ABCMdb

ABCC7 p.Asp614Gly

Admin's notes:	Class II (maturation defect) Veit et al.
ClinVar:	c.1840G>T , p.Asp614Tyr ? , not provided
CF databases:	c.1841A>G , p.Asp614Gly ? , Varying clinical consequence ; CFTR1: This mutation, found in exon 13 of a CF patient from Italian origin, was observed once while screening 56 Italian CF chromosomes. The mutated sequence was detected using DGGE and DNA sequencing. c.1840G>T , p.Asp614Tyr (CFTR1) ? , This substitution involves a residue conserved among species and affects the charge of the CFTR protein. It was found in a CF patient heterozygous for 1677delTA (the assignement was not possible), and presenting with a severe classical form. D614Y creates a HindIII restriction site.
Predicted by SNAP2:	A: D (95%), C: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: D (91%), P: D (95%), Q: D (95%), R: D (95%), S: D (91%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

II (maturation defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]

Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
295 I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R and L633P resulted in aberrant processing. Login to comment
297 L619S resulted in an inactive channel whereas D614G and I618T display a partial activity as chloride channels [161]. Login to comment

[hide] Analysis of the entire coding region of the cystic... Hum Mutat. 2001 Aug;18(2):166. Castellani C, Gomez Lira M, Frulloni L, Delmarco A, Marzari M, Bonizzato A, Cavallini G, Pignatti P, Mastella G
Analysis of the entire coding region of the cystic fibrosis transmembrane regulator gene in idiopathic pancreatitis.
Hum Mutat. 2001 Aug;18(2):166., [PMID:11462247]

Abstract [show]
Many Cystic Fibrosis (CF) carriers have been detected testing some subjects with chronic pancreatitis for a limited number of mutations. The aim of this study was to find out if some subjects with pancreatitis and a CFTR mutation actually carry another, undetected mutation. We screened for 18 CFTR mutations plus the CFTR intron 8 poly(T) tract length a population of 67 patients suffering from idiopathic either acute, or recurrent acute, or chronic pancreatitis. Three of them were diagnosed as affected by CF. Among the others, a subset of 14 (8 CFTR mutation carriers, 4 5T carriers, and 2 sweat chloride borderliners) was selected and analyzed by denaturing gradient gel electrophoresis. Six possibly CF-related mutations were detected: L997F and 3878delG were found in two of the subjects already carrying another mutation, S1235R and L997F in one patient carrying the 5T, and L997F and D614G in the two patients with borderline sweat chloride. Among the 14 selected cases a total of 11 patients carried at least one mutation, and three of them were compound heterozygotes. Though it is debatable whether these three individuals can be considered affected by CF, their pancreatitis is possibly a clinical manifestation of some CFTR-related disease. Hum Mutat 18:166, 2001.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Six possibly CF-related mutations were detected: L997F and 3878delG were found in two of the subjects already carrying another mutation, S1235R and L997F in one patient carrying the 5T, and L997F and D614G in the two patients with borderline sweat chloride. Login to comment
73 Six possibly CF-related mutations were detected: L997F and 3878delG (the latter described here for the first time) were found in two of the subjects already carrying another mutation, S1235R and L997F in one patient carrying the 5T allele, and L997F and D614G in two of the three patients with borderline sweat chloride. Login to comment
77 Sex (m/f) Age (yr) Pancreatitis CFTR Testing for 18 mutations Newly found mutations after DGGE PolyT Splice Variant Sweat Cl- (mEq/l) Nasal Potential Difference CF-compatible anamnestical and clinical features Sputum culture FEV1 (%) 1 m 17 ICP F508del L997F 7/9 23.5 n.a. - neg. 141 2 m 33 ICP F508del 7/9 n.a. n.a. - n.a. n.a. 3 m 45 ICP 2789+5G→A 7/7 59.5 n.a. - neg. 71 4 f 52 ICP F508del 7/9 28.5 basal and activated: negative - neg. 107 5 m 18 IRAP R1162X 7/7 n.a. n.a. sinusitis n.a. n.a. 6 m 45 ICP F508del 7/9 55.5 basal negative diabetes 7 m 50 ICP F508del 7/9 n.a. n.a. - n.a. n.a. 8 m 14 IAP 3849+10KbC→T 3878delG* 7/7 n.a. n.a. - n.a. n.a. 9 m 27 ICP - S1235R L997F 5/7 24.5 basal and activated: negative - neg. n.a. 10 m 32 IRAP - 5/7 n.a. n.a. - n.a. n.a. 11 f 24 ICP - 5/7 57.5 basal and activated: negative - neg. n.a. 12 f 7 IRAP - 5/7 9.5 basal negative - n.a. n.a. 13 m 28 ICP - L997F 7/9 49.5 n.a. chronic cough n.a. n.a. 14 f 27 IRAP - D614G 7/7 56 n.a. chronic cough, sinusitis neg. 117 n.a. : not available * : novel mutation DISCUSSION There is general agreement that a diagnosis of CF can be formulated in presence of one or more consistent phenotypic features (including pancreatitis) plus the evidence of CFTR dysfunction as documented by elevated sweat chloride concentrations, or identification of two CF-causing mutations, or the in vivo demonstration of abnormal ion transport across the nasal epithelium (Rosenstein et al, 1998). Login to comment
105 As for the other mutations found in phase 2, 3878delG had not been described previously, D614G had been found in exon 13 of a CF patient from Italian origin, and S1235R in exon 19 in two out of 34 unrelated Belgian CF chromosomes (Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca./cftr). Login to comment

[hide] Molecular consequences of cystic fibrosis transmem... Gut. 2003 Aug;52(8):1159-64. Ahmed N, Corey M, Forstner G, Zielenski J, Tsui LC, Ellis L, Tullis E, Durie P
Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas.
Gut. 2003 Aug;52(8):1159-64., [PMID:12865275]

Abstract [show]
BACKGROUND AND AIMS: We tested the hypothesis that the actual or predicted consequences of mutations in the cystic fibrosis transmembrane regulator gene correlate with the pancreatic phenotype and with measures of quantitative exocrine pancreatic function. METHODS: We assessed 742 patients with cystic fibrosis for whom genotype and clinical data were available. At diagnosis, 610 were pancreatic insufficient, 110 were pancreatic sufficient, and 22 pancreatic sufficient patients progressed to pancreatic insufficiency after diagnosis. RESULTS: We identified mutations on both alleles in 633 patients (85.3%), on one allele in 95 (12.8%), and on neither allele in 14 (1.9%). Seventy six different mutations were identified. The most common mutation was DeltaF508 (71.3%) followed by G551D (2.9%), G542X (2.3%), 621+1G-->T (1.2%), and W1282X (1.2%). Patients were categorized into five classes according to the predicted functional consequences of each mutation. Over 95% of patients with severe class I, II, and III mutations were pancreatic insufficient or progressed to pancreatic insufficiency. In contrast, patients with mild class IV and V mutations were consistently pancreatic sufficient. In all but four cases each genotype correlated exclusively with the pancreatic phenotype. Quantitative data of acinar and ductular secretion were available in 93 patients. Patients with mutations belonging to classes I, II, and III had greatly reduced acinar and ductular function compared with those with class IV or V mutations. CONCLUSION: The predicted or known functional consequences of specific mutant alleles correlate with the severity of pancreatic disease in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
309 Table 2 Genotype classification according to the functional consequences of CFTR gene mutations Pancreatic status Class I Class II Class III Class IV Class V PS F1 , 875+1G→C(2) F, F (1) F, G551D (1) F, R117H (11) F,3849+10kbC→T (5) F, G85E2 (1) F, R347H (3) F,3272-26A→G (4) F, S1251N (2) F,A445E (3) F, D614G (1) F,P574H (2) F, R347P (1) F,3120G>A (1) R117H,R117H (1) F, 5T (8) F, L1335P (1) F,2789+5G→A (1) F,P67L (1) F,R347P/R347H (1) F,V232D(2) R334W, R334W(1) PS→PI F,3659delC (1) F,F (15) F,G551D (1) F, I1234V (1) F,2184insA (1) F,R560T (1) PI F, G542X (27) F,F (365) F, G551D (28) F, 621+1G→T (13) F, R560T (7) F,R553X (7) F, N1303K (9) F, R1162X (6) F,L1077P (2) F, 3659delC (5) F, I48T (1) F, 1717-1G→A (5) F,A559T (1) F, W1282X (5) F, G85E2 (2) F, 711+1G→T (5) G551D,G551D(1) F,2184delA(4) F,H199R (1) W1282X,W1282X (4) F,I1072T(1) F,Y1092X (3) F,S549 (R75Q) (1) F,556delA (3) F, Q493X (3) F,4016InsT (3) F, 3120+1G→A (2) F, G551D/R553X (2) F,Q814X(2) F,1154insTC (2) F,441delA (1) F, 4326delTC (1) F,Q552X(1) F,3007delG (1) F,2184insA (1) F, 4010del4 (1) F,3905insT (1) F,1078delT(1) F,E1104X (1) F,3876delA (1) F,4374+1G→T (1) F,E585X (1) F, E60X (1) CFTR, cystic fibrosis transmembrane regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment

[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

[hide] Characterization of cystic fibrosis conductance tr... Hum Reprod. 2004 Nov;19(11):2502-8. Epub 2004 Aug 27. Grangeia A, Niel F, Carvalho F, Fernandes S, Ardalan A, Girodon E, Silva J, Ferras L, Sousa M, Barros A
Characterization of cystic fibrosis conductance transmembrane regulator gene mutations and IVS8 poly(T) variants in Portuguese patients with congenital absence of the vas deferens.
Hum Reprod. 2004 Nov;19(11):2502-8. Epub 2004 Aug 27., [PMID:15333598]

Abstract [show]
BACKGROUND: Cystic fibrosis conductance transmembrane regulator (CFTR) gene mutations and IVS8 poly(T) variants in Portuguese patients with bilateral (CBAVD) and unilateral (CUAVD) congenital absence of the vas deferens remain to be evaluated. METHODS: Patient screening was carried out by PCR, denaturing gradient gel electrophoresis and DNA sequencing. RESULTS: CFTR mutations were found in 18 out of 31 (58.1%) CBAVD and in three of four (75%) CUAVD patients. The most frequent mutations were F508del and R334W in CBAVD and G542X in CUAVD, with the allelic frequencies of R334W (6.5%) and G542X (25%) being particular to the Portuguese population. The 5T allelic frequency was 3.5% in the fertile male population, 25% in CUAVD and 27.4% in CBAVD patients. The combined frequency of mutations (CFTR+5T) was increased in CBAVD to 22 out of 31 (71%). The frequency of CFTR mutations was compared with that of patients with secondary obstructive azoospermia (OAZ; one out of 16, 6.3%) and non-obstructive azoospermia (NOAZ; two out of 22, 9.1%) with conserved spermatogenesis, which were similar to the general population. However, whereas the 5T allelic frequency in OAZ was similar to that of the general population (3.1%), it was increased in NOAZ cases (14.3%). CONCLUSIONS: Data confirm that CFTR+5T mutations represent the most common genetic abnormality in CAVD, and suggest that cases of NOAZ may be associated with the 5T allele.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 The frequency of the other mutations was: four of 62 (6.5%) for R334W, two of 62 (3.2%) for R117H, P205S and G576A, and one of 62 (1.6%) for D614G, V562I, R668C, 2789-5G ! Login to comment
104 Of the 22 NOAZ patients with conserved spermatogenesis and normal renal development, there were seven (31.8%) Table I. CFTR mutations and IVS8-5T variants found in 77 Portuguese azoospermic patients Syndromes Mutations n CFTR mutations IVS8 poly(T) variants Two mutations One mutation CBAVD F508del/R117H 1 1 - 7/9 F508del/D614G 1 1 - 7/9 R334W/R334W 1 1 - 7/7 R334W/V562I 1 1 - 5/7 R117H/P205S 1 1 - 7/7 2789 þ 5G ! Login to comment

[hide] Molecular characterization of the cystic fibrosis ... Genet Med. 2007 Mar;9(3):163-72. Grangeia A, Sa R, Carvalho F, Martin J, Girodon E, Silva J, Ferraz L, Barros A, Sousa M
Molecular characterization of the cystic fibrosis transmembrane conductance regulator gene in congenital absence of the vas deferens.
Genet Med. 2007 Mar;9(3):163-72., [PMID:17413420]

Abstract [show]
PURPOSE: Approximately 20% of patients with congenital absence of the vas deferens remain without two mutations identified. We applied a strategy of serial screening steps to 45 patients with congenital absence of the vas deferens and characterized cystic fibrosis transmembrane conductance regulator gene mutations in all cases. METHODS: DNA samples of 45 patients with congenital absence of the vas deferens were screened by successive different molecular genetics approaches. RESULTS: Initial screening for the 31 most frequent cystic fibrosis mutations, IVS8 poly(TG)m, poly(T)n, and M470V polymorphisms, identified 8 different mutations in 40 patients (88.9%). Extensive cystic fibrosis transmembrane conductance regulator gene analysis by denaturing gradient gel electrophoresis, denaturing high-performance liquid chromatography, and DNA sequencing detected 17 further mutations, of which three were novel. Cystic fibrosis transmembrane conductance regulator gene rearrangements were searched by semiquantitative fluorescent multiplex polymerase chain reaction, which detected a CFTRdele2,3 (21 kb) large deletion and confirmed two homozygous mutations. Overall, 42 patients (93.3%) had two mutations and 3 patients (6.7%) had one mutation detected. CONCLUSIONS: The present screening strategy allowed a higher mutation detection rate than previous studies, with at least one cystic fibrosis transmembrane conductance regulator gene mutation found in all patients with congenital absence of the vas deferens.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 DeltaF508 was the second most common mutation, representing 21 (23.3%) of total alleles, followed by R334W (6, Table 1 CFTR gene mutations and polymorphisms in patients with congenital absence of the vas deferens Mutation Location Nucleotide alteration Effect Method 1 CFTRdele2,3 Exons 2-3 Deletion of exons 2 and 3 Frameshift QFM-PCR 2 R117H Exon 4 G¡A at 482 AA substitution 31 mutation panel 3 P205S Exon 6a C¡T at 745 AA substitution DGGE/dHPLC 4 L206W Exon 6a T¡G at 749 AA substitution DGGE/dHPLC 5 R258G Exon 6b A¡G at 904 AA substitution DGGE/dHPLC 6 R334W Exon 7 C¡T at 1132 AA substitution 31 mutation panel 7 T5 allele Intron 8 Deletion of 2T at 1342-12 to -6 Aberrant splicing DGGE/DNA sequencing 8 P439S Exon 9 C¡T at 1447 AA substitution DGGE/dHPLC 9 D443Ya Exon 9 G¡T at 1459 AA substitution DGGE/dHPLC 10 I507del Exon 10 Deletion of 3 bp at 1648-1653 AA deletion 31 mutation panel 11 DeltaF508 Exon 10 Deletion of 3 bp at 1652-1655 AA deletion 31 mutation panel 12 G542X Exon 11 G¡T at 1756 Truncation 31 mutation panel 13 V562I Exon 12 G¡A at 1816 AA substitution DGGE/dHPLC 14 G576Aa Exon 12 G¡C at 1859 Aberrant splicing DGGE/dHPLC 15 D614G Exon 13 A¡G at 1973 AA substitution DGGE/dHPLC 16 R688Ca Exon 13 C¡T at 2134 AA substitution DGGE/dHPLC 17 V754M Exon 13 G¡A at 2392 AA substitution DGGE/dHPLC 18 E831X Exon 14a G¡T at 2623 Truncation DGGE/dHPLC 19 3272-26AϾG Intron 17a A¡G at 3272-26 Aberrant splicing DGGE/dHPLC 20 2789ϩ5G¡A Intron 14b G¡A at 2789ϩ5 Aberrant splicing 31 mutation panel 21 V1108L Exon 17b G¡C at 3454 AA substitution DGGE/dHPLC 22 L1227S Exon 19 T¡C at 3812 AA substitution DGGE/dHPLC 23 S1235R Exon 19 T¡G at 3837 AA substitution DGGE/dHPLC 24 P1290S Exon 20 C¡T at 4000 AA substitution DGGE/dHPLC 25 N1303K Exon 21 C¡G at 4041 AA substitution 31 mutation panel 26 E1401K Exon 23 G¡A at 4333 AA substitution DGGE/dHPLC Polymorphisms 1 TG repeats Intron 8 9-13 copies at 1342-12 to -35 Sequence variation DGGE/DNA sequencing 2 M470V Exon 10 A or G at 1540 Sequence variation DNA sequencing 3 125G/C Exon 1 G¡C at 125 Sequence variation DGGE/dHPLC 4 1001ϩ11T/C Intron 6b C¡4T at 1001ϩ11 Sequence variation DGGE/dHPLC 5 1716G/A Exon 10 G¡A at 1716 Sequence variation DGGE/dHPLC 6 1899-136T/G Intron 12 T¡G at 1899-136 Sequence variation DGGE/dHPLC 7 T854T Exon 14a T¡G at 2694 Sequence variation DGGE/dHPLC 8 3601-65C/A Intron 18 C¡A at 3601-65 Sequence variation DGGE/dHPLC 9 4521G/A Exon 24 G¡A at 4521 Sequence variation DGGE/dHPLC QFM-PCR, semiquantitative fluorescent multiplex polymerase chain reaction; bp, base pair; DGGE, denaturing gradient gel electrophoresis; dHPLC, denaturing high-performance liquid chromatography. Login to comment
97 The allelic frequency of the other mutations was 4.4% for R117H, G576A, and R668C, 3.3% for S1235R and 3272-26A¡G, and 2.2% for P205S, L206W, D443Y, G542X, D614G, and N1301K, whereas the remaining 12 mutations were present in single patients (Table 3). Login to comment
101 The missense M470V polymorphism was evaluated in all 45 pa- tientswithCAVD(Table2).TheallelicfrequencyoftheM470variant Table 2 CFTR genotypes identified in patients with congenital absence of the vas deferens CFTR mutation genotypes [(TG)mTn] genotype M470V Patients N % DeltaF508 (TG)10T9 (TG)12T5 M V 11 24.4 DeltaF508 (TG)10T9 (TG)11T5 M M 1 2.2 DeltaF508 R117H (TG)10T9 (TG)10T7 M M 2 4.4 G542X (TG)10T9 (TG)12T5 M V 2a 4.4 DeltaF508 R334W (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 D443Y-G576A-R668C (TG)10T9 (TG)10T7 M M 1 2.2 DeltaF508 D614G (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 E831X (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 L1227S (TG)10T9 (TG)11T7 M M 1 2.2 DeltaF508 E1401K (TG)10T9 (TG)11T7 M V 1 2.2 I507del D614G (TG)11T7 (TG)10T7 M V 1 2.2 N1303K L206W (TG)10T9 (TG)9T9 M M 1 2.2 R117H P205S (TG)11T7 (TG)10T7 M V 1 2.2 R117H R334W (TG)10T7 (TG)11T7 M V 1 2.2 R334W P439S (TG)11T7 (TG)11T7 M V 1 2.2 R334W R334Wb (TG)11T7 (TG)11T7 V V 1 2.2 R334W V562I (TG)11T7 (TG)11T5 V M 1 2.2 D443Y-G576A-R668C 3272-26A¡G (TG)10T7 (TG)10T7 M M 1 2.2 G576A-R668C V754Mb (TG)10T7 (TG)11T7 M M 1 2.2 S1235R S1235Rb (TG)13T5 (TG)13T5 M M 1 2.2 2789ϩ5G¡A S1235Rb (TG)10T7 (TG)13T5 M M 1 2.2 3272-26A¡G P1290S (TG)11T7 (TG)10T7 M V 1 2.2 P205S (TG)11T7 (TG)12T5 V V 1 2.2 G576A-R668C b (TG)10T7 (TG)11T5 M M 1 2.2 V1108L b (TG)11T7 (TG)11T5 V M 1 2.2 N1303K (TG)10T9 (TG)12T5 M V 1 2.2 3272-26A¡G b (TG)10T7 (TG)12T5 M V 1 2.2 CFTRdele2,3 b (TG)11T7 (TG)13T5 V M 1 2.2 b (TG)11T5 (TG)12T5 M V 1 2.2 b (TG)13T5 (TG)12T5 M V 1 2.2 DeltaF508 - (TG)10T9 (TG)11T7 M V 1a 2.2 L206W -b (TG)9T9 (TG)11T7 M V 1 2.2 R258G -b (TG)11T7 (TG)11T7 V V 1 2.2 a CUAVD. Login to comment
110 Large Table 3 Allelic frequencies of CFTR mutations in patients with congenital absence of the vas deferens CBAVD CUAVD Total Patients 42 3 45 Alleles 84 6 90 Mutations N % N % N % 1 T5 allele 26a 31 2 33.3 28 31.1 2 DeltaF508 20 23.8 1 16.7 21 23.3 3 R334W 6a 7.1 0 0 6 6.7 4 R117H 4 4.8 0 0 4 4.4 5 G576A 4b 4.8 0 0 4 4.4 6 R688C 4b 4.8 0 0 4 4.4 7 S1235R 3a 3.6 0 0 3 3.3 8 3272-26A¡G 3 3.6 0 0 3 3.3 9 P205S 2 2.4 0 0 2 2.2 10 L206W 2 2.4 0 0 2 2.2 11 D443Y 2b 2.4 0 0 2 2.2 13 D614G 2 2.4 0 0 2 2.2 14 N1303K 2 2.4 0 0 2 2.2 12 G542X 0 0 2 33.3 2 2.2 15 R258G 1 1.2 0 0 1 1.1 16 P439S 1 1.2 0 0 1 1.1 17 I507del 1 1.2 0 0 1 1.1 18 V562I 1 1.2 0 0 1 1.1 19 V754M 1 1.2 0 0 1 1.1 20 E831X 1 1.2 0 0 1 1.1 21 2789ϩ5G¡A 1 1.2 0 0 1 1.1 22 V1108L 1 1.2 0 0 1 1.1 23 L1227S 1 1.2 0 0 1 1.1 24 P1290S 1 1.2 0 0 1 1.1 25 E1401K 1 1.2 0 0 1 1.1 26 CFTRdele2,3 1 1.2 0 0 1 1.1 CBAVD, congenital bilateral absence of the vas deferens; CUAVD, congenital unilateral absence of the vas deferens. Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

[hide] Association of cystic fibrosis genetic modifiers w... Fertil Steril. 2010 Nov;94(6):2122-7. Epub 2010 Jan 25. Havasi V, Rowe SM, Kolettis PN, Dayangac D, Sahin A, Grangeia A, Carvalho F, Barros A, Sousa M, Bassas L, Casals T, Sorscher EJ
Association of cystic fibrosis genetic modifiers with congenital bilateral absence of the vas deferens.
Fertil Steril. 2010 Nov;94(6):2122-7. Epub 2010 Jan 25., [PMID:20100616]

Abstract [show]
OBJECTIVE: To investigate whether genetic modifiers of cystic fibrosis (CF) lung disease also predispose to congenital bilateral absence of the vas deferens (CBAVD) in association with cystic fibrosis transmembrane conductance regulator (CFTR) mutations. We tested the hypothesis that polymorphisms of transforming growth factor (TGF)-beta1 (rs 1982073, rs 1800471) and endothelin receptor type A (EDNRA) (rs 5335, rs 1801708) are associated with the CBAVD phenotype. DESIGN: Genotyping of subjects with clinical CBAVD. SETTING: Outpatient and hospital-based clinical evaluation. PATIENT(S): DNA samples from 80 subjects with CBAVD and 51 healthy male controls from various regions of Europe. This is one of the largest genetic studies of this disease to date. INTERVENTION(S): None. MAIN OUTCOME MEASURE(S): Genotype analysis. RESULT(S): For single nucleotide polymorphism (SNP) rs 5335, we found increased frequency of the CC genotype among subjects with CBAVD. The difference was significant among Turkish patients versus controls (45.2% vs. 19.4%), and between all cases versus controls (36% vs. 15.7%). No associations between CBAVD penetrance and polymorphisms rs 1982073, rs 1800471, or rs 1801708 were observed. CONCLUSION(S): Our findings indicate that endothelin receptor type A polymorphism rs 5335 may be associated with CBAVD penetrance. To our knowledge, this is the first study to investigate genetic modifiers relevant to CBAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Portuguese CFTR alleles Spanish CFTR alleles Turkish CFTR alleles 5T 22 F508del 11 5T 20 F508del 14 5T 9 D1152H 14 R334W 5 D443Ya 3 D110H 3 R117H 3 G576Aa 3 F508del 2 S1235R 3 R668Ca 3 3041-11del7 2 N1303K 2 G542X 2 1767del6 2 P205S 2 R117H 2 2789þ5G>A 2 D614G 2 V232D 2 CFTRdele2(ins186) 2 G542X 1 L997F 1 3120þ1G>A 1 L206W 1 H609R 1 G1130A 1 V562I 1 N1303H 1 M952I 1 I507del 1 L206W 1 365insT 1 3272-26A>G 1 3272-26A/G 1 E585X 1 2789þ5G>A 1 L15P 1 2752-15C>G 1 G576Aa 1 R347H 1 R334Q 1 R668Ca 1 2689insG 1 R347H 1 CFTRdele2,3 1 R1070W 1 E831X 1 L1227S 1 I 1027T 1 R1070W 1 E831X 1 3272-26A>G 1 L997F 1 I853F 1 A349V 1 6T 1 Note: CFTR ¼ cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Characterization of 19 disease-associated missense... Hum Mol Genet. 1998 Oct;7(11):1761-9. Vankeerberghen A, Wei L, Jaspers M, Cassiman JJ, Nilius B, Cuppens H
Characterization of 19 disease-associated missense mutations in the regulatory domain of the cystic fibrosis transmembrane conductance regulator.
Hum Mol Genet. 1998 Oct;7(11):1761-9., [PMID:9736778]

Abstract [show]
In order to gain a better insight into the structure and function of the regulatory domain (RD) of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, 19 RD missense mutations that had been identified in patients were functionally characterized. Nine of these (I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R and L633P) resulted in aberrant processing. No or a very small number of functional CFTR proteins will therefore appear at the cell membrane in cells expressing these mutants. These mutations were clustered in the N-terminal part of the RD, suggesting that this subdomain has a folding pattern that is very sensitive to amino acid changes. Mutations that caused no aberrant processing were further characterized at the electrophysiological level. First, they were studied at the whole cell level in Xenopus laevis oocytes. Mutants that induced a whole cell current that was significantly different from wild-type CFTR were subsequently analysed at the single channel level in COS1 cells transiently expressing the different mutant and wild-type proteins. Three mutant chloride channels, G622D, R792G and E822K CFTR, were characterized by significantly lower intrinsic chloride channel activities compared with wild-type CFTR. Two mutations, H620Q and A800G, resulted in increased intrinsic chloride transport activities. Finally, T665S and E826K CFTR had single channel properties not significantly different from wild-type CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 Nine of these (I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R and L633P) resulted in aberrant processing. Login to comment
61 Some of the mutants, however, presented an abnormal maturation pattern, as can be seen for L610S and D614G CFTR (Fig. 2). Login to comment
66 The mutations that gave rise to a protein that was not able to proceed to the 190 kDa form (I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R and L633P; Table 2) are therefore class two mutations (17), where the disease phenotype is caused by the absence of sufficient CFTR protein at the cell surface. Login to comment
68 Primers used for mutagenesis Primer Sequence I601F (a1933t) 5'-CTA ACA AAA CTA GGT TTT TGG TCA CTT C-3' L610S (t1961c) 5'-CTA AAA TGG AAC ATT CAA AGA AAG CTG-3' A613T (g1969a) 5'-CAT TTA AAG AAA ACT GAC AAA ATA TTA-3' D614G (a1973g) 5'-CAT TTA AAG AAA GCT GGC AAA ATA TTA A-3' I618T (t1985c) 5'-GAC AAA ATA TTA ACT TTG CAT GAA GG-3' L619S (t1988c) 5'-GAC AAA ATA TTA ATT TCG CAT GAA GGT-3' H620P (a1991c) 5'-CAA AAT ATT AAT TTT GCC TGA AGG TAG C-3' H620Q (t1992g) 5'-AAT ATT AAT TTT GCA GGA AGG TAG CAG-3' G622D (g1997a) 5'-TTG CAT GAA GAT AGC AGC TAT TTT TAT G-3' G628R (g2014c) 5'-GCA GCT ATT TTT ATC GGA CAT TTT C-3' L633P (t2030c) 5'-CAT TTT CAG AAC CCC AAA ATC TAC AGC-3' D648V (a2075t) 5'-CTC ATG GGA TGT GTT TCT TTC GAC C-3' T665S (a2125t) 5'-CAA TCC TAA CTG AGT CCT TAC ACC G-3' F693L (t2209c) 5'-CAG ACT GGA GAG CTT GGG GAA AAA AG-3' R766M (g2429t) 5'-GCA CGA AGG ATG CAG TCT GTC CTG-3' R792G (c2506g) 5'-CAG CAT CCA CAG GAA AAG TGT CAC TG-3' A800G (c2531g) 5'-CTG GCC CCT CAG GGA AAC TTG ACT G-3' I807M (a2553g) 5'-CTG AAC TGG ATA TGT ATT CAA GAA GG-3' E822K (g2596a) 5'-GGC TTG GAA ATA AGT AAA GAA ATT AAC G-3' E826K (g2608a) 5'-GAA GAA ATT AAC AAA GAA GAC TTA AAG-3' Selection primer BstBI 5'-CTC TGG GGT CCG GAA TGA CCG AC-3' Two primers were used for each mutagenesis reaction. Login to comment
77 Mutations detected in patients (I601F, L610S, A613T, D614G, I618T, L619S, H620P, H620Q, D622G, G628R, L633P, T665S, F693L, K698R, V754M, R766M, R792G, A800G, I807M, E822K and E826K) are indicated in bold and underlined, the PKA phosphorylation sites by an arrow and the two acidic domains are boxed. Login to comment
87 Maturation pattern of RD mutations and their associated phenotype found in patients with the indicated genotype (when the mutation is associated with CF, only the pancreas status is given) Mutation A-form B-form C-form Clinical data Genotype Phenotype Reference I601F + + - I601F/G542X PS M. Schwarz, personal communication L610S + + - Unknown Unknown A613T + + - Unknown Unknown D614G + + - D614G/unknown PI 14 I618T + + - I618T/dF508 PS G.R. Cutting, personal communication L619S + + - L619S/unknown PI B. Tümmler, personal communication H620P + + - H620P/R1158X PS M. Schwarz, personal communication H620Q + + + H620Q/dF508 PI T. Dörk, personal communication G622D + + + G622D/unknown Oligospermia J. Zielenski, personal communication G628R + + - Unknown Unknown L633P + + - L633P/3659delC M. Schwarz, personal communication D648V + + + D648V/3849+10kb C/T PI C. Ferec, personal communication T665S + + + Unknown Unknown F693L + + + F693L/W1282X Healthy C. Ferec; CF Genetic Analysis Consortium R766M + + + R766M/R792G CBAVD D. Glavac, personal communication R792G + + + R766M/R792G CBAVD D. Glavac, personal communication A800G + + + A800G/unknown CBAVD 34 I807M + + + I807M/unknown CBAVD Our observation E822K + + + E822K/unknown PI 35 E826K + + + E826K/unknown Thoracic sarcoidosis C. Bombieri, personal communication +, the protein matures up to that form; -, the protein does not reach the respective maturation step. Login to comment
99 Pulse chase and immunoprecipitation of CFTR from COS1 cells transiently expressing wild-type, L610S, D614G or I807M CFTR. Login to comment
109 Nine mutations caused aberrant processing: I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R and L633P. Login to comment

[hide] A conserved region of the R domain of cystic fibro... J Biol Chem. 1998 Nov 27;273(48):31759-64. Pasyk EA, Morin XK, Zeman P, Garami E, Galley K, Huan LJ, Wang Y, Bear CE
A conserved region of the R domain of cystic fibrosis transmembrane conductance regulator is important in processing and function.
J Biol Chem. 1998 Nov 27;273(48):31759-64., 1998-11-27 [PMID:9822639]

Abstract [show]
The R domain of cystic fibrosis transmembrane conductance regulator (CFTR) connects the two halves of the protein, each of which possess a transmembrane-spanning domain and a nucleotide binding domain. Phosphorylation of serine residues, which reside mostly within the C-terminal two-thirds of the R domain, is required for nucleotide-dependent activation of CFTR chloride channel activity. The N terminus of the R domain is also likely to be important in CFTR function, since this region is highly conserved among CFTRs of different species and exhibits sequence similarity with the "linker region" of the related protein, P-glycoprotein. To date, however, the role of this region in CFTR channel function remains unknown. In this paper, we report the effects of five disease-causing mutations within the N terminus of the CFTR-R domain. All five mutants exhibit defective protein processing in mammalian HEK-293 cells, suggesting that they are mislocalized and fail to reach the cell surface. However, in the Xenopus oocyte, three mutants reached the plasma membrane. One of these mutants, L619S, exhibits no detectable function, whereas the other two, D614G and I618T, exhibit partial activity as chloride channels. Single channel analysis of these latter two mutants revealed that they possess defective rates of channel opening, consistent with the hypothesis that the N terminus of the R domain participates in ATP-dependent channel gating. These findings support recent structural models that include this region within extended boundaries of the first nucleotide binding domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 One of these mutants, L619S, exhibits no detectable function, whereas the other two, D614G and I618T, exhibit partial activity as chloride channels. Login to comment
41 The two other mutants, D614G and I618T, exhibited partial function in two-electrode voltage clamp experiments and could be studied at the single channel level, wherein it was revealed that they exhibited altered rates of channel opening. Login to comment
130 Single Channel Analysis Reveals Defects in Channel Opening by CFTR D614G and I618T-We know from the previous whole cell studies that the L619S mutation causes severe dysfunction of the CFTR channel activity because, despite expression of this mutant protein at the cell surface (Fig. 3), cyclic AMP-activated chloride currents were not detected (Fig. 4). Login to comment

[hide] Functional hot spots in human ATP-binding cassette... Protein Sci. 2010 Nov;19(11):2110-21. Kelly L, Fukushima H, Karchin R, Gow JM, Chinn LW, Pieper U, Segal MR, Kroetz DL, Sali A
Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains.
Protein Sci. 2010 Nov;19(11):2110-21., [PMID:20799350]

Abstract [show]
The human ATP-binding cassette (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP binding and hydrolysis to the transport of diverse substrates across cellular membranes. Defects in 18 transporters have been implicated in human disease. In hundreds of cases, disease phenotypes and defects in function can be traced to nonsynonymous single nucleotide polymorphisms (nsSNPs). The functional impact of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine experimental mutational studies with sequence and structural analysis to describe the impact of nsSNPs in human ABC transporters. First, the disease associations of 39 nsSNPs in 10 transporters were rationalized by identifying two conserved loops and a small alpha-helical region that may be involved in interdomain communication necessary for transport of substrates. Second, an approach to discriminate between disease-associated and neutral nsSNPs was developed and tailored to this superfamily. Finally, the functional impact of 40 unannotated nsSNPs in seven ABC transporters identified in 247 ethnically diverse individuals studied by the Pharmacogenetics of Membrane Transporters consortium was predicted. Three predictions were experimentally tested using human embryonic kidney epithelial (HEK) 293 cells stably transfected with the reference multidrug resistance transporter 4 and its variants to examine functional differences in transport of the antiviral drug, tenofovir. The experimental results confirmed two predictions. Our analysis provides a structural and evolutionary framework for rationalizing and predicting the functional effects of nsSNPs in this clinically important membrane transporter superfamily.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Disease-associated nsSNPs at Three Structural Hotspots in Human ABC Transporter NBDs Gene Disease Position ARA motif ABCB11 BRIC2 A570T ABCD1 X-ALD A616V CFTR CF A559T ABCC6 PXE R765Q ABCC8 HHF1 R841G ABCC8 HHF1 R1493Q ABCC8 HHF1 R1493W ABCD1 X-ALD R617C ABCD1 X-ALD R617G ABCD1 X-ALD R617H CFTR CF R560K CFTR CF R560S CFTR CF R560T ABCA1 HDLD1 A1046D ABCB4 ICP A546D C-loop 1 motif ABCC8 HHF1 D1471H ABCC8 HHF1 D1471N CFTR CBAVD G544V ABCC8 HHF1 G1478R C-loop2 motif ABCA4 STGD1 H2128R ABCC8 HHF1 K889T ABCD1 X-ALD R660P ABCD1 X-ALD R660W ABCA1 HDLD2 M1091T ABCA4 STGD1 E2131K ABCA12 LI2 E1539K ABCA4 STGD1 and CORD3 E1122K CFTR CF L610S ABCC8 HHF1 L1543P ABCA1 Colorectal cancer sample; somatic mutation A2109T ABCC9 CMD1O A1513T ABCD1 X-ALD H667D CFTR CF A613T ABCA1 HDLD2 D1099Y ABCD1 X-ALD T668I CFTR CF D614G ABCA4 STGD1 R2139W ABCA4 STGD1 R1129C ABCA4 ARMD2, STGD1, and FFM R1129L Disease abbreviations are as follows: BRIC2, benign recurrent intrahepatic cholestasis type 2; X-ALD, X-linked adrenoleukodystrophy; CF, cystic fibrosis; PXE, Pseudoxanthoma elasticum; HHF1, familial hyperinsulinemic hypoglycemia-1; HDLD1, high density lipoprotein deficiency type 1; ICP, intrahepatic cholestasis of pregnancy; CBAVD, congenital bilateral absence of the vas deferens; STGD1, Stargardt disease type 1; HDLD2, high density lipoprotein deficiency type 2; LI2, ichthyosis lamellar type 2; CORD3, cone-rod dystrophy type 3; CMD1O, cardiomyopathy dilated type 1O; ARMD2, age-related macular degeneration type 2; FFM, fundus flavimaculatus. Login to comment

[hide] Extensive molecular analysis of patients bearing C... J Mol Diagn. 2012 Jan;14(1):81-9. Epub 2011 Oct 20. Amato F, Bellia C, Cardillo G, Castaldo G, Ciaccio M, Elce A, Lembo F, Tomaiuolo R
Extensive molecular analysis of patients bearing CFTR-related disorders.
J Mol Diagn. 2012 Jan;14(1):81-9. Epub 2011 Oct 20., [PMID:22020151]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR)-related disorders (CFTR-RDs) may present with pancreatic sufficiency, normal sweat test results, and better outcome. The detection rate of mutations is lower in CFTR-RD than in classic CF: mutations may be located in genes encoding proteins that interact with CFTR or support channel activity. We tested the whole CFTR coding regions in 99 CFTR-RD patients, looking for gene mutations in solute carrier (SLC) 26A and in epithelial Na channel (ENaC) in 33 patients who had unidentified mutations. CFTR analysis revealed 28 mutations, some of which are rare. Of these mutations, RT-PCR demonstrated that the novel 1525-1delG impairs exon 10 splicing; by using minigene analysis, we excluded the splicing effect of three other novel intronic variants. Analysis of SLC26A genes revealed several variants, some of which are novel, that did not affect mRNA expression. Other mutations occurred in the ENaC genes encoding the ENaC subunits, but their frequency did not significantly differ between patients and controls. Our data, although obtained on a preliminary cohort of CFTR-RD patients, exclude a role of mutations in SLC26A and in SCNN genes in the pathogenesis of such disease; we confirm that CFTR analysis has a relevant role in CFTR-RD patients; and it appears mandatory to use CFTR scanning techniques and approaches to reveal the effect of novel mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 Allele Frequency and CFTR Mutations in Patients Bearing CFTR-RDs Mutation (traditional name) HGVS nomenclature15 CBAVD (118 alleles)* RP (42 alleles)* DB (38 alleles)* Total (198 alleles)* TG12-T5-470V 34 (28.8) 2 (4.8) 10 (26.3) 46 (23.2) F508del c.1521_1523del 19 (16.1) 7 (16.7) 4 (10.5) 30 (15.2) 3195del6 c.3063_3069del 9 (7.6) 0 0 9 (4.5) N1303K c.3909CϾG 3 (2.5) 1 (2.4) 4 (10.5) 8 (4.0) G542X c.1624GϾT 4 (3.4) 1 (2.4) 1 (2.6) 6 (3.0) D1152H c.3454GϾC 1 (0.8) 2 (4.8) 2 (5.3) 5 (2.5) G85E c.254GϾA 2 (1.7) 3 (7.1) 0 5 (2.5) 1525-1delG c.1394de 3 (2.5) 1 (2.4) 0 4 (3.0) 4016insT c.3885insT 2 (1.7) 1 (2.4) 0 3 (1.5) 2789ϩ5GϾA c.2657ϩ5GϾA 0 3 (7.1) 0 3 (1.5) Q1476X c.4426CϾT 3 (2.5) 0 0 3 (1.5) 2183AAϾG c.2051_2052delinsG 1 (0.8) 1 (2.4) 0 2 (1.0) R553X c.1657CϾT 1 (0.8) 1 (2.4) 0 2 (1.0) L568F c.1704GϾT 2 (1.7) 0 0 2 (1.0) R1158X c.3472CϾT 2 (1.7) 0 0 2 (1.0) V920M c.2758GϾA 1 (0.8) 0 1 (2.6) 2 (1.0) 711ϩ1GϾT c.579ϩ1GϾT 0 1 (2.4) 0 1 (0.5) D614G c.1841AϾG 1 (0.8) 0 0 1 (0.5) 2184insA c.2052del 0 1 (2.4) 0 1 (0.5) 621ϩ1GϾT c.489ϩ1GϾT 1 (0.8) 0 0 1 (0.5) R1438W c.4312CϾT 0 1 (2.4) 0 1 (0.5) E193X c.577GϾT 0 1 (2.4) 0 1 (0.5) G1244E c.3731GϾA 1 (0.8) 0 0 1 (0.5) K68E c.202AϾG 1 (0.8) 0 0 1 (0.5) R347P c.1040GϾC 1 (0.8) 0 0 1 (0.5) 621ϩ3AϾG c.489ϩ3AϾG 1 (0.8) 0 0 1 (0.5) L997F c.2991GϾC 0 1 (2.4) 0 1 (0.5) F508C c.1523TϾG 1 (0.8) 0 0 1 (0.5) Total 94 (79.7) 28 (66.7) 22 (57.9) 144 (72.7) Undetected 24 (20.3) 14 (33.3) 16 (42.1) 54 (27.3) *Data are given as number (percentage). Login to comment
144 This detection rate is higher than that reported for other patients affected by CBAVD,20 RP,21-24 or DB.25-28 Most previous studies tested restricted mutation panels for first-level analysis, whereas we used sequencing analysis, and 11 mutations identified in our study (3195del6, Q1476X, L568F, V920M, 1525-1delG, D614G, R1438W, E193X, K68E, 621ϩ3AϾG, and L997F), present in approximately 13% of chromosomes of CFTR-RD patients, are not included in most mutation panels. Login to comment

[hide] Borderline sweat test: Utility and limits of genet... Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24. Seia M, Costantino L, Paracchini V, Porcaro L, Capasso P, Coviello D, Corbetta C, Torresani E, Magazzu D, Consalvo V, Monti A, Costantini D, Colombo C
Borderline sweat test: Utility and limits of genetic analysis for the diagnosis of cystic fibrosis.
Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24., [PMID:19318035]

Abstract [show]
OBJECTIVE: The sweat test remains the gold standard for the diagnosis of Cystic Fibrosis (CF) even despite the availability of molecular analysis of Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR). We investigated the relationship between CFTR mutation analysis and sweat chloride concentration in a cohort of subjects with borderline sweat test values, in order to identify misdiagnosis of CF. DESIGN AND METHODS: In the period between March 2006 and February 2008 we performed 773 sweat tests in individuals referred for suspect CF. Ninety-one subjects had chloride values in the border-line range. Clinicians required CFTR gene complete scanning on 66 of them. RESULTS: The mean value of sweat chloride in the DNA negative subjects was lower than in those with at least one CFTR mutation. Our data indicate that 39 mEq/l is the best sensitivity trade off for the sweat test with respect to genotype. CONCLUSIONS: To optimise diagnostic accuracy of reference intervals, it may be useful to modify from 30 to 39 mEq/l the threshold for sweat chloride electrolytes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported. Login to comment
57 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported. Login to comment

[hide] Genotype and phenotype correlations in patients wi... Gastroenterology. 2002 Dec;123(6):1857-64. Durno C, Corey M, Zielenski J, Tullis E, Tsui LC, Durie P
Genotype and phenotype correlations in patients with cystic fibrosis and pancreatitis.
Gastroenterology. 2002 Dec;123(6):1857-64., [PMID:12454843]

Abstract [show]
BACKGROUND & AIMS: Pancreatitis is known to occur in some patients with cystic fibrosis (CF), but the prevalence, natural history, and genotypic basis are unclear. We examined a well-defined cohort of patients with CF to answer these questions. METHODS: Patients with CF were identified from a computerized database (1966-1996). Chart audit identified all patients with CF and pancreatitis. RESULTS: Among 1075 patients with CF, 937 (87%) were pancreatic insufficient at diagnosis, 28 (3%) were pancreatic sufficient but developed pancreatic insufficiency after diagnosis, and 110 (10%) have remained pancreatic sufficient. No patients with pancreatic insufficiency developed pancreatitis. Nineteen patients (17.3%) with pancreatic sufficiency experienced one or more attacks of pancreatitis. The mean age at diagnosis of pancreatitis was 22.7 +/- 10.3 years (range, 10-35 years), and pancreatitis was recognized before the diagnosis of CF in 6 patients (32%). The diagnosis of CF in pancreatic-sufficient patients, with and without pancreatitis, was established at a significantly older age than in those with pancreatic insufficiency (P < 0.0001). Genotyped patients with pancreatic insufficiency carried 2 severe mutant alleles. All genotyped patients with pancreatic sufficiency and pancreatitis carried at least one mild mutation. No specific genotype was predictive of pancreatitis. CONCLUSIONS: Patients with CF with pancreatic sufficiency carry at least one mild mutant allele and are at a significant risk of developing pancreatitis. Symptoms of pancreatitis may precede the diagnosis of CF. Pancreatitis is associated with an otherwise mild CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 CFTR Genotypes Among CF Patients With PS With and Without Pancreatitis Two mutations (n) ⌬F508/R117H (9) ⌬F508/(5T) (6) ⌬F508/3272-26A 3 G (4) ⌬F508/R347H (2) ⌬F508/P574H (2) ⌬F508/875 ϩ 1G Ͼ C (2) ⌬F508/3849 ϩ 10kb C 3 T (1) ⌬F508/A455E (1) ⌬F508/D614G (1) ⌬F508/G85E (1) ⌬F508/R347P (1) ⌬F508/S1251N (1) ⌬F508/⌬F508a (1) ⌬F508/3120G Ͼ A (1) ⌬F508/G551Da (1) G542X/R117H (1) R560T/L206W (1) R117H/R117H (1) R31L/P67L (1) 1461ins4 (AGAT)/G85E (1) G551D/(5T) (1) R1066C/3849 ϩ 10kb C Ͼ T (1) G551D/3849 ϩ 10kb C Ͼ T (1) R334W/R334W (1) R334W/681delC (1) W1282X/3489 ϩ 10kb C Ͼ T (1) One mutation (n) ⌬F508/- (18) L1077P/- (1) W1282X/- (1) M1137V/- (1) G551D/- (1) R347H/- (1) Q30X1/- (1) G1244E/- (1) R117H/- (1) 621 ϩ 2G621 ϩ 1G 3 T/- (1) NOTE. Login to comment

[hide] Correlation of sweat chloride concentration with c... J Pediatr. 1995 Nov;127(5):705-10. Wilschanski M, Zielenski J, Markiewicz D, Tsui LC, Corey M, Levison H, Durie PR
Correlation of sweat chloride concentration with classes of the cystic fibrosis transmembrane conductance regulator gene mutations.
J Pediatr. 1995 Nov;127(5):705-10., [PMID:7472820]

Abstract [show]
OBJECTIVE: To compare differences in epithelial chloride conductance according to class of mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. METHODS: We evaluated the relationship between the functional classes of CFTR mutations and chloride conductance using the first diagnostic sweat chloride concentration in a large cystic fibrosis (CF) population. RESULTS: There was no difference in sweat chloride value value between classes of CFTR mutations that produce no protein (class I), fail to reach the apical membrane because of defective processing (class II), or produce protein that fails to respond to cyclic adenosine monophosphate (class III). Those mutations that produce a cyclic adenosine monophosphate-responsive channel with reduced conductance (class IV) were associated with a significantly lower, intermediate sweat chloride value. However, patients with the mutations that cause reduced synthesis or partially defective processing of normal CFTR (class V) had sweat chloride concentrations similar to those in classes I to III. CONCLUSION: Studies of differences in chloride conductance between functional classes of CFTR mutations provide insight into phenotypic expression of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 Defined mutations (each mutation cited in references 8, 23, and 24; numerals in parentheses indicate number of patients): Nonsense mutations-----class I: Frameshift mutations---class I: Splice site mutations-class I: Missense mutations---class HI: Missense mutations---class IV: Partially defective processing---class V: Alternative spficing-----classV: R1162X (3), Y1092X (3), G542X (21), Q552X (2), Q493X (2), w1282x (2), E1104X (1), R553X (6), E585X (l), (all PI) 3659delC (5), 2184delA (4), 4010de14 (1), 556delA (1), 3002delG (1) 3905insT (1), 4016insT (3), 1154insTC (l), 441delA (1), 2184insA (2), 1078delT (1), 4326delTC (3) (all PI) I717-1G--~A (4), 621+lG--*T (10), 711+IG--~T (3), 875+1G-+C (2), 3120+IG-~A (1) (18 PI, 2 PS) G551D (25), N1303K (7), R560T (8), I148T (1), G85E (3), A559T (1), L1077P (2), T1234V (1), (47 PI, 1 PS) R117H (10), R347H (3), R347P (1), D614G (1), S1251N (2), (all PS) P574H (2), A455E (2), (all PS) 3272-26A-+G (4), 3849+10KbC---~T (2), 3120G-+A (1), (all PS) analysis, we further grouped the patients according to the molecular consequences conferred by the CFTR alleles. Login to comment

[hide] CFTR gene variant for patients with congenital abs... Am J Hum Genet. 1995 Oct;57(4):958-60. Zielenski J, Patrizio P, Corey M, Handelin B, Markiewicz D, Asch R, Tsui LC
CFTR gene variant for patients with congenital absence of vas deferens.
Am J Hum Genet. 1995 Oct;57(4):958-60., [PMID:7573058]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 W1282X Unknown 2 R553X Unknown ............ 20.0 4173delC Unknown1 1 D614G Unknown 1 1716+12T- C Unknown 1 J Unknown Unknown ............ .15 21.4 NOTE.-The known CFTR mutations screened included AF508, G542X, GSS1D, N1303K, R553X, W1282X, AI507, 1717-1G-A, R560T, S549N, 621+1G--T, and R117H. Login to comment

[hide] Definition of a "functional R domain" of the cysti... Mol Genet Metab. 2000 Sep-Oct;71(1-2):245-9. Chen JM, Scotet V, Ferec C
Definition of a "functional R domain" of the cystic fibrosis transmembrane conductance regulator.
Mol Genet Metab. 2000 Sep-Oct;71(1-2):245-9., [PMID:11001817]

Abstract [show]
The R domain of the cystic fibrosis transmembrane conductance regulator (CFTR) was originally defined as 241 amino acids, encoded by exon 13. Such exon/intron boundaries provide a convenient way to define the R domain, but do not necessarily reflect the corresponding functional domain within CFTR. A two-domain model was later proposed based on a comparison of the R-domain sequences from 10 species. While RD1, the N-terminal third of the R domain is highly conserved, RD2, the large central region of the R domain has less rigid structural requirements. Although this two-domain model was given strong support by recent functional analysis data, the simple observation that two of the four main phosphorylation sites are excluded from RD2 clearly indicates that RD2 still does not satisfy the requirements of a "functional R domain." Nevertheless, knowledge of the CFTR structure and function accumulated over the past decade and reevaluated in the context of a comprehensive sequence comparison of 15 CFTR homologues made it possible to define such a "functional R domain," i.e., amino acids C647 to D836. This definition is validated primarily because it contains all of the important potential consensus phosphorylation sequences. In addition, it includes the highly charged motif from E822 to D836. Finally, it includes all of the deletions/insertions in this region. This definition also aids in understanding the effects of missense mutations occurring within this domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Second, while I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R, and L633P resulted in aberrant processing, neither D648V or T665S caused an arrest in protein maturation (8). Login to comment

[hide] Phenotypic discordance in three siblings affected ... J Cyst Fibros. 2006 Aug;5(3):193-5. Epub 2006 Feb 14. Castaldo G, Tomaiuolo R, Vanacore B, Ferrara P, DEL Vecchio S, Carnovale V, Abete P, Rengo F, Salvatore F
Phenotypic discordance in three siblings affected by atypical cystic fibrosis with the F508del/D614G genotype.
J Cyst Fibros. 2006 Aug;5(3):193-5. Epub 2006 Feb 14., [PMID:16478680]

Abstract [show]
We report an example of atypical CF, i.e., a family in which three siblings were affected by late-diagnosed mild CF, and showed discordant pulmonary and pancreatic phenotypes. Sibling no. 1 (male), showed a severe pulmonary involvement and pancreatic sufficiency; sibling no. 2 (female) showed a mild pulmonary disease with pancreatic sufficiency; sibling no. 3 (male) had a very mild pulmonary expression and pancreatic insufficiency. The sweat test was altered in all three siblings, and all had intestinal occlusion in young age. The whole scanning of CFTR revealed the rare F508del/D614G genotype. The discordance of clinical expression within the same family reinforces the putative role of modifier genes of CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 The whole scanning of CFTR revealed the rare F508del/D614G genotype. Login to comment
24 The gene sequencing scanning of the whole coding region of the CFTR gene in the three siblings revealed the second mutation, i.e., D614G. Login to comment
25 Thus, the CFTR genotype was F508del/D614G. Login to comment
55 Indeed, the three siblings carried the F508del/D614G genotype. Login to comment
56 D614G [5,6] is a rare mutation, not included in commercial kits or in home-made panels [7]. Login to comment
58 The D614G mutation has been identified in atypical CF patients with idiopathic pancreatitis [5,6]. Login to comment

[hide] Defining the disease liability of variants in the ... Nat Genet. 2013 Oct;45(10):1160-7. doi: 10.1038/ng.2745. Epub 2013 Aug 25. Sosnay PR, Siklosi KR, Van Goor F, Kaniecki K, Yu H, Sharma N, Ramalho AS, Amaral MD, Dorfman R, Zielenski J, Masica DL, Karchin R, Millen L, Thomas PJ, Patrinos GP, Corey M, Lewis MH, Rommens JM, Castellani C, Penland CM, Cutting GR
Defining the disease liability of variants in the cystic fibrosis transmembrane conductance regulator gene.
Nat Genet. 2013 Oct;45(10):1160-7. doi: 10.1038/ng.2745. Epub 2013 Aug 25., [PMID:23974870]

Abstract [show]
Allelic heterogeneity in disease-causing genes presents a substantial challenge to the translation of genomic variation into clinical practice. Few of the almost 2,000 variants in the cystic fibrosis transmembrane conductance regulator gene CFTR have empirical evidence that they cause cystic fibrosis. To address this gap, we collected both genotype and phenotype data for 39,696 individuals with cystic fibrosis in registries and clinics in North America and Europe. In these individuals, 159 CFTR variants had an allele frequency of l0.01%. These variants were evaluated for both clinical severity and functional consequence, with 127 (80%) meeting both clinical and functional criteria consistent with disease. Assessment of disease penetrance in 2,188 fathers of individuals with cystic fibrosis enabled assignment of 12 of the remaining 32 variants as neutral, whereas the other 20 variants remained of indeterminate effect. This study illustrates that sourcing data directly from well-phenotyped subjects can address the gap in our ability to interpret clinically relevant genomic variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
137 In addition to these ten variants, c.1210-12(7) (legacy name 7T) had already been reported to be non-penetrant48 and was identified as a second variant in numerous fathers, and a twelfth variant, p.Ile1027Thr, was deemed 159 variants ࣙ0.01% frequency in CFTR2 127 variants meet clinical and functional criteria Clinical and functional analysis 13 variants meet neither criteria 14 variants 5 variants 7 variants 6 variants Evidence of non-penetrance No evidence of non-penetrance 19 variants meet clinical or functional criteria 127 variants are CF causing 12 variants are non CF causing 20 variants are indeterminate p.Arg117HisߤC p.Arg75Gln p.Gly576Alaߤ p.Arg668Cys ߤ p.Met470Val C p.IIe1027Thr ߤC p.Val754Met ߤC p.IIe148Thr ߤC p.Arg31Cys C p.Ser1235Arg ߤ p.Leu997Phe ߤ p.Arg1162Leu p.Leu227Arg F p.Gln525* F p.Leu558SerC p.Asp614Gly C c.2657+2_2657+3insA C c.1418delG F c.1210-12(7) ߤ p.Arg1070Gln C p.Asp1270Asn ߤC p.[Gln359Lys; Thr360Lys] p.Gly1069Argߤ p.Asp1152His p.Phe1052Val c.1210-12(5) p.Arg74Trpߤ p.IIe1234Val ߤC p.Arg1070Trp ߤF p.Ser977Phe F p.Asp579Gly C p.Tyr569Asp F Penetrance analysis Figure 4ߒ Assignment of disease liability to the 159 most frequent CFTR variants using three criteria. Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Both methods used 5 &#b5;l of isolated DNA for the NGS assay. NGS assay for detection of CFTR mutations/variants CFTR mutations are described using both the international nomenclature of the Human Genome Variation Society Mutations that have varying consequences c.3454G>C (D1152H) c.3154T>G (F1052V) c.3208C>T (R1070W) c.2930C>T (S977F) - c.3808G>A (D1270N) c.3205G>A (G1069R) c.350G>A (R117H) PolyTG/ polyT - c.1736A>G (D579G) c.3209G>A (R1070Q) c.220C>T (R74W) - - Mutations still under evaluation c.2657ߙ+ߙ2_2657ߙ+ߙ3insA (2789ߙ+ߙ2insA) c.680T>G (L227R) c.1705T>G (Y569D) - - c.1841A>G (D614G) c.1673T>C (L558S) - - - c.3700A>G (I1234V) c. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 [1117-8A>G;1727G>C; 2002C>T]) and mutations G1069R (p.Gly1069Arg), D614G (p.Asp614Gly), S42F (p.Ser42Phe) and S912L (p.Ser912Leu) should also be considered as part of this extension, even if not found in CF-PI but studied up to the DEL step because they are found in genotypes with an unknown allele. Login to comment
286 These patients had the following mutations on the other allele: F508del (p.Phe508del) (3 CF-PS and 1 CFTR-RD), W1282X (p.Trp1282*) (2 CF-PS), Q779X (p.Gln779*) (2 CF-PS siblings), D110H (p.Asp110His) (1 CF-PS), D614G (p.Asp614Gly) (1 CF-PS), unknown (1 CBAVD). Login to comment
385 [Gly576Ala;Arg668Cys] D579G c.1736A>G CF-PS varying clinical consequence p.Asp579Gly E585X c.1753G>T CF-PI CF-causing p.Glu585* H609L c.1826A>T CFTR-RD nd p.His609Leu A613T c.1837G>A CF-PS nd p.Ala613Thr D614G c.1841A>G CF-PS unknown significance p.Asp614Gly 2143delT c.2012delT CF-PS CF-causing p.Leu671* 2183AA>G c.2051_2052delAAinsG CF-PI,CF-PS CF-causing p.Lys684SerfsX38 2184insA c.2052_2053insA CF-PI CF-causing p.Gln685ThrfsX4 R709X c.2125C>T CF-PI CF-causing p.Arg709* L732X c.2195T>G CF-PI CF-causing p.Leu732* R764X c.2290C>T CF-PI CF-causing p.Arg764* Q779X c.2335C>T uncertain: CF-PI and/or CF-PS nd p.Gln779* E831X c.2491G>T CF-PS CF-causing p.Glu831* Y849X c.2547C>A CF-PI CF-causing p.Tyr849* ex14b-17bdel c.2620-674_3367+198del9858 CF-PI nd 2789+5G>A c.2657+5G>A CF-PI,CF-PS CF-causing 2790-2A>G c.2658-2A>G CF-PS nd S912L c.2735C>T uncertain: found only with an unknown allele in trans nd p.Ser912Leu S945L c.2834C>T CF-PS CF-causing p.Ser945Leu S977F c.2930C>T CFTR-RD varying clinical consequence p.Ser977Phe L997F c.2991G>C CF-PS,CFTR-RD,CBAVD non CF-causing p.Leu997Phe ex17a-18del c.2988+1173_3468+2111del8600 CF-PI nd P1013L c.3038C>T CFTR-RD nd p.Pro1013Leu Y1032C c.3095A>G CFTR-RD nd p.Tyr1032Cys 3272-26A>G c.3140-26A>G CF-PS CF-causing L1065P c.3194T>C CF-PI,CF-PS CF-causing p.Leu1065Pro L1065R c.3194T>G uncertain: CF-PI and/or CF-PS nd p.Leu1065Arg R1066C c.3196C>T CF-PI CF-causing p.Arg1066Cys R1066H c.3197G>A CF-PI CF-causing p.Arg1066His G1069R c.3205G>A uncertain: found only with an unknown allele in trans varying clinical consequence p.Gly1069Arg Continued on next page of 0.021). Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 [Gln359Lys; Thr360Lys] L558S c.1673 T4C p.Leu558Ser Y569D c.1705 T4G p.Tyr569Asp D579G c.1736 A4G p.Asp579Gly D614G c.1841 A4G p.Asp614Gly S977F c.2930C4T p.Ser977Phe F1052V c.3154 T4G p.Phe1052Val G1069R c.3205G4A p.Gly1069Arg R1070Q c.3209G4A p.Arg1070Gln D1152H c.3454G4C p.Asp1152His I1234V c.3700 A4G p.Ile1234Val 5T c.1210 - 12[5] Examples of common not CF-causing variantsc R31C c.91C4T p.Arg31Cys R74W c.220C4T p.Arg74Trp R75Q c.224G4A p.Arg75Gln I148T c.443 T4C p.Ile148Thr M470V c.1408 A4G p.Met470Val G576A c.1727G4C p.Gly576Ala R668C c.2002C4T p.Arg668Cys V754M c.2260G4A p.Val754Met L997F c.2991G4C p.Leu997Phe I1027T c.3080 T4C p.Ile1027Thr R1070W c.3208C4T p.Arg1070Trp R1162L c.3485G4T p.Arg1162Leu Table 1 (Continued) HGVS nomenclature Legacy name cDNA nucleotide name Protein name S1235R c.3705 T4G p.Ser1235Arg D1270N c.3808G4A p.Asp1270Asn 7T c.1210-12[7] Abbreviation: HGVS, Human Genome Variation Society. Login to comment

[hide] Newborn Screening for Cystic Fibrosis in Californi... Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16. Kharrazi M, Yang J, Bishop T, Lessing S, Young S, Graham S, Pearl M, Chow H, Ho T, Currier R, Gaffney L, Feuchtbaum L
Newborn Screening for Cystic Fibrosis in California.
Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16., [PMID:26574590]

Abstract [show]
OBJECTIVES: This article describes the methods used and the program performance results for the first 5 years of newborn screening for cystic fibrosis (CF) in California. METHODS: From July 16, 2007, to June 30, 2012, a total of 2 573 293 newborns were screened for CF by using a 3-step model: (1) measuring immunoreactive trypsinogen in all dried blood spot specimens; (2) testing 28 to 40 selected cystic fibrosis transmembrane conductance regulator (CFTR) mutations in specimens with immunoreactive trypsinogen values >/=62 ng/mL (top 1.6%); and (3) performing DNA sequencing on specimens found to have only 1 mutation in step 2. Infants with >/=2 mutations/variants were referred to CF care centers for diagnostic evaluation and follow-up. Infants with 1 mutation were considered carriers and their parents offered telephone genetic counseling. RESULTS: Overall, 345 CF cases, 533 CFTR-related metabolic syndrome cases, and 1617 carriers were detected; 28 cases of CF were missed. Of the 345 CF cases, 20 (5.8%) infants were initially assessed as having CFTR-related metabolic syndrome, and their CF diagnosis occurred after age 6 months (median follow-up: 4.5 years). Program sensitivity was 92%, and the positive predictive value was 34%. CF prevalence was 1 in 6899 births. A total of 303 CFTR mutations were identified, including 78 novel variants. The median age at referral to a CF care center was 34 days (18 and 37 days for step 2 and 3 screening test-positive infants, respectively). CONCLUSIONS: The 3-step model had high detection and low false-positive levels in this diverse population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 [1210-12[5]];[1210-34TG[11]] (IVS8 (TG)11-5T)f 1 2 c.531delT (663delT) / c.314T.A (I105N)e 1 3 c.1521_1523delCTT (F508del) / c.1841A.G (D614G)e 1 3 c.1521_1523delCTT (F508del) / c.290T.C (V97A)e 1 3 c.1519_1521delATC (I507del) / c. Login to comment