ABCC7 p.Cys276*
| ClinVar: |
c.828C>A
,
p.Cys276*
D
, Likely pathogenic
|
| CF databases: |
c.828C>A
,
p.Cys276*
D
, CF-causing
|
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]
Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL.
X
ABCC7 p.Cys276* 12007216:109:269
status: NEW[hide] Interleukin 8 secretion from monocytes of subjects... Clin Diagn Lab Immunol. 2004 Sep;11(5):819-24. Zaman MM, Gelrud A, Junaidi O, Regan MM, Warny M, Shea JC, Kelly C, O'Sullivan BP, Freedman SD
Interleukin 8 secretion from monocytes of subjects heterozygous for the deltaF508 cystic fibrosis transmembrane conductance regulator gene mutation is altered.
Clin Diagn Lab Immunol. 2004 Sep;11(5):819-24., [PMID:15358638]
Abstract [show]
Patients with cystic fibrosis (CF) exhibit an excessive host inflammatory response. The aim of this study was to determine (i) whether interleukin 8 (IL-8) secretion is increased from monocytes from subjects heterozygous as well as homozygous for cystic fibrosis transmembrane conductance regulator (CFTR) mutations and (ii) whether this is due to increased cell surface lipopolysaccharide (LPS) receptors or, alternatively, increased activation of mitogen-activated protein kinases (MAPK). The basal level of IL-8 secretion was higher from monocytes from CF patients than from monocytes from healthy controls (P = 0.02) and obligate heterozygotes (parents of the CF patients). The 50% effective concentrations for LPS-induced IL-8 production for monocytes from both CF patients and obligate heterozygotes were 100-fold lower than those for monocytes from healthy controls (P < 0.05). No differences in the levels of IL-1beta production were seen between these groups. Expression of the LPS surface receptors CD14 and Toll-like receptor 4 were not different between CF patients and healthy controls. In contrast, phosphorylation of the MAPKs p38 and ERK occurred at lower doses of LPS in monocytes from patients heterozygous and homozygous for CFTR mutations. These results indicate that a single allelic CFTR mutation is sufficient to augment IL-8 secretion in response to LPS. This is not a result of increased LPS receptor expression but, rather, is associated with alterations in MAPK signaling.
Comments [show]
None has been submitted yet.
No. Sentence Comment
49 Although the majority of CF subjects were homozygous for ⌬F508, mutations on the other allele (compound heterozygotes) included 621 ϩ 1G-T, N1303K, C276X, W1282X, and 1717-1GϾA.
X
ABCC7 p.Cys276* 15358638:49:161
status: NEW[hide] Platelet activation in cystic fibrosis. Blood. 2005 Jun 15;105(12):4635-41. Epub 2005 Feb 10. O'Sullivan BP, Linden MD, Frelinger AL 3rd, Barnard MR, Spencer-Manzon M, Morris JE, Salem RO, Laposata M, Michelson AD
Platelet activation in cystic fibrosis.
Blood. 2005 Jun 15;105(12):4635-41. Epub 2005 Feb 10., 2005-06-15 [PMID:15705796]
Abstract [show]
Cystic fibrosis (CF) is caused by a mutation of the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR). We examined platelet function in CF patients because lung inflammation is part of this disease and platelets contribute to inflammation. CF patients had increased circulating leukocyte-platelet aggregates and increased platelet responsiveness to agonists compared with healthy controls. CF plasma caused activation of normal and CF platelets; however, activation was greater in CF platelets. Furthermore, washed CF platelets also showed increased reactivity to agonists. CF platelet hyperreactivity was incompletely inhibited by prostaglandin E(1) (PGE(1)). As demonstrated by Western blotting and reverse-transcriptase-polymerase chain reaction (RT-PCR), there was neither CFTR nor CFTR-specific mRNA in normal platelets. There were abnormalities in the fatty acid composition of membrane fractions of CF platelets. In summary, CF patients have an increase in circulating activated platelets and platelet reactivity, as determined by monocyte-platelet aggregation, neutrophil-platelet aggregation, and platelet surface P-selectin. This increased platelet activation in CF is the result of both a plasma factor(s) and an intrinsic platelet mechanism via cyclic adenosine monophosphate (cAMP)/adenylate cyclase, but not via platelet CFTR. Our findings may account, at least in part, for the beneficial effects of ibuprofen in CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
44 Clinical characteristics of cystic fibrosis patients Patient Age, y Vitamin E, mg/L* FEV1, % predicted† Inpatient or outpatient‡ Genotype Platelet studies§ 1 20 6.6 25 In ␦F508/unk A 2 20 3.6 70 In ␦F508/G542X A 3 11 16.8 92 Out ␦F508/dF508 A 4 16 5.4 101 Out ␦F508/G542X A 5 9 3.9 124 Out ␦F508/dF508 A,F 6 6 5.1 118 Out ␦F508/dF508 A,F 7 13 8.1 119 Out ␦F508/dF508 A,F 8 10 9.7 104 Out ␦F508/dF508 A,F 9 22 9.0 58 In ␦F508/dF508 A 10 19 8.0 57 Out ␦F508/N1303K A 11 17 7.0 24 Out ␦F508/dF508 A,D,E 12 20 3.2 55 Out ␦F508/dF508 A,D 13 15 5.8 41 In ␦F508/dF508 A,D,E 14 26 12.7 88 Out ␦F508/dF508 A,D 15 11 16.3 72 Out ␦F508/W1282X A,D 16 18 10.0 58 In ␦F508/dF508 A,D 17 22 10.5 50 Out ␦F508/dF508 A,D 18 35 8.6 87 Out ␦F508/C276X A,E 19 17 16.2 62 In ␦F508/dF508 B,E 20 14 4.1 85 In ␦F508/dF508 B 21 22 2.3 62 In ␦F508/G542X B 22 21 7.7 54 In ␦F508/N1303K B 23 19 2.4 69 In ␦F508/Y1092X B 24 19 4.6 87 In ␦F508/dF508 B, C, E 25 21 8.2 58 In R334W/unk C 26 22 5.8 85 In ␦F508/dF508 C,E 27 22 2.9 67 In unk/unk C 28 20 6.7 77 In ␦F508/dF508 E 29 18 13.3 92 In ␦F508/dF508 E 30 22 8.8 71 In ␦F508/394delTT E 31 15 13.0 68 In ␦F508/dF508 E 32 14 unk 97 Out ␦F508/dF508 E unk indicates unknown.
X
ABCC7 p.Cys276* 15705796:44:871
status: NEW[hide] Genotype-phenotype correlations for the paranasal ... Am J Respir Crit Care Med. 1999 May;159(5 Pt 1):1412-6. Jorissen MB, De Boeck K, Cuppens H
Genotype-phenotype correlations for the paranasal sinuses in cystic fibrosis.
Am J Respir Crit Care Med. 1999 May;159(5 Pt 1):1412-6., [PMID:10228103]
Abstract [show]
Genotype-phenotype correlations in cystic fibrosis (CF) have been found for lung and pancreatic function, but not for paranasal sinus disease. Because such correlations may have pathophysiological and clinical implications, the correlation of mutations, in particular DeltaF508, with paranasal sinus disease was investigated in 113 CF patients with known genotype. The clinical importance of paranasal sinus disease was evaluated using three parameters: polyps, overall clinical severity of upper airway problems, and surgery. Polyps were evaluated by nasal endoscopy and graded on a five-point scale. Four severity groups were distinguished based on history, clinical records, and examination: no upper airway problems; more problems than in control subjects; severe, recurrent or chronic problems; and paranasal sinus surgery cases. DeltaF508 homozygosity correlated with clinical severity (p < 0.02) and with the presence of polyps on endoscopy (p < 0.05). The relative risk for paranasal sinus surgery in DeltaF508 homozygous CF patients was 2.33. In conclusion, there are genotype-phenotype correlations for paranasal sinus disease in CF. DeltaF508 homozygosity is a risk factor for paranasal sinus disease in CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
120 of Patients in Surgical Group ⌬F508 Genotype Homozygosity 69 61 22 Compound heterozygosity 33 29 5 Negative 11 10 1 Mutations ⌬F508 171 75.7 27 Non-⌬F508 55 24.3 6 R117H (4) C276X (1) 394delT (1) W401X (2,† ) A455E (1) G542X (4,‡ ) G551D (1) R553X (1) G628R(G→C) (1) Y1092X (1) D1152H (1) S1251N (1) W1282X (3) N1303K (8) W1310X (1) 1717-1G→A (3,† ) 1898ϩ1G→C (1) 2183AA-G (3,†† ) 3659delC (2) 3272-26A→G (2,† ) 4218-insT (2) unknown (11,‡ ) * The genotype and mutations are given for the 113 patients with CF.
X
ABCC7 p.Cys276* 10228103:120:195
status: NEW121 of Patients in Surgical Group DF508 Genotype Homozygosity 69 61 22 Compound heterozygosity 33 29 5 Negative 11 10 1 Mutations DF508 171 75.7 27 Non-DF508 55 24.3 6 R117H (4) C276X (1) 394delT (1) W401X (2,ߤ ) A455E (1) G542X (4,ߥ ) G551D (1) R553X (1) G628R(GC) (1) Y1092X (1) D1152H (1) S1251N (1) W1282X (3) N1303K (8) W1310X (1) 1717-1GA (3,ߤ ) 189811GC (1) 2183AA-G (3,ߤߤ ) 3659delC (2) 3272-26AG (2,ߤ ) 4218-insT (2) unknown (11,ߥ ) * The genotype and mutations are given for the 113 patients with CF.
X
ABCC7 p.Cys276* 10228103:121:174
status: NEW[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]
Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.
Comments [show]
None has been submitted yet.
No. Sentence Comment
368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L .
X
ABCC7 p.Cys276* 25910067:368:812
status: NEW