structure and function for the two NBDs.22 In addition to 3876delA, a few other mutations in NBD2, including G1244E, S1255P, S1255X, 3905insT, W1282X, N1303K, and G1349D, all result in a PI phenotype.5 23 It should be noted that S1255P, S1255X, 3905insT, and 3876delA are all clustered around the Walker A motif. Login to comment

[hide] Correlation between mutations and age in cystic fi... J Med Genet. 2000 Mar;37(3):225-7. Rivard SR, Allard C, Leblanc JP, Milot M, Aubin G, Simard F, Ferec C, de Braekeleer M
Correlation between mutations and age in cystic fibrosis in a French Canadian population.
J Med Genet. 2000 Mar;37(3):225-7., [PMID:10777368]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
320 Since ATP hydrolysis at NBD2 terminates a burst of activities associated with opening the channel, loss of NBD2 would confer a loss of the gating control.21 A recent study shows that the Walker A motif in NBD2 is more solvent accessible than that in NBD1, suggesting a diVerence in structure and function for the two NBDs.22 In addition to 3876delA, a few other mutations in NBD2, including G1244E, S1255P, S1255X, 3905insT, W1282X, N1303K, and G1349D, all result in a PI phenotype.5 23 It should be noted that S1255P, S1255X, 3905insT, and 3876delA are all clustered around the Walker A motif. Login to comment

[hide] Genotype-phenotype correlation in three homozygote... J Med Genet. 2000 Apr;37(4):307-9. Kilinc MO, Ninis VN, Tolun A, Estivill X, Casals T, Savov A, Dagli E, Karakoc F, Demirkol M, Huner G, Ozkinay F, Demir E, Seculi JL, Pena J, Bousono C, Ferrer-Calvete J, Calvo C, Glover G, Kremenski I
Genotype-phenotype correlation in three homozygotes for the cystic fibrosis mutation 2183AA-->G shows a severe phenotype.
J Med Genet. 2000 Apr;37(4):307-9., [PMID:10819640]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
446 The clinical data presented for three patients homozygous for the mutation and eight compound heterozygous patients who carry a severe mutation ( F508, G542X, and G1244E) on the other CFTR chromosome indicate that the mutation causes a severe CF phenotype. Login to comment

[hide] Type I, II, III, IV, and V cystic fibrosis transme... Curr Opin Pulm Med. 2000 Nov;6(6):521-9. Choo-Kang LR, Zeitlin PL
Type I, II, III, IV, and V cystic fibrosis transmembrane conductance regulator defects and opportunities for therapy.
Curr Opin Pulm Med. 2000 Nov;6(6):521-9., [PMID:11100963]

Abstract [show]
Recent advances in cellular and molecular biology have furthered the understanding of several genetic diseases, including cystic fibrosis. Mutations that cause cystic fibrosis are now understood in terms of the specific molecular consequences to the cystic fibrosis transmembrane conductance regulator (CFTR) protein expression and function. This knowledge has spawned interest in the development of therapies aimed directly at correcting the defective CFTR itself. In this article, we review the molecular defect underlying each recognized class of CFTR mutation and the potential therapies currently under investigation. Opportunities for protein-repair therapy appear to be vast and range from naturally occurring compounds, such as isoflavonoids, to pharmaceuticals already in clinical use, including aminoglycoside antibiotics, butyrate analogues, phosphodiesterase inhibitors, and adenosine nucleotides. Future therapies may resemble designer compounds like benzo[c]quinoliziniums or take the form of small peptide replacements. Given the heterogeneity and progressive nature of cystic fibrosis, however, optimal benefit from protein-repair therapy will most likely require the initiation of combined therapies early in the course of disease to avoid irreparable organ damage.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 These mutants, including S1255P, G551S, G1244E, and G1349D, sustain a reduced response to ATP. Login to comment

[hide] Aberrant CFTR-dependent HCO3- transport in mutatio... Nature. 2001 Mar 1;410(6824):94-7. Choi JY, Muallem D, Kiselyov K, Lee MG, Thomas PJ, Muallem S
Aberrant CFTR-dependent HCO3- transport in mutations associated with cystic fibrosis.
Nature. 2001 Mar 1;410(6824):94-7., 2001-03-01 [PMID:11242048]

Abstract [show]
Cystic fibrosis (CF) is a disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR). Initially, Cl- conductance in the sweat duct was discovered to be impaired in CF, a finding that has been extended to all CFTR-expressing cells. Subsequent cloning of the gene showed that CFTR functions as a cyclic-AMP-regulated Cl- channel; and some CF-causing mutations inhibit CFTR Cl- channel activity. The identification of additional CF-causing mutants with normal Cl- channel activity indicates, however, that other CFTR-dependent processes contribute to the disease. Indeed, CFTR regulates other transporters, including Cl(-)-coupled HCO3- transport. Alkaline fluids are secreted by normal tissues, whereas acidic fluids are secreted by mutant CFTR-expressing tissues, indicating the importance of this activity. HCO3- and pH affect mucin viscosity and bacterial binding. We have examined Cl(-)-coupled HCO3- transport by CFTR mutants that retain substantial or normal Cl- channel activity. Here we show that mutants reported to be associated with CF with pancreatic insufficiency do not support HCO3- transport, and those associated with pancreatic sufficiency show reduced HCO3- transport. Our findings demonstrate the importance of HCO3- transport in the function of secretory epithelia and in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 Similar rates were measured for the I148T, G178R, A1067T, G1244E, S1255P and G1349D mutants (see Fig. 3 for location of these mutations in CFTR), all of which are associated with CF with pancreatic insuf®- ciency. Login to comment
186 letters to nature 96 NATURE |VOL 410 |1 MARCH 2001 |www.nature.com HCO3 -/Cl- transportratio 0 0.25 0.50 0.75 1.00 WT I148T G178R R297Q G551D H620Q G970R A1067T G1244E S1255P G1349D E193K G551S A800G H949Y R1070Q Pancreatic insufficient Pancreatic sufficientD648V N CI148T G178R E193K R297Q R117H A1067T R1070Q G1244E S1255P G1349D NBD2 RD H949Y G970R CL4CL3CL2CL1 NBD1 G551D G551S H620Q D648V A800G Figure 3 The HCO3:Cl-transport ratio of CFTR mutants associated with CF. Login to comment

[hide] Cystic fibrosis phenotype evaluation and paternity... Hum Reprod. 2001 Oct;16(10):2093-7. Josserand RN, Bey-Omar F, Rollet J, Lejeune H, Boggio D, Durand DV, Durieu I
Cystic fibrosis phenotype evaluation and paternity outcome in 50 males with congenital bilateral absence of vas deferens.
Hum Reprod. 2001 Oct;16(10):2093-7., [PMID:11574497]

Abstract [show]
BACKGROUND: Most infertile males with congenital bilateral absence of vas deferens (CBAVD) carry mutations on the cystic fibrosis transmembrane conductance regulator gene and may express mild cystic fibrosis (CF) symptoms. Barriers to paternity for these men can now be overcome by assisted reproduction. Our aims were to investigate the CF-related phenotype and clinical outcome for 50 patients with CBAVD seen at a CF adult centre between 1992 and 1999. METHODS AND RESULTS: The investigation of the patients included screening for 22 CF mutations and identification of the poly-T variant of intron 8, sweat testing, clinical investigation for CF-related extra-genital manifestations, and genetic counselling. CFTR mutations were detected on 56 alleles of the 50 patients. A total of 15 (30%) was compound heterozygote and 26 (52%) heterozygote. In all, 38% of the patients had a positive sweat test. Four patients were diagnosed with typical CF not detected previously. Twenty-one patients became fathers following ICSI (eight cases), artificial insemination by donor or IVF with sperm donor (seven cases) or through adoption (six cases). A mail survey allowed the identification of CF-related clinical symptoms. Information on the occurrence of CF-related symptoms was obtained for 58.5% of patients: in the absence of initial symptoms, no new clinical signs were reported. CONCLUSION: Patients diagnosed with CBAVD need genetic counselling before assisted reproduction. Even when no wish for paternity is expressed, CF gene screening should be associated with at least a sweat test and clinical evaluation because of possible mild forms of CF disease. Medical follow-up did not reveal any new symptoms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Leukocytes samples were analysed for a series of 22 CF mutations including the five most frequently encountered in our region (The CF Genotype Consortium, 1994): ∆F508, G542X, N1303K, 1717-G-A, 885E; and 17 others: R117H, R334W, R347H, R347P, 556delA, S549N, S549I, S549R, G551D, R553X, R560T, G1244E, S1255X, W1282X, R1283K, 3898ins C, D1270N. Login to comment

[hide] Improved detection of CFTR mutations in Southern C... Hum Mutat. 2001 Oct;18(4):296-307. Wong LJ, Wang J, Zhang YH, Hsu E, Heim RA, Bowman CM, Woo MS
Improved detection of CFTR mutations in Southern California Hispanic CF patients.
Hum Mutat. 2001 Oct;18(4):296-307., [PMID:11668613]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause cystic fibrosis (CF), a common autosomal recessive disease in Caucasians. The broad mutation spectrum varies among different patient groups. Current molecular diagnoses are designed to detect 80-97% of CF chromosomes in Caucasians and Ashkenazi Jews but have a much lower detection rate in Hispanic CF patients. Grebe et al. [1994] reported a 58% detection rate in Hispanic patients. Since then, there has been no large-scale, complete mutational analysis of Hispanic CF patients. In this study, the mutations in 62 Hispanic patients from southern California were investigated. The entire coding and flanking intronic regions of the CFTR gene were analyzed by temporal temperature gradient gel electrophoresis (TTGE) followed by sequencing to identify the mutations. Eleven novel mutations were discovered in this patient group: 3876delA, 406-1G>A, 935delA, 663delT, 3271delGG, 2105-2117del13insAGAAA, 3199del6, Q179K, 2108delA, 3171delC, and 3500-2A>T. Among the mutations, seven were out-of-frame insertions and deletions that result in truncated proteins, two were splice-site mutations, one was an in-frame 6 bp deletion, and one was a missense mutation that involved the non-conservative change of glutamine-179 to lysine. All patients presented severe classical clinical course with pancreatic insufficiency and poor growth, consistent with the nature of truncation mutation. The results indicate that TTGE screening following the analysis of recurrent mutations will substantially improve the mutation detection rate for Hispanic CF patients from southern California.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 In addition, rare mutations including1949del84, Q98R, R75X, and G1244E, were also detected. Login to comment
117 Summary of Mutations Found in This Group of Hispanic Patients Exon or Number of Mutation intron chromosomes Frequency % Mutations detected before full gene analysis 91 73.38% 1 F508 10 64 51.6 2 G542X 11 5 4 3 3849+10kb C>T Intron 19 5 4 4 S549N 11 3 2.4 5 I148T 4 2 1.6 6 3120+1G>A 16 2 1.6 7 R334W 7 2 1.6 8 G551D 11 1 0.8 9 N1303K 21 1 0.8 10 W1282X 20 1 0.8 11 R1162X 19 1 0.8 12 G85E 3 1 0.8 13 W1089X 17b 1 0.8 14 Y1092X 17b 1 0.8 15 P205S 6a 1 0.8 Mutations detected by full gene screening 26 20.97% 16 R1066Ca 17b 2 1.6 17 1949del84 13 1 0.8 18 2184delA 13 1 0.8 19 Q98R 4 1 0.8 20 R75X 3 1 0.8 21 G1244E 20 1 0.8 22 3876delA 20 7 5.65 23 935delA 6b 2 1.6 24 406-1G>A Intron 2 2 1.6 25 3271delGG 17a 1 0.8 26 2105-2117del13insAGAAA 13 1 0.8 27 663delT 5 1 0.8 28 3171delC 17a 1 0.8 29 2108delA 13 1 0.8 30 Q179K 5 1 0.8 31 3199del6 17a 1 0.8 32 3500-2 A->T Intron 17b 1 0.8 Total identified 117 (177)b 94.35 (97.5)b Unidentified 7 (3)b 5.65 (2.5)b Total 124 (120)b 100 (100)b a This mutation was also detected by SSCP. Login to comment

[hide] Cystic fibrosis mutation testing in Italy. Genet Test. 2001 Fall;5(3):229-33. Bombieri C, Pignatti PF
Cystic fibrosis mutation testing in Italy.
Genet Test. 2001 Fall;5(3):229-33., [PMID:11788089]

Abstract [show]
In Italy, Cystic fibrosis (CF) mutation frequency differences have been observed in different regions. In the northeastern Veneto and Trentino Alto Adige regions, a complete cystic fibrosis transmembrane conductance regulator (CFTR) gene screening in CF patients detected through a newborn screening program has identified about 90% of the mutations. In these two regions, the current detection rate using a CF screening panel containing the 16 most common mutations is 86.6%. CF mutations in some other Italian regions have not been so thoroughly analysed. Available data indicate that a more general national screening panel comprising 31 mutations may detect about 75% of all CF mutations in Italy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 CF GENE MUTATIONS IN ITALY Number of alleles Frequency Cumulative Mutation screened (%) frequency (%) DF508 3442 51.07 51.07 N1303K 3056 4.84 55.91 G542X 3082 4.83 60.75 2183 AA ® G 2596 2.66 63.41 R1162X 2580 2.42 65.83 1717-1 G ® A 2892 2.11 67.94 W1282X 2600 1.23 69.17 R553X 2882 1.15 70.31 T338I 2306 0.69 71.01 R347P 2642 0.61 71.61 711 1 5 G ® A 2454 0.57 72.18 G85E 1980 0.40 72.59 621 1 1 G ® T 2594 0.39 72.97 R334W 2366 0.30 73.27 R352Q 2112 0.24 73.50 S549N 2118 0.24 73.74 R347H 2184 0.18 73.92 L1077P 1840 0.16 74.09 R1158X 1878 0.16 74.25 541del C 1884 0.16 74.40 R1066H 1918 0.16 74.56 E585X 1922 0.16 74.72 Q552X 2172 0.14 74.86 D1152H 1824 0.11 74.97 2790-2 A ® G 1862 0.11 75.07 3132 del TG 1862 0.11 75.18 3667ins 4 1876 0.11 75.29 DI507 1914 0.10 75.39 1898 1 3 A ® G 1920 0.10 75.50 G1244E 1960 0.10 75.60 1784 del G 2052 0.10 75.69 From Rendine et al. (1997). Login to comment

[hide] Predictors of deterioration of lung function in cy... Pediatr Pulmonol. 2002 Jun;33(6):483-91. Schaedel C, de Monestrol I, Hjelte L, Johannesson M, Kornfalt R, Lindblad A, Strandvik B, Wahlgren L, Holmberg L
Predictors of deterioration of lung function in cystic fibrosis.
Pediatr Pulmonol. 2002 Jun;33(6):483-91., [PMID:12001283]

Abstract [show]
The severity of lung disease in cystic fibrosis (CF) may be related to the type of mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, and to environmental and immunological factors. Since pulmonary disease is the main determinant of morbidity and mortality in CF, it is important to identify factors that can explain and predict this variation. The aim of this longitudinal study of the whole Swedish CF population over age 7 years was to correlate genetic and clinical data with the rate of decline in pulmonary function. The statistical analysis was performed using the mixed model regression method, supplemented with calculation of relative risks for severe lung disease in age cohorts.The severity of pulmonary disease was to some extent predicted by CFTR genotype. Furthermore, the present investigation is the first long-term study showing a significantly more rapid deterioration of lung function in patients with concomitant diabetes mellitus. Besides diabetes mellitus, pancreatic insufficiency and chronic Pseudomonas colonization were found to be negative predictors of pulmonary function. In contrast to several other reports, we found no significant differences in lung function between genders. Patients with pancreatic sufficiency have no or only a slight decline of lung function with age once treatment is started, but an early diagnosis in this group is desirable.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 TABLE 3CFTR Mutations Associated With Pancreatic Sufficiency in Swedish CF Population Y109C S549I/S549I Y109N S945L R117C N1088D À R75Q R117H G1244E L206W 711 þ 3A !G T338I 1249 À 5A !G A455E 2789 þ 5G ! Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment
110 Germany ∆F508 (71.8%) 1789+5G→A (0.9%) 87.6 76.7 17 5662/1316 Dörk et al. [1992]; Dörk et al. R553X (2.0%) 3272-26A→G (0.9%) [1994]; Tümmler et al. [1996]; N1303K (1.8%) W1282X (0.7%) Estivill et al. [1997]; Dörk et G542X (1.2%) 2143delT (0.7%) al. [2000] R347P (1.2%) 1078delT (0.6%) CFTRdele2,3 (1.2%) 2183AA→G (0.6%) 3849+10KbC→T (1.0%) 2184insA (0.6%) G551D (0.9% 3659delC (0.6%) 1717-1G→A (0.9%) Greece ∆F508 (52.9%) 3272-26A→G (0.8%) 82.2 67.6 22 2097/718 Kanavakis et al. [1995]; Estivill 621+1G→T (5.0%) R1070Q (0.8%) et al. [1997]; Tzetis et al. G542X (4.1%) W496X (0.7%) [1997]; Macek et al. [2002] N1303K (3.3%) 621+3A→G (0.7%) 2183AA→G (1.8%) ∆I507 (0.7%) 2789+5G→A (1.7%) W1282X (0.7%) E822X (1.6%) 574delA (0.7%) R117H (1.2%) 1677delTA (0.7%) R334W (1.1%) A46D (0.6%) R1158X (1.0%) 3120+1G→A (0.6%) G85E (1.0%) G551D (0.5%) Hungary ∆F508 (54.9%) W1282X (1.8%) 68.3 46.6 9 1133/976 CFGAC [1994]; Estivill et al. 1717-1G→A (1.9%) G542X (1.7%) [1997]; Macek et al. [2002] R553X (2.1%) N1303K (1.3%) Y1092X (1.8%) G551D (1.0%) S1196X (1.8%) Ireland ∆F508 (70.4%) G542X (1.0%) 82.1 67.4 7 801/509 CFGAC [1994]; Estivill et al. G551D (5.7%) 621+1G→T (0.8%) [1994] R117H (2.4%) 1717-1G→A (0.6%) R560T (1.2%) Italy ∆F508 (50.9%) ∆I507 (0.65%) 60.3 36.4 9 3524 Estivill et al. [1997] (total) G542X (3.1%) W1282X (0.62%) 1717-1G→A (1.6%) Y122K (0.59%) N1303K (1.4%) G551D (0.53%) R553X (0.94%) Italy ∆F508 (47.6%) R553X (1.3%) 87.1 75.9 15 225 Bonizzato et al. [1995] (Northeast) R1162X (9.8%) 2789+G→A (1.3%) 2183AA→G (9.3%) Q552X (1.3%) N1303K (4.0%) 621+1G→T (0.9%) G542X (2.7%) W1282X (0.9%) 711+5G→A (2.7%) 3132delTG (0.9%) 1717-1G→A (2.2%) 2790-2A→G (0.9%) G85E (1.3%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS583 Italy ∆F508 (56.4%) 711+1G→T (1.3%) 85.7 73.4 13 660/396 Castaldo et al. [1996]; Castaldo (southern) N1303K (6.8%) G1244E (1.3%) et al. [1999] G542X (5.7%) R1185X (1.3%) W1282X (3.8%) L1065P (1.3%) 1717-1G→A (2.3%) R553X (1.1%) 2183AA→G (1.9%) I148T (0.7%) 4016insT (1.8%) Latvia 1) DF508 (58.3%) 4) CFTRdele2,3 (2.8%) - - 6 36 Dörk et al. [2000]; Macek et al. 2) 3849+10KbC®T (8.3%) 5) W1282X (2.8%) [2002] 3) N1303K (5.6%) 6) 394delTT (2.8%) Lithuania ∆F508 (31.0%) N1303K (2.0%) 39.0 15.2 4 94 Dörk et al. [2000]; Macek et al. R553X (4.0%) CFTRdele2,3 (2.0%) [2002] Macedonia ∆F508 (54.3%) 711+3A→G (1.0%) 69.2 47.9 12 559/226 Petreska et al. [1998]; Dörk et G542X (4.2%) 3849G→A (1.0%) al. [2000]; Macek et al. N1303K (2.0%) 2184insA (0.9%) [2002] CFTRdele2,3 (1.3%) 457TAT→G (0.7%) 621+1G→T (1.3%) V139E (0.7%) 611-1G→T (1.2%) 1811+1G→C (0.6%) Netherlands ∆F508 (74.2%) R1162X (0.9%) 86.8 75.3 9 3167/1442 Gan et al. [1995]; Estiville et al. A455E (4.7%) S1251N (0.9%) [1997]; Collee et al. [1998] G542X (1.8%) N1303K (0.9%) 1717-1G→A (1.5%) W1282X (0.7%) R553X (1.2%) Norway ∆F508 (60.2%) G551D (1.2%) 69.8 48.7 6 410/242 Schwartz et al. [1994]; Estivill 394delTT (4.2%) G542X (0.6%) et al. [1997] R117H (3.0%) N1303K (0.6%) Poland ∆F508 (57.1%) CFTRdele2,3 (1.8%) 73.5 54.0 11 4046/1726 CFGAC [1994]; Estivill et al. 3849+10Kb C→T (2.7%) R560T (1.5%) [1997]; Dörk et al [2000]; G542X (2.6%) W1282X (0.7%) Macek et al. [2002] 1717-1G→A (2.4%) ∆I507 (0.5%) R553X (1.9%) G551D (0.5%) N1303K (1.8%) Portugal ∆F508 (44.7%) R334W (0.7%) 49.7 24.7 5 739/454 CFGAC [1994]; Estivill et al. G542X (1.6%) N1303K (0.7%) [1997] R1066C (2.0%) Romania ∆F508 (36.6%) G542X (1.4%) 51.5 26.5 11 224/74 CFGAC [1994]; Estivill et al. 2043delG (2.0%) R553X (1.4%) [1997]; Popa et al. [1997]; W1282X (1.7%) G576X (1.4%) Macek et al. [2002] 1717-2A→G (1.4%) 1898+1G→A (1.4%) I148T (1.4%) 2183AA→G (1.4%) 621+1G→T (1.4%) Russia ∆F508 (54.4%) 552insA (0.9%) 70.7 50.0 12 5073/2562 CFGAC [1994]; Estivill et al. CFTRdele2,3 (5.0%) G542X (0.9%) [1997]; Dörk et al. [2000]; R553X (3.5%) R334W (0.9%) Macek et al. [2002] 2183AA→G (1.3%) 1677delTA (0.8%) W1282X (1.0%) Y122X (0.5%) 394delTT (1.0%) 1367del5 (0.5%) (Continued) BOBADILLAETAL. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

[hide] Extensive sequencing of the cystic fibrosis transm... Genet Med. 2003 Jan-Feb;5(1):9-14. Strom CM, Huang D, Chen C, Buller A, Peng M, Quan F, Redman J, Sun W
Extensive sequencing of the cystic fibrosis transmembrane regulator gene: assay validation and unexpected benefits of developing a comprehensive test.
Genet Med. 2003 Jan-Feb;5(1):9-14., [PMID:12544470]

Abstract [show]
PURPOSE: To develop a sequencing assay for the gene to identify mutations in patients with cystic fibrosis (CF). METHODS: An automated assay format was developed to sequence all exons and splice junctional sequences, the promotor region, and parts of introns 11 and 19. RESULTS: After validating the assay using 20 known samples, DNA of seven patients, four of whom were heterozygous for a known CF mutation, was sequenced. Known CF mutations were detected in seven of the eight chromosomes, and a novel missense mutation was detected in the eighth. In addition, this assay allowed 14 ambiguous results obtained using the Roche CF gold strips to be resolved. Three false-positive diagnoses were prevented; a different mutation at the same codon was identified in two patients and confirmation was provided in the remaining nine cases. CONCLUSIONS: Sequencing of the gene provides important information for CF patients and is a valuable adjunct to a carrier screening program to resolve ambiguities in panel testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
90 Table 4 Results of sequencing of patient samples Description Prior genotype Sequencing CommentAllele 1 Allele 2 Confirmed CF wt/delta F508 delta F508 P205S Known mutation Confirmed CF wt/3849 ϩ 10 kb 3849 ϩ 10 kb L1077P Known mutation C 3 T C 3 T Confirmed CF wt/delta F508 delta F508 R1066C Known mutation Confirmed CF wt/delta F508 delta F508 D806G Novel missense Confirmed CF wt/wt 3154delG 3154delG Both parents confirmed carriers Confirmed CF delta F508/wt delta F508 G1244E Known mutation Confirmed CF wt/wt wt F191L Novel missense Borderline sweat test wt/wt wt wt Table 5 Resolution of ambiguities on linear array assay using sequencing Linear array result Resolution Weak mutant A455E line 1508 C 3 T (S459F) polymorphism or novel mutation Weak mutant A455E line 1508 C 3 T (S459F) polymorphism or novel mutation Weak mutant A455E line wt/1496 C 3 T (A455V) polymorphism or novel mutation Weak mutant A455E line wt/1496 C 3 T (A455V) polymorphism or novel mutation Weak mutant A455E line wt/1520 G 3 A (G463D) polymorphism or novel mutation No A455E mutant or wt line Homozygous 1499 T 3 C (V456A) polymorphism or novel mutation No A455E mutant or wt line Homozygous 1497 C 3 A polymorphism (no amino acid change) Weak wt 1898 ϩ 1 G 3 A line wt/E587A novel missense mutation or polymorphism Weak 1898 ϩ 1 G 3 A line wt/1898 ϩ 1 G 3 C-different mutation; G 3 C NOT G 3 A DISCUSSION The ACMG recommended panel of CF mutations has rapidly become the standard of care for US carrier screening. Login to comment

[hide] Clinical characteristics and genotype analysis of ... Clin Otolaryngol Allied Sci. 2003 Apr;28(2):125-32. Cimmino M, Cavaliere M, Nardone M, Plantulli A, Orefice A, Esposito V, Raia V
Clinical characteristics and genotype analysis of patients with cystic fibrosis and nasal polyposis.
Clin Otolaryngol Allied Sci. 2003 Apr;28(2):125-32., [PMID:12680831]

Abstract [show]
The prevalence of nasal polyps in a group of paediatric patients with cystic fibrosis was prospectively studied in comparison with a control group with cystic fibrosis but without polyps. Clinical variables, including pulmonary function tests, skin testing and mucociliary transport, were carried out in both groups, as well as genotype analysis. Endoscopic intranasal evaluation identified polyps in 29 of 89 patients (33%). Statistical analysis revealed that patients with nasal polyposis had better pulmonary function, a higher rate of Pseudomonas aeruginosa colonization, more hospitalizations, and more prevalence of allergy to Aspergillus fumigatus than did the comparison group. We found no statistically different genotype distribution between the polyposis and the control group. However, it can be emphasized that the prevalence of the compound heterozygous genotype is higher in the nasal polyposis group than in controls. Our observations suggest that other genetic and environmental factors could play an important role in the development of nasal polyposis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 Analysis of mutations in the CFTR gene as tested by the multiplex polymerase chain reaction (PCR), followed by the reverse dot-blot technique, which searches for 29 of the most frequent mutations (DF508, N1303K, G542X, W1282X, 1717±1 G-A, R553X, 2183 AA-G, DI507, G551D, R560T, 3849 10kbC > T, R1162X, 3659delC, 3905insT, G85E, 621 1GT, R117H, R347P, R334W, A455E, 2789 5GA, Q552X, S1251N, 3905insT, 394delTT, E60X, 2143delT, 2184delA, 711 5G > A), and by ASO dot-blot for the following mutations: I148T, R1158X, 4016 1T, G1244E G >A.26 Statistical analysis was performed using multivariate analysis, by forward stepwise comparison; it was done to ®nd out which of the examined characteristics could be associated (P < 0.01) to nasal polyposis. Login to comment

[hide] Segregation analysis in cystic fibrosis at-risk fa... Prenat Diagn. 2004 Dec 15;24(12):981-3. D'Apice MR, Gambardella S, Russo S, Lucidi V, Nardone AM, Pietropolli A, Novelli G
Segregation analysis in cystic fibrosis at-risk family demonstrates that the M348K CFTR mutation is a rare innocuous polymorphism.
Prenat Diagn. 2004 Dec 15;24(12):981-3., 2004-12-15 [PMID:15614862]

Abstract [show]
OBJECTIVE: Cystic fibrosis (CF; OMIM# 219700) is caused by mutation in the CF transmembrane regulator (CFTR) gene. We investigate whether the (paternal) M348K mutation is a benign polymorphism or a disease-causing mutation in a patient clinically affected with CF, with the second (maternal) CFTR allele identified as N1303K. METHODS: The patient and his father were studied for the presence of mutations in the CFTR gene using the DHPLC system to analyze all CFTR exons. Amplicons showing an abnormal elution profile were sequenced. RESULTS: The CFTR gene from the healthy father has two mutations, M348K and G1244E. The affected son inherited only the G1244E paternal mutation from his father, and hence the two paternal mutations are trans and do not occur in the same CFTR gene. The patient's genotype is G1244E(paternal)/N1303K(maternal). This information was used to study an ongoing pregnancy of the couple, where the fetus inherited the same genotype as the affected proband and therefore is affected. CONCLUSION: M348K in the CFTR gene is not a mutation causing CF, but a rare polymorphism. These data are important for genetic counseling and prenatal diagnosis and illustrate the importance of full sequence data when studying rare mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Results The CFTR gene from the healthy father has two mutations, M348K and G1244E. Login to comment
7 The affected son inherited only the G1244E paternal mutation from his father, and hence the two paternal mutations are trans and do not occur in the same CFTR gene. Login to comment
28 Received: 30 April 2004 Revised: 7 October 2004 Accepted: 10 October 2004 M. R. D`APICE ET AL. 1 1 1 1 3 4 1 2 1 1 4 1 1 2 1 1 4 1 1 2 1 1 2 1I:1 II:1 II:2 I:2 G1244E M348K G1244E N1303K N1303K G1244E N1303K IVS8GT IVS17bCA IVS17bTA IVS8GT IVS17bCA IVS17bTA IVS8GT IVS17bCA IVS17bTA IVS8GT IVS17bCA IVS17bTA Figure 1-The reported family pedigree. Login to comment
29 The proband (II:1) and the fetus (II:2) have each inherited G1244E and N1303K. Login to comment
30 Their asymptomatic father (I:1) shows the G1244E CF mutation and the M348K polymorphism; their mother (I:2) shows the N1303K mutation. Login to comment
36 Abnormal DHPLC patterns were observed for exons 7 and 20 (Figure 1), caused by nucleotide changes (T to A at position 1175, missense mutation M348K; G to A in position 3863, missense mutation G1244E). Login to comment
38 Direct analysis of exons 7 and 20 showed that the patient received only the G1244E paternal mutation and the N1303K maternal mutation giving a genotype N1303K/G1244E. Login to comment
39 Analysis using three intragenic microsatellites (IVS8GT, IVS17bTA, IVS17bCA) confirmed that the affected proband inherited the paternal chromosome carrying the G1244E mutation and N1303K from his mother. Login to comment
42 G1244E is a missense mutation in exon 20, peculiar to patients from southern Italy (Castaldo et al., 1999). Login to comment
43 DISCUSSION The mutation G1244E is known to be found in Italian CF patients and causes moderate to severe disease (Castaldo et al., 1999). Login to comment
44 Since the father has no symptoms of CF, and has the genotype M348/G1244E, M348K must be a rare polymorphism in the CFTR gene that is not disease-associated, at least in association with G1244E. Login to comment
51 The fetus (II-2, Figure 1) was compound heterozygous for the N1303K/G1244E mutations and haploidentical to the affected proband. Login to comment

[hide] Comprehensive cystic fibrosis mutation epidemiolog... Ann Hum Genet. 2005 Jan;69(Pt 1):15-24. Castaldo G, Polizzi A, Tomaiuolo R, Cazeneuve C, Girodon E, Santostasi T, Salvatore D, Raia V, Rigillo N, Goossens M, Salvatore F
Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population.
Ann Hum Genet. 2005 Jan;69(Pt 1):15-24., [PMID:15638824]

Abstract [show]
We screened the whole coding region of the cystic fibrosis transmembrane regulator (CFTR) gene in 371 unrelated cystic fibrosis (CF) patients from three regions of southern Italy. Forty-three mutations detected 91.5% of CF mutated chromosomes by denaturing gradient gel electrophoresis analysis, and three intragenic CFTR polymorphisms predicted a myriad of rare mutations in uncharacterized CF chromosomes. Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711 + 1G > T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Several mutations frequently found in northern Italy (e.g., R1162X, 711 + 5G > T) and northern Europe (e.g., G551D, I507del and 621 + 1G > T) are absent from the studied population. The I148T-3195del6 complex allele was present in two CF chromosomes, whereas I148T was present in both alleles (as a single mutation) in another CF patient and in five CF carriers; this could result from crossover events. The haplotype analysis of three intragenic polymorphisms (IVS8CA, IVS17bTA and IVS17bCA) compared with data from other studies revealed that several mutations (3849 + 10kbC > T, 1717-1G > A, E585X, 3272-26G > A, L558S, 2184insA and R347P) originated from multiple events, whereas others (R1158X and S549R) could be associated with one or more intragenic recombinant events. Given the large population migration from southern Italy, knowledge of the CF molecular epidemiology in this area is an important contribution to diagnosis, counselling and interlaboratory quality control for molecular laboratories worldwide.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711+1G>T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Login to comment
33 The 13 mutations in this panel are: F508del, N1303K, G542X, W1282X, 2183AA>G, 1717-1G>A, R553X, I148T, R1158X, 711+1G>T, 4016insT, L1065P and G1244E. Login to comment
49 In particular, 4016insT, R1158X, 711+1 G>T and L1065P had a cumulative frequency of 6.3% in CF chromosomes from Campania; G1244E and 852del22 a cumulative frequency of 9.6% in CF chromosomes from Basilicata; and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D a cumulative frequency of 19.6% in CF chromosomes from Puglia. Login to comment
62 A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n. Login to comment
86 However, 12 mutations (4016insT, R1158X, 711+1G>T, L1065P, G1244E, 4382delA, 1259insA, I502T, 852del22, D579G, L1077P and G1349D) have not been found (or have a low incidence) in populations from the British Isles (Cheadle et al. 1993; Ferec et al. 1992), Spain (Chillon et al. 1994; Casals et al. Login to comment
97 Due to the presence of 'local` mutations, the detection rate with commercial kits for CF chromosomes in Table 3 Mutations linked to different haplotypes possibly due to slippage events, characteryzed at the level of three CFTR intragenic loci (IVS8CA, IVS17bTA, IVS17bCA) by the indication of the repeats number Present study Other studies Cases Haplotype cases (n) (n. of repeats) (n) Haplotype references* (n. of repeats) R347P 4/4 16-32-13 3 16-32-13 1,2,3 1 16-31-13 3 2 17-28-13 1 1 16-45-13 1 L1077P 3/3 17-7-17 1 17-7-17 1 1 17-7-16 1 G85E 2/2 16-24-13 9 16-24-13 2,3 1 16-25-13 2 2183AA>G 14/14 16-31-13 1 16-31-13 3 4 16-30-13 1 R553X 6/11 17-55-13 3 17-58-13 3 3/11 18-55-13 1 17-57-11 1 1/11 16-55-13 2 17-55-13 1,3 1/11 16-55-11 6 17-55-11 1 1 17-52-11 1 1 17-54-11 1 1 17-56-13 3 G1244E 5/6 16-32-13 1 17-34-13 1 1/6 16-34-13 711 +1 G>T 5/5 16-25-13 7 16-25-13 1,2,3 1 16-26-13 1 G1349D 5/6 16-30-13 1/6 16-32-13 G178R 1/2 16-32-13 1 16-30-13 3 1/2 16-32-13 2 16-32-13 1 * References 1: Morral et al. 1996. Login to comment

[hide] The CFTR 3849+10kbC->T and 2789+5G->A alleles are ... Eur Respir J. 2005 Mar;25(3):468-73. Dugueperoux I, De Braekeleer M
The CFTR 3849+10kbC->T and 2789+5G->A alleles are associated with a mild CF phenotype.
Eur Respir J. 2005 Mar;25(3):468-73., [PMID:15738290]

Abstract [show]
Most cystic fibrosis (CF) transmembrane receptor mutations are rare. The French CF Registry offers an opportunity to study the genotype-phenotype relationship of these rare alleles. Since 1992, 39 CF patients carrying one copy of the 3849+10kbC->T mutation and 88 the 2789+5G->A allele have been seen at least once in a CF care centre. Among them, 16 carrying the 3849+10kbC->T/Delta F508 genotype and 34 with the 2789+5G->A/Delta F508 genotype were seen in 2000. Their age at diagnosis, sweat chloride concentration, anthropometric and lung function results, and clinical aspects were compared with those homozygous for the Delta F508 mutation matched for sex, age and CF care centre. Major differences, most of them statistically significant, in the age at diagnosis, prevalence of pancreatic insufficiency, and other clinical signs, anthropometric and lung function measures were observed between both compound heterozygote groups and their matched Delta F508/Delta F508 groups. The mean sweat chloride concentration was also lower (close to normal values) among 3849+10kbC->T/Delta F508 patients, but not among 2789+5G->A/Delta F508 patients. In conclusion, both mutations studied here are associated with a milder course of cystic fibrosis disease. The 3849+10kbC->T and 2789+5G->A alleles are splice site mutations, leading to abnormal mRNA; however, a small amount of normally spliced transcripts can also be detected. The presence of these small amounts of normal cystic fibrosis transmembrane receptor protein in these cystic fibrosis patients is likely to be responsible for the milder severity of disease and a better life expectancy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Two genotypes accounted for almost 80% of the patients, 3849+10kbC-.T/DF508 (n527, 69.2%) and 3849+10kbC-.T/ G542X (n54, 10.3%), and two siblings shared the G1244E allele (5.2%). Login to comment
63 Although only borderline significant, lung function was definitely better in the 3849+10kbC-.T/DF508 group (FEV1 83.0% and FVC 91.6% pred) than in the DF508 homozygote group (FEV1 59.9% TABLE 1 Genotypes identified among cystic fibrosis patients sharing the 3849+10kbC-.T or the 2789+5G-.A mutation Genotypes 3849+10kbC-.T 2789+5G-.A DI507 2 DF508 27 61 1525-1G-.A 1 1717-1G.A 1 2183AA.G 3 3129del4 1 3659delC 1 G542X 4 6 G551D 1 G970R 2 G1244E 2 L558S 1 M1V 1 N1303K 1 R347P 1 R553X 1 1 R1066C 1 S1251N 1 Unknown 1 6 Total 39 88 I. DUGUE´PE´ROUX AND M. DE BRAEKELEER MILD PHENOTYPE ASSOCIATED WITH TWO CFTR MUTATIONS c and FVC 76.9% pred). Login to comment

[hide] Mutation spectrum in Jewish cystic fibrosis patien... Am J Med Genet A. 2005 Jul 30;136(3):246-8. Quint A, Lerer I, Sagi M, Abeliovich D
Mutation spectrum in Jewish cystic fibrosis patients in Israel: implication to carrier screening.
Am J Med Genet A. 2005 Jul 30;136(3):246-8., 2005-07-30 [PMID:15948195]

Abstract [show]
We have tested 144 unrelated Jewish patients suffering from the classical form of cystic fibrosis. The patients were screened for a panel of 12 mutations including the six Ashkenazi founder mutations (DeltaF508, W1282X, N1303K, G542X, 3849 + 10 kb C-->T, 1717-1G > A) and six mutations that were found in non-Ashkenazi Jewish patients (S549R (T-->G), G85E, 405 + 1G-->A, W1089X, Y1092, and D1152H). Patients of Georgian origin were tested also for the Q359K/T360K mutation. In addition, all the patients were tested for the IVS-8 variant (9T/7T/5T). Of all the cystic fibrosis (CF)-bearing chromosomes, 94% (264/281) were accounted for by one of the known mutations, and none of the patients had the 5T allele of the IVS-8 variant. Single strand conformation polymorphism (SSCP) analysis of the coding sequence of the CFTR gene followed by sequencing showed eight mutations on ten CF chromosomes, leaving seven chromosomes (2.5%) with unknown mutations. We identified three mutations in two or more CF chromosomes, 2571 + 1insT in Jews from Iraq, 3121-1G > A in patients from Kurdistan and I1234V in Yemenite Jewish patients. The other five mutations appeared on a single allele and are considered "private mutations." In this study we have identified 99% of CF alleles in Ashkenazi Jewish patients, 91% in Jews of North African origin and 75% in Jewish patients from Iraq. The significance of these findings to the population screening in Israel is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The L997F and G1244E mutations were identified following SSCP analysis, each on a single chromosome, and three alleles (9%) remain unidentified. The mutation L997F was described in patients with atypical CF [Castellani et al., 2001a,b] and patients with congenital absence of vas deferens [Dork et al., 1997] and it is debatable as to whether this is a CF-causing mutation or just a sequence variant. Login to comment
58 Mutations in the CF Bearing Alleles in the Jewish Patients According to the Ethnic Origin Country of origin Ashkenazi Morocco Tunisia Balkan Iraq Iran/ Kurdistan Georgia Yemen Total Number of alleles (%) 193 (69.0) 34 (12.1) 12 (4.3) 21 (7.5) 8 (2.8) 3 (0.7) 8 (2.8) 2 (0.7) 281 W1282X (%) 83 (42.8) 1 (8.3) 4 (19.0) 88 (31.3) DF508 (%) 65 (33.5) 24 (70.6) 3 (25.0) 7 (33.3) 1 100 (35.6) N1303K (%) 10 (5.2) 10 (3.6) G542X (%) 19 (10.3) 4 (19.0) 24 (8.5) 3849-10 kbC!T (%) 10 (5.1) 1 (2.9) 2 (9.5) 13 (4.6) 1717-1G!A (%) 2 (1.0) 2 (0.7) D1152H (%) 1 (0.5) 1 (0.4) S549R (T!G) (%) 4 (11.8) 4 (1.4) G85E (%) 2 (9.5) 2 (0.7) 405 þ 1G!A (%) 8 (66.7) 8 (2.8) Y1092X (%) 3 (37.5) 3 (1.1) W1089X (%) 2 (9.5) 2 (0.7) Q359K/T360K (%) 8 (100) 8 (2.8) I1234V (%) 2 (100) 2 (0.7) 2751 þ 1insT (%) 2 (25.0) 2 (0.7) 3121-1G > A (%) 1 1 (0.4) M952I (%) 1 (12.5) 1 (0.4) L165S (%) 1 (0.5) 1 (0.4) A455E (%) 1 (0.5) 1 (0.4) L997F (%) 1 (2.9) 1 (0.4) G1244E (%) 1 (2.9) 1 (0.4) Unkown (%) 1 (0.5) 3 (8.8) 2 (25.0) 1 7 (2.5) Mutation Spectrum in Jewish CF Patients [Wahab, 2003]. Login to comment

[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]

Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T. Login to comment

[hide] Diversity of the basic defect of homozygous CFTR m... J Med Genet. 2008 Jan;45(1):47-54. Stanke F, Ballmann M, Bronsveld I, Dork T, Gallati S, Laabs U, Derichs N, Ritzka M, Posselt HG, Harms HK, Griese M, Blau H, Mastella G, Bijman J, Veeze H, Tummler B
Diversity of the basic defect of homozygous CFTR mutation genotypes in humans.
J Med Genet. 2008 Jan;45(1):47-54., [PMID:18178635]

Abstract [show]
BACKGROUND: Knowledge of how CFTR mutations other than F508del translate into the basic defect in cystic fibrosis (CF) is scarce due to the low incidence of homozygous index cases. METHODS: 17 individuals who are homozygous for deletions, missense, stop or splice site mutations in the CFTR gene were investigated for clinical symptoms of CF and assessed in CFTR function by sweat test, nasal potential difference and intestinal current measurement. RESULTS: CFTR activity in sweat gland, upper airways and distal intestine was normal for homozygous carriers of G314E or L997F and in the range of F508del homozygotes for homozygous carriers of E92K, W1098L, R553X, R1162X, CFTRdele2(ins186) or CFTRdele2,3(21 kb). Homozygotes for M1101K, 1898+3 A-G or 3849+10 kb C-T were not consistent CF or non-CF in the three bioassays. 14 individuals exhibited some chloride conductance in the airways and/or in the intestine which was identified by the differential response to cAMP and DIDS as being caused by CFTR or at least two other chloride conductances. DISCUSSION: CFTR mutations may lead to unusual electrophysiological or clinical manifestations. In vivo and ex vivo functional assessment of CFTR function and in-depth clinical examination of the index cases are indicated to classify yet uncharacterised CFTR mutations as either disease-causing lesions, risk factors, modifiers or neutral variants.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Several well characterised severe mutations occur in the evolutionarily conserved Walker (G1244E, G1249E) or dodecapeptide motifs (G551D, G1349D) of the ABC transporter CFTR.1 The missense mutants G622D23 in the regulatory domain and G314E in the fifth transmembrane region led to no clinical symptoms of CF. Login to comment

[hide] Phenotypic characterisation of patients with inter... Thorax. 2009 Aug;64(8):683-91. Epub 2009 Mar 23. Goubau C, Wilschanski M, Skalicka V, Lebecque P, Southern KW, Sermet I, Munck A, Derichs N, Middleton PG, Hjelte L, Padoan R, Vasar M, De Boeck K
Phenotypic characterisation of patients with intermediate sweat chloride values: towards validation of the European diagnostic algorithm for cystic fibrosis.
Thorax. 2009 Aug;64(8):683-91. Epub 2009 Mar 23., [PMID:19318346]

Abstract [show]
BACKGROUND: In patients with symptoms suggestive of cystic fibrosis (CF) and intermediate sweat chloride values (30-60 mmol/l), extensive CFTR gene mutation analysis and nasal potential difference (NPD) measurement are used as additional diagnostic tests and a positive result in either test provides evidence of CFTR dysfunction. To define the phenotype of such patients and confirm the validity of grouping them, patients with intermediate sweat chloride values in whom either additional CF diagnostic test was abnormal were compared with subjects in whom this was not the case and patients with classic CF. METHODS: The phenotypic features of four groups were compared: 59 patients with CFTR dysfunction, 46 with an intermediate sweat chloride concentration but no evidence of CFTR dysfunction (CF unlikely), 103 patients with CF and pancreatic sufficiency (CF-PS) and 62 with CF and pancreatic insufficiency (CF-PI). RESULTS: The CFTR dysfunction group had more lower respiratory tract infections (p = 0.01), more isolation of CF pathogens (p<0.001) and clubbing (p = 0.001) than the CF unlikely group, but less frequent respiratory tract infections with CF pathogens than the CF-PS group (p = 0.05). Patients in the CF-PS group had a milder phenotype than those with PI. Many features showed stepwise changes through the patient groups. CONCLUSION: Patients with intermediate sweat chloride values and two CFTR mutations or an abnormal NPD measurement have a CF-like phenotype compatible with CFTR dysfunction and, as a group, differ phenotypically from patients with intermediate sweat chloride values in whom further CF diagnostic tests are normal as well as from CF-PS and CF-PI patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Table 2 CFTR mutations in the patient subgroups CF-PS CFTR dysfunction CF unlikely Genotype Subjects (n) Genotype Subjects (n) Genotype Subjects (n) F508del*/Not found 12 F508del*/3849+10 kb(C.T){ 11 Not found/Not found 39 Not found/Not found 10 F508del*/R117H{ 7 F508del*/Not found 4 F508del*/3849+10 kb(C.T){ 7 F508del*/Not found 7 IVS8-5T{/Not found 1 F508del*/R347P{ 5 Not found/Not found 5 S1235E/E528E 1 F508del*/R117H{ 4 F508del*/D1152H{ 4 No mutation analysis 1 F508del*/2789+5G.A{ 4 F508del*/IVS8-5T{ 4 Total 46 F508del*/S945L* 3 F508del*/S945L* 2 2789+5G.A{/Not found 3 W1282X*/IVS8-5T{ 2 F508del*/3272-26 A.G{ 2 F508del*/R1070W{ 1 F508del*/A455E{ 2 F508del*/L159S 1 F508del*/711+5G.A 2 F508del*/T1246I 1 F508del*/2789+5G.A 2 F508del*/L165S 1 G542X*/R334W{ 2 W1282X*/D1152H{ 1 F508del*/R334W{ 2 R1162X*/D1152H{ 1 R347P{/Not found 2 R347Hu/D1152H{ 1 F508del*/2116delCTAA 1 R553X*/R117H{ 1 F508del*/IVS8-5T{ 1 3659delC*/R117H{ 1 F508del*/D1152H{ 1 3849+10kb(C.T){/G551R 1 F508del*/711+3A.G 1 R1162X*/3849+10 kb(C.T){ 1 F508del*/L206W{ 1 2789+5G.A{/Not found 1 F508del*/I336K{ 1 G542X*/T854A 1 F508del*/G970D 1 R553X*/Q1463H 1 F508del*/L159S 1 S1235R/R668C 1 F508del*/R751L 1 2789+5G.A{/S977F 1 F508del*/E656X 1 No mutation analysis 1 F508del*/4015delA 1 Total 59 F508del*/Y913S 1 F508del*/L165S 1 F508del*/2143delT 1 G551D*/I336K{ 1 G551D*/3272-26A.G{ 1 G551D*/711+3A.G 1 R553X*/4005+2T.C 1 R553X*/E92K{ 1 G542X*/L206W{ 1 W1282X*/I336K 1 R1162X*/3849+10 kb(C.T){ 1 R1162X*/2789+5G.A{ 1 574delA*/3141del9 1 9890X/I105N 1 R334W{/R1070Q{ 1 3272-26A.G{/4218insT 1 3272-26A.G{/L165S 1 711+3A.G/G1244E 1 R352Q/1812-1G.A 1 F1052V/IVS8-5T{ 1 R74W/D1270N 1 1898-3G.A/1898-3G.A 1 1717-1G.A*/R334W{ 1 3659delC*/Not found 1 394delTT/Not found 1 R1162X*/Not found 1 R553X*/Not found 1 R117H{/Not found 1 G85E*/Not found 1 3849+10k(C.T){/Not found 1 Total 103 *Mutation class I, II or III. Login to comment

[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT. Login to comment

[hide] Identification of the second CFTR mutation in pati... Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26. Giuliani R, Antonucci I, Torrente I, Grammatico P, Palka G, Stuppia L
Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols.
Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26., [PMID:20657600]

Abstract [show]
Congenital bilateral absence of vas deferens (CBAVD) is a manifestation of the mildest form of cystic fibrosis (CF) and is characterized by obstructive azoospermia in otherwise healthy patients. Owing to the availability of assisted reproductive technology, CBAVD patients can father children. These fathers are at risk of transmitting a mutated allele of the CF transmembrane conductance regulator (CFTR) gene, responsible for CF, to their offspring. The identification of mutations in both CFTR alleles in CBAVD patients is a crucial requirement for calculating the risk of producing a child with full-blown CF if the female partner is a healthy CF carrier. However, in the majority of CBAVD patients, conventional mutation screening is not able to detect mutations in both CFTR alleles, and this difficulty hampers the execution of correct genetic counselling. To obtain information about the most represented CFTR mutations in CBAVD patients, we analysed 23 CBAVD patients, 15 of whom had a single CFTR mutation after screening for 36 mutations and the 5T allele. The search for the second CFTR mutation in these cases was performed by using a triplex approach: (i) first, a reverse dot-blot analysis was performed to detect mutations with regional impact; (ii) next, multiple ligation-dependent probe amplification assays were conducted to search for large rearrangements; and (iii) finally, denaturing high-performance liquid chromatography was used to search for point mutations in the entire coding region. Using these approaches, the second CFTR mutation was detected in six patients, which increased the final detection rate to 60.8%.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Preconceptional identification of cystic fibrosis ... J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22. Coiana A, Faa' V, Carta D, Puddu R, Cao A, Rosatelli MC
Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program.
J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22., [PMID:21429822]

Abstract [show]
BACKGROUND: In Sardinia the mutational spectrum of CFTR gene is well defined. A mutation detection rate of 94% can be achieved by screening for 15 CFTR mutations with a frequency higher than 0.5%. The efficiency of this molecular test suggests that Sardinians may represent a suitable population for a preconceptional screening. METHODS: Five hundred couples of Sardinia descent were screened for 38 mutations using a semi-automated reverse-dot blot and PCR-gel electrophoresis assays. This mutation panel included the 15 most frequent CF alleles in Sardinia. RESULTS: We identified 38 CF carriers, revealing an overall frequency of 1/25 (4%). The most common CF allele was the p.Thr338Ile (T338I) (65%), followed by the p.Phe508del (F508del) (22.5%). We also identified one couple at risk and an asymptomatic female homozygote for the p.Thr338Ile allele. CONCLUSIONS: In spite of the low number of the couples tested, the results herein reported demonstrate the efficacy and efficiency of the preconceptional screening program and the high participation rate of the Sardinian population (99%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 Mutation nomenclaturea Alleles (%) T338I (p.Thr338Ile) 26 (65.0) F508del (p.Phe508del) 9 (22.5) N1303K (p.Asn1303Lys) 1 (2.5) 2183AANG (c.2051_2052delAAinsG) 1 (2.5) 621+1GNT (c.489+1GNT) 1 (2.5) exon 2 del (c.54-5811_164+2187del8108ins182) 1 (2.5) R347P (p.Arg347Pro) 1 (2.5) The 3849+10kbCNT (c.3717+12191CNT), G85E (p.Gly85Glu), 2789+5GNA (c.2657+5GNA), W1282X (p.Trp1282X), G1244E (p.Gly1244Glu), 711+5GNA (c.579+5GNA), 711+1GNT (c.579+1GNA), 4016insT (p.Ser1297PhefsX5), G542X (p.Gly542X), 1717-1GNA (c.1585-1GNA), R553X (p.Arg553X), Q552X (p.Gln552X), G551D (p.Gly551Asp), S549R (ANC) (p.Ser549Arg), I507del (p.Ile507del), F508C (p.Phe508Cys), I502T (p.Ile502Thr), 1706del17 (p.Gln525LeufsX37), 1677delTA (p.Tyr515X), R117H (p.Arg117His), D1152H (p.Asp1152His), L1065P (p.Leu1065Pro), R1066H (p.Arg1066His), L1077P (p.Leu1077Pro), 4382delA (p.Glu1418ArgfsX14), R1162X (p.Arg1162X), R1158X (p.Arg1158X), 1259 insA (p.Gln378AlafsX4), 852del22 (p.Gly241GlufsX13), S912X (p.Ser912X), and 991del5bp (p.Asn287LysfsX19) mutations included in the CF panel were not detected in the population tested. Login to comment

[hide] Detection of CFTR mutations using temporal tempera... Electrophoresis. 2004 Aug;25(15):2593-601. Wong LJ, Alper OM
Detection of CFTR mutations using temporal temperature gradient gel electrophoresis.
Electrophoresis. 2004 Aug;25(15):2593-601., [PMID:15300780]

Abstract [show]
Cystic fibrosis (CF), caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, is one of the most common autosomal recessive diseases with variable incidences and mutation spectra among different ethnic groups. Current commercially available mutation panels designed for the analysis of known recurrent mutations have a detection rate between 38 to 95%, depending upon the ethnic background of the patient. We describe the application of a novel mutation detection method, temporal temperature gradient gel electrophoresis (TTGE), to the study of the molecular genetics of Hispanic CF patients. TTGE effectively identified numerous rare and novel mutations and polymorphisms. One interesting observation is that the majority of the novel mutations are splice site, frame shift, or nonsense mutations that cause severe clinical phenotypes. Our data demonstrate that screening of the 27 exons and intron/exon junctions of the CFTR gene by TTGE greatly improves the molecular diagnosis of Hispanic CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
133 Identification of rare and novel mutations and polymorphisms Base substitution Mutation Exon or intron Homozygote or heterozygote Polymorphism or mutation # Alleles identified 1 c.124_146del23bp Frameshift 1 Heterozygote Mutation 1 2 c.296+2T>A Splice Int 2 Heterozygote Mutation 1 3 c.296+28A/G Int 2 Homozygote Polymorphism 2 4 c.355CT p.R75X 3 Heterozygote Mutation 2 5 c.360_365insT Frameshift 3 Heterozygote Mutation 1 6 c.379_381insT Frameshift 3 Heterozygote Mutation 1 7 c.406-1G>A Splice Int 4 Heterozygote Mutation 2 8 c.424C.T p.Q98X 4 Heterozygote Mutation 1 9 c.425A.G p.Q98R 4 Heterozygote Mutation 3 10 c.586A.G p.M152V 4 Homozygote Mutation 2 11 c.663delT Frameshift 5 Heterozygote Mutation 3 12 c.667C>A p.Q179K 5 Heterozygote Mutation, 1 13 c.745C.T p.P205S 6a Heterozygote Mutation 5 14 c.875140A/G 6a Heterozygote Polymorphism 11 15 c.935delA Frameshift 6b Heterozygote Mutation 2 16 c.124811G.A Splice Int 7 Heterozygote Mutation 2 17 c.1285ins TA Frameshift 8 Heterozygote Mutation 4 Homozygote Mutation 2 18 c.1342+196C/T Int 8 Heterozygote Polymorphism 4 Homozygote 2 19 c.1461insAGAT Frameshift 9 Heterozygote Mutation 1 20 c.1525-61A/G 10 Heterozygote Polymorphism 22 21 c.1529C.A/G p.S466X 10 Heterozygote Mutation 1 22 c.1607C.T p.S492F 10 Heterozygote Mutation 3 23 c.1814C.T p.A561E 12 Heterozygote Mutation 1 24 c.189813A.G Splice Int 12 Heterozygote Mutation 1 25 c.18981152T/A Int 12 Heterozygote Polymorphism 5 26 c.1924del 7bp Frameshift 13 Heterozygote Mutation 1 27 c.1949del84 Frameshift 13 Heterozygote Mutation 1 28 c.2055del9toA Frameshift 13 Homozygote Mutation 2 29 c.2105_2117 Frameshift 13 Heterozygote Mutation 4 del13insAGAAA 30 c.2108delA Frameshift 13 Heterozygote Mutation 1 31 c.2184insA Frameshift 13 Heterozygote Mutation 2 32 c.2184delA Frameshift 13 Heterozygote Mutation 1 33 c.2289_2295 Frameshift 13 Heterozygote Mutation 1 del7insGT 34 c.2694T.G p.T854T 14a Heterozygote Polymorphism 10 35 c.2752+12G/C Int 14a Heterozygote Polymorphism 2 36 c.2800C.T p.Q890X 15 Homozygote Mutation 2 37 c.3171delC Frameshift 17a Heterozygote Mutation 1 38 c.3179T>C p.F1016S 17a Heterozygote Mutation 1 39 c.3199del 6bp Frameshift 17a Heterozygote Mutation 1 40 c.3212T.C p.I1027T 17a Heterozygote Mutation 1 41 c.3272-26A.G Splice Int17a Heterozygote Mutation 4 42 c.3271delGG Frameshift 17a Heterozygote Mutation 1 43 c.3313G.C p.G1061R 17b Heterozygote Mutation 1 44 c.3328C.T p.R1066C 17b Heterozygote Mutation 2 45 c.3362T.C p.L1077P 17b Heterozygote Mutation 1 46 c.3431A.C p.Q1100P 17b Heterozygote Mutation 1 47 c.3500-2A>T Splice Int 17b Heterozygote Mutation 1 48 c.3743G.A p.W1204X 19 Heterozygote Mutation 1 Homozygote Mutation 2 49 c.3601-65C/A Int 19 Heterozygote Polymorphism 14 50 c.3863G.A p.G1244E 20 Heterozygote Mutation 3 Table 3. Login to comment

[hide] A neutral variant involved in a complex CFTR allel... Hum Genet. 2005 May;116(6):454-60. Epub 2005 Mar 3. Clain J, Lehmann-Che J, Girodon E, Lipecka J, Edelman A, Goossens M, Fanen P
A neutral variant involved in a complex CFTR allele contributes to a severe cystic fibrosis phenotype.
Hum Genet. 2005 May;116(6):454-60. Epub 2005 Mar 3., [PMID:15744523]

Abstract [show]
In order to further elucidate the contribution of complex alleles to the wide phenotypic variability of cystic fibrosis (CF), we investigated the structure-function relationships of a severe CF-associated complex allele [p.S912L;p.G1244V]. To evaluate the contribution of each mutation to the phenotype, cystic fibrosis transmembrane conductance regulator (CFTR) mutants were expressed in HeLa cells and analysed for protein processing and Cl- channel activity. Both p.G1244V and [p.S912L;p.G1244V] mutants had normal protein processing but markedly decreased Cl- channel activity compared with wild-type. Notably, the double mutant displayed a dramatic decrease in Cl- channel activity compared with p.G1244V (P<0.001). p.S912L had normal protein processing and no detectable impact on CFTR function. In other respects, the p.S912L variation was identified in compound heterozygosity with p.R709X in a healthy fertile man. Together, these data strongly support the view that p.S912L in isolation should be considered as a neutral variant but one that might significantly impair CFTR function when inherited in cis with another CFTR mutation. Our data also further document the contribution of complex alleles to the wide phenotypic variability of CF. The results of functional studies of such complex alleles in other genetic diseases are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
94 At the same location, the severe CF-associated p.G1244E mutation (Devoto et al. 1991) exhibits a defect in the open state probability of the CFTR protein (Anderson and Welsh 1992). Login to comment

[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]

Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4. Login to comment

[hide] Homozygous CFTR mutation M348K in a boy with respi... Eur J Pediatr. 2012 Jul;171(7):1039-46. doi: 10.1007/s00431-012-1672-1. Epub 2012 Jan 25. Hentschel J, Riesener G, Nelle H, Stuhrmann M, Schoner A, Sommerburg O, Fritzsching E, Mall MA, von Eggeling F, Mainz JG
Homozygous CFTR mutation M348K in a boy with respiratory symptoms and failure to thrive. Disease-causing mutation or benign alteration?
Eur J Pediatr. 2012 Jul;171(7):1039-46. doi: 10.1007/s00431-012-1672-1. Epub 2012 Jan 25., [PMID:22274833]

Abstract [show]
We report on a 6-month-old premature boy from consanguineous parents. He presented with respiratory distress, necrotizing enterocolitis and hyperbilirubinemia shortly after birth. Persisting respiratory symptoms and failure to thrive prompted cystic fibrosis diagnostics, which showed the lack of wild-type signal for the mutation R347P suggesting a homozygous deletion or an alteration different from the known mutation at this position. Sequencing of this region revealed the homozygous substitution 1175 T > A (HGVS: c.1043 T > A) in exon 7 resulting in the homozygous amino acid change M348K. This mutation has never been reported in homozygosity before. Computational analysis tools classified M348K as 'presumably disease causing.' In our patient, sweat testing and electrophysiological assessment of CFTR function in native rectal epithelium demonstrated normal Cl(-) secretion. Conclusion: We assume that the homozygous alteration M348K is a harmless variant rather than a CF-causing mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 Previously, a clinically affected individual was described carrying G1244E and N1303K [5]. Login to comment
28 The healthy father was found to be compound heterozygous for M348K and G1244E. Login to comment

[hide] Retrospective analysis of stored dried blood spots... J Cyst Fibros. 2012 Jul;11(4):332-6. doi: 10.1016/j.jcf.2012.01.001. Epub 2012 Feb 1. Barben J, Gallati S, Fingerhut R, Schoeni MH, Baumgartner MR, Torresani T
Retrospective analysis of stored dried blood spots from children with cystic fibrosis and matched controls to assess the performance of a proposed newborn screening protocol in Switzerland.
J Cyst Fibros. 2012 Jul;11(4):332-6. doi: 10.1016/j.jcf.2012.01.001. Epub 2012 Feb 1., [PMID:22300503]

Abstract [show]
BACKGROUND: Newborn screening (NBS) for Cystic Fibrosis (CF) has been introduced in many countries, but there is no ideal protocol suitable for all countries. This retrospective study was conducted to evaluate whether the planned two step CF NBS with immunoreactive trypsinogen (IRT) and 7 CFTR mutations would have detected all clinically diagnosed children with CF in Switzerland. METHODS: IRT was measured using AutoDELFIA Neonatal IRT-Kit in stored NBS cards. RESULTS: Between 2006 and 2009, 66 children with CF were reported, 4 of which were excluded for various reasons (born in another country, NBS at 6 months, no informed consent). 98% (61/62) had significantly higher IRT compared to matched control group. There was one false negative IRT result in an asymptomatic child with atypical CF (normal pancreatic function and sweat test). CONCLUSIONS: All children but one with atypical CF would have been detected with the planned two step protocol.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 CFTR mutations Alleles found Percentage of total Homozygous (n) F508del a 86 68.2 30 3905insT a 4 3.2 1 G542X a 3 2.4 - R553X a 3 2.4 1 W1282X a 2 1.6 - 1717-1 GNA a 2 1.6 - N1303K a 0 0.0 - S549R 3 2.4 1 Q525X 3 2.4 - Y1092X 2 1.6 - 3120+1 GNA b 2 1.6 1 2347delG 2 1.6 - 2176insC 1 0.8 - 3659delC 1 0.8 - 3359delCTCTG 1 0.8 - W1089X 1 0.8 - 711+1 GNT 1 0.8 - D1152H 1 0.8 - G1244E 1 0.8 - R1066C 1 0.8 - R31C 1 0.8 - R347P 1 0.8 - R74W 1 0.8 - S945L 1 0.8 - T501I 1 0.8 - K68X 1 0.8 - Total 126 100.0% 34 a Seven most common CF-gene mutations in Switzerland ("Swiss panel")=79.4% (100/126) of alleles. Login to comment

[hide] Ivacaftor potentiation of multiple CFTR channels w... J Cyst Fibros. 2012 May;11(3):237-45. doi: 10.1016/j.jcf.2011.12.005. Epub 2012 Jan 30. Yu H, Burton B, Huang CJ, Worley J, Cao D, Johnson JP Jr, Urrutia A, Joubran J, Seepersaud S, Sussky K, Hoffman BJ, Van Goor F
Ivacaftor potentiation of multiple CFTR channels with gating mutations.
J Cyst Fibros. 2012 May;11(3):237-45. doi: 10.1016/j.jcf.2011.12.005. Epub 2012 Jan 30., [PMID:22293084]

Abstract [show]
BACKGROUND: The investigational CFTR potentiator ivacaftor (VX-770) increased CFTR channel activity and improved lung function in subjects with CF who have the G551D CFTR gating mutation. The aim of this in vitro study was to determine whether ivacaftor potentiates mutant CFTR with gating defects caused by other CFTR gating mutations. METHODS: The effects of ivacaftor on CFTR channel open probability and chloride transport were tested in electrophysiological studies using Fischer rat thyroid (FRT) cells expressing different CFTR gating mutations. RESULTS: Ivacaftor potentiated multiple mutant CFTR forms with defects in CFTR channel gating. These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations. CONCLUSION: These in vitro data suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support investigation of the potential clinical benefit of ivacaftor in CF patients who have CFTR gating mutations beyond G551D.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations. Login to comment
23 Other known CFTR gating mutations include G178R, G551S, G970R, G1244E, S1255P, and G1349D [9-11]. Login to comment
39 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11]. Login to comment
46 This analysis showed that, as expected for known CFTR gating mutations (G551D, G178R, G551S, G970R, G1244E, S1255P, and G1349D) [5,9-11], the amount of CFTR delivered to the cell surface was generally similar between CFTR with gating defects and normal CFTR. Login to comment
50 Ivacaftor increased the channel gating of mutant CFTR with defective channel gating The effect of ivacaftor on CFTR channel gating was monitored by quantifying the channel open probability by patch-clamp electrophysiology using membrane patches excised from FRT cells expressing the known CFTR gating mutations, G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, or G1349D-CFTR. Login to comment
52 Under these conditions, the baseline CFTR channel open probability of G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, and G1349D-CFTR was ≤5% of normal CFTR (Fig. 2, B; Table 1). Login to comment
53 For most mutant CFTR forms, the single channel current amplitude, a measure of channel conductance, was similar to normal CFTR (between 77% and 122% of normal CFTR), although a small but statistically significant difference in single channel current amplitude was observed for S1255P-CFTR (Table 1). Login to comment
58 Ivacaftor enhanced chloride transport through mutant CFTR with defective channel gating The impact of the increase in CFTR channel gating by ivacaftor on total chloride transport was assessed in Ussing chamber studies using FRT cells expressing the known CFTR gating mutations, G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, and G1349D-CFTR. Login to comment
71 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTRmRNA (%NormalCFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTRMaturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations MatureCFTR (%NormalCFTR) A B D C Mature Immature Fig. 1. Login to comment
96 Taken together, these in vitro results provide a rationale for testing the potential benefit of ivacaftor in individuals with CF who have a CFTR gating mutation other than G551D, including the G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P, and G1349D CFTR gating mutations. Login to comment
97 Evaluation of CF-associated CFTR mutations that were expected to cause protein alterations in the ATP-binding sites formed by the NBDs indicated that S549N- and S1251N-CFTR also shared similar in vitro functional characteristics with G551D-CFTR and could be classified as CFTR gating mutations. Login to comment
99 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 µM Ivacaftor * * * * * * * * * * * CFTR Mutation ChannelOpenProbability ChannelOpenProbability (%NormalCFTR) B 1pA 3sec + 10 µM Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2. Login to comment
127 Like G551D, the G551S, G1244E, S1255P, and G1349D CFTR gating mutations, as well as the S549N, S549R, and S1251N CFTR gating mutations identified in the Table 1 Effect of ivacaftor on the channel gating activity of CFTR with gating mutations. Login to comment
128 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 μM ivacaftor Baseline With 10 μM ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57±0.03 100 0.63±0.02 111 0.400±0.04 100 0.800±0.04 a 200 G551D 0.46±0.06 81 0.46±0.03 81 0.019±0.01 b 5 0.121±0.035 a 30 G178R 0.59±0.11 103 0.66±0.08 116 0.005±0.001 b 1 0.228±0.022 a 57 S549N 0.55±0.02 97 0.61±0.02 108 0.003±0.010 b 1 0.396±0.119 a 99 S549R 0.45±0.01 b 79 0.55±0.02 a 96 0.004±0.010 b 1 0.143±0.031 a 36 G551S 0.57±0.13 100 0.64±0.02 113 0.010±0.001 b 3 0.337±0.110 a 84 G970R 0.55±0.03 96 0.55±0.03 97 0.001±0.001 b 0 0.245±0.042 a 61 G1244E 0.44±0.11 77 0.54±0.08 94 0.011±0.010 b 3 0.470±0.122 a 118 S1251N 0.54±0.07 95 0.63±0.04 111 0.003±0.010 b 1 0.350±0.03 a 88 S1255P 0.70±0.03 b 122 0.71±0.02 125 0.018±0.016 b 5 0.468±0.168 a 117 G1349D 0.49±0.08 85 0.63±0.06 111 0.019±0.015 b 5 0.315±0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation. Login to comment
130 0 100 200 300 400 -9 -8 -7 -6 -5 -4 G178R G551D G551S 0 S549N S549R Ivacaftor [Log M] 0 100 200 300 400 0 50 100 150 200 -9 -8 -7 -6 -5 -4 G970R G1244E S1255P G1349D 0 S1251N Ivacaftor [Log M] ChlorideTransport (%NormalCFTR) Normal Forskolin G178R G551S G970R G1244E 50 2 1 min S1255P Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 0 50 100 150 200 * * * * * * * * * * * * * CFTR Mutation ChlorideTransport(µA/cm2)ChlorideTransport(µA/cm2) ChlorideTransport(A/cm2) ChlorideTransport (%NormalCFTR) B G1349D G551D A F508del C S549N S549R S1251N Baseline Baseline present study, cause protein alterations in the ATP binding pockets formed by the two NBDs required for normal CFTR channel gating (Fig. 4) [2]. Login to comment
131 The G178R and G970R CFTR gating mutations alter the intracellular cytoplasmic loops that are believed to link the ATP-driven conformational changes in the NBDs to the opening of the CFTR channel pore formed by the membrane spanning domains [27]. Login to comment
144 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D. Login to comment
24 Other known CFTR gating mutations include G178R, G551S, G970R, G1244E, S1255P, and G1349D [9-11]. Login to comment
40 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11]. Login to comment
47 This analysis showed that, as expected for known CFTR gating mutations (G551D, G178R, G551S, G970R, G1244E, S1255P, and G1349D) [5,9-11], the amount of CFTR delivered to the cell surface was generally similar between CFTR with gating defects and normal CFTR. Login to comment
51 Ivacaftor increased the channel gating of mutant CFTR with defective channel gating The effect of ivacaftor on CFTR channel gating was monitored by quantifying the channel open probability by patch-clamp electrophysiology using membrane patches excised from FRT cells expressing the known CFTR gating mutations, G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, or G1349D-CFTR. Login to comment
59 Ivacaftor enhanced chloride transport through mutant CFTR with defective channel gating The impact of the increase in CFTR channel gating by ivacaftor on total chloride transport was assessed in Ussing chamber studies using FRT cells expressing the known CFTR gating mutations, G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, and G1349D-CFTR. Login to comment
72 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTR mRNA (% Normal CFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTR Maturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations Mature CFTR (% Normal CFTR) A B D C Mature Immature Fig. 1. Login to comment
100 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 &#b5;M Ivacaftor * * * * * * * * * * * CFTR Mutation Channel Open Probability Channel Open Probability (% Normal CFTR) B 1pA 3sec + 10 &#b5;M Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2. Login to comment
129 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 bc;M ivacaftor Baseline With 10 bc;M ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57&#b1;0.03 100 0.63&#b1;0.02 111 0.400&#b1;0.04 100 0.800&#b1;0.04 a 200 G551D 0.46&#b1;0.06 81 0.46&#b1;0.03 81 0.019&#b1;0.01 b 5 0.121&#b1;0.035 a 30 G178R 0.59&#b1;0.11 103 0.66&#b1;0.08 116 0.005&#b1;0.001 b 1 0.228&#b1;0.022 a 57 S549N 0.55&#b1;0.02 97 0.61&#b1;0.02 108 0.003&#b1;0.010 b 1 0.396&#b1;0.119 a 99 S549R 0.45&#b1;0.01 b 79 0.55&#b1;0.02 a 96 0.004&#b1;0.010 b 1 0.143&#b1;0.031 a 36 G551S 0.57&#b1;0.13 100 0.64&#b1;0.02 113 0.010&#b1;0.001 b 3 0.337&#b1;0.110 a 84 G970R 0.55&#b1;0.03 96 0.55&#b1;0.03 97 0.001&#b1;0.001 b 0 0.245&#b1;0.042 a 61 G1244E 0.44&#b1;0.11 77 0.54&#b1;0.08 94 0.011&#b1;0.010 b 3 0.470&#b1;0.122 a 118 S1251N 0.54&#b1;0.07 95 0.63&#b1;0.04 111 0.003&#b1;0.010 b 1 0.350&#b1;0.03 a 88 S1255P 0.70&#b1;0.03 b 122 0.71&#b1;0.02 125 0.018&#b1;0.016 b 5 0.468&#b1;0.168 a 117 G1349D 0.49&#b1;0.08 85 0.63&#b1;0.06 111 0.019&#b1;0.015 b 5 0.315&#b1;0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation. Login to comment
145 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D. Login to comment

[hide] Extensive molecular analysis of patients bearing C... J Mol Diagn. 2012 Jan;14(1):81-9. Epub 2011 Oct 20. Amato F, Bellia C, Cardillo G, Castaldo G, Ciaccio M, Elce A, Lembo F, Tomaiuolo R
Extensive molecular analysis of patients bearing CFTR-related disorders.
J Mol Diagn. 2012 Jan;14(1):81-9. Epub 2011 Oct 20., [PMID:22020151]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR)-related disorders (CFTR-RDs) may present with pancreatic sufficiency, normal sweat test results, and better outcome. The detection rate of mutations is lower in CFTR-RD than in classic CF: mutations may be located in genes encoding proteins that interact with CFTR or support channel activity. We tested the whole CFTR coding regions in 99 CFTR-RD patients, looking for gene mutations in solute carrier (SLC) 26A and in epithelial Na channel (ENaC) in 33 patients who had unidentified mutations. CFTR analysis revealed 28 mutations, some of which are rare. Of these mutations, RT-PCR demonstrated that the novel 1525-1delG impairs exon 10 splicing; by using minigene analysis, we excluded the splicing effect of three other novel intronic variants. Analysis of SLC26A genes revealed several variants, some of which are novel, that did not affect mRNA expression. Other mutations occurred in the ENaC genes encoding the ENaC subunits, but their frequency did not significantly differ between patients and controls. Our data, although obtained on a preliminary cohort of CFTR-RD patients, exclude a role of mutations in SLC26A and in SCNN genes in the pathogenesis of such disease; we confirm that CFTR analysis has a relevant role in CFTR-RD patients; and it appears mandatory to use CFTR scanning techniques and approaches to reveal the effect of novel mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 Allele Frequency and CFTR Mutations in Patients Bearing CFTR-RDs Mutation (traditional name) HGVS nomenclature15 CBAVD (118 alleles)* RP (42 alleles)* DB (38 alleles)* Total (198 alleles)* TG12-T5-470V 34 (28.8) 2 (4.8) 10 (26.3) 46 (23.2) F508del c.1521_1523del 19 (16.1) 7 (16.7) 4 (10.5) 30 (15.2) 3195del6 c.3063_3069del 9 (7.6) 0 0 9 (4.5) N1303K c.3909CϾG 3 (2.5) 1 (2.4) 4 (10.5) 8 (4.0) G542X c.1624GϾT 4 (3.4) 1 (2.4) 1 (2.6) 6 (3.0) D1152H c.3454GϾC 1 (0.8) 2 (4.8) 2 (5.3) 5 (2.5) G85E c.254GϾA 2 (1.7) 3 (7.1) 0 5 (2.5) 1525-1delG c.1394de 3 (2.5) 1 (2.4) 0 4 (3.0) 4016insT c.3885insT 2 (1.7) 1 (2.4) 0 3 (1.5) 2789ϩ5GϾA c.2657ϩ5GϾA 0 3 (7.1) 0 3 (1.5) Q1476X c.4426CϾT 3 (2.5) 0 0 3 (1.5) 2183AAϾG c.2051_2052delinsG 1 (0.8) 1 (2.4) 0 2 (1.0) R553X c.1657CϾT 1 (0.8) 1 (2.4) 0 2 (1.0) L568F c.1704GϾT 2 (1.7) 0 0 2 (1.0) R1158X c.3472CϾT 2 (1.7) 0 0 2 (1.0) V920M c.2758GϾA 1 (0.8) 0 1 (2.6) 2 (1.0) 711ϩ1GϾT c.579ϩ1GϾT 0 1 (2.4) 0 1 (0.5) D614G c.1841AϾG 1 (0.8) 0 0 1 (0.5) 2184insA c.2052del 0 1 (2.4) 0 1 (0.5) 621ϩ1GϾT c.489ϩ1GϾT 1 (0.8) 0 0 1 (0.5) R1438W c.4312CϾT 0 1 (2.4) 0 1 (0.5) E193X c.577GϾT 0 1 (2.4) 0 1 (0.5) G1244E c.3731GϾA 1 (0.8) 0 0 1 (0.5) K68E c.202AϾG 1 (0.8) 0 0 1 (0.5) R347P c.1040GϾC 1 (0.8) 0 0 1 (0.5) 621ϩ3AϾG c.489ϩ3AϾG 1 (0.8) 0 0 1 (0.5) L997F c.2991GϾC 0 1 (2.4) 0 1 (0.5) F508C c.1523TϾG 1 (0.8) 0 0 1 (0.5) Total 94 (79.7) 28 (66.7) 22 (57.9) 144 (72.7) Undetected 24 (20.3) 14 (33.3) 16 (42.1) 54 (27.3) *Data are given as number (percentage). Login to comment
89 In one CBAVD patient, 1525-1delG was in cis with the R74W variant and the other chromosome carried the G1244E mutation. Login to comment
156 On the other hand, the known 1525-1GϾA mutation that involves the same nucleotide also causes the activation of novel splicing sites within exon 10.18 A CBAVD patient had a complex genotype (ie, G1244E, R74W, and 1525-1delG), the latter in cis with R74W. Login to comment
158 The patient had the severe G1244E mutation37 on the other chromosome, and he was affected only by CBAVD without any other sign of CF. Login to comment

[hide] Improvement in clinical markers in CF patients usi... J Cyst Fibros. 2008 Sep;7(5):433-6. Epub 2008 May 21. Visca A, Bishop CT, Hilton SC, Hudson VM
Improvement in clinical markers in CF patients using a reduced glutathione regimen: an uncontrolled, observational study.
J Cyst Fibros. 2008 Sep;7(5):433-6. Epub 2008 May 21., [PMID:18499536]

Abstract [show]
CFTR mutation, which causes cystic fibrosis (CF), has also recently been identified as causing glutathione system dysfunction and systemic deficiency of reduced glutathione (GSH). Such dysfunction and deficiency regarding GSH may contribute to the pathophysiology of CF. We followed 13 patients (age range 1-27 years) with cystic fibrosis who were using a regimen of reduced glutathione (GSH), including oral glutathione and inhaled buffered glutathione in an uncontrolled, observational study. Dosage ranged from 66-148 mg/kg/day in divided doses, and the term examined was the initial 5.5 months of GSH use (45 days of incrementally adjusted dose, plus 4 months of use at full dosage). Baseline and post-measurements of FEV1 percent predicted, BMI percentile, and weight percentile were noted, in addition to bacterial status and pulmonary exacerbations. Significant improvement in the following clinical parameters was observed: average improvement in FEV1 percent predicted (N=10) was 5.8 percentage points (p<0.0001), average weight percentile (N=13) increased 8.6 points (p<0.001), BMI percentile (N=11) improved on average 1.22 points (p<0.001). All patients improved in FEV1 and BMI, if measured in their case; 12 of 13 patients improved in weight percentile. Positive sputum cultures of bacteria in 11 patients declined from 13 to 5 (p<0.03) with sputum cultures of Pseudomonas aeruginosa becoming negative in 4 of 5 patients previously culturing PA, including two of three patients chronically infected with PA as determined by antibody status. Use of a daily GSH regimen appears to be associated in CF patients with significant improvement in lung function and weight, and a significant decline in bacteria cultured in this uncontrolled study. These findings bear further clinical investigation in larger, randomized, controlled studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 65 64 71 28.5 28 30 9 5 6 PA PA none 3, F, 19 DF508/G1244E 47 48 55 43 43 48 3 3 9 PA b PAb PA 4, M, 5 DF508/R347P NA NA NA 17 17.5 19 33 33 40 SA SA none 5, M, 24 W1282G/G542X 60 58 70 51 51.5 57 3 3 7 BC BC BC 6, F, 14 3659delC/? Login to comment
44 70 71 72 42 42 49 20 17 41 none SA none 7, F, 8 DF508/DF508 66 66 69 21 20.5 23 12 6 14 SA SA,H none 8, F, 7 Y1182X/G1244E 73 72 75 21 20.5 21.5 35 23 21 none none none 9, M, 27 DF508/2183delAA 38 38 44 53 53 58.5 3 3 10 PA b PAb SA 10, M, 22 2183delAA/? Login to comment
64 15.1 15.3 1 0 36 30 3, F, 19 DF508/G1244E 16.3 18.3 0 0 9 18 4, M, 5 DF508/R347P 14.7 15.4 0 1 11 11 5, M, 24 W1282G/G542X 17.8 19.7 1 0 16 20 6, F, 14 3659delC/? Login to comment
65 16.6 19.3 0 0 22 22 7, F, 8 DF508/DF508 14.0 15.0 2 1 34 14 8, F, 7 Y1182X/G1244E 15.5 15.7 0 0 28 20 9, M, 27 DF508/2183delAA 18.1 20.0 3 1 48 31 10, M, 22 2183delAA/? Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Table 1. Continued CFTR location Amino acid change Nucleotide change 141 IVS 16 Splicing defect 3120 ϩ 1GϾA 142 IVS 16 Splicing defect 3121 - 2AϾG 143 IVS 16 Splicing defect 3121 - 2AϾT 144 E 17a Frameshift 3132delTG 145 E 17a I1005R 3146TϾG 146 E 17a Frameshift 3171delC 147 E 17a Frameshift 3171insC 148 E 17a del V1022 and I1023 3199del6 149 E 17a Splicing defect 3271delGG 150 IVS 17a Possible splicing defect 3272 - 26AϾG 151 E 17b G1061R 3313GϾC 152 E 17b R1066C 3328CϾT 153 E 17b R1066S 3328CϾA 154 E 17b R1066H 3329GϾA 155 E 17b R1066L 3329GϾT 156 E 17b G1069R 3337GϾA 157 E 17b R1070Q 3341GϾA 158 E 17b R1070P 3341GϾC 159 E 17b L1077P 3362TϾC 160 E 17b W1089X 3398GϾA 161 E 17b Y1092X (TAA) 3408CϾA 162 E 17b Y1092X (TAG) 3408CϾG 163 E 17b L1093P 3410TϾC 164 E 17b W1098R 3424TϾC 165 E 17b Q1100P 3431AϾC 166 E 17b M1101K 3434TϾA 167 E 17b M1101R 3434TϾG 168 IVS 17b 3500 - 2AϾT 3500 - 2AϾT 169 IVS 17b Splicing defect 3500 - 2AϾG 170 E 18 D1152H 3586GϾC 171 E 19 R1158X 3604CϾT 172 E 19 R1162X 3616CϾT 173 E 19 Frameshift 3659delC 174 E 19 S1196X 3719CϾG 175 E 19 S1196T 3719TϾC 176 E 19 Frameshift and K1200E 3732delA and 3730AϾG 177 E 19 Frameshift 3791delC 178 E 19 Frameshift 3821delT 179 E 19 S1235R 3837TϾG 180 E 19 Q1238X 3844CϾT 181 IVS 19 Possible splicing defect 3849 ϩ 4AϾG 182 IVS 19 Splicing defect 3849 ϩ 10 kb CϾT 183 IVS 19 Splicing defect 3850 - 1GϾA 184 E 20 G1244E 3863GϾA 185 E 20 G1244V 3863GϾT 186 E 20 Frameshift 3876delA 187 E 20 G1249E 3878GϾA 188 E 20 S1251N 3884GϾA 189 E 20 T1252P 3886AϾC 190 E 20 S1255X 3896CϾA and 3739AϾG in E19 191 E 20 S1255L 3896CϾT 192 E 20 Frameshift 3905insT 193 E 20 D1270N 3940GϾA 194 E 20 W1282R 3976TϾC 195 E 20 W1282X 3978GϾA 196 E 20 W1282C 3978GϾT 197 E 20 R1283M 3980GϾT 198 E 20 R1283K 3980GϾA 199 IVS 20 Splicing defect 4005 ϩ 1GϾA 200 E 21 Frameshift 4010del4 201 E 21 Frameshift 4016insT 202 E 22 Inframe del E21 del E21 203 E 21 N1303K 4041CϾG 204 E 24 Frameshift 4382delA Genomic and Synthetic Template Samples Where possible, native genomic DNA was collected. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 Spectrum of CFTR Sequence Variants in 257 Hispanic Patients Who Underwent Diagnostic DNA Testing for CF Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) ACMG/ACOG recommended 25 mutation panel* DeltaF508 53 28.96 10.31 G542X 7 3.83 1.36 R334W 2 1.09 0.39 R553X 2 1.09 0.39 DeltaI507 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 3120 ϩ 1 GϾA 1 0.55 0.19 7 different mutations 67 36.61 13.04 All mutations included ACMG/ACOG 1248 ϩ 1 GϾA 1 0.55 0.19 1249 - 29delAT 1 0.55 0.19 1288insTA1288insTA 1 0.55 0.19 1341 ϩ 80 GϾA1341 ϩ 80 GϾA 1 0.55 0.19 1429del71429del7 1 0.55 0.19 1525 - 42 GϾA1525 - 42 GϾA 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 1717 - 8 GϾA 2 1.09 0.39 1811 ϩ 1 GϾA1811 ϩ 1 GϾA 1 0.55 0.19 2055del9-ϾA 3 1.64 0.58 2105-2117del13insAGAAA 1 0.55 0.19 2215insG 1 0.55 0.19 2585delT2585delT 1 0.55 0.19 2752 - 6 TϾC 1 0.55 0.19 296 ϩ 28 AϾG 1 0.55 0.19 3120 ϩ 1 GϾ A 1 0.55 0.19 3271 ϩ 8 AϾG3271 ϩ 8 AϾG 1 0.55 0.19 3271delGG 1 0.55 0.19 3272 - 26 AϾG 2 1.09 0.39 3876delA 2 1.09 0.39 4016insT 1 0.55 0.19 406 - 1 GϾA 6 3.28 1.17 406 - 6 TϾC 1 0.55 0.19 4374 ϩ 13 A ϾG 1 0.55 0.19 663delT 1 0.55 0.19 874insTACA874insTACA 1 0.55 0.19 A1009T 2 1.09 0.39 A559T 1 0.55 0.19 D1152H 1 0.55 0.19 D1270N 3 1.64 0.58 D1445N 2 1.09 0.39 D836Y 1 0.55 0.19 DeltaF311 1 0.55 0.19 DeltaF508 53 28.96 10.31 DeltaI507 1 0.55 0.19 E116K 2 1.09 0.39 E585X 1 0.55 0.19 E588VE588V 2 1.09 0.39 E831X 1 0.55 0.19 F311L 1 0.55 0.19 F693L 1 0.55 0.19 G1244E 1 0.55 0.19 G542X 7 3.83 1.36 G576A 1 0.55 0.19 H199Y 3 1.64 0.58 I1027T 3 1.64 0.58 I285FI285F 1 0.55 0.19 L206W 3 1.64 0.58 L320V 1 0.55 0.19 L967S 1 0.55 0.19 L997F 3 1.64 0.58 P1372LP1372L 1 0.55 0.19 P205S 1 0.55 0.19 P439SP439S 1 0.55 0.19 Q1313X 1 0.55 0.19 Q890X 2 1.09 0.39 Q98R 1 0.55 0.19 R1066C 1 0.55 0.19 R1066H 1 0.55 0.19 (Table continues) missense variant, I1027T (3212TϾC), in exon 17a.25 Family studies have not been performed to identify which allele carries two mutations. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment

[hide] High heterogeneity of CFTR mutations and unexpecte... J Cyst Fibros. 2004 Dec;3(4):265-72. des Georges M, Guittard C, Altieri JP, Templin C, Sarles J, Sarda P, Claustres M
High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France.
J Cyst Fibros. 2004 Dec;3(4):265-72., [PMID:15698946]

Abstract [show]
In this report, we present updated spectrum and frequency of mutations of the CFTR gene that are responsible for cystic fibrosis (CF) in Languedoc-Roussillon (L-R), the southwestern part of France. A total of 75 different mutations were identified by DGGE in 215 families, accounting for 97.6% of CF genes and generating 88 different mutational genotypes. The frequency of p.F508del was 60.23% in L-R versus 67.18% in the whole country and only five other mutations (p.G542X, p.N1303K, p.R334W, c.1717-1G>A, c.711+1G>T) had a frequency higher than 1%. The mutations were scattered over 20 exons or their border. This sample representing only 5.7% of French CF patients contributed to 24% of CFTR mutations reported in France. This is one of the highest molecular allelic heterogeneity reported so far in CF. We also present the result of a neonatal screening program based on a two-tiered approach "IRT/20 mutations/IRT" analysis on blood spots, implemented in France with the aim to improve survival and quality of life of patients diagnosed before clinical onset. This 18-month pilot project showed an unexpected low incidence of CF (1/8885) in South of France, with only six CF children detected among 43,489 neonates born in L-R, and 13 among 125,339 neonates born in Provence-Alpes-Cote-d'Azur (PACA).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 of chromosomes (frequency %) p.E1104X 17b 2 (0.47) p.R1158X 19 3 (0.70) p.R1162X 19 2 (0.47) c.3659delC 19 1 (0.23) c.3737delA 19 2 (0.47) p.I1234V 19 1 (0.23) c.3849+10kbCNT intron 19 4 (0.93) c.3850-1GNA intron 19 1 (0.23) p.G1244E 20 1 (0.23) p.W1282X 20 2 (0.47) p.N1303H 21 1 (0.23) p.N1303K 21 13 (3.02) p.Q1313X 21 1 (0.23) c.4382delA 24 1 (023) Mutations described for the first time by our laboratory appear in bold. Login to comment

[hide] Genotype and phenotype correlations in patients wi... Gastroenterology. 2002 Dec;123(6):1857-64. Durno C, Corey M, Zielenski J, Tullis E, Tsui LC, Durie P
Genotype and phenotype correlations in patients with cystic fibrosis and pancreatitis.
Gastroenterology. 2002 Dec;123(6):1857-64., [PMID:12454843]

Abstract [show]
BACKGROUND & AIMS: Pancreatitis is known to occur in some patients with cystic fibrosis (CF), but the prevalence, natural history, and genotypic basis are unclear. We examined a well-defined cohort of patients with CF to answer these questions. METHODS: Patients with CF were identified from a computerized database (1966-1996). Chart audit identified all patients with CF and pancreatitis. RESULTS: Among 1075 patients with CF, 937 (87%) were pancreatic insufficient at diagnosis, 28 (3%) were pancreatic sufficient but developed pancreatic insufficiency after diagnosis, and 110 (10%) have remained pancreatic sufficient. No patients with pancreatic insufficiency developed pancreatitis. Nineteen patients (17.3%) with pancreatic sufficiency experienced one or more attacks of pancreatitis. The mean age at diagnosis of pancreatitis was 22.7 +/- 10.3 years (range, 10-35 years), and pancreatitis was recognized before the diagnosis of CF in 6 patients (32%). The diagnosis of CF in pancreatic-sufficient patients, with and without pancreatitis, was established at a significantly older age than in those with pancreatic insufficiency (P < 0.0001). Genotyped patients with pancreatic insufficiency carried 2 severe mutant alleles. All genotyped patients with pancreatic sufficiency and pancreatitis carried at least one mild mutation. No specific genotype was predictive of pancreatitis. CONCLUSIONS: Patients with CF with pancreatic sufficiency carry at least one mild mutant allele and are at a significant risk of developing pancreatitis. Symptoms of pancreatitis may precede the diagnosis of CF. Pancreatitis is associated with an otherwise mild CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 CFTR Genotypes Among CF Patients With PS With and Without Pancreatitis Two mutations (n) ⌬F508/R117H (9) ⌬F508/(5T) (6) ⌬F508/3272-26A 3 G (4) ⌬F508/R347H (2) ⌬F508/P574H (2) ⌬F508/875 ϩ 1G Ͼ C (2) ⌬F508/3849 ϩ 10kb C 3 T (1) ⌬F508/A455E (1) ⌬F508/D614G (1) ⌬F508/G85E (1) ⌬F508/R347P (1) ⌬F508/S1251N (1) ⌬F508/⌬F508a (1) ⌬F508/3120G Ͼ A (1) ⌬F508/G551Da (1) G542X/R117H (1) R560T/L206W (1) R117H/R117H (1) R31L/P67L (1) 1461ins4 (AGAT)/G85E (1) G551D/(5T) (1) R1066C/3849 ϩ 10kb C Ͼ T (1) G551D/3849 ϩ 10kb C Ͼ T (1) R334W/R334W (1) R334W/681delC (1) W1282X/3489 ϩ 10kb C Ͼ T (1) One mutation (n) ⌬F508/- (18) L1077P/- (1) W1282X/- (1) M1137V/- (1) G551D/- (1) R347H/- (1) Q30X1/- (1) G1244E/- (1) R117H/- (1) 621 ϩ 2G621 ϩ 1G 3 T/- (1) NOTE. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
104 c 4016insT, G1244E, R1158X, 3120+1G>A, 1677delTA, I1234V, E831X, 5T, Q220X, E92K, G91R. Login to comment

[hide] Cystic fibrosis: a multiple exocrinopathy caused b... Am J Med. 1998 Jun;104(6):576-90. Schwiebert EM, Benos DJ, Fuller CM
Cystic fibrosis: a multiple exocrinopathy caused by dysfunctions in a multifunctional transport protein.
Am J Med. 1998 Jun;104(6):576-90., [PMID:9674722]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
224 In NBD2, a few key mutations have been found that include missense mutations (G1349D, D1370N, K1250M, K1250Q, G1244E, S1255P) and several nonsense mutations (W1282X, S1255X, W1316X). Login to comment

[hide] Genetic findings in congenital bilateral aplasia o... Hum Mutat. 1998;11(6):480. de Meeus A, Guittard C, Desgeorges M, Carles S, Demaille J, Claustres M
Genetic findings in congenital bilateral aplasia of vas deferens patients and identification of six novel mutatations. Mutations in brief no. 138. Online.
Hum Mutat. 1998;11(6):480., [PMID:10200050]

Abstract [show]
Congential bilateral aplasia of vas deferens (CBAVD), a form of male sterility, has been suggested to represent a "genital" form of cystic fibrosis (CF), as mutations in the CFTR gene have been identified in most patients with this condition. Interestingly, the 5T allele in intron 8 appeared to be the most frequent mutation associated with CBAVD. However, the molecular basis of CBAVD is not completely understood. We have analysed the complete coding and flanking CFTR sequences by PCR-DGGE in 64 men with CBAVD from southern France with the aim to list any sequence alteration. Fourty-two of the 64 patients (65.6%) had mutations on both copies of the CFTR gene, including one patient with two mutations in the same copy (DF508 + A1067T). The 5T allele was present in 21/64 cases (33%). Six of the 28 different mutations identified in this study had never been described previously, and appeared to be specific to CBAVD (P111L, M244K, A1364V, G544V, 2896insAG,-33G->A).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 Phenotype CFTRamutations Intron 8, Poly(T) tract 1 3 crisis of acute pancreatitis F508 / L206W 9/7 2 F508 / L206W 9/9 3 frequent bronchitis F508 / R347H 9/9 4 F508 / R347H 9/9 5 F508 / M244K 9/7 6 F508 / A1364V 9/7 7 F508 / D1152H 9/7 8 chronic sinusitis and bronchitis F508 / D1152H 9/7 9 F508 / R117H 9/7 10 F508 / R117H 9/7 11 F508 / M952I 9/7 12 D443Y / G542X 7/9 13 D443Y / G542X 7/9 14 2184delA / D443Y 7/7 15 2184delA / D443Y 7/7 16 R347H / D443Y 9/7 17 seminal vesicles agenesia R117H / G1349D 7/7 18 R117H / G1244E 7/7 19 N1303K / P111L 9/7 20 chronic sinusitis, nasal polyps W1282X / D1152H 7/7 21 chronic sinusitis R347H / Y1092X 7/7 22 seminal vesicles agnesia 297-3C-GTT / 4279insA 7/7 23 G544V / F508C 7/7 24 D1152H / 2896insAG 7-9 25 F508 / - 9/5 26 F508 / - 9/5 27 F508 / - 9/5 28 F508 / - 9/5 29 F508 / - 9/5 30 chronic sinusitis, bronchitis F508 / - 9/5 31 sinusitis and allergy F508 / - 9/5 32 allergy F508 / - 9/5 33 F508 / - 9/5 34 F508 / - 9/5 35 F508 / - 9/5 36 F508 / - 9/5 37 bronchitis, asthma F508 / - 9/5 38 chronic sinusitis F508+A1067T / - 9/5 39 chronic sinusitis D1152H / - 7/5 40 2184delA / - 7/5 41 R764X / - 7/5 42 711+1G-GTT / - 7/5 43 F508 / - 9/7 44 F508 / - 9/7 45 F508 / - 9/7 46 F508 / - 9/9 47 R553X / - 7/7 48 -33G-GTA / - 7/7 49 K710X / - 7/7 50 - / - 5/5 51 - / - 5/7 52 - / - 5/7 53 - / - 7/7 54 - / - 7/7 55 - / - 7/7 56 - / - 7/7 57 - / - 7/7 58 - / - 7/7 59 - / - 7/7 60 - / - 7/7 61 - / - 7/9 62 - / - 7/9 63 NIDDb - / - 7/9 64 - / - 7/9 a : Cystic Fibrosis Transmembrane Regulator gene b : Non Insulino-Dependant Diabetis References Anguiano A, Oates RD, Amos JA, Dean M, Gerrard B, Stewart C, Maher TA, White MB, Milunsky A (1992) Congenital absence of the vas deferens: a primarily genital form of cystic fibrosis. Login to comment

[hide] High heterogeneity for cystic fibrosis in Spanish ... Hum Genet. 1997 Dec;101(3):365-70. Casals T, Ramos MD, Gimenez J, Larriba S, Nunes V, Estivill X
High heterogeneity for cystic fibrosis in Spanish families: 75 mutations account for 90% of chromosomes.
Hum Genet. 1997 Dec;101(3):365-70., [PMID:9439669]

Abstract [show]
We have analyzed 640 Spanish cystic fibrosis (CF) families for mutations in the CFTR gene by direct mutation analysis, microsatellite haplotypes, denaturing gradient gel electrophoresis, single-strand conformation analysis and direct sequencing. Seventy-five mutations account for 90.2% of CF chromosomes. Among these we have detected seven novel CFTR mutations, including four missense (G85V, T582R, R851L and F1074L), two nonsense (E692X and Q1281X) and one splice site mutation (711+3A-->T). Three variants, two in intronic regions (406-112A/T and 3850-129T/C) and one in the coding region (741C/T) were also identified. Mutations G85V, T582R, R851L, E692X and Q1281X are severe, with lung and pancreatic involvement; 711+3A-->T could be responsible for a pancreatic sufficiency/insufficiency variable phenotype; and F1074L was associated with a mild phenotype. These data demonstrate the highest molecular heterogeneity reported so far in CF, indicating that a wide mutation screening is necessary to characterize 90% of the Spanish CF alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Eight mutations have frequencies 366 Table 1 Seventy-five CFTR mutations identified in 640 Spanish families with cystic fibrosis (CF) Mutation Exon/intron CF alleles % ∆F508 E.10 681 53.20 G542X E.11 108 8.43 N1303K E.21 34 2.65 1811+1.6kbA→Ga I.11 24 1.87 711+1G→T I.5 22 1.71 R1162Xa E.19 21 1.64 R334Wa E.7 21 1.64 R1066C E.17b 14 1.09 1609delCAa E.10 13 1.01 Q890X E.15 13 1.01 G85E E.3 12 0.94 712-1G→Ta I.5 11 0.86 2789+5G→A I.14b 11 0.86 ∆I507 E.10 10 0.78 W1282X E.20 10 0.78 2869insGa E.15 9 0.70 L206W E.6a 7 0.54 R709X E.13 7 0.54 621+1G→T I.4 6 0.47 3272-26A→G I.17a 6 0.47 R347H E.7 5 0.39 2183AA→G E.13 5 0.39 K710X E.13 5 0.39 2176insC E.13 5 0.39 3849+10kbC→T I.19 5 0.39 P205Sa E.6a 4 0.31 1078delT E.7 4 0.31 R553X E.11 4 0.31 G551D E.11 4 0.31 1812-1G→Aa I.11 4 0.31 CFdel#1a E.4-7/11-18 4 0.31 V232D E.6a 3 0.23 936delTAa E.6b 3 0.23 1717-8G→A I.10 3 0.23 1949del84 E.13 3 0.23 W1089X E.17b 3 0.23 R347P E.7 3 0.23 del E.3a E.3 2 0.16 R117H E.4 2 0.16 L558S E.11 2 0.16 A561E E.12 2 0.16 2603delT E.13 2 0.16 Y1092X E.17b 2 0.16 Q1100Pa E.17b 2 0.16 M1101K E.17b 2 0.16 delE.19a E.19 2 0.16 G1244E E.20 2 0.16 P5La E.1 1 0.08 Q30Xa E.2 1 0.08 G85Va E.3 1 0.08 E92Ka E.4 1 0.08 A120Ta E.4 1 0.08 I148T E.4 1 0.08 711+3A→Ta I.5 1 0.08 H199Y E.6a 1 0.08 875+1G→A I.6a 1 0.08 Table 1 (continued) Mutation Exon/intron CF alleles % 1717-1G→A I.10 1 0.08 L571S E.12 1 0.08 T582Ra E.12 1 0.08 E585X E.12 1 0.08 1898+3A→G I.12 1 0.08 G673X E.13 1 0.08 E692Xa E.13 1 0.08 R851X E.14a 1 0.08 R851La E.14a 1 0.08 A1006E E.17a 1 0.08 L1065Ra E.17b 1 0.08 F1074La E.17b 1 0.08 R1158X E.19 1 0.08 3667del4a E.19 1 0.08 3860ins31a E.20 1 0.08 3905insT E.20 1 0.08 4005+1G→A I.20 1 0.08 Q1281Xa E.20 1 0.08 Q1313X E.21 1 0.08 Known mutations (75) 1155 90.23 Unknown mutations 125 9.77 a Mutations discovered by the CF group of the Medical and Molecular Genetics Centre - IRO, Barcelona, Spain that range between 0.5% and 0.9%, representing 6.0% of the CF chromosomes. Login to comment

[hide] Effect of cystic fibrosis-associated mutations in ... J Biol Chem. 1996 Aug 30;271(35):21279-84. Cotten JF, Ostedgaard LS, Carson MR, Welsh MJ
Effect of cystic fibrosis-associated mutations in the fourth intracellular loop of cystic fibrosis transmembrane conductance regulator.
J Biol Chem. 1996 Aug 30;271(35):21279-84., [PMID:8702904]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) contains multiple membrane spanning sequences that form a Cl- channel pore and cytosolic domains that control the opening and closing of the channel. The fourth intracellular loop (ICL4), which connects the tenth and eleventh transmembrane spans, has a primary sequence that is highly conserved across species, is the site of a preserved sequence motif in the ABC transporter family, and contains a relatively large number of missense mutations associated with cystic fibrosis (CF). To investigate the role of ICL4 in CFTR function and to learn how CF mutations in this region disrupt function, we studied several CF-associated ICL4 mutants. We found that most ICL4 mutants disrupted the biosynthetic processing of CFTR, although not as severely as the most common DeltaF508 mutation. The mutations had no discernible effect on the channel's pore properties; but some altered gating behavior, the response to increasing concentrations of ATP, and stimulation in response to pyrophosphate. These effects on activity were similar to those observed with mutations in the nucleotide-binding domains, suggesting that ICL4 might help couple activity of the nucleotide-binding domains to gating of the Cl- channel pore. The data also explain how these mutations cause a loss of CFTR function and suggest that some patients with mutations in ICL4 may have a milder clinical phenotype because they retain partial activity of CFTR at the cell membrane.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 This pattern of response for A1067T is similar to what we have found with the NBD mutants G551D, G1244E, and G1349D (8). Login to comment
138 This pattern of response for A1067T is similar to what we have found with the NBD mutants G551D, G1244E, and G1349D (8). Login to comment

[hide] Disease-associated mutations in the fourth cytopla... J Biol Chem. 1996 Jun 21;271(25):15139-45. Seibert FS, Linsdell P, Loo TW, Hanrahan JW, Clarke DM, Riordan JR
Disease-associated mutations in the fourth cytoplasmic loop of cystic fibrosis transmembrane conductance regulator compromise biosynthetic processing and chloride channel activity.
J Biol Chem. 1996 Jun 21;271(25):15139-45., [PMID:8662892]

Abstract [show]
A cluster of 18 point mutations in exon 17b of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has been detected in patients with cystic fibrosis. These mutations cause single amino acid substitutions in the most C-terminal cytoplasmic loop (CL4, residues 1035-1102) of the CFTR chloride channel. Heterologous expression of the mutants showed that 12 produced only core-glycosylated CFTR, which was retained in the endoplasmic reticulum; the other six mutants matured and reached the cell surface. In some cases substitution of one member of pairs of adjacent residues resulted in misprocessing, whereas the other did not. Thus, the secondary structure of CL4 may contribute crucially to the proper folding of the entire CFTR molecule. Cyclic AMP-stimulated iodide efflux was not detected from cells expressing the misprocessed variants but was from the other six, indicating that their mutations cause relatively subtle channel defects. Consistent with this, these latter mutations generally are present in patients who are pancreatic-sufficient, while the processing mutants are mostly from patients who are pancreatic-insufficient. Single-channel patch-clamp analysis demonstrated that the processed mutants had the same ohmic conductance as wild-type CFTR, but a lower open probability, generally due to an increase in channel mean closed time and a reduction in mean open time. This suggests that mutations in CL4 do not affect pore properties of CFTR, but disrupt the mechanism of channel gating.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 Other disease-causing CFTR mutants, which are appropriately processed and trafficked to the plasma membrane, show defective ion conduction properties (e.g. R334W, R347H, and R347P; Sheppard et al., 1993; Tabcharani et al., 1993) or defective regulation of channel activity (e.g. G551S, G1244E, S1255P, and G1349D; Anderson and Welsh, 1992). Login to comment
95 Other disease-causing CFTR mutants, which are appropriately processed and trafficked to the plasma membrane, show defective ion conduction properties (e.g. R334W, R347H, and R347P; Sheppard et al., 1993; Tabcharani et al., 1993) or defective regulation of channel activity (e.g. G551S, G1244E, S1255P, and G1349D; Anderson and Welsh, 1992). Login to comment

[hide] Haplotype analysis of 94 cystic fibrosis mutations... Hum Mutat. 1996;8(2):149-59. Morral N, Dork T, Llevadot R, Dziadek V, Mercier B, Ferec C, Costes B, Girodon E, Zielenski J, Tsui LC, Tummler B, Estivill X
Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers.
Hum Mutat. 1996;8(2):149-59., [PMID:8844213]

Abstract [show]
We have analyzed 416 normal and 467 chromosomes carrying 94 different cystic fibrosis (CF) mutations with polymorphic genetic markers J44, IVS6aGATT, IVS8CA, T854, IVS17BTA, IVS17BCA, and TUB20. The number of mutations found with each haplotype is proportional to its frequency among normal chromosomes, suggesting that there is no preferential haplotype in which mutations arise and thus excluding possible selection for specific haplotypes. While many common mutations in the worldwide CF population showed absence of haplotype variation, indicating their recent origins, some mutations were associated with more than one haplotype. The most common CF mutations, delta F508, G542X, and N1303K, showed the highest number of slippage events at microsatellites, suggesting that they are the most ancient CF mutations. Recurrence was probably the case for 9 CF mutations (R117H, H199Y, R347YH, R347P, L558S, 2184insA, 3272-26A-->G, R1162X, and 3849 + 10kbC-->T). This analysis of 94 CF mutations should facilitate mutation screening and provides useful data for studies on population genetics of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 CFTR Haplotypes for Diallelic and Multiallelic DNA Markers for 94 CF Mutations" J44-GATT- 8CA-17BTA- No. of T854-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 2-7-1-2 17-47-13 (55.4%) 17-46-13 17-45-13 17-34-13 17-32-13 17-31-14 17-31-13 17-29-14 17-28-13 16-48-13 16-46-14 16-46-13 16-45-13 16-44-13 16-35-13 16-33-13 16-32-13 16-31-14 16-31-13 16-30-13 16-29-13 16-26-13 16-25-13 16-24-13 14-31-13 1-7-2-1 17-7-17 (16.8%) R334W R334W 3860ins31 G1244E R1162X R1162X R1162X G91R MllOlK R347P R334W R117C E92K 3849+lOkbC+T 3293delA 1811+1.6kb A-tG 1811+1.6kb A-tG 2184insA P205S 3659delC G673X 11005R I336K W58S R347P W846X 405+1-A G178R 3905insT R1162X R347H 3100insA E60X 1078delT 4005+1-A K710X 1677delTA H199Y 3601-2AjG 3850-3T+G 3272-26A-tG 3850-1-A 1812-1-A R117H L1059X S492F Y1092X Y569H 3732delA C866Y 711+1G+T 711+1-T G85E 1949del84 2789+5-A H1085R W1282X R1066C 2043delG V456F 2 1 1 1 2 1 6 2 2 1 2 1 1 2 1 1 4 1 1 1 3 2 1 1 1 1 1 1 2 7 1 1 1 1 2 1 1 3 19 3 3 1 1 2 1 1 5 1 1 1 1 3 6 3 5 1 13 2 1 1 - 0.48 0.48 - - - 0.24 - - - 2.65 2.40 1.93 2.65 1.68 2.65 0.72 13.94 13.46 1.93 - 0.72 0.24 3.37 - b b fP fP fP t b,fb.fP h fb t h t h h fP fP b.h b h h b h h h h h fb fb,fP.t fP fP fP9t fP b t fPh b h fb b.fb,h fb*fP b,fP h h t h fb fb,fp,h.t fP fP fb t b.fP,t b,fb,h,t b f b h h fb b,fb.fP,h fP h h Gasparini et al. (1991b) Chilldn et al. (1993a) Devoto et al. (1991) Gasparini et al. (1991b) Dork et al. (1993a) Guillermit et al. (1993) Zielenski et al. (1993) Dean et al. (1990) Dork et al. (1994a) Nunes et al. (1993) Highsmith et al. (1994) Ghanem et al. (1994) Chilldn et al. (1995) Dork et al. (1994a) Dork et al. (1993a) Chilldn et al. (1993b) Kerem et al. (1990) Dork et al. (1994a) Dork et al. (1994a) Cuppenset al. (1993) Fanen et al. (1992) Maggio et al. (personal communication) Audrezet et al. (1993) Vidaud et al. (1990) Dork et al. (1993b) Zielenski et al. (1991a) Chilldn et al. (1994b) Malik et al. (personal communication) Cremonesi et at. Login to comment

[hide] Double mutant alleles: are they rare? Hum Mol Genet. 1995 Jul;4(7):1169-71. Savov A, Angelicheva D, Balassopoulou A, Jordanova A, Noussia-Arvanitakis S, Kalaydjieva L
Double mutant alleles: are they rare?
Hum Mol Genet. 1995 Jul;4(7):1169-71., [PMID:8528204]

Abstract [show]
The presence of two different mutations carried by the same CF allele has been demonstrated in four out of 44 Bulgarian CF patients during a systematic search of the entire coding sequence of the CFTR gene. Two of the double mutant alleles include one nonsense and one missense mutation and although the nonsense mutation can be considered to be the main defect, the amino acid substitutions are good candidates for disease-causing mutations as well. One double mutant carries two missense mutations whose contribution to the CF phenotype is difficult to evaluate. The findings suggest that double mutant alleles may be more common than expected and could account for some of the problems in phenotype-genotype correlations. Such alleles may have important implications for molecular diagnosis and genetic counselling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Another mutation (G1244E), has been found to result from a different substitution at the same nucleotide position, namely G->A at nt 3863 in codon 1244 where glycine is replaced by glutamic acid. Login to comment
57 G1244E was initially described in an Italian patient with a mild CF phenotype (12) and has been detected in two pancreatic sufficient patients in our study. Login to comment

[hide] Mechanism of dysfunction of two nucleotide binding... EMBO J. 1995 Mar 1;14(5):876-83. Sheppard DN, Ostedgaard LS, Winter MC, Welsh MJ
Mechanism of dysfunction of two nucleotide binding domain mutations in cystic fibrosis transmembrane conductance regulator that are associated with pancreatic sufficiency.
EMBO J. 1995 Mar 1;14(5):876-83., [PMID:7534226]

Abstract [show]
Variability in the severity of cystic fibrosis (CF) is in part due to specific mutations in the CF transmembrane conductance regulator (CFTR) gene. To understand better how mutations in CFTR disrupt Cl- channel function and to learn about the relationship between genotype and phenotype, we studied two CF mutants, A455E and P574H, that are associated with pancreatic sufficiency. A455E and P574H are located close to conserved ATP binding motifs in CFTR. Both mutants generated cAMP-stimulated apical membrane Cl- currents in heterologous epithelial cells, but current magnitudes were reduced compared with wild-type. Patch-clamp analysis revealed that both mutants had normal conductive properties and regulation by phosphorylation and nucleotides. These mutants had normal or increased Cl- channel activity: A455E had an open-state probability (Po) similar to wild-type, and P574H had an increased Po because bursts of activity were prolonged. However, both mutants produced less mature glycosylated protein, although levels were greater than observed with the delta F508 mutant. These changes in channel activity and processing provide a quantitative explanation for the reduced apical Cl- current. These data also dissociate structural requirements for channel function from features that determine processing. Finally, the results suggest that the residual function associated with these two mutants is sufficient to confer a milder clinical phenotype and infer approaches to developing treatments.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
126 For example, G551S, G1244E, S1255P and G1349D had a markedly reduced PO at all concentrations of MgATP tested, and S1255P was less potently stimulated by MgATP (Anderson and Welsh, 1992; Smit et al., 1993). Login to comment
127 Therefore, we tested the hypothesis that ATP-dependent regulation of A455E and P574H was altered. Login to comment

[hide] Cystic fibrosis: genotypic and phenotypic variatio... Annu Rev Genet. 1995;29:777-807. Zielenski J, Tsui LC
Cystic fibrosis: genotypic and phenotypic variations.
Annu Rev Genet. 1995;29:777-807., [PMID:8825494]

Abstract [show]
Cystic fibrosis (CF) is a common genetic disorder in the Caucasian population. The gene was identified in 1989 on the basis of its map location on chromosome 7. The encoded gene product, named cystic fibrosis transmembrane conductance regulator (CFTR), corresponds to a cAMP-regulated chloride channel found almost exclusively in the secretory epithelial cells. Although the major mutation that results in a single amino acid deletion (F508) accounts for 70% of the disease alleles, more than 550 additional mutant alleles of different forms have been detected. Many of these mutations can be divided into five general classes in terms of their demonstrated or presumed molecular consequences. In addition, a good correlation has been found between CFTR genotype and one of the clinical variables--pancreatic function status. An unexpected finding, however, is the documentation of CFTR mutations in patients with atypical CF disease presentations, including congenital absence of vas deferens and several pulmonary diseases. Thus, the implication of CFTR mutation is more profound than CF alone.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
631 The range of effects of dysregulation of the channel includes those with a severe lack of function (such as that for G551D), reduced response to ATP stimulation (S1255P), and slight reduction of absolute activity (G551S, G1244E, and G1349D) (7, 63). Login to comment

[hide] Independent origins of cystic fibrosis mutations R... Am J Hum Genet. 1994 Nov;55(5):890-8. Morral N, Llevadot R, Casals T, Gasparini P, Macek M Jr, Dork T, Estivill X
Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene.
Am J Hum Genet. 1994 Nov;55(5):890-8., [PMID:7526685]

Abstract [show]
Microsatellite analysis of chromosomes carrying particular cystic fibrosis mutations has shown different haplotypes in four cases: R334W, R347P, R1162X, and 3849 + 10kbC-->T. To investigate the possibility of recurrence of these mutations, analysis of intra- and extragenic markers flanking these mutations has been performed. Recurrence is the most plausible explanation, as it becomes necessary to postulate either double recombinations or single recombinations in conjunction with slippage at one or more microsatellite loci, to explain the combination of mutations and microsatellites if the mutations arose only once. Also in support of recurrence, mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T involve CpG dinucleotides, which are known to have an increased mutation rate. Although only 15.7% of point mutations in the coding sequence of CFTR have occurred at CpG dinucleotides, approximately half of these CpG sites have mutated at least once. Specific nucleotide positions of the coding region of CFTR, distinct from CpG sequences, also seem to have a higher mutation rate, and so it is possible that the mutations observed are recurrent. G-->A transitions are the most common change found in those positions involved in more than one mutational event in CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 CT................... 3863: G--oA .................. G-.T ................... 3980: G-jA .................. G--)T.................... 4374+1: G-A .................. G--oT.................... L88S L88X L88X G. Malone, personal communication Savov et al. 1994b Macek et al. 1992 406-1G--.C Bonizzato et al. 1992 406-1G- T T. Bienvenu, personal communication E92K Nunes et al. 1993 E92X Will et al. 1994 S549N Cutting et al. 1990 S5491 Kerem et al. 1990 R560K Ferec et al. 1992 R560T Kerem et al. 1990 Y563D A. Hamosh, personal communication Y563N Kerem et al. 1990 1898+1CG-.A Strong et al. 1992 1898+1GC-.C Cuppens et al. 1993 1898+3A-)C W. Lissens, personal communication 1898+3A--4G Cremonesi et al. 1992 G628R G628R 2183AA- G 2184delA 2184insA M1101K M1101R 3667del4 3667ins4 3791delC T12201 G1244E G1244V R1283K R1283M Fanen et al. 1992 Cuppens et al. 1993 Bozon et al. 1994 Dork et al., in press N. Kilin, personal communication Zielenski et al. 1993 Mercier et al. 1993 Chillon et al. 1994a Sangiuolo et al. 1993 M. Macek, Jr., personal communication Ghanem et al. 1994 Devoto et al. 1991 Savov et al. 1994a Chevalier et al., in press Cheadle et al. 1992 4374+1G-*A Fanen et al. 1992 4374+1G--iT Dork et al. 1993 of the most common allele. Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment
40 R1283K can be detected by two different restriction enzyme digestions: abolition of the MnlI site or creation of an MboII site giving a pattern similar to G1244E on agarose gel electrophoresis.2' The presence of this new mutation highlights the necessity of verification by ASO hybridisation for mutations detected by abolition of a restriction enzyme site. Login to comment

[hide] The cystic fibrosis transmembrane conductance regu... J Biol Chem. 1994 May 20;269(20):14584-8. Ko YH, Thomas PJ, Pedersen PL
The cystic fibrosis transmembrane conductance regulator. Nucleotide binding to a synthetic peptide segment from the second predicted nucleotide binding fold.
J Biol Chem. 1994 May 20;269(20):14584-8., [PMID:7514174]

Abstract [show]
Previous studies from this laboratory with a 67-amino acid synthetic peptide (P-67) demonstrated directly that the first predicted nucleotide binding fold of the cystic fibrosis transmembrane conductance regulator (CFTR) binds ATP (Thomas, P.J, Shenbagamurthi, P., Ysern, S., and Pedersen, P.L. (1991) Science 251, 555-557). Although mutational analysis within the predicted second nucleotide binding fold indicates that this domain may be functionally important also, direct evidence for nucleotide binding is lacking. Here, we report the design, chemical synthesis, and purification of a 51-amino acid segment (P-51) of the second predicted nucleotide binding fold of CFTR and demonstrate that this peptide binds ATP. P-51 consists of amino acid residues from glutamic acid 1228 through threonine 1278 and contains a motif, GX4GKS, very similar or identical to that found in many nucleotide-binding proteins. The freshly dissolved peptide moves predominantly as a single species upon molecular sieve chromatography and readily binds ATP without eliciting its hydrolysis. P-51 also readily binds the fluorescent ATP analogs TNP-ATP (2'(3')-0-(2,4,6-trinitrophenyl)-adenosine-5'-triphosphate) and TNP-ADP but exhibits much less capacity to bind TNP-AMP. ATP displaces TNP-ATP with a Kd (ATP) of 0.46 mM. In the presence of the denaturant urea, P-51 loses most of its binding capacity indicating that structure is important for binding. Consistent with this conclusion, circular dichroism spectroscopy revealed that P-51 has significant secondary structure. Elements of such structure calculated from deconvolution of the circular dichroism spectra compare favorably with those predicted from the program of Chou, P.Y., and Fasman, G.D. (1977) J. Mol. Biol. 115, 135-175. These experiments provide the first direct evidence that the second predicted nucleotide binding fold of CFTR binds ATP and define a 51-amino acid segment within the approximately 150-amino acid fold critical for this function. They also indicate that the beta and gamma phosphate groups of ATP may be important for binding and that the 51-amino acid region studied is not sufficient to catalyze ATP hydrolysis. Finally, as seven different mutations within P-51 are known to cause cystic fibrosis, these studies will be important in future efforts to understand the molecular basis of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 TNP Nucleotide Binding-The enhancement of fluorescence of the TMS-1 TMS-2 NBF-2 COO- + % N E P-51 (122B-<278) ENISFSISPGQRVGLL&TGSG~TLLSAFLP.LLNTEGEIQIDGVSWDSIT1/1 51 -ttl).ttttttt"-, CF Mutations within P-51 Q123ESTOP 11234" G1244E S1251N S1255P D1270N S1255STOP FIG.1.Primary sequence of P-51 and its predicted secondary structure. Login to comment

[hide] G1244V: a novel missense mutation in exon 20 of th... Hum Mol Genet. 1994 Mar;3(3):513-4. Savov A, Jordanova A, Gavrilov D, Angelicheva D, Kalaydjieva L
G1244V: a novel missense mutation in exon 20 of the CFTR gene in a Bulgarian cystic fibrosis patient.
Hum Mol Genet. 1994 Mar;3(3):513-4., [PMID:7516777]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
10 The cycling parameters were: initial denaturation at 94°C for 5 min. followed by 30 cycles of 94°C 30 sec, 57°C 30 sec, 72°C 1 min. and a final step at 72°C for 7 min. SSCP analysis of exon 20 was performed on 14% acrylamide gels with several different mutations used as heterozygous controls (W1282X, 4005 +1 G - A , 3850 - 1 G - A , G1244E, P1290P) (Fig. 1A). Login to comment
20 A transition (G-A) at the same nucleotide position which results in thereplacementof glycine with glutamic acid (G1244E) has been described previously in an Italian CF patient (6). Login to comment
21 The G1244E mutation was also detected in our study, in a female CF patient of Bulgarian ethnic background who is a G1244E/delF508 compound. Login to comment
24 Lane 1, normal individual N/N; lane 2, W1282X/N; lane 3, 3850-1 G-A/N; lane 4, 4005 + 1 G-A/N; lane 5, P1290P/N; lane 10, G1244V/N; lane 11, G1244E/N; lanes 6, 7, 8, 9, 12 investigated patients without mutations in exon 20. Login to comment

[hide] Molecular mechanisms of CFTR chloride channel dysf... Cell. 1993 Jul 2;73(7):1251-4. Welsh MJ, Smith AE
Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis.
Cell. 1993 Jul 2;73(7):1251-4., [PMID:7686820]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
17 Classes of CFTR Mutations That Cause CF Class Defect Examples Do- Fre- Clin- main quency ical Protein production Nonsense mutations Frameshift Splice Processing Conduction 6542X NBDI 3.4 3905 insT NBD2 2.1 621 + G-T MSDl 1.3 Al507 NBDl AF506 NBDl s5491 NBDl S549R NED1 A559T NED1 N1303K NBDP G551 D NBDl G551S NBDl G1244E NBDP S1255P NBDP G1349D NBDP RI 17H MSDI R334W MSDl R347P MSDl 0.5 67.2 Rare 0.3 Rare 1.a 2.4 Rare Rare Rare Rare 0.6 0.4 0.5 PI PI PI PI PI PI PI PI PS PI PI PI PS PS PS NED, nucleotide-binding domain; MSD, membrane-spanning domain; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment
56 Some nucleotide-binding domain mutants (such as G551D) have very little function, in some (such as S1255P) ATP is less potent at stimulating activity, and the absolute activity of others (such as G551S, G1244E, and G1349D) is reduced (Anderson and Welsh, 1992; Drumm et al., 1991). Login to comment

[hide] Effects of the delta F508 mutation on the structur... J Bioenerg Biomembr. 1993 Feb;25(1):11-9. Thomas PJ, Pedersen PL
Effects of the delta F508 mutation on the structure, function, and folding of the first nucleotide-binding domain of CFTR.
J Bioenerg Biomembr. 1993 Feb;25(1):11-9., [PMID:7680027]

Abstract [show]
The fatal autosomal recessive disease cystic fibrosis (CF) is caused by mutations in the gene which encodes the cystic fibrosis transmembrane conductance regulator (CFTR). Many of these disease-causing mutations, including the deletion of F508 (delta F508) which accounts for approximately 70% of the disease alleles, occur in one of the two consensus nucleotide binding sequences. Peptide studies have directly demonstrated that the N-terminal nucleotide binding sequences bind adenine nucleotides. Structurally, circular dichroism spectropolarimetry indicates that this region of CFTR assumes a beta-stranded structure in solution. The delta F508 mutation causes a diminution in the amount of beta-stranded structure and a concomitant increase in the amount of random coil structure present, indicating that either the mutant peptide has a different native structure or that the conformational equilibrium is shifted toward a more disordered form. Furthermore, the mutant peptide is more sensitive to denaturation, indicating that delta F508 is a stability, or protein-folding mutant. Here we review these results and discuss their implications for interpreting the behavior of delta F508 in situ and for the rational design of new CF drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 For example, the G458V (Cuppens et al., 1990) and G1244E (Devoto et al., 1991) mutations which change the first glycine residue in the Gx 4GKT sequence of the A homology region and the R560T (Kerem et al., 1990) mutation in the Rx6.sh4D sequence of the B homology region are known to cause CF. Login to comment

[hide] The spectrum of cystic fibrosis mutations. Trends Genet. 1992 Nov;8(11):392-8. Tsui LC
The spectrum of cystic fibrosis mutations.
Trends Genet. 1992 Nov;8(11):392-8., [PMID:1279852]

Abstract [show]
Although the major mutation causing cystic fibrosis accounts for almost 70% of mutant chromosomes screened, almost 300 sequence alterations have been identified in the gene during the past two and a half years. At least 230 of these mutations are probably associated with disease. This rapid accumulation of data is in part due to the highly coordinated effort by members of the Cystic Fibrosis Genetic Analysis Consortium. The information is not only essential to genetic diagnosis, but also will aid in understanding the structure and function of the protein, and possibly in correlating genotype with phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 Most notable are the mutations identified at the glycine residues in the Walker motifs (regions highly conserved among ATP-binding proteins), namely, G458V and G551D in NBF1 (Refs 16, 10), and G1244E and G1349D at the corresponding residues in NBF2 (Refs 17, 18), suggesting that ATP binding is essential for CFTR function. Login to comment
123 8 NO. 11 m []~EVIEWS G551D R553Q G551S I L558S aI~7 S5491 I I 1&559T A455F E5040 I&F508 V520F SS49NII IIR560T PS74H I G458V G480C $492F /" • ss,9 II III* oa. / III / NBF1 ~t ~t NBF2 I I I I I III I I I 11234V G1244E IS1255P D1270N II I Q1291H N1303K G1349D S1251N W1282R] F1286S N1303H Q1283M, FIG[] Cystic fibrosis (missense) mutations located within the two presumptive ATP-binding domains (NBF1 and NBF2) of CFTR. Login to comment

[hide] Screening for non-delta F508 mutations in five exo... Am J Hum Genet. 1991 Jun;48(6):1127-32. Devoto M, Ronchetto P, Fanen P, Orriols JJ, Romeo G, Goossens M, Ferrari M, Magnani C, Seia M, Cremonesi L
Screening for non-delta F508 mutations in five exons of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in Italy.
Am J Hum Genet. 1991 Jun;48(6):1127-32., [PMID:1709778]

Abstract [show]
Analysis of exons 10, 11, 14a, 15, and 20 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by denaturing-gradient-gel electrophoresis (DGGE) allowed the identification of mutations causing cystic fibrosis (CF) in 25 of 109 non-delta F508 chromosomes, as well as identification of a number of polymorphisms and sequence variations. Direct sequencing of the PCR fragments which showed an altered electrophoretic behavior not attributable to known mutations has led to the characterization of four new mutations, two in exon 11, and one each in exons 15 and 20. Screening for the different mutations thus far identified in our patients by the DGGE analysis and other independent methods should allow detection of about 70% of the molecular defects causing CF in Italy. Mutations located in exons 11 and 20 account for at least 30% of the non-delta F508 mutations present in Italian CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
49 .. 2 ... ... 2 ... 1 1 ... 2 Unknown PI Lombardia QS52X.. ... 1 1 2 2 1 2 1 2 2 1 Unknown PI Ven~to Exon 15: 2909delT ...1... ...... ... ... 1 1 ... 2 Unknown PI Lombardia Exon 20: G1244E .....1 2 2 1 2 2 1 1 1 1 ... 1 deltaF508 PI Sicily a PI = pancreatic insufficiency. Login to comment
52 The mutation found in exon 20 is a missense mutation due to a G-to-A transition at position 3863 and generates a glycine-to-glutamic-acid substitution in codon 1244 (G1244E). Login to comment
83 As for G1244E, it seems that the substitution of a charged amino acid (glutamic acid) for a neutral one (glycine) may be relevant to the protein functioning. Login to comment

[hide] Prenatal diagnosis of cystic fibrosis: a case of t... Clin Chim Acta. 2000 Aug;298(1-2):121-33. Castaldo G, Martinelli P, Massa C, Fuccio A, Grosso M, Rippa E, Paladini D, Salvatore F
Prenatal diagnosis of cystic fibrosis: a case of twin pregnancy diagnosis and a review of 5 years' experience.
Clin Chim Acta. 2000 Aug;298(1-2):121-33., [PMID:10876009]

Abstract [show]
We performed prenatal diagnoses for cystic fibrosis in 32 high risk (1:4) couples (including a dizygotic pregnancy). Chorionic villi sampling did not cause abortion or fetal malformation in any case. The preliminary analysis of 9 short tandem repeats always excluded maternal contamination of the DNA extracted from chorionic villi and confirmed paternity. Twenty-two prenatal diagnoses were made by direct analysis of the mutations. In seven cases diagnosis was made by the analysis of intragenic polymorphisms; in three cases, we analyzed two extragenic polymorphisms. The prenatal diagnosis (including genetic counselling) was completed within 24 h from the sampling. Seven prenatal diagnoses revealed an affected fetus; all couples opted for therapeutic abortion. In 17 cases the fetus was heterozygote, and in seven cases it was non carrier of mutated alleles. In the twin pregnancy, mutations were DeltaF508/N1303K. Direct analysis of the DNA extracted from the two independent samples of chorionic villi revealed one fetus non carrier of mutated alleles and the other a carrier of the N1303K mutation. Analysis of the HPRT locus predicted both the fetuses as males. Furthermore, the genotype of each fetus was defined after birth. The prenatal diagnosis with chorionic villi sampling plays a key role in the prevention of cystic fibrosis. The laboratories must be equipped for both the direct analysis of mutations and for the analysis of a large number of polymorphisms. The preliminary analysis of short tandem repeats is recommended both to exclude maternal contamination and to confirm parentage.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 T, 4016insT, G1244E and R1158X) was analysed on all the CF families with an allele Table 1 Short tandem repeats (STR) used to exclude maternal contamination and to confirm paternity in prenatal diagnosis of cystic fibrosis. Login to comment

[hide] Cystic fibrosis: the 'bicarbonate before chloride'... Curr Biol. 2001 Jun 26;11(12):R463-6. Wine JJ
Cystic fibrosis: the 'bicarbonate before chloride' hypothesis.
Curr Biol. 2001 Jun 26;11(12):R463-6., [PMID:11448786]

Abstract [show]
The specific effects of some mutations that cause cystic fibrosis suggest that reduced HCO(3)(-) transport is the key to understanding cystic fibrosis pathology. But there is a puzzling discrepancy between measures of CFTR-mediated chloride conductance in expression systems and the sweat chloride values of patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Ion transport (% WT) 42 41 69 75 >100 >100 98 + 103 100 + + 120 Pancreatic sufficient Pancreatic insufficient Bicarbonate Chloride - intermediate Chloride - high Unknown WT D648V R117H R1070Q H949Y G551S H620Q I148T A1067T G178R G970R S1255P G1244E G551D G1349D 0 0.5 1 1.5 2 2.5 Current Biology ࢞F508 Dispatch R absence of the vas deferens [16]. Login to comment
76 Critical information was provided by Thilo D&#f6;rk (H620Q); R. Moss (R117H & G551D homozygotes); David Kessler, Theresa Grebe and Elizabeth Perkett (D648V); Monica Brooks and contributors to the Cystic Fibrosis Foundation Registry (G178R and G1244E); Aleksey Savov and Luba Kalaydjieva (R1070Q); and Christiane De Boeck and Harry Cuppens (G970R). Login to comment

[hide] A 96-well formatted method for exon and exon/intro... Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5. Lucarelli M, Narzi L, Piergentili R, Ferraguti G, Grandoni F, Quattrucci S, Strom R
A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene.
Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5., [PMID:16635477]

Abstract [show]
Full genotypic characterization of subjects affected by cystic fibrosis (CF) is essential for the definition of the genotype-phenotype correlation as well as for the enhancement of the diagnostic and prognostic value of the genetic investigation. High-sensitivity diagnostic methods, capable of full scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, are needed to enhance the significance of these genetic assays. A method for extensive sequencing of the CFTR gene was optimized. This method was applied to subjects clinically positive for CF and to controls from the general population of central Italy as well as to a single subject heterozygous for a mild mutation and with an uncertain diagnosis. Some points that are crucial for the optimization of the method emerged: a 96-well format, primer project and purification, and amplicon purification. The optimized method displayed a high degree of diagnostic sensitivity; we identified a subset of 13 CFTR mutations that greatly enhanced the diagnostic sensitivity of common methods of mutational analysis. A novel G1244R disease causing mutation, leading to a CF phenotype with pancreatic sufficiency but early onset of pulmonary involvement, was detected in the subject with an uncertain diagnosis. Some discrepancies between our results and previously published CFTR sequence were found.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 In this work, we found a limited subset of 13 mutations (not included in the PCR/OLA/SCS assay) in 7 CFTR exons, significantly improving the sensitivity of standard assays: D110H, R117C, and H139R (exon 4); R334L, T338I, and A349V (exon 7); S549R(A->C) (exon 11); Y849X (exon 14a); L997F (exon 17a); L1065P, R1066C, and L1077P (exon 17b); and G1244E (exon 20). Login to comment
155 The importance of the 1244 codon, which can be classified as a mutational hot spot, is also highlighted by the fact that this same codon can be affected by two other mutations, G1244V [32] and G1244E [33], both of which already have been shown to cause disease. Login to comment
165 The frequency of the G1244R mutation must be calculated on a larger number of CF subjects to ascertain whether it is a rare mutation; however, the frequency of the G1244E mutation, one of the other mutations in the same codon, was found to be approximately 0.3%, which is relatively high. Login to comment

[hide] Cystic fibrosis in a boy with meconium ileus and m... Turk J Pediatr. 2008 Jul-Aug;50(4):383-5. Yalcin E, Ozcelik U, Yilmaz E, Dogru D, Kiper N, Ferec C
Cystic fibrosis in a boy with meconium ileus and mild clinical phenotype associated with 2183AA-G/D1152H genotype.
Turk J Pediatr. 2008 Jul-Aug;50(4):383-5., [PMID:19014055]

Abstract [show]
We report a 16-year-old boy with cystic fibrosis presenting with meconium ileus in the neonatal period who showed mild clinical phenotype later. He had sufficient pancreatic function, mild lung involvement and borderline sweat chloride levels. Analysis of the cystic fibrosis transmembrane regulator protein gene revealed the rare mutation: 2183AA-G/D1152H. To our knowledge, this is the first report concerning such a mutation combination in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 These nine patients carried delF508, G542X, G1244E and 2789+5G-A on the other CF allele. Login to comment

[hide] [Mucoviscidosis: CFTR mutation-specific therapy: a... Arch Pediatr. 2013 Jan;20(1):63-73. doi: 10.1016/j.arcped.2012.10.018. Epub 2012 Nov 27. Leonard A, Leal T, Lebecque P
[Mucoviscidosis: CFTR mutation-specific therapy: a ray of sunshine in a cloudy sky].
Arch Pediatr. 2013 Jan;20(1):63-73. doi: 10.1016/j.arcped.2012.10.018. Epub 2012 Nov 27., [PMID:23199563]

Abstract [show]
There is a need to find a cure for pulmonary disease in cystic fibrosis (CF), though full benefit of this approach will be restricted to those patients with well-preserved lungs. The most promising route is currently that of a pharmacological mutation-specific approach aiming at correcting the mechanism by which mutations lead to impairment of chloride conductance across respiratory epithelial cells. In the past 14years, 7 candidate drugs (CPX, 4PBA, gentamicin, PTC124, VX-770 or Ivacaftor, VX-809 or Lumacaftor, and Miglustat) have been investigated in CF patients. A postulate of 14 out of the 15 published studies has been that an effective agent had to improve total chloride secretion as assessed in vivo by nasal potential difference measurements. The present review casts a critical look at these studies. Apparent inconsistencies are discussed as well as possible limitations of nasal potential difference measurements as outcome parameters in these trials. Primarily targeting a mutation carried by less than 2% of French CF patients, the 2 Ivacaftor studies could well be a milestone on the long road toward a cure for CF. However, further data on safety and long-term efficacy are obviously needed and the current price of this medication in the US would make it unaffordable for European patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
178 De re &#b4;centes donne &#b4;es in vitro sugge `rent que cette me &#b4;dication soit e &#b4;galement efficace sur 9 autres mutations de la me c6;me classe (G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, G1349D) [50,51]. Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 These include the most common CFTR gating mutation, G551D, as well as the G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D mutations [12]. Login to comment

[hide] Ivacaftor: a review of its use in patients with cy... Drugs. 2013 Sep;73(14):1595-604. doi: 10.1007/s40265-013-0115-2. Deeks ED
Ivacaftor: a review of its use in patients with cystic fibrosis.
Drugs. 2013 Sep;73(14):1595-604. doi: 10.1007/s40265-013-0115-2., [PMID:24030637]

Abstract [show]
Ivacaftor (Kalydeco) is a potentiator of the cystic fibrosis transmembrane conductance regulator (CFTR) and is the first drug that treats an underlying cause of cystic fibrosis to be licensed for use. Ivacaftor increases the open probability (i.e. gating) of CFTR channels with the G551D mutation, thus enhancing chloride transport, and is indicated in a number of countries for the treatment of cystic fibrosis in patients aged >/=6 years who carry this mutation. This review focuses on pharmacological, clinical efficacy and tolerability data relevant to the use of ivacaftor in this indication. In two 48-week, double-blind, phase III trials in patients aged >/=12 (STRIVE) or 6-11 (ENVISION) years with cystic fibrosis and the G551D mutation, oral ivacaftor 150 mg every 12 h significantly improved lung function relative to placebo, when used in combination with standard care. Significant improvements in pulmonary exacerbation risk (in STRIVE) as well as bodyweight and some aspects of health-related quality of life (both studies) were also seen with the drug versus placebo. Moreover, the beneficial effects of ivacaftor on parameters such as lung function and bodyweight were maintained over up to 96 weeks of treatment in an ongoing open-label extension of these studies. Ivacaftor was generally well tolerated, with headache, oropharyngeal pain, upper respiratory tract infection and nasal congestion being among the most common adverse events. Thus, ivacaftor expands the current treatment options for patients with cystic fibrosis who have the G551D mutation. Its potential for use in patients with other CFTR mutations is also of interest.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 For example, in rodent cells expressing G551D/S, G178R, S549N/R, G970R, G1244E, S1251N, S1255P or G1349D CFTR, ivacaftor increased channel open probability from B5 % of normal at baseline to 30-118 % of normal and increased chloride transport C16- fold (EC50 124-594 nmol/L). Login to comment

[hide] The relative frequency of CFTR mutation classes in... J Cyst Fibros. 2014 Jul;13(4):403-9. doi: 10.1016/j.jcf.2013.12.003. Epub 2014 Jan 16. De Boeck K, Zolin A, Cuppens H, Olesen HV, Viviani L
The relative frequency of CFTR mutation classes in European patients with cystic fibrosis.
J Cyst Fibros. 2014 Jul;13(4):403-9. doi: 10.1016/j.jcf.2013.12.003. Epub 2014 Jan 16., [PMID:24440181]

Abstract [show]
More than 1900 different mutations in the CFTR gene have been reported. These are grouped into classes according to their effect on the synthesis and/or function of the CFTR protein. CFTR repair therapies that are mutation or mutation class specific are under development. To progress efficiently in the clinical phase of drug development, knowledge of the relative frequency of CFTR mutation classes in different populations is useful. Therefore, we describe the mutation class spectrum in 25,394 subjects with CF from 23 European countries. In 18/23 countries, 80% or more of the patients had at least one class II mutation, explained by F508del being by far the most frequent mutation. Overall 16.4% of European patients had at least one class I mutation but this varied from 3 countries with more than 30% to 4 countries with less than 10% of subjects. Overall only respectively 3.9, 3.3 and 3.0% of European subjects had at least one mutation of classes III, IV and V with again great variability: 14% of Irish patients had at least one class III mutation, 7% of Portuguese patients had at least one class IV mutation, and in 6 countries more than 5% of patients had at least one class V mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations Large deletions and insertions 1078delT; 1717-1G࢐A; 3659delC; 621+1G࢐T Class II Defective protein processing G85E, F508del, I507del, R560T, N1303K Class III Defective protein regulation ('gating`) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R117H, R334W, R347P Class V Reduced amount of functioning protein 2789+5G࢐A, 3849+10KbC࢐T, A455E Unclassified All other mutations, including those unknown. Login to comment

[hide] Personalised medicine in cystic fibrosis is unaffo... Paediatr Respir Rev. 2014 Jun;15 Suppl 1:2-5. doi: 10.1016/j.prrv.2014.04.003. Epub 2014 Apr 13. Balfour-Lynn IM
Personalised medicine in cystic fibrosis is unaffordable.
Paediatr Respir Rev. 2014 Jun;15 Suppl 1:2-5. doi: 10.1016/j.prrv.2014.04.003. Epub 2014 Apr 13., [PMID:24832698]

Abstract [show]
Personalised medicine refers to a tailored approach to treatment of an individual based on molecular analysis of genes, proteins or metabolites, and commonly involves a companion diagnostic test. It usually applies to small subsets of patients, often with rare diseases. In cystic fibrosis (CF), the best example is the CFTR (CF transmembrane conductance regulator) potentiator, ivacaftor, relevant to the 5% of cystic fibrosis patients with the p.Gly551Asp gene mutation. However the cost of personalised medicine is too high, making it unaffordable in the long term for many healthcare systems. Society needs to find a way to make personalised medicine affordable in order to not deny life-changing treatments from patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 It is currently licensed for use only in those with the p.Gly551Asp mutation; but a further license has been recently approved in the USA for use in other rarer gating mutations (G178R, G551S, S549N, S549R, G970R, G1244E, S1251N, S1255P, or G1349D). Login to comment

[hide] New pharmacological approaches for cystic fibrosis... Pharmacol Ther. 2015 Jan;145:19-34. doi: 10.1016/j.pharmthera.2014.06.005. Epub 2014 Jun 14. Bell SC, De Boeck K, Amaral MD
New pharmacological approaches for cystic fibrosis: promises, progress, pitfalls.
Pharmacol Ther. 2015 Jan;145:19-34. doi: 10.1016/j.pharmthera.2014.06.005. Epub 2014 Jun 14., [PMID:24932877]

Abstract [show]
With the discovery of the CFTR gene in 1989, the search for therapies to improve the basic defects of cystic fibrosis (CF) commenced. Pharmacological manipulation provides the opportunity to enhance CF transmembrane conductance regulator (CFTR) protein synthesis and/or function. CFTR modulators include potentiators to improve channel gating (class III mutations), correctors to improve abnormal CFTR protein folding and trafficking (class II mutations) and stop codon mutation read-through drugs relevant for patients with premature stop codons (most class I mutations). After several successful clinical trials the potentiator, ivacaftor, is now licenced for use in adults and children (>six years), with CF bearing the class III G551D mutation and FDA licence was recently expanded to include 8 additional class III mutations. Alternative approaches for class I and class II mutations are currently being studied. Combination drug treatment with correctors and potentiators appears to be required to restore CFTR function of F508del, the most common CFTR mutation. Alternative therapies such as gene therapy and pharmacological modulation of other ion channels may be advantageous because they are mutation-class independent, however progress is less well advanced. Clinical trials for CFTR modulators have been enthusiastically embraced by patients with CF and health care providers. Whilst novel trial end-points are being evaluated allowing CFTR modulators to be efficiently tested, many challenges related to the complexity of CFTR and the biology of the epithelium still need to be overcome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
547 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations: G542X, R1162X, RW1282X Deletions and insertions: CFTRdele2,3; 1078delT; 1717-1G ࢐ A; 3659delC; 621+1G N T Class II Defective protein processing G85E, F508del, I507del, R560T, A561E, R1066C, N1303K Class III Defective protein regulation (gating) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R334W, R347P, R117H Class V Reduced amount of functioning protein 2789+5G ࢐ A, 3272-26ANG, 3849+10KbC ࢐ T, A455E Class VI Reduced cell surface stability Rescued F508del, c.120del23 Unclassified All other mutations, including those unknown a F508del-CFTR pocket (at NBD1:ICL4 interface) (Farinha et al., 2013). Login to comment

[hide] Mechanisms of CFTR functional variants that impair... PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul. LaRusch J, Jung J, General IJ, Lewis MD, Park HW, Brand RE, Gelrud A, Anderson MA, Banks PA, Conwell D, Lawrence C, Romagnuolo J, Baillie J, Alkaade S, Cote G, Gardner TB, Amann ST, Slivka A, Sandhu B, Aloe A, Kienholz ML, Yadav D, Barmada MM, Bahar I, Lee MG, Whitcomb DC
Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.
PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul., [PMID:25033378]

Abstract [show]
CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

[hide] CFTR Modulators for the Treatment of Cystic Fibros... P T. 2014 Jul;39(7):500-11. Pettit RS, Fellner C
CFTR Modulators for the Treatment of Cystic Fibrosis.
P T. 2014 Jul;39(7):500-11., [PMID:25083129]

Abstract [show]
Defects in a single gene lead to the defective proteins that cause cystic fibrosis, making the disease an ideal candidate for mutation-targeted therapy. Although ivacaftor is currently the only FDA-approved CFTR modifier, others are in development.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 At 48 weeks, 67% of patients in the ivacaftor group had not had a pulmonary exacerbation compared with 41% in the Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Ramsey(2011)30 STRIVE: Randomized, double-blind, placebo-controlled G551D Age 12-53 years N = 161 FEV1 40-90% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Percent change in FEV1 from baseline to 24 wks (P < 0.001): IVA, 10.4%; PBO, -0.2% ߦ Percent change in FEV1 from baseline to 48 wks compared with PBO (P < 0.001): IVA, 10.5% ߦ Percent of patients pulmonary exacerbation-free at 48 wks: IVA, 67%; PBO, 41% ߦ Change in body weight from baseline to 48 wks: IVA, 3.1 kg; PBO, 0.4 kg ߦ Sweat chloride change from baseline to 48 wks compared with PBO (P < 0.001): IVA, -48.1 mmol/L ߦ Change in CFQ-R respiratory domain from baseline to 48 wks (P < 0.001): IVA, 5.9 pts; PBO, -2.7 pts Davies (2013)29 ENVISION: Randomized, double-blind, placebo-controlled G551D Age 6-11 years N = 52 FEV1 40-105% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Absolute change in FEV1 percentage from baseline at 48 wks compared with PBO (P < 0.001): IVA, 10% ߦ Absolute change in FEV1 percentage from baseline at 24 wks (P < 0.001): IVA, 12.6%; PBO, 0.1% ߦ Mean change in sweat chloride from baseline to 48 wks compared with PBO (P < 0.001): IVA, -54.3 mmol/L ߦ Body weight change from baseline to 48 wks compared with PBO (P < 0.001): IVA, 2.8 kg ߦ Absolute CFQ-R change from baseline to 24 wks compared with PBO (P = 0.109): IVA, 6.1 pts McKone (2013)31 PERSIST: Open-label extension G551D Age ࣙ 6 years Patients had completed 48 wks of either ENVISION or STRIVE IVA 150 mg b.i.d. 96 wks (patients received 96 wks or 144 wks of IVA depending on ENVISION or STRIVE randomization) ߦ Absolute change in percent predicted FEV1: &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 9.4 &#b1; 8.3 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 9.4 &#b1; 10.8 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: -1.2 &#b1; 7.8 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 9.5 &#b1; 11.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 10.2 &#b1; 15.7 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 10.3 &#b1; 12.4 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: -0.6 &#b1; 10.1 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.5 &#b1; 11.5 ߦ Absolute change in weight (kg): &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 3.4 &#b1; 4.9 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 4.1 &#b1; 7.1 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: 0.3 &#b1; 2.2 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 3 &#b1; 4.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 6.1 &#b1; 2.9 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 14.8 &#b1; 5.7 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: 2.9 &#b1; 1.8 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.1 &#b1; 4.1 ߦ Absolute change in CFQ-R respiratory domain: &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 6.4 &#b1; 16.8 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 6.8 &#b1; 19.6 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: -3.6 &#b1; 14.1 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 9.8 &#b1; 16.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 7.4 &#b1; 17.4 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 10.6 &#b1; 18.9 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: 0.8 &#b1; 18.4 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.8 &#b1; 12.8 CFTR Modulators for the Treatment of Cystic Fibrosis Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Davies (2013)32 Placebo-controlled, double-blind, crossover study G551D Age > 6 years N = 17 FEV1 > 90% LCI > 7.4 Sequence 1: PBO ࢐ WO ࢐ IVA 150 mg b.i.d. Sequence 2: IVA 150 mg b.i.d. ࢐ WO ࢐ PBO 28-day treatment and WO periods ߦ Average change in LCI from baseline compared with PBO (P < 0.0001): IVA, -2.16 (95% CI, -2.88 to -1.44) ߦ Average change in FEV1 from baseline compared with PBO (P = 0.0103): IVA, 8.67 (95% CI, 2.36 to 14.97) ߦ Average change in FEF25-75 from baseline compared with PBO (P = 0.0237): IVA, 16.56 (95% CI, 2.30 to 27.71) Barry (2013)34 Retrospective review G551D Age 20-31 in IVA group N = 21 FEV1 < 40% IVA 150 mg b.i.d. (n = 21); matched controls (n = 35) Median duration, 237 days ߦ Absolute FEV1 change from baseline (P = 0.0075): IVA, 0.125 L; CON, 0.01 L ߦ Percent predicted FEV1 change from baseline (P = 0.0092): IVA, 12.7%, CON, 2.2% ߦ Median weight increase from baseline: IVA, 1.8 kg; CON, 0.1 kg ߦ Median inpatient days per year decreased from 23 days to 0 days in the IVA group (P = 0.001) ߦ Median total intravenous antibiotic days per year decreased from 74 days to 38 days in the IVA group (P = 0.002) De Boeck (2013)37 KONNECTION: Randomized, double-blind, crossover, placebo-controlled Non-G551D gating mutations G178R, G551S, S549N, S549R, G970R, G1244E, S1251N, S1255P, G1349D Age ࣙ 6 years N = 39 FEV1 ࣙ 40% Treatment sequence 1: IVA 150 mg b.i.d. ࢐ WO ࢐ PBO ࢐ open-label Treatment sequence 2: PBO ࢐ WO ࢐ IVA 150 mg b.i.d. ࢐ open-label 8 wks of IVA or PBO; 4-8 wks WO period; 16 wks open label ߦ Absolute change from baseline percent predicted FEV1 (P < 0.0001): IVA, 7.49%; PBO, -3.19% ߦ Absolute change from baseline BMI (P < 0.0001): IVA, 0.68; PBO, 0.02 ߦ Absolute change from baseline in CFQ-R respiratory domain (P = 0.0004): IVA, 8.94 pts; PBO, -0.67 pts ߦ Absolute change from baseline in sweat chloride (mmol/L): IVA, -52.28; PBO, -3.11 Flume (2011)35 Randomized, double-blind, placebo-controlled, parallel group with open-label extension Homozygous F508del Age ࣙ 12 years Part 1: N = 140 Part 2: N = 33 42 patients were eligible for part 2 if change in FEV1 ࣙ 10% or sweat chloride decreased by at least 15 mmol/L at day 15 and week 8 Part 1: IVA 150 mg b.i.d. or PBO 16 wks Part 2: Open label IVA 150 mg b.i.d. Login to comment
56 These promising results led to an FDA label expansion to include CF patients with the following eight mutations in addition to G551D: G178R, S549R, S549N, G551S, G1244E, S1251N, S1255P, and G1349D.38 Clinical Considerations Ivacaftor was well tolerated in clinical trials. Login to comment

[hide] A cocktail drug therapy for patients with cystic f... J Cyst Fibros. 2014 Sep;13(5):489-90. doi: 10.1016/j.jcf.2014.07.002. Epub 2014 Jul 24. Chen JH
A cocktail drug therapy for patients with cystic fibrosis?
J Cyst Fibros. 2014 Sep;13(5):489-90. doi: 10.1016/j.jcf.2014.07.002. Epub 2014 Jul 24., [PMID:25088968]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 More recently, VX-770 has been approved by the FDA (NDA 203188, www.fda.gov) and recommended by the EMA (EMA/CHMP/365663/2014) for use with an additional eight CF gating (class III) mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D), although, including G551D, these mutations still just occur in ~5% of CF patients worldwide. Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
359 Third, at the level of the NBD1:NBD2 heterodimer, CF-causing mutations are concentrated within the canonical ATP-binding site (S549N, S549R, G551D/G551S, G1244E, S1251N, and S1255P) (Fig. 7d). Login to comment
360 The effects of remaining mutations listed in CFTR2 database can also be well understood in light of our structural data: (1) A455E has indeed no room to be well adapted, (2) G1244E (mentioned above) also occurs in a well conserved position (position 23 in Online Resource 2), (3) L467P might disturb the helix in which it is included, (4) G1349D is in the non-canonical ATP-binding site and, alike its corresponding G551D, has no room to be well adapted in presence of ATP, and finally (5) N1303K might disturb the large Q-loop of the NBD2 a-helical subdomain (position 42 in Online Resource 1 and Online Resource 2). Login to comment

[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]

Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 The molecular analysis of the CFTR gene revealed that the two Table 1 Number of subjects tested who were carriers of the cystic fibrosis transmembrane regulator gene Mutation Men Women Total G551D 1 2 3 R553X 0 1 1 F508del 35 32 67 N1303K 7 8 15 I148T 4 9 13 G542X 3 6 9 DI507 2 0 2 L1077P 0 2 2 D1152H 1 6 7 W1282X 2 0 2 2183 AA>G 3 0 3 1259insA 0 1 1 4016insT 1 0 1 I507del 1 0 1 2789+5G>A 1 0 1 4382delA 0 2 2 G1244E 1 0 1 621+3A>G 1 0 1 Total 63 69 132 Figure 1 76 patients with cystic fibrosis and positive sweat test, all have two genes mutated. Login to comment
59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17]. Login to comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] Mutation analysis of PRSS1, SPINK1 and CFTR gene i... Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287. Sisman G, Tugcu M, Ayla K, Sebati O, Senturk H
Mutation analysis of PRSS1, SPINK1 and CFTR gene in patients with alcoholic and idiopathic chronic pancreatitis: A single center study.
Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287., [PMID:25835118]

Abstract [show]
BACKGROUND/AIMS: A relation between some genetic mutations and chronic pancreatitis (CP) has been reported. However, the relation of genetic mutation to alcoholic CP (ACP) and idiopathic CP (ICP) still remains controversial. In this study, we investigated the prevalence of protease serine 1 (PRSS1), serine protease inhibitor, Kazal type 1 (SPINK1) SPINK1 and cystic fibrosis transmembrane conductance regulator (CFTR) mutations in ACP and ICP patients in Turkey. MATERIALS AND METHODS: Forty-one patients with ACP and 38 patients with ICP were enrolled, and 35 healthy individuals served as controls. The PRSS1 and SPINK1 mutations were investigated by the polymerase chain reaction (PCR)-restriction fragment-length polymorphism (RFLP) technique. The CFTR mutation was examined with PCR direct sequencing. RESULTS: The mean ages of the ACP, ICP and healthy control groups were 53.2, 40.4 and 46.3 years, respectively. A CFTR F508 mutation was detected as a heterozygote in one (2.4%) patient with ACP. In the ICP and control populations, PRSS1, SPINK1 and CFTR mutations were not detected. CONCLUSION: This study shows that PRSS1, SPINK1 and CFTR mutations do not play a role in ACP and ICP patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 DNA samples were multiplied by multiplex PCR with a CF 22Mut and CF 14Mut+Tn strip assay kit which has 36 common mutations of the CFTR gene (DF508, DI507, F508C, I502T, 1706del17, 1677del TA, G542X, 1717-1G>A, R553X, Q552X, G551D, S549R(A>C), N1303K, 4016insT, R1162X, R1158X, W1282X, G1244E, 2789+5G>A, 2183AA>G, 711+5G>A, 711+1G>T, G85E, 3849+10kbC>T, 621+1G>T, R117H, D1152H, L1065P, R1066H, L1077P, 4382delA, 1259insA, 852del22, R347P, T338I, S912X and Allele5T-7T-9T). Login to comment

[hide] Functional reconstitution and channel activity mea... J Vis Exp. 2015 Mar 9;(97). doi: 10.3791/52427. Eckford PD, Li C, Bear CE
Functional reconstitution and channel activity measurements of purified wildtype and mutant CFTR protein.
J Vis Exp. 2015 Mar 9;(97). doi: 10.3791/52427., [PMID:25867140]

Abstract [show]
The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of transporters. The phosphorylation and nucleotide dependent chloride channel activity of CFTR has been frequently studied in whole cell systems and as single channels in excised membrane patches. Many Cystic Fibrosis-causing mutations have been shown to alter this activity. While a small number of purification protocols have been published, a fast reconstitution method that retains channel activity and a suitable method for studying population channel activity in a purified system have been lacking. Here rapid methods are described for purification and functional reconstitution of the full-length CFTR protein into proteoliposomes of defined lipid composition that retains activity as a regulated halide channel. This reconstitution method together with a novel flux-based assay of channel activity is a suitable system for studying the population channel properties of wild type CFTR and the disease-causing mutants F508del- and G551D-CFTR. Specifically, the method has utility in studying the direct effects of phosphorylation, nucleotides and small molecules such as potentiators and inhibitors on CFTR channel activity. The methods are also amenable to the study of other membrane channels/transporters for anionic substrates.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 While the correctors VX-809 and VX-661 (are not yet approved for use in patients, the potentiator Kalydeco (ivacaftor; VX-770) is being used at 150 mg every 12 hr in CF patients >6 years with at least one G551D-CFTR mutation, and more recently for patients with one of G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
390 L1077P c.3230T>C CF-PI CF-causing p.Leu1077Pro Y1092X(C>A) c.3276C>A CF-PI CF-causing p.Tyr1092* M1137V c.3409A>G CFTR-RD nd p.Met1137Val D1152H c.3454G>C CF-PI,CF-PS,CFTR-RD varying clinical consequence p.Asp1152His R1162X c.3484C>T CF-PI CF-causing p.Arg1162* D1168G c.3503A>G CFTR-RD nd p.Asp1168Gly 3667ins4 c.3535_3536insTCAA CF-PI CF-causing p.Thr1179IlefsX17 S1206X c.3617C>A uncertain: CF-PI and/or CF-PS nd p.Ser1206* I1234V c.3700A>G CF-PI,CF-PS CF-causing p.Ile1234Val S1235R c.3705T>G CFTR-RD non CF-causing p.Ser1235Arg 3849+10kbC>T c.3717+12191C>T CF-PI,CF-PS CF-causing V1240G c.3719T>G CFTR-RD nd p.Val1240Gly G1244R c.3730G>A uncertain: CF-PI and/or CF-PS nd p.Gly1244Arg G1244E c.3731G>A CF-PI,CF-PS CF-causing p.Gly1244Glu G1247R(G>C) c.3739G>C CF-PS nd p.Gly1247Arg W1282X c.3846G>A CF-PI CF-causing p.Trp1282* Q1291R c.3872A>G CF-PI,CF-PS,CFTR-RD nd p.Gln1291Arg 4016insT c.3884_3885insT CF-PI CF-causing p.Ser1297PhefsX5 4040delA c.3908delA CF-PI nd p.Asn1303ThrfsX25 N1303K c.3909C>G CF-PI CF-causing p.Asn1303Lys ex22-24del c.3964-3890_4443+3143del9454ins5 CF-PI nd ex22,23del c.3964-78_4242+577del1532 CF-PI CF-causing 4168delCTAAGCC c.4036_4042del CF-PI nd p.Leu1346MetfsX6 G1349D c.4046G>A CF-PI CF-causing p.Gly1349Asp H1375P c.4124A>C uncertain: CF-PI and/or CF-PS nd p.His1375Pro S1455X c.4364C>G CF-PS,CFTR-RD nd p.Ser1455* Q1476X c.4426C>T CFTR-RD nd p.Gln1476* nd,Not determined.According to the three rules described (see Materials and Methods),each mutated allele was classified according to its clinical outcome.It was impossible to univocally assign 16 of the 125 different mutated alleles to one or more macrocategories.A comparison with the CFTR2 project (11) (http://www.cftr2.org) is shown.The alleles are ordered according to their nucleotidic position. Login to comment

[hide] Translating the genetics of cystic fibrosis to per... Transl Res. 2015 Apr 15. pii: S1931-5244(15)00131-0. doi: 10.1016/j.trsl.2015.04.008. Corvol H, Thompson KE, Tabary O, le Rouzic P, Guillot L
Translating the genetics of cystic fibrosis to personalized medicine.
Transl Res. 2015 Apr 15. pii: S1931-5244(15)00131-0. doi: 10.1016/j.trsl.2015.04.008., [PMID:25940043]

Abstract [show]
Cystic fibrosis (CF) is the most common life-threatening recessive genetic disease in the Caucasian population. This multiorgan disease is caused by mutations in the gene encoding the CF transmembrane conductance regulator (CFTR) protein, a chloride channel recognized as regulating several apical ion channels. The gene mutations result either in the lack of the protein at the apical surface or in an improperly functioning protein. Morbidity and mortality because of the mutation of CFTR are mainly attributable to lung disease resulting from chronic infection and inflammation. Since its discovery as the causative gene in 1989, much progress has been achieved not only in clinical genetics but also in basic science studies. Recently, combinations of these efforts have been successfully translated into development and availability for patients of new therapies targeting specific CFTR mutations to correct the CFTR at the protein level. Current technologies such as next gene sequencing and novel genomic editing tools may offer new strategies to identify new CFTR variants and modifier genes, and to correct CFTR to pursue personalized medicine, which is already developed in some patient subsets. Personalized medicine or P4 medicine ("personalized," "predictive," "preventive," and "participatory") is currently booming for CF. The various current and future challenges of personalized medicine as they apply to the issues faced in CF are discussed in this review.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
155 Furthermore, Kalydeco has been tested in patients carrying other class III mutations, or targeted class IVand V mutations (sharing functional similarities with the class III).58 The new trials led to an extension of the FDA and European Medical Agency approval to 8 additional gating mutations: p.Gly178Arg (p.G178R), p.Ser549Asn (p.S549N), p.Ser549Arg (p.S549R), p.Gly551Ser (p.G551S), p.Gly1244Glu (p.G1244E), p.Ser1251Asn (p.S1251N), p.Ser1255Pro (pS1255P), and p.Gly1349Asp (p.G1349D).59 Recently, ivacaftor has also been shown to benefit patients carrying the c.350G . Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 G1244E c.3731G4A p.Gly1244Glu 3876delA c.3744delA p.Lys1250Argfs*9 S1251N c.3752G4A p.Ser1251Asn 3905insT c.3773dupT p.Leu1258Phefs*7 4005+1G4A c.3873+1G4A 4016insT c.3889dupT p.Ser1297Phefs*5 Q1313X c.3937C4T p.Gln1313* CFTRdele22,23 c.3964-78_4242+577del p. Login to comment

[hide] [Challenges of personalized medicine for cystic fi... Arch Pediatr. 2015 Jul;22(7):778-86. doi: 10.1016/j.arcped.2015.04.015. Epub 2015 May 26. Corvol H, Taytard J, Tabary O, Le Rouzic P, Guillot L, Clement A
[Challenges of personalized medicine for cystic fibrosis].
Arch Pediatr. 2015 Jul;22(7):778-86. doi: 10.1016/j.arcped.2015.04.015. Epub 2015 May 26., [PMID:26021452]

Abstract [show]
Personalized medicine, or P4 medicine for "Personalized", "Predictive", "Preventive" and "Participatory", is currently booming for cystic fibrosis, with the development of therapies targeting specific CFTR mutations. The various challenges of personalized medicine applied to cystic fibrosis issues are discussed in this paper.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
135 Compte tenu de l`efficacite &#b4; de KalydecoW chez ces patients, le laboratoire VertexW a ensuite teste &#b4;, puis de &#b4;montre &#b4; son efficacite &#b4; chez des patients porteurs d`autres mutations de classe III, ce qui a permis cette anne &#b4;e une extension d`autorisation de mise sur le marche &#b4; (AMM) pour 8 mutations supple &#b4;mentaires : G1244E, G1349D, G178R, G551S, S1251N, S1255P, S549N et S549R [37]. Login to comment

[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]

Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 Using the US and Italian data, we calculated equally low MIP scores for G178R (0.09, n = 22), S549N (0.12, n = 39), S1251N (0.07, n = 14), and G1244E (0.0, n = 3), but not for S549R (0.21, n = 14) (Supplementary Table S1 online). Login to comment
105 MIP scores were significantly different between the mutations F508del and G551D, which is in agreement with early studies of smaller numbers of patients with CF that reported a lower MI incidence in patients carrying F508del/G551D when compared with patients with CF with F508del/ F508del.28,29 We demonstrated equally low MIP scores for other class III CFTR mutations (G178R, S549N, G1244E, S1251N), further supporting the idea that class III CFTR mutations are not as severe as F508del, at least with respect to gastrointestinal development. Login to comment

[hide] Targeting ion channels in cystic fibrosis. J Cyst Fibros. 2015 Sep;14(5):561-70. doi: 10.1016/j.jcf.2015.06.002. Epub 2015 Jun 23. Mall MA, Galietta LJ
Targeting ion channels in cystic fibrosis.
J Cyst Fibros. 2015 Sep;14(5):561-70. doi: 10.1016/j.jcf.2015.06.002. Epub 2015 Jun 23., [PMID:26115565]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause a characteristic defect in epithelial ion transport that plays a central role in the pathogenesis of cystic fibrosis (CF). Hence, pharmacological correction of this ion transport defect by targeting of mutant CFTR, or alternative ion channels that may compensate for CFTR dysfunction, has long been considered as an attractive approach to a causal therapy of this life-limiting disease. The recent introduction of the CFTR potentiator ivacaftor into the therapy of a subgroup of patients with specific CFTR mutations was a major milestone and enormous stimulus for seeking effective ion transport modulators for all patients with CF. In this review, we discuss recent breakthroughs and setbacks with CFTR modulators designed to rescue mutant CFTR including the common mutation F508del. Further, we examine the alternative chloride channels TMEM16A and SLC26A9, as well as the epithelial sodium channel ENaC as alternative targets in CF lung disease, which remains the major cause of morbidity and mortality in patients with CF. Finally, we will focus on the hurdles that still need to be overcome to make effective ion transport modulation therapies available for all patients with CF irrespective of their CFTR genotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
604 When tested in clinical trials, the potentiator ivacaftor (also known as VX-770) showed a marked clinical benefit, with substantial improvement of lung function, reduction of pulmonary exacerbations, and increase in body weight in CF patients with G551D and 8 additional Class III mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D) [32-35]. Login to comment

[hide] Hallmarks of therapeutic management of the cystic ... J Cyst Fibros. 2015 Nov;14(6):687-99. doi: 10.1016/j.jcf.2015.09.006. Epub 2015 Oct 29. Amaral MD, Balch WE
Hallmarks of therapeutic management of the cystic fibrosis functional landscape.
J Cyst Fibros. 2015 Nov;14(6):687-99. doi: 10.1016/j.jcf.2015.09.006. Epub 2015 Oct 29., [PMID:26526359]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) protein does not operate in isolation, rather in a dynamic network of interacting components that impact its synthesis, folding, stability, intracellular location and function, referred to herein as the 'CFTR Functional Landscape (CFFL)'. For the prominent F508del mutation, many of these interactors are deeply connected to a protein fold management system, the proteostasis network (PN). However, CF encompasses an additional 2000 CFTR variants distributed along its entire coding sequence (referred to as CFTR2), and each variant contributes a differential liability to PN management of CFTR and to a protein 'social network' (SN) that directs the probability of the (patho)physiologic events that impact ion transport in each cell, tissue and patient in health and disease. Recognition of the importance of the PN and SN in driving the unique patient CFFL leading to disease highlights the importance of precision medicine in therapeutic management of disease progression. We take the view herein that it is not CFTR, rather the PN/SN, and their impact on the CFFL, that are the key physiologic forces driving onset and clinical progression of CF. We posit that a deep understanding of each patients PN/SN gained by merging genomic, proteomic (mass spectrometry (MS)), and high-content microscopy (HCM) technologies in the context of novel network learning algorithms will lead to a paradigm shift in CF clinical management. This should allow for generation of new classes of patient specific PN/SN directed therapeutics for personalized management of the CFFL in the clinic.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
656 The FDA approval of Ivacaftor for multiple G551D like phenotypic variants including G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D [159,160] found at the cell surface with gating defects [161,162], and the FDA-approval of a combination of Lumacaftor and Ivacaftor for treatment of F508del [156] are examples of successful application of these technologies. Login to comment