ABCMdb

ABCC7 p.Ser945Leu

Admin's notes:	Class II-III (maturation defect, gating defect) Veit et al.
ClinVar:	c.2834C>T , p.Ser945Leu D , Pathogenic c.2835G>A , p.Ser945= N , Likely benign
CF databases:	c.2834C>T , p.Ser945Leu D , CF-causing ; CFTR1: This mutation was detected by SSCP analysis then identified by sequencing. The nucleotide change is a C->T at position 2966 and destroys a TaqI restriction site.
Predicted by SNAP2:	A: N (61%), C: D (63%), D: D (85%), E: D (85%), F: D (80%), G: D (59%), H: D (75%), I: D (75%), K: D (85%), L: D (75%), M: D (75%), N: D (66%), P: D (85%), Q: D (80%), R: D (85%), T: D (66%), V: D (71%), W: D (80%), Y: D (80%),
Predicted by PROVEAN:	A: N, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: N, P: D, Q: D, R: D, T: N, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Two buffer PAGE system-based SSCP/HD analysis: a g... Eur J Hum Genet. 1999 Jul;7(5):590-8. Liechti-Gallati S, Schneider V, Neeser D, Kraemer R
Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease.
Eur J Hum Genet. 1999 Jul;7(5):590-8., [PMID:10439967]

Abstract [show]
The large size of many disease genes and the multiplicity of mutations complicate the design of an adequate assay for the identification of disease-causing variants. One of the most successful methods for mutation detection is the single strand conformation polymorphism (SSCP) technique. By varying temperature, gel composition, ionic strength and additives, we optimised the sensitivity of SSCP for all 27 exons of the CFTR gene. Using simultaneously SSCP and heteroduplex (HD) analysis, a total of 80 known CF mutations (28 missense, 22 frameshift, 17 nonsense, 13 splicesite) and 20 polymorphisms was analysed resulting in a detection rate of 97.5% including the 24 most common mutations worldwide. The ability of this technique to detect mutations independent of their nature, frequency, and population specificity was confirmed by the identification of five novel mutations (420del9, 1199delG, R560S, A613T, T1299I) in Swiss CF patients, as well as by the detection of 41 different mutations in 198 patients experimentally analysed. We present a three-stage screening strategy allowing analysis of seven exons within 5 hours and analysis of the entire coding region within 1 week, including sequence analysis of the variants. Additionally, our protocol represents a general model for point mutation analysis in other genetic disorders and has already been successfully established for OTC deficiency, collagene deficiency, X-linked myotubular myopathy (XLMTM), Duchenne and Becker muscular dystrophy (DMD, BMD), Wilson disease (WD), Neurofibromatosis I and II, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, and defects in mitochondrial DNA. No other protocol published so far presents standard SSCP/HD conditions for mutation screening in different disease genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 The distribution of analysed known mutations is similar to that of the total number of mutations in the entire CFTR gene: missense mutations account for 35% (G27E, G85E, R117H, A120T, I148T, H199Y, R334W, T338I, R347P, R347H, A455E, M718K, S5449N, S5449I, G551D, R560T, R560S, S945L, S977P, I1005R, R1066C, R1070Q, M1101K, D1152H, S1235R, R1283M, N1303K, N1303H), followed by 28% of frameshift mutations (175delC, 394delTT, 457TAT- > G, 905delG, 1078delT, I507, F508, 1609delCA, 1677delTA, 2143delT, 2176insC, 218delA, 2184insA, 2869insG, 3659delC, 3732delA, 3821delT, 3905insT, 4016insT, 4172delGC, 4382delA), 21% of nonsense mutations (Q30X, Q39X, Q220X, W401X, Q525X, G542X, Q552X, R553X, V569X, E585X, K710X, R792X, Y1092X, R1162X, S1255X, W1282X, E1371X), and 16% of splice site mutations (621 + 1G- > T, 711 + 1G- > T, 711 + 5G- > A, 1717-1G- > A, 1898 + 1G- > A, 1898 + 5G- > T, 2789 + 5G- > A, 3271 + 1G- > A, 3272-26A- > G, 3601-17T- > C, 3849 + 4A- > G, 3849 + 10kbC- > T, 4374 + 1G- > T). Login to comment
92 The technique developed demonstrates excellent single-strand separation and non-radioactive visualisation on polyacrylamide gels, and is time-saving and directly Table 2 Known mutations identified in 198 CF patients analysed investigatively Exon (E) Number of CFTR mutations intron (I) chromosomes Patient`s nationality Highest prevalence ∆F508 E10 212 miscellaneous 3905insT E20 025 Swiss Swiss, Amish, Arcadian R553X E11 020 Swiss, German German 1717-1G->A I10 017 Swiss, Italian Italian N1303K E21 011 Swiss, French, Italian Italian W1282X E20 014 Swiss, Italian, Israelit Jewish-Askhenazi G542X E11 009 Swiss, Spanish, Italian Spanish 2347delG E13 008 Swiss R1162X E19 006 Swiss, Italian, Russian Italian 3849+10kbC->T I19 005 German, French R347P E07 004 Swiss T5 I08 004 Swiss R334W E07 003 Swiss Q525X E10 003 Swiss 3732delA E19 003 Swiss S1235R E19 003 Italian, Turkish G85E E03 002 Italian, Greek I148T E04 002 Austrian, Turkish French-Canadian 621+1G->T I04 002 French French-Canadian 1078delT E07 002 Swiss E585X E12 002 Italian 2176insC E13 002 Swiss, Italian 2789+5G->A I14b 002 Italian Spanish D1152H E18 002 Swiss, French 4016insT E21 002 Turkish Q39X E02 001 Swiss 394delTT E03 001 Swiss Nordic, Finnish R117H E04 001 Swiss A120T E04 001 Swiss G126D E04 001 Swiss 711+5G->A I05 001 Russian M348K E07 001 Italian L568F E12 001 Italian 2183AA->G E13 001 Italian Italian K710X E13 001 Swiss S945L E15 001 French 3272-26A.->G I17a 001 Swiss M1101K E17b 001 Swiss Huttite 3601-17C->T I18 001 Swiss R1158X E19 001 Swiss 4005+1G-A I20 001 Italian applicable to early diagnostic testing, carrier detection and prenatal diagnosis. Login to comment

[hide] Two novel mutations in a cystic fibrosis patient o... Hum Genet. 1999 Jun;104(6):511-5. Wagner JA, Vassilakis A, Yee K, Li M, Hurlock G, Krouse ME, Moss RB, Wine JJ
Two novel mutations in a cystic fibrosis patient of Chinese origin.
Hum Genet. 1999 Jun;104(6):511-5., [PMID:10453741]

Abstract [show]
Cystic fibrosis is rare in non-Caucasian populations, and in such populations little is known about the spectrum of mutations and polymorphisms in the CFTR gene. We studied a 23-year-old patient of Chinese ethnicity with sweat chloride values of 104 mM/l, pancreatic sufficiency, an FEV1 60% of normal, sputum cultures positive for Staphylococcus aureus and Burkholderia cepacia, and a history of allergic bronchopulmonary aspergillosis. Genetic screening for 31 common CFTR mutations was negative, leading us to search for unknown mutations using single-strand conformation polymorphism and heteroduplex analysis (SSCP/HA). Two novel mutations were detected. In exon 4, a deletion of 8 bp (451458, deltaGCTTCCTA) causes a frameshift and immediately creates a stop codon. In exon 16, mutation 3041G-->A causes the missense change G970D. Functional analysis using an isotopic flux assay indicated that the G970D mutation retains partial function; western blotting indicated that the protein is glycosylated. The patient is heterozygous for the common polymorphisms (2694T/G) in exon 14a and (GATT)6/7 in intron 6a, indicating that these variants arose in ancestors common to Caucasians and Chinese.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 G970 lies within the third cytoplasmic loop of CFTR (residues 933- 990, between TMD 6 and 7), as do the CF-causing mutations, S945L (Claustres et al. 1993) and H949Y (Ghanem et al. 1994). Login to comment
98 Seibert et al. (1996) examined all three point mutations in the third cytoplasmic loop and determined that S945L and H949Y are trafficking mutations, while G970R is trafficked normally, but shows significantly reduced function when tested with an iodide efflux assay. Login to comment

[hide] Complex allele [-102T>A+S549R(T>G)] is associated ... Hum Genet. 1999 Jul-Aug;105(1-2):145-50. Romey MC, Guittard C, Chazalette JP, Frossard P, Dawson KP, Patton MA, Casals T, Bazarbachi T, Girodon E, Rault G, Bozon D, Seguret F, Demaille J, Claustres M
Complex allele [-102T>A+S549R(T>G)] is associated with milder forms of cystic fibrosis than allele S549R(T>G) alone.
Hum Genet. 1999 Jul-Aug;105(1-2):145-50., [PMID:10480369]

Abstract [show]
We recently reported a novel complex allele in the cystic fibrosis transmembrane regulator (CFTR) gene, combining a sequence change in the minimal CFTR promoter (-102T>A) and a missense mutation in exon 11 [S549R(T>G)]. Here we compare the main clinical features of six patients with cystic fibrosis (CF) carrying the complex allele [-102T>A+S549R(T>G)] with those of 16 CF patients homozygous for mutation S549R(T>G) alone. Age at diagnosis was higher, and current age was significantly higher (P=0.0032) in the group with the complex allele, compared with the S549R/S549R group. Although the proportion of patients with lung colonization was similar in both groups, the age at onset was significantly higher in the group with the complex allele (P=0.0022). Patients with the complex allele also had significantly lower sweat test chloride values (P=0.0028) and better overall clinical scores (P=0.004). None of the 22 patients reported in this study had meconium ileus. All 16 patients homozygous for S549R(T>G), however, were pancreatic insufficient, as compared with 50% of patients carrying the complex allele (P=0.013). Moreover, the unique patient homozygous for [-102T>A+S549R(T>G)] presented with a mild disease at 34 years of age. These observations strongly suggest that the sequence change (-102T>A) in the CFTR minimal promoter could attenuate the severe clinical phenotype associated with mutation S549R(T>G).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Five patients were compound heterozygotes for the complex allele and another mutation, two with ∆F508 and three with, R334 W, G542X, or S945L, respectively, and one patient was homozygous for the [-102T>A+S549R(T>G)] complex allele. Login to comment
50 5 months - 5 years 1 year 4 months 8 months 1.5 years - - 3 months 3 years 1 year 3 months 3 months 1 month 1 month (age of onset) Meconium ileus No No No No No No No No No No No No No No No No Pancreatic Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes insufficiency Table 2 Clinical characteristics of six patients carrying the complex allele: [-102T>A+S549R(T>G) (ND no data, FEV1 forced expiratory volume in 1 s, FVC forced vital capacity) Characteristic Patient P1 P2 P3 P4 P5 P6 Genotype -102T>A+S549R(T>G) -102T>A+S549R(T>G) -102T>A+S549R(T>G) -102T>A+S549R(T>G) -102T>A+S549R(T>G) -102T>A+S549R(T>G) -102T>A+S549R(T>G) R334 W ∆F508 ∆F508 G542X S945L Geographic background South of France South of Spain South of France North of France North of France South of France Ethnic background Jews of Algeria ND Jews ND North of Africa Jews Gender F F F F M M Current age (years) 34 38 6 31 23 18 Age at diagnosis 6 years 35 years 3.5 years 2 months 4 months 9 years Age of first clinical symptoms 5 years ND 3 years 2 months 4 months 5 years First clinical symptoms Episodic bronchitis Dyspnea Pulmonary disease Pulmonary disease Cough Pulmonary disease Sweat Cl- (mmol/l) ND < 60 122 66 72 85 Height (percentile) 60 50 ND 60 26 30 Weight (percentile) 60 50 ND 40 12 < 25 Shwachman-Kulczycki score 85 ND 85 ND 60 85 FEV1 (% predicted) 30 19.3 89 60 59 89 FVC (% predicted) 50 38.7 96 100 76 115 Lung colonization Yes No Yes Yes Yes Yes Pseudomonas aerug. Login to comment
64 As opposed to 100% of S549R(T>G)/S549R(T>G) patients, 50% of patients carrying the (-102T>A) sequence alter- 148 Table 3 Comparison of clinical features between CF patients carrying the complex allele [-102T>A+ S549R(T>G) and those carrying S549R(T>G) only Feature Patients with [-102T>A+ S549R(T>G)] Patients with S549R(T>G) P value (n = 6) (n = 16) Mean ± SD Median (5th-95th Mean ± SD Median (5th-95th (no. studied) percentile) (no. studied) percentile) Current age (years) 25 ± 11.8 (6) 27 (6-38) 5 ± 3.35 (13) 5 (2-12) 0.0032 Age at diagnosis (years) 9.0 ± 13.2 (6) 4.75 (0.16-35) 0.88 ± 1.0 (16) 0.41 (0.08-3.5) NS Sweat Cl- (mmol/l) 79.0 ± 27.13 (5) 72 (50-120) 117.2 ± 25.1 (14) 120 (70-155) 0.028 Shwachman-Kulczycki score 78.8 ± 12.5 (4) 85 (60-85) 50.0 ± 7.3 (15) 50 (35-60) 0.004 Age at onset of lung colonization 11.5 ± 6.7 (5) 11 (3.5-22) 1.0 ± 1.43 (13) 0.41 (0.08-5) 0.0022 Lung colonization 5/6 (83) 13/16 (81) NS (no. positive/no. studied) (%) Pancreatic insufficiency 3/6 (50) 16/16 (100) 0.013 (no. positive/no. studied) (%) Table 4 CFTR haplotypes for seven [-102T>A+ S549R(T>G)] chromosomes (parentheses indicate unknown phase) P1 [-102T>A+S549R(T>G)] 1 2 1 23 7 1 34 13 1 1 [-102T>A+S549R(T>G)] 1 2 1 23 7 1 34 13 1 1 P2 [-102T>A+S549R(T>G)] (1) (2) (1) 23 7 (1) 34 13 1 1 R334W (2) (1) (2) 17 7 (2) 46 13 1 1 P3 [-102T>A+S549R(T>G)] 1 2 1 23 7 1 34 13 1 1 ∆F508 1 2 1 23 9 1 31 13 1 1 P4 [-102T>A+S549R(T>G)] 1 2 1 23 7 1 34 13 1 1 ∆F508 1 2 1 23 9 1 32 13 1 1 P5 [-102T>A+S549R(T>G)] 1 2 1 23 7 1 34 13 1 1 G542X 1 2 1 22 9 1 33 13 1 1 P6 [-102T>A+S549R(T>G)] 1 2 1 23 1 34 13 1 1 S945L 2 1 2 16 7 2 29 13 1 1 Patient Genotype XV-2c KM-9 J44 IVS8CA IVS8(T)n M470V IVS17BTA IVS17BC 3601-65C/A J3.11 ation were pancreatic insufficient (P = 0.013). Login to comment

[hide] Heterogeneity for mutations in the CFTR gene and c... Hum Reprod. 2000 Jul;15(7):1476-83. Casals T, Bassas L, Egozcue S, Ramos MD, Gimenez J, Segura A, Garcia F, Carrera M, Larriba S, Sarquella J, Estivill X
Heterogeneity for mutations in the CFTR gene and clinical correlations in patients with congenital absence of the vas deferens.
Hum Reprod. 2000 Jul;15(7):1476-83., [PMID:10875853]

Abstract [show]
Congenital absence of the vas deferens (CAVD) is a heterogeneous disorder, largely due to mutations in the cystic fibrosis (CFTR) gene. Patients with unilateral absence of the vas deferens (CUAVD) and patients with CAVD in association with renal agenesis appear to have a different aetiology to those with isolated CAVD. We have studied 134 Spanish CAVD patients [110 congenital bilateral absence of the vas deferens (CBAVD) and 24 CUAVD], 16 of whom (six CBAVD, 10 CUAVD) had additional renal anomalies. Forty-two different CFTR mutations were identified, seven of them being novel. Some 45% of the CFTR mutations were specific to CAVD, and were not found in patients with cystic fibrosis or in the general Spanish population. CFTR mutations were detected in 85% of CBAVD patients and in 38% of those with CUAVD. Among those patients with renal anomalies, 31% carried one CFTR mutation. Anomalies in seminal vesicles and ejaculatory ducts were common in patients with CAVD. The prevalence of cryptorchidism and inguinal hernia appeared to be increased in CAVD patients, as well as nasal pathology and frequent respiratory infections. This study confirms the molecular heterogeneity of CFTR mutations in CAVD, and emphasizes the importance of an extensive CFTR analysis in these patients. In contrast with previous studies, this report suggests that CFTR might have a role in urogenital anomalies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Dilatation V232D/V232D 9T/9T 1 of ejaculatory ducts, often resembling utricular cysts, was S945L/R258G 7T/7T 1 demonstrable also in some men, all of whom were azoospermicG551D/F1074L 5T/7T 1 A1006E/L383S 5T/7T 1 (Figure 1). Login to comment

[hide] Adenosine triphosphate-binding cassette superfamil... Biol Reprod. 2001 Aug;65(2):394-400. Larriba S, Bassas L, Egozcue S, Gimenez J, Ramos MD, Briceno O, Estivill X, Casals T
Adenosine triphosphate-binding cassette superfamily transporter gene expression in severe male infertility.
Biol Reprod. 2001 Aug;65(2):394-400., [PMID:11466205]

Abstract [show]
Cystic fibrosis transmembrane regulator (CFTR), multidrug-resistant (MDR)1, and multidrug resistance-associated (MRP) proteins belong to the ATP-binding cassette (ABC) transporter superfamily. A compensatory regulation of MDR1 and CFTR gene expression has been observed in CFTR knockout rodent intestine and in an epithelial cell line of human colon, whereas a high homology and similar anion binding site are shared by MRP and CFTR proteins. To provide better insight into the relationship among the expression behavior in vivo of the three genes in human testis, analysis of MDR1 and MRP gene expression in testicular biopsies was performed and related to the presence of CFTR gene mutations in congenital absence of the vas deferens (CAVD: n = 20) and non-CAVD (n = 30) infertile patients with azoospermia or severe oligozoospermia. A CFTR mutation analysis performed in both groups of patients supported the involvement of CFTR gene mutations in CAVD phenotype (85%) and in defective spermatogenesis (19%). Quantitative reverse transcription-polymerase chain reaction analysis of testicular tissue showed a CFTR-independent MDR1 and MRP gene expression in human testis, suggesting that the mechanisms underlying CFTR gene regulation in testis are different from those in intestine. These findings should contribute to the understanding of patterns of in vivo expression of CFTR, MDR1, and MRP genes in CFTR-related infertility.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Phenotypical and genotypical description of CAVD and non-CAVD infertile patients.a No. patient Phenotype FSH (U/L) Non-CFTR infertility-associated factors Testicular biopsy CFTR mutation M470V polymorphism CAVD infertility 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CBAVD CUAVD CUAVD CUAVD CUAVD 3.1 7.3 3.1 2.4 1.9 3.5 5.7 4.3 3.6 ND 2.2 4.8 11.3 2.1 ND 7.6 5.3 6.5 3.9 21.4 None None None None None None None None None None None None None None None None None None None Yes 1 Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes V232D/V232D F508del/R117H F508del/R117H G542X/2789ϩ5GϾA F508del/D1270N ϩ R74W F508del/D1270N ϩ R74W S945L/R258G F508del/5T F508del/5T L206W/5T R117H/N F508del/N Y1014C/N 5T/N N/N N/N Y1092X/R258G 621ϩ1GϾT/5T Q890R/N N/N M/M M/M M/M M/M M/V M/V M/V M/M M/V M/V M/V M/V M/V M/V M/M V/V V/V M/V V/V M/M Non-CAVD infertility 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SA) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SSO) TF (SA) TF (SA) TF (SSO) OA OA OA OA OA OA OA OA 42.0 15.9 34.8 8.9 26.3 6.4 7.8 15.6 8.7 3.2 3.9 12.6 4.7 1.3 5.6 3.9 6.1 9.3 8.8 19.3 9.6 ND 3.3 5.9 6.6 3.6 1.9 4.2 2.0 4.4 None None None None None None None None None None None None None None None None Yes 2 Yes 2 Yes 2, 3 Yes 4 Yes 5 Yes 6 None None None None None Yes 1 Yes 7 Yes 8 Yes Yes Yes Yes No Yes Yes Yes Yes Yes Yes Yes Yes No No No No No No Yes Yes Yes Yes Yes Yes Yes No Yes Yes Yes F508del/N R334W/N N/N N/N N/N N/N N/N N/N N/N R75Q/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N N/N 5T/5T N/N N/N N/N N/N N/N N/N N/N M/M V/V M/V M/V M/V M/V V/V V/V V/V V/V M/V M/V M/V ND V/V M/M M/V M/M M/V M/M M/V V/V M/V M/V M/V V/V V/V M/V M/V V/V a CFTR mutations and M470V allele are also described for each patient. Login to comment
94 CFTR Analysis We have identified 14 different CFTR mutations (R117H, L206W, V232D, R258G, F508del, G542X, 621ϩ1GϾT, Q890R, S945L, Y1014C, Y1092X, D1270N, 2789ϩ5GϾA, IVS8-6[5T]) in 17 of 20 patients of the CAVD group, giving a CFTR mutation frequency of 85%. Login to comment

[hide] The S549R (T-->G) cystic fibrosis gene mutation. J Trop Pediatr. 2001 Aug;47(4):196-8. Dawson KP, Frossard PM
The S549R (T-->G) cystic fibrosis gene mutation.
J Trop Pediatr. 2001 Aug;47(4):196-8., [PMID:11523757]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 A male patient had a compound heterozygote S549R (T➝G)/S945L with -102T➝A promoter mutation. Login to comment

[hide] Spectrum of mutations in the CFTR gene of patients... Genet Test. 2001 Fall;5(3):235-42. Strandvik B, Bjorck E, Fallstrom M, Gronowitz E, Thountzouris J, Lindblad A, Markiewicz D, Wahlstrom J, Tsui LC, Zielenski J
Spectrum of mutations in the CFTR gene of patients with classical and atypical forms of cystic fibrosis from southwestern Sweden: identification of 12 novel mutations.
Genet Test. 2001 Fall;5(3):235-42., [PMID:11788090]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CFTR gene. The spectrum of CFTR mutations varies between populations and depends on different factors, such as ethnic background and geographical location. The extensive CFTR mutation screening of 129 patients with classical or atypical CF from the south-western region of Sweden revealed the presence of 37 CFTR mutations, including 12 novel alleles. The overall mutation detection rate in this study population was 92%, the highest among all tested regions in Sweden. Eight mutations with a frequency above 1% (DeltaF508, 394delTT, R117C, 3659delC, E60X, 1112delT, R764X, and 621 + 1G --> T) accounted for 78% of CF chromosomes and have been recommended for inclusion in the CFTR mutation screening panel for molecular diagnosis of CF in this region. The multiple occurrence of specific CFTR alleles less common than the predominant DeltaF508 mutation (394delTT, R117C, 3659delC) allowed for genotype-phenotype comparisons and revealed consistent relationships between these mutations and disease severity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 MUTATIONS IDENTIFIED IN 258 CHROMOSOMES IN THE CF POPULATION ATTENDING THE SOUTH-WESTERN SWEDISH CF CENTRE Location in the Frequency of Mutation gene, exon Number of mutations mutation (%) Homozygotes Heterozygotes DF508 10 161 62.4 56 49 394delTT 3 13 5.0 3 7 R117C 4 7 2.7 7 3659delC 19 5 1.9 5 E60X 3 4 1.6 4 1112delT 7 4 1.6 1 2 R764X 13 4 1.6 1 2 621 1 1G ® T 4 3 1.2 3 G551D 11 2 0.8 2 I506L 10 2 0.8 2 N1088D (R75Q) 17b 2 0.8 2 Q1238X 19 2 0.8 2 R117H (IVS8-5T) 4 2 0.8 2 V603F (IVS8-5T) 13 2 0.8 2 1716G ® A 10 2 0.8 2 R75Q 3 2 0.8 2 R533X 11 1 0.4 1 2329A ® G Promoter 1 0.4 1 297-3 C ® A 2 1 0.4 1 Y161D 4 1 0.4 1 994del9 Exon/intron 6b 1 0.4 1 1154insTC 7 1 0.4 1 W361R 7 1 0.4 1 T338I 7 1 0.4 1 1249-5A ® G Intron 7 1 0.4 1 1717-2A ® G Intron 10 1 0.4 1 R560T 11 1 0.4 1 E1401X 23 1 0.4 1 3126del4 17a 1 0.4 1 S945L 15 1 0.4 1 R668C 13 1 0.4 1 2622 1 2del6 Intron 13 1 0.4 1 R1162Q Exon 19 1 0.4 1 3849 1 10kbC ® T Intron 19 1 0.4 1 R74W Exon 3 1 0.4 1 2363C ® T Promoter 1 0.4 1 IVS8-5Ta Intron 8 1 0.4 1 Unidentified 20 7.8 Total 258 100 61 116 The new mutations are displayed in bold. Login to comment

[hide] Predictors of deterioration of lung function in cy... Pediatr Pulmonol. 2002 Jun;33(6):483-91. Schaedel C, de Monestrol I, Hjelte L, Johannesson M, Kornfalt R, Lindblad A, Strandvik B, Wahlgren L, Holmberg L
Predictors of deterioration of lung function in cystic fibrosis.
Pediatr Pulmonol. 2002 Jun;33(6):483-91., [PMID:12001283]

Abstract [show]
The severity of lung disease in cystic fibrosis (CF) may be related to the type of mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, and to environmental and immunological factors. Since pulmonary disease is the main determinant of morbidity and mortality in CF, it is important to identify factors that can explain and predict this variation. The aim of this longitudinal study of the whole Swedish CF population over age 7 years was to correlate genetic and clinical data with the rate of decline in pulmonary function. The statistical analysis was performed using the mixed model regression method, supplemented with calculation of relative risks for severe lung disease in age cohorts.The severity of pulmonary disease was to some extent predicted by CFTR genotype. Furthermore, the present investigation is the first long-term study showing a significantly more rapid deterioration of lung function in patients with concomitant diabetes mellitus. Besides diabetes mellitus, pancreatic insufficiency and chronic Pseudomonas colonization were found to be negative predictors of pulmonary function. In contrast to several other reports, we found no significant differences in lung function between genders. Patients with pancreatic sufficiency have no or only a slight decline of lung function with age once treatment is started, but an early diagnosis in this group is desirable.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 Furthermore, the inferred values for FEV1 and VC at age 5 years (the intercepts) were significantly lower TABLE 1- Allele Frequencies of 10 Most Common CFTR Mutations in Swedish CF Population Mutation Allele frequency (%) DF508 67.9 394delTT 7.1 3659delC 6.4 S945L 1.2 R117C 1.0 R117H 0.55 T338I 0.55 G551D 0.55 R553X 0.55 I506L 0.41 compared with those in the other CF patients (63.4% and 68.2% vs. 89% and 93.3%). Login to comment
121 TABLE 3CFTR Mutations Associated With Pancreatic Sufficiency in Swedish CF Population Y109C S549I/S549I Y109N S945L R117C N1088D À R75Q R117H G1244E L206W 711 þ 3A !G T338I 1249 À 5A !G A455E 2789 þ 5G ! Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

[hide] Spatial and temporal distribution of cystic fibros... Hum Genet. 2002 Sep;111(3):247-54. Epub 2002 Aug 1. Scotet V, Gillet D, Dugueperoux I, Audrezet MP, Bellis G, Garnier B, Roussey M, Rault G, Parent P, De Braekeleer M, Ferec C
Spatial and temporal distribution of cystic fibrosis and of its mutations in Brittany, France: a retrospective study from 1960.
Hum Genet. 2002 Sep;111(3):247-54. Epub 2002 Aug 1., [PMID:12215837]

Abstract [show]
Cystic fibrosis (CF) is the most common severe inherited disorder that affects children in Caucasian populations. The aim of this study was to define the spatial and temporal distribution of CF and its mutations in Brittany (western France) where the frequency of the disease is high. We retrospectively registered all CF patients born in Brittany since 1960 by cross-checking various data sources (e.g. medical care centres, genetics laboratories, hospital archives). Councils were contacted so that the place of residence of patients at birth could be determined. Moreover, the spectrum of CF transmembrane conductance regulator (CFTR) mutations and their spatial distribution across Brittany were determined. A total of 520 patients was registered in this study. The incidence of CF was assessed according to administrative (department, district) and diocesan divisions of Brittany and its evolution analysed over four decades. The incidence of CF was 1/2630, with a west/east gradient that was confirmed over time (Finistere: 1/2071 vs Ille-et-Vilaine: 1/3286). At present, the incidence of CF is decreasing, mainly as a result of prenatal diagnosis. An excellent mutation detection rate of 99.7% was obtained. Western Brittany presented a specific spectrum of mutations: 1078delT (9.4% of mutated alleles in the diocese of Cornouaille), G551D (7.7% in the diocese of Leon), 4005+1G-->A (2.9% in Cornouaille) and W846X (1.5% in western Brittany). On the other hand, the eastern region showed a spectrum more similar to the overall picture in France as a whole. This study enabled a precise measurement of the incidence of CF in Brittany to be obtained. The high frequency of the CFTR mutated alleles may result from founder effects and genetic drifts. Moreover, the study brings together the regional specificities of the CFTR gene and highlights disparities that exist in this part of France, both in incidence and in mutation distribution. These are attributable to different degrees of isolation and of population movements between the eastern and western parts of the region. Given that this is the first time that such a detailed study of the CFTR gene has been performed on a large population, this heightened knowledge of the epidemiology of CF in Brittany should provide a basis for the improvement of diagnostic strategies and refinement of genetic counselling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 His genotype was ∆F508/∆F508 Mutation Exon Basse-Bretagne Haute-Bretagne Brittanya ∆F508 10 446 75.6% 224 73.7% 672 75.0% 1078delT 7 31 5.3% 3 1.0% 34 3.8% G551D 11 21 3.6% 12 3.9% 33 3.7% N1303K 21 3 0.5% 9 3.0% 12 1.3% W846X 14a 9 1.5% 1 0.3% 10 1.1% 2789+5G→A 14b 3 0.5% 6 2.0% 9 1.0% 1717-1G→A 11 5 0.8% 3 1.0% 8 0.9% Y1092X 17b 1 0.2% 6 2.0% 7 0.8% 4005+1G→A 20 6 1.0% 1 0.3% 7 0.8% E60X 3 3 0.5% 3 1.0% 6 0.7% 621+1G→T 4 3 0.5% 3 1.0% 6 0.7% R347H 7 6 1.0% 0 0.0% 6 0.7% S492F 10 2 0.3% 3 1.0% 5 0.6% G542X 11 4 0.7% 1 0.3% 5 0.6% 3272-26A→G 17b 2 0.3% 3 1.0% 5 0.6% R117H 4 3 0.5% 1 0.3% 4 0.4% G91R 3 3 0.5% 0 0.0% 3 0.3% ∆I507 10 1 0.2% 2 0.7% 3 0.3% R553X 11 3 0.5% 0 0.0% 3 0.3% W1282X 20 2 0.3% 1 0.3% 3 0.3% A72D 3 0 0.0% 2 0.7% 2 0.2% G85E 3 0 0.0% 2 0.7% 2 0.2% F311L 7 0 0.0% 2 0.7% 2 0.2% 1221delCT 7 2 0.3% 0 0.0% 2 0.2% R560K 11 0 0.0% 2 0.7% 2 0.2% 2622+1G→A 13 2 0.3% 0 0.0% 2 0.2% S945L 15 0 0.0% 2 0.7% 2 0.2% I1234V 19 2 0.3% 0 0.0% 2 0.2% G1249R 20 2 0.3% 0 0.0% 2 0.2% 3905insT 20 2 0.3% 0 0.0% 2 0.2% Unidentified - 3 0.5% 0 0.0% 3 0.3% Total - 590 65.7% 304 34.3% 896 100% IVS17bTA, IVS17bCA) of Irish, Scottish, English, Breton and Czech subjects who were carriers of this mutation, and showed that all these alleles carried a unique haplotype (16-7-17), testifying to the Celtic origin of this mutation (Cashman et al. 1995). Login to comment

[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]

Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment

[hide] The phenotypic consequences of CFTR mutations. Ann Hum Genet. 2003 Sep;67(Pt 5):471-85. Rowntree RK, Harris A
The phenotypic consequences of CFTR mutations.
Ann Hum Genet. 2003 Sep;67(Pt 5):471-85., [PMID:12940920]

Abstract [show]
Cystic fibrosis is a common autosomal recessive disorder that primarily affects the epithelial cells in the intestine, respiratory system, pancreas, gall bladder and sweat glands. Over one thousand mutations have currently been identified in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene that are associated with CF disease. There have been many studies on the correlation of the CFTR genotype and CF disease phenotype; however, this relationship is still not well understood. A connection between CFTR genotype and disease manifested in the pancreas has been well described, but pulmonary disease appears to be highly variable even between individuals with the same genotype. This review describes the current classification of CFTR mutation classes and resulting CF disease phenotypes. Complex disease alleles and modifier genes are discussed along with alternative disorders, such as disseminated bronchiectasis and pancreatitis, which are also thought to result from CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
177 Two individuals who had genotypes 102T → A + S549R(T → G)/ F508 and 102T → A + S549R(T → G)/S945L both had mild CF disease and were pancreatic sufficient. Login to comment

[hide] CFTR genotypes in patients with normal or borderli... Hum Mutat. 2003 Oct;22(4):340. Feldmann D, Couderc R, Audrezet MP, Ferec C, Bienvenu T, Desgeorges M, Claustres M, Mittre H, Blayau M, Bozon D, Malinge MC, Monnier N, Bonnefont JP, Iron A, Bieth E, Dumur V, Clavel C, Cazeneuve C, Girodon E
CFTR genotypes in patients with normal or borderline sweat chloride levels.
Hum Mutat. 2003 Oct;22(4):340., [PMID:12955726]

Abstract [show]
In recent years, some patients bearing "atypical" forms of cystic fibrosis (CF) with normal sweat chloride concentrations have been described. To identify the spectrum of mutant combinations causing such atypical CF, we collected the results of CFTR (ABCC7) mutation analysis from 15 laboratories. Thirty patients with one or more typical symptoms of the disease associated with normal or borderline sweat chloride levels and bearing two CFTR mutations were selected. Phenotypes and genotypes of these 30 patients are described. A total of 18 different CFTR mutations were observed in the 60 chromosomes analysed. F508del was present in 31.6 % of the mutated chromosomes and 3849+10kbC>T in 13.3 %. R117H, D1152H, L206W, 3272-26A>G, S1235R, G149R, R1070W, S945L, and the poly-T tract variation commonly called IVS8-5T were also observed. The relative frequency of CFTR mutations clearly differed from that observed in typical CF patients or in CBAVD patients with the same ethnic origin. A mild genotype with one or two mild or variable mutations was observed in all the patients. These findings improve our understanding of the distribution of CFTR alleles in CF with normal or borderline sweat chloride concentrations and will facilitate the development of more sensitive CFTR mutation screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 R117H, D1152H, L206W, 3272-26A>G, S1235R, G149R, R1070W, S945L, and the poly-T tract variation commonly called IVS8-5T were also observed. Login to comment
44 Table 1 : Genotypes and Phenotypes of Patients with Normal or BordIerline Sweat Tests Patient Age at diagnosis (years) CFTR GENOTYPE* Allele 1 Allele 2 SWEAT CL- MEAN (MMOL/L) PHENOTYPE 1 0.2 F508del G149R 38 P+PI, neonatal hypertrypsinemia, 2 0.3 G551D R117H-7T 31 neonatal hypertrypsinemia 3 0.4 F508del R1070W 30.5 neonatal hypertrypsinemia 4 0.4 F508del R117H-7T 52 P 5 0.6 F508del 3849+10kbC>T 48 P 6 0.11 F508del S945L 58 P+PI 7 1 F508del 5T 40 P+CBAVD 8 2 F508del L206W 53 P 9 2 W1282X 5T 42.5 P 10 5 F508del 3849+10kbC>T 55.5 P 11 5 F508del L206W 55 P 12 5 G91R 5T 47.5 P 13 6 G551D S1235R+5T 49.5 P, neonatal hypertrypsinemia 14 7 F508del 3849+10kb 50 P, nasal popyposis 15 13 F508del R117H-7T 58 P, nasal polyposis 16 18 F508del 5T 60.5 P 17 20 G542X 3849+10kbC>T 52 P+PI 18 21 I507del 3849+10kbC>T 54 P, bronchiectasis 19 30 R347P 3849+10kbC>T 43 P, Pseudomonas colonisation 20 30 I507del L206W 57.5 CBAVD, chronic cough 21 31 F508del R117H-7T 60 CBAVD 22 32 G542X 3849+10kbC>T 30 P, Pseudomonas colonisation 23 34 F508del 3272-26A>G 64 P, CBAVD 24 37 R1070Q D1152H 56 CBAVD, bronchectasis 25 46 F508del D1152H 43 P 26 55 F508del D1152H 48 P, Pseudomonas colonisation 27 56 I507del S1235R 53 P 28 >18 F508del D1152H 60 P+PI 29 >20 F508del 3849+10kbC>T 18 P, bronchiectasis 30 >20 F508del 3272-26A>G 61 P *All mutations are named in accordance with the numbering used in the CFTR Mutation Database: http://www.genet.sickkids.on.ca/cftr/. Login to comment
101 The other mutations observed in trans of severe mutations were G149R, R1070W, S945L and S1235R. Login to comment
103 But, S945L previously reported in CF patient, was observed in this study in one patient with borderline sweat test. Login to comment
104 The large cohort of patients studied in this work can help the screening of CFTR mutations in patients with the selected phenotype and of all the mutations described in this work, at least two mutations, 3272-26A/G and S945L, were observed for the first time in patients with borderline sweat chloride values. Login to comment

[hide] Association between serum oncofetal antigens CA 19... Acta Paediatr. 2003 Nov;92(11):1267-71. Gronowitz E, Pitkanen S, Kjellmer I, Heikinheimo M, Strandvik B
Association between serum oncofetal antigens CA 19-9 and CA 125 and clinical status in patients with cystic fibrosis.
Acta Paediatr. 2003 Nov;92(11):1267-71., [PMID:14696845]

Abstract [show]
In cystic fibrosis (CF), mucus plugging in the airways and in the gastrointestinal tract leads to severe morbidity and mortality. The mucin-associated antigens CA 19-9 and CA 125 are markers of gastrointestinal malignancy, and CA 19-9 has also been reported in association with pulmonary function in CF. AIM: To test whether these antigens might serve as markers for the severity of pulmonary and gastrointestinal disease in CF. METHODS: In 99 patients, aged 1 to 48 y, serum levels of CA 19-9 and CA 125 were measured by RIA and ELISA and related to clinical data. RESULTS: Patients with severe mutations had significantly increased serum levels of CA 125, indicating an association with a more severe CF phenotype. This was further supported by the association with lung function, chronic pulmonary colonization of Pseudomonas aeruginosa and pancreatic insufficiency. CA 19-9 was also shown to be associated with lung function and Ps. aeruginosa colonization. No gastrointestinal malignancy was found in our patients despite very high values of CA 19-9 in some patients. During a 5-y follow-up, the very high serum levels of CA 19-9 decreased along with improved general condition of the patients. CONCLUSION: Increased serum levels of CA 125 in CF patients were associated with severe cystic fibrosis transmembrane conductance regulator mutations and a severe phenotype. Both antigens were associated with pseudomonas colonization and lung function and CA 125 also with pancreatic insufficiency. The estimates of CA 19-9 are hampered by the influence of the Lewis histo-blood group system on the synthesis of CA 19-9.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 The remaining 23 patients had at least one mild (I506L, R117C, S945L, T338I, W301R, 3849 10KBC → T, 1249-5 → G, R117H, R75Q), moderate (G551D, R560T, V603F) or unknown mutation. Login to comment

[hide] Rapid detection of CFTR gene rearrangements impact... J Med Genet. 2004 Nov;41(11):e118. Niel F, Martin J, Dastot-Le Moal F, Costes B, Boissier B, Delattre V, Goossens M, Girodon E
Rapid detection of CFTR gene rearrangements impacts on genetic counselling in cystic fibrosis.
J Med Genet. 2004 Nov;41(11):e118., [PMID:15520400]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
136 The subjects were divided into three groups according to the results of a previous screening: (i) 43 CF patients who fulfilled the diagnostic criteria of CF15 and who carried a CF mutation, and seven parents of deceased CF patients, a CF mutation having already been identified in the other parent (50 unidentified CF alleles); (ii) 12 CF patients with no identified CF mutation (24 unidentified CF alleles); and (iii) 16 patients apparently homozygous for a CFTR mutation and who had CF (F508del 2n = 6-, 2104insA22109del10, S945L, 3120+1GRA, N1303K) or a CFTR related disease, that is, isolated CBAVD (D110H, R117H, L997F, R74W-D1270N) or DB (R334W, R668C- G576A-D443Y) (0-16 unidentified CF alleles). Login to comment

[hide] Pancreatitis among patients with cystic fibrosis: ... Pediatrics. 2005 Apr;115(4):e463-9. Epub 2005 Mar 16. De Boeck K, Weren M, Proesmans M, Kerem E
Pancreatitis among patients with cystic fibrosis: correlation with pancreatic status and genotype.
Pediatrics. 2005 Apr;115(4):e463-9. Epub 2005 Mar 16., [PMID:15772171]

Abstract [show]
OBJECTIVE: Pancreatitis is an infrequent complication among patients with cystic fibrosis (CF). It has mainly been reported for patients with pancreatic sufficiency (PS). Previous studies involved only a small number of patients because they contained data from single centers. The aim of this study was to evaluate the incidence of pancreatitis in a large heterogeneous CF population, to determine the relationship with pancreatic function, and to assess whether pancreatitis is associated with specific CFTR mutations. METHODS: Physicians caring for patients with CF were approached through the CF Thematic Network or through the European Cystic Fibrosis Foundation newsletter. They were asked to provide data on their current patient cohort through a standardized questionnaire and to report how many patients they had ever diagnosed as having pancreatitis. A detailed questionnaire was then sent, to be filled out for all of their patients for whom pancreatitis had ever occurred. We defined pancreatitis as an episode of acute abdominal pain associated with serum amylase levels elevated above the ranges established by each participating center's laboratory. General clinical data included age, genotype, age at diagnosis of CF, sweat chloride concentrations, pancreatic status, biometric findings, and respiratory status. CFTR mutations were also reported according to the functional classification of classes I to V. Patients were categorized as having PS, pancreatic insufficiency (PI), or PI after an initial period of PS. PI was defined as a 72-hour stool fat loss of >7 g/day, fat absorption of <93%, or fecal elastase levels of <200 microg/g feces. Clinical data on pancreatitis included age at the first episode, amylase and lipase levels, possible triggers, and occurrence of relapses or complications. RESULTS: A total of 10071 patients with CF, from 29 different countries, who were undergoing follow-up monitoring in 2002 were surveyed. Among this group, pancreatitis had ever been diagnosed for 125 patients (1.24%; 95% confidence interval [CI]: 1.02-1.46%). There was variability in the reported rates of pancreatitis for different countries. Twenty-six centers in 15 different countries sent detailed clinical data on their patients with pancreatitis and on their whole CF clinic. This involved 3306 patients with CF and 61 cases of pancreatitis, leading to a prevalence of 1.84% (95% CI: 1.39-2.30%). The mean age of the patients with pancreatitis ever was 24.4 years (SD: 10.8 years). The first episode of pancreatitis occurred at a mean age of 19.9 years (SD: 9.6 years). The median serum amylase level at the time of pancreatitis was 746 IU/L (interquartile range: 319-1630 IU/L), and the median lipase level was 577 IU/L (interquartile range: 229-1650 IU/L). The majority of patients had PS (34 of 61 patients, 56%; 95% CI: 43-68%). Pancreatitis occurred for 15 patients with PI (25%; 95% CI: 14-35%). Eight patients developed PI after initial PS. The occurrence of pancreatitis among patients with PS was 34 cases per 331 patients, ie, 10.27% (95% CI: 7.00-13.55%); the occurrence of pancreatitis among patients with PI was 15 cases per 2971 patients, ie, 0.5% (95% CI: 0.25-0.76%). The mean age (in 2002) of the CF cohort with pancreatitis did not differ between the PS and PI subgroups. The forced expiratory volume in 1 second was significantly lower among the patients with PI than among the patients with PS, ie, 65% (SEM: 7%) vs 79% (SEM: 4%). The mean age at the occurrence of pancreatitis and the amylase and lipase levels during pancreatitis were not different for patients with pancreatitis and PI versus PS. In the group with PS, 31 of 34 patients carried at least 1 class IV or V CFTR mutation. In the groups with PI and PI after PS, 5 of 15 patients and 3 of 8 patients, respectively, carried 2 class I, II, or III CFTR mutations. Relapses and/or evolution to chronic pancreatitis occurred for 42 patients. Pancreatitis preceded the diagnosis of CF in 18 of 61 cases. These patients were significantly older than the rest of the cohort, ie, age of 28.4 years (SEM: 3.4 years) vs 22.7 years (SEM: 1.3 years). Their median age at the diagnosis of CF was also significantly greater, ie, 21.5 years (interquartile range: 11.9-31 years) vs 7.6 years (interquartile range: 0.4-17.0 years). However, the ages at the occurrence of pancreatitis were similar, ie, 21.0 years (SEM: 3.0 years) vs 19.5 years (SEM: 1.2 years). CONCLUSIONS: This study of 10071 patients with CF from 29 different countries revealed an estimated overall occurrence of pancreatitis among patients with CF of 1.24% (95% CI: 1.02-1.46%). The incidence of pancreatitis was much higher among patients with PS. However, pancreatitis was also reported for 15 patients with PI from 11 centers in 9 different countries. A correct diagnosis of pancreatitis for the reported patients with PI was supported by amylase and lipase levels increased above 500 IU/L, similar to those for patients with PS and pancreatitis. A correct diagnosis of PI for these patients with pancreatitis was supported by the adequacy of the methods used. We chose the cutoff values used to distinguish between patients with PI and control subjects without gastrointestinal disease. For one half of the patients, the diagnosis of PI was established on the basis of low levels of stool elastase (mean: 97 mug/g stool). With a cutoff value of 200 microg/g stool, this noninvasive test has high sensitivity (>95%) and high specificity (>90%) to differentiate patients with PI from control subjects with normal pancreatic function. For the other one half of the patients with PI in the cohort, the pancreatic status was determined on the basis of the 3-day fecal fat balance, with the widely used cutoff value of >7 g of fat loss per day. The most likely reason for pancreatitis occurring among patients with PI is that some residual pancreatic tissue is present among these patients. Pancreatitis is a rare complication among patients with CF. It occurred for 1.24% (95% CI: 1.02-1.46%) of a large CF cohort. Pancreatitis occurs mainly during adolescence and young adulthood. It is much more common among patients with CF and PS (10.3%), but it can occur among patients with PI (0.5%). Pancreatitis can be the first manifestation of CF. Pancreatitis was reported for patients carrying a wide range of mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
171 Mutations Found Among Patients With CF and Pancreatitis PS PI PI after PS Not classified 3849ϩ10-kbCϾT*/F508del† (3) F508del†/F508del† F508del†/2789ϩ5GϾA† F508del†/3849ϩ10-kbCϾT* 3849ϩ10-kbCϾT*/W1282X† F508del†/I336K† F508del†/G628RϩGϾA† F508del†/unknown D1152H*/F508del† (2) F508del†/2789ϩ5GϾA† W1282X†/G85E† F508del†/S945L D1152H*/W1282X† G551D†/N1303K† F508del†/R117H*ϩ7T Unknown/unknown R334W*/F508del† (2) I507del†/G1069R† F508del†/3849ϩ10-kbCϾT* R334W*/G542X† F508del†/D1152H* (2) F508del†/R347P R334W*/Q890X F508del†/A455E* R1162X†/R334W* R117H*ϩ7T/L997F†ϩ7T F508del†/R1066H* R347H*/2118del4 R117H*/F508del† F508del†/S13F* P205S*/G542X† F508del†/1898ϩ3AϾG* D1270NϩR74W*/I507del† Y1092X†/A455E* R352Q*/1812-1GϾA F508del†/I1005R L206W*/F508del† G542X†/unknown 5T*/W1282X† Refused testing 5T*/F508del† 5T*/7T* 7T*/F508del† 2789ϩ5GϾA†/unknown W1282X†/unknown (3) F508del†/unknown (6) F508del†/V232D† 2789ϩ5GϾA†/N1303K† 2347delG†/1341GϾA† Patients are grouped according to pancreatic status. Login to comment

[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]

Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

[hide] Extensive sequencing of the CFTR gene: lessons lea... Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28. McGinniss MJ, Chen C, Redman JB, Buller A, Quan F, Peng M, Giusti R, Hantash FM, Huang D, Sun W, Strom CM
Extensive sequencing of the CFTR gene: lessons learned from the first 157 patient samples.
Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28., [PMID:16189704]

Abstract [show]
Cystic fibrosis (CF) is one of the most common monogenic diseases affecting Caucasians and has an incidence of approximately 1:3,300 births. Currently recommended screening panels for mutations in the responsible gene (CF transmembrane regulator gene, CFTR) do not detect all disease-associated mutations. Our laboratory offers extensive sequencing of the CFTR (ABCC7) gene (including the promoter, all exons and splice junction sites, and regions of selected introns) as a clinical test to detect mutations which are not found with conventional screening. The objective of this report is to summarize the findings of extensive CFTR sequencing from our first 157 consecutive patient samples. In most patients with classic CF symptoms (18/24, 75%), extensive CFTR sequencing confirmed the diagnosis by finding two disease-associated mutations. In contrast, only 5 of 75 (7%) patients with atypical CF had been identified with two CFTR mutations. A diagnosis of CF was confirmed in 10 of 17 (58%) newborns with either positive sweat chloride readings or positive immunoreactive trypsinogen (IRT) screen results. We ascertained ten novel sequence variants that are potentially disease-associated: two deletions (c.1641AG>T, c.2949_2853delTACTC), seven missense mutations (p.S158T, p.G451V, p.K481E, p.C491S, p.H949L, p.T1036N, p.F1099L), and one complex allele ([p.356_A357del; p.358I]). We ascertained three other apparently novel complex alleles. Finally, several patients were found to carry partial CFTR gene deletions. In summary, extensive CFTR gene sequencing can detect rare mutations which are not found with other screening and diagnostic tests, and can thus establish a definitive diagnosis in symptomatic patients with previously negative results. This enables carrier detection and prenatal diagnosis in additional family members.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 The patient with the Table 3 Classic CF patients in whom extensive sequencing revealed two CFTR mutations Phenotype Age (years) Sweat chloride concentration (mmol/l) Genotype after sequencing CF; meconium ileus at birth; respiratory symptoms 12 110,115 p.V358I/c.1198del6 CF; pulmonary symptoms; partial PI 30 Pos c.2307insA/p.S945L Classic CF; pancreatic and pulmonary symptoms 22 >100 p.H609R/c.1641AG>Ta Classic CF 10 ? Login to comment

[hide] Rescue of DeltaF508 and other misprocessed CFTR mu... Mol Pharm. 2005 Sep-Oct;2(5):407-13. Loo TW, Bartlett MC, Clarke DM
Rescue of DeltaF508 and other misprocessed CFTR mutants by a novel quinazoline compound.
Mol Pharm. 2005 Sep-Oct;2(5):407-13., [PMID:16196493]

Abstract [show]
Cystic fibrosis (CF) is most commonly caused by deletion of Phe508 in the cystic fibrosis transmembrane conductance regulator protein (DeltaF508 CFTR). The misfolded DeltaF508 CFTR protein is retained in the endoplasmic reticulum (misprocessed mutant) and is rapidly degraded. Studies on misprocessed mutants of P-glycoprotein (P-gp), a sister protein of CFTR, however, have shown that specific substrates and modulators can act as specific chemical/pharmacological chaperones to rescue the protein. A major goal in CF research is the identification of compounds that can be used at low concentrations to rescue misprocessed CFTR mutants. Here, we show that a novel quinazoline derivative, 4-cyclohexyloxy-2-{1-[4-(4-methoxy-benzenesulfonyl)piperazin-1-yl]ethyl}qu inazoline (CF(cor)-325), rescued DeltaF508 CFTR. Incubation of BHK cells stably expressing human DeltaF508 CFTR with 1-10 microM CF(cor)-325 resulted in maturation and delivery of a functional molecule to the cell surface as determined by the iodide efflux assay. The misprocessed CFTR mutants R258G, S945L, and H949Y were also rescued by CF(cor)-325 in either BHK or HEK 293 cells. CF(cor)-325 appeared to be specific for DeltaF508 CFTR because another quinazoline derivative, prazosin, did not rescue the misprocessed CFTR mutants. CF(cor)-325 could also rescue misprocessed mutants of P-gp. The compound was a P-gp inhibitor as it inhibited vinblastine-stimulated ATPase activity. P-gp-mediated vinblastine resistance was also reduced about 10-fold with 300 nM CF(cor)-325. These results show that CF(cor)-325 is a particularly important lead compound for treatment of CF because low concentrations can be used to rescue many misprocessed CFTR mutants.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Incubation of BHK cells stably expressing human ∆F508 CFTR with 1-10 µM CFcor-325 resulted in maturation and delivery of a functional molecule to the cell surface as determined by the iodide efflux assay. The misprocessed CFTR mutants R258G, S945L, and H949Y were also rescued by CFcor-325 in either BHK or HEK 293 cells. Login to comment
26 Wild-type, ∆F508, H139R, G149R, R258G, S945L, and H949Y CFTR cDNAs were inserted into the pcDNA3 (Invitrogen, Oakville, ON) vector as described previously.13,14 Wild-type and mutant G268V P-gp cDNAs were inserted into the pMT21 vector (Genetics Institute) as described previously.15 Baby hamster kidney (BHK) cells stably expressing CFTR or P-gp were generated by cotransfection with cDNA and pWL-neo (Stratagene, Cedar Creek, TX). Login to comment
132 (C) BHK cells expressing misprocessed CFTR mutants H139R, G149R, R258G, S945L, H949Y, or wild-type CFTR were incubated for 48 h with (+) or without (-) 3 µM CFcor-325. Whole cell extracts were subjected to immunoblot analysis with a rabbit polyclonal antibody against CFTR. Login to comment
144 BHK cells expressing mutants H139R, G149R, and R258G in the first transmembrane domain (TMD1)30 or mutants S945L and H949Y in TMD213 were treated with or without 3 µM CFcor-325 for 48 h. Whole cell SDS extracts were then subjected to immunoblot analysis. Login to comment
145 The presence of CFcor-325 significantly enhanced maturation of mutants R258G, S945L, and H949Y (Figure 2C). Login to comment
178 It was possible to promote maturation of some mutants that had mutations in different domains of CFTR including NBD1 (∆F508), TMD1 (R258G in the second intracellular loop), and TMD2 (S945L and H949Y in the third intracellular loop). Login to comment
24 Wild-type, ∆F508, H139R, G149R, R258G, S945L, and H949Y CFTR cDNAs were inserted into the pcDNA3 (Invitrogen, Oakville, ON) vector as described previously.13,14 Wild-type and mutant G268V P-gp cDNAs were inserted into the pMT21 vector (Genetics Institute) as described previously.15 Baby hamster kidney (BHK) cells stably expressing CFTR or P-gp were generated by cotransfection with cDNA and pWL-neo (Stratagene, Cedar Creek, TX). Login to comment
130 (C) BHK cells expressing misprocessed CFTR mutants H139R, G149R, R258G, S945L, H949Y, or wild-type CFTR were incubated for 48 h with (+) or without (-) 3 µM CFcor-325. Whole cell extracts were subjected to immunoblot analysis with a rabbit polyclonal antibody against CFTR. Login to comment
142 BHK cells expressing mutants H139R, G149R, and R258G in the first transmembrane domain (TMD1)30 or mutants S945L and H949Y in TMD213 were treated with or without 3 µM CFcor-325 for 48 h. Whole cell SDS extracts were then subjected to immunoblot analysis. Login to comment
143 The presence of CFcor-325 significantly enhanced maturation of mutants R258G, S945L, and H949Y (Figure 2C). Login to comment
176 It was possible to promote maturation of some mutants that had mutations in different domains of CFTR including NBD1 (∆F508), TMD1 (R258G in the second intracellular loop), and TMD2 (S945L and H949Y in the third intracellular loop). Login to comment

[hide] Identification of CFTR, PRSS1, and SPINK1 mutation... Pancreas. 2006 Oct;33(3):221-7. Keiles S, Kammesheidt A
Identification of CFTR, PRSS1, and SPINK1 mutations in 381 patients with pancreatitis.
Pancreas. 2006 Oct;33(3):221-7., [PMID:17003641]

Abstract [show]
OBJECTIVES: Chronic pancreatitis is a progressive inflammatory disorder leading to irreversible exocrine and/or endocrine impairment. It is well documented that mutations in the cationic trypsinogen (PRSS1) gene can cause hereditary pancreatitis. Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) and the serine protease inhibitor Kazal type 1 (SPINK1) genes are also associated with pancreatitis. METHODS: We analyzed 381 patients with a primary diagnosis of chronic or recurrent pancreatitis using the Ambry Test: Pancreatitis to obtain comprehensive genetic information for the CFTR, SPINK1, and PRSS1 genes. RESULTS: The results identified 32% (122/381) of patients with 166 mutant CFTR alleles, including 12 novel CFTR variants: 4375-20 A>G, F575Y, K598E, L1260P, G194R, F834L, S573C, 2789 + 17 C>T, 621+83 A>G, T164S, 621+25 A>G, and 3500-19 G>A. Of 122 patients with CFTR mutations, 5.5% (21/381) also carried a SPINK1 mutation, and 1.8% (7/381) carried a PRSS1 mutation. In addition, 8.9% (34/381) of all patients had 1 of 11 different SPINK1 mutations. Another 6.3% (24/381) of the patients had 1 of 8 different PRSS1 mutations. Moreover, 1.3% of the patients (5/381) had 1 PRSS1 and 1 SPINK1 mutation. A total 49% (185/381) of the patients carried one or more mutations. CONCLUSIONS: Comprehensive testing of the CFTR, PRSS1, and SPINK1 genes identified genetic variants in nearly half of all subjects considered by their physicians as candidates for genetic testing. Comprehensive test identified numerous novel variants that would not be identified by standard clinical screening panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Patients With 1 CFTR Mutation CFTR Mutation 1 No. of Patients 1717-1 G9A 1 2789+5 G9A 1 3849+10kb C9T 2 3849+45 G9A 1 621+3 A9G 2 A1364V 1 A349V 1 A455E 1 D1152H 1 D1445N 1 deltaF508 16 E217G 1 F1286C 1 F316L 1 G542X 1 G551D 1 I148T 1 I807M 1 L206W 1 L967S 2 L997F 2 P55S 1 Q179K 1 Q220X 1 R117H 3 R1453W 1 R297Q 1 R31C 1 R668C 2 S1235R 1 S573C 1 S945L 1 V562A 1 V754M 2 Y1092X 1 Total patients 58 MutationsinboldfacewouldnothavebeendetectedbytheACOG/ACMGmutationpanel. Login to comment

[hide] Airway nitric oxide in patients with cystic fibros... Chest. 2007 Jun;131(6):1857-64. Epub 2007 Mar 30. Keen C, Olin AC, Edentoft A, Gronowitz E, Strandvik B
Airway nitric oxide in patients with cystic fibrosis is associated with pancreatic function, Pseudomonas infection, and polyunsaturated fatty acids.
Chest. 2007 Jun;131(6):1857-64. Epub 2007 Mar 30., [PMID:17400678]

Abstract [show]
BACKGROUND: Airway nitric oxide (NO) is low or normal in cystic fibrosis (CF) patients. This may affect bacterial status since NO has antimicrobial properties. Arachidonic acid (AA), which is increased in the serum and airways of CF patients, has been shown to reduce NO levels. The aim of this study was to investigate whether airway NO level correlates with genotype and pancreatic function, and whether low airway NO level is associated with bacterial infection and increased serum AA level in CF patients. METHOD: Nasal NO (nNO) and exhaled NO (eNO) were measured according to the European Respiratory Society/American Thoracic Society standard in 59 CF patients aged 7 to 55 years, 80% of whom were pancreatic insufficient (PI) and 51% were chronically infected with Pseudomonas aeruginosa. RESULTS: PI CF patients had significantly lower nNO levels than pancreatic-sufficient (PS) patients. Airway NO level did not correlate with lung function or inflammatory parameters. PI patients chronically infected with P aeruginosa had significantly lower nNO levels than noninfected PI patients. nNO level correlated inversely with the AA/docosahexaenoic acid ratio, and eNO with the essential fatty acid (FA) deficiency index, which is the ratio between mead acid and AA. CONCLUSIONS: CF patients with PI, which is associated with more severe genotypes, had lower airway NO levels than patients with PS. Low NO level was correlated to chronic P aeruginosa infection, and an association was found between airway NO level and the abnormal serum phospholipid FA pattern.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Patients in group 3 were heterozygous for mutations dF508 and V603F, R560T, or 621 ϩ 1G-T; group 4 patients were heterozygous for mutations dF508, 3659del C, or 394delTT and a mutation linked to a "mild" phenotype (eg, N1088D, R117C, R117H, R75Q, R658X, S945L, 1154insTC, or T338I). Login to comment

[hide] CFTR mutations in Turkish and North African cystic... Genet Test. 2008 Mar;12(1):25-35. Lakeman P, Gille JJ, Dankert-Roelse JE, Heijerman HG, Munck A, Iron A, Grasemann H, Schuster A, Cornel MC, Ten Kate LP
CFTR mutations in Turkish and North African cystic fibrosis patients in Europe: implications for screening.
Genet Test. 2008 Mar;12(1):25-35., [PMID:18373402]

Abstract [show]
AIMS: To obtain more insight into the variability of the CFTR mutations found in immigrant cystic fibrosis (CF) patients who are living in Europe now, and to estimate the test sensitivity of different frequently used methods of DNA analysis to detect CF carriers or patients among these Turkish or North African immigrants. METHODS: A survey among 373 European CF centers asking which CFTR mutations had been found in Turkish and North African CF patients. RESULTS: 31 and 26 different mutations were reported in Turkish and North African patients, identifying 64.2% (113/176) and 87.4% (118/135) alleles, respectively (p < 0.001). The mean sensitivity (detection rate) of three most common CFTR mutation panels to detect these mutations differed between Turkish and North African people, 44.9% (79/176) versus 69.6% (94/135) (p < 0.001), and can be increased to 57.4% (101/176) and 79.3% (107/135) (p < 0.001), respectively, by expanding these panels with 13 mutations which have been found on two or more alleles. CONCLUSION: 35.8% and 12.6%, respectively, of CF alleles in Turkish and North African patients living in Europe now had not been identified. Among these populations, the test sensitivity of common CFTR mutation panels is insufficient for use in screening programs in Europe, even after expansion with frequent Turkish and North African mutations. This raises questions about whether and how to implement CF carrier and neonatal screening in a multiethnic society.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 Identity and Frequency of CFTR Mutations on Unrelated Turkish (Tr) and North African (NA) CF alleles Total number of allelesa Number of CF patients with this mutationb Mutation Exon All Tr NA Homozygote Compound heterozygote: two mutations found Compound heterozygote: one mutation found F508delc 10 73 33 40 27 11 6 N1303K 21 22 12 10 10 5 2 711 þ 1G > T Intron 5 14 - 14 7 2 0 G542X 11 14 6 8 7 1 0 R1162X 19 11 - 11 1 5 2 2183AA > G 13 9 9 - 3 3 1 W1282X 20 7 3 4 2 3 1 2789 þ 5G > A Intron 14b 6 3 3 1 4 1 L227R 6a 4 - 4 3 1 0 1677delTA 10 4 4 - 2 1 1 2184insA 13 4 4 - 1 2 0 R334W 7 4 4 - 1 1 1 G85E 3 4 3 1 1 2 0 R709X 13 3 - 3 2 0 0 L732X 13 3 3 - 2 0 0 2184delA 13 3 3 - 0 3 0 del exon 1-4d 1-4 3 3 - 1 1 0 del exon 19 19 2 2 - 2 0 0 3849 þ 10kbC > T Intron 19 2 - 2 1 0 0 S549N 11 2 1 1 0 1 1 3120 þ G > A Intron 16 2 2 - 1 0 0 3601-2A > G Intron 18 2 2 - 1 0 0 D1152H 18 2 2 - 1 0 0 E1104X 17b 2 - 2 1 0 0 S1159F 19 2 2 - 1 0 0 S977F 16 2 - 2 0 1 0 2347delG 13 2 - 2 1 0 0 4096-3C > G Intron 21 1 1 - 1 0 0 E831X 14a 1 1 - 1 0 0 L619S 13 1 1 - 1 0 0 1525-1G > Ac Intron 9 1 1 - 1 0 0 F1052V 17b 1 1 - 1 0 0 3130delA 17a 1 1 - 1 0 0 R352Q 7 1 - 1 0 1 0 1812-1G > A Intron 11 1 - 1 0 1 0 R553X 11 1 - 1 0 0 1 IVS8-5T Intron 8 1 1 - 0 1 0 R1066C 17b 1 - 1 0 1 0 3129del4 17a 1 - 1 0 1 0 D110H 4 1 1 - 0 1 0 R117H 4 1 - 1 0 1 0 S945L 15 1 - 1 0 1 0 1716G=A 10 1 - 1 0 0 1 711 þ 3A > G Intron 5 1 1 - 0 1 0 R75X 3 1 1 - 0 1 0 R764X 13 1 - 1 0 1 0 S1196X 19 1 1 - 0 1 0 S492F 10 1 - 1 0 1 0 G551D 11 1 - 1 1 0 0 del exon 2 2 1 1 - 1 0 0 Subtotal 231 113 118 - No mutation 80 63 17 - Total 311 176 135 88 60 18 a n ¼ 311 alleles, based on 166 CF patients (332 alleles) with both parents and 22 CF patients (22 alleles) with one parent from Turkey or North Africa, minus 43 alleles of homozygous CF patients with consanguineous parents of whom only one allele was taken into account. Login to comment

[hide] Atomic model of human cystic fibrosis transmembran... Cell Mol Life Sci. 2008 Aug;65(16):2594-612. Mornon JP, Lehn P, Callebaut I
Atomic model of human cystic fibrosis transmembrane conductance regulator: membrane-spanning domains and coupling interfaces.
Cell Mol Life Sci. 2008 Aug;65(16):2594-612., [PMID:18597042]

Abstract [show]
We describe herein an atomic model of the outward-facing three-dimensional structure of the membrane-spanning domains (MSDs) and nucleotide-binding domains (NBDs) of human cystic fibrosis transmembrane conductance regulator (CFTR), based on the experimental structure of the bacterial transporter Sav1866. This model, which is in agreement with previous experimental data, highlights the role of some residues located in the transmembrane passages and directly involved in substrate translocation and of some residues within the intracellular loops (ICL1-ICL4) making MSD/NBD contacts. In particular, our model reveals that D173 ICL1 and N965 ICL3 likely interact with the bound nucleotide and that an intricate H-bond network (involving especially the ICL4 R1070 and the main chain of NBD1 F508) may stabilize the interface between MSD2 and the NBD1F508 region. These observations allow new insights into the ATP-binding sites asymmetry and into the molecular consequences of the F508 deletion, which is the most common cystic fibrosis mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
255 Other CF-associated mutations of interest in ICL1 and ICL3 are (i) E193K, a mutation of an ICL1 residue that exhibits, similarly to G178R, impaired anion translocation capacity [73], and (ii) S945L, H949Yand G970R, which affect ICL3 residues and are probably involved (as G970R) in obtaining or maintaining the open state of the transporter [74]. Login to comment

[hide] Phenotypic characterisation of patients with inter... Thorax. 2009 Aug;64(8):683-91. Epub 2009 Mar 23. Goubau C, Wilschanski M, Skalicka V, Lebecque P, Southern KW, Sermet I, Munck A, Derichs N, Middleton PG, Hjelte L, Padoan R, Vasar M, De Boeck K
Phenotypic characterisation of patients with intermediate sweat chloride values: towards validation of the European diagnostic algorithm for cystic fibrosis.
Thorax. 2009 Aug;64(8):683-91. Epub 2009 Mar 23., [PMID:19318346]

Abstract [show]
BACKGROUND: In patients with symptoms suggestive of cystic fibrosis (CF) and intermediate sweat chloride values (30-60 mmol/l), extensive CFTR gene mutation analysis and nasal potential difference (NPD) measurement are used as additional diagnostic tests and a positive result in either test provides evidence of CFTR dysfunction. To define the phenotype of such patients and confirm the validity of grouping them, patients with intermediate sweat chloride values in whom either additional CF diagnostic test was abnormal were compared with subjects in whom this was not the case and patients with classic CF. METHODS: The phenotypic features of four groups were compared: 59 patients with CFTR dysfunction, 46 with an intermediate sweat chloride concentration but no evidence of CFTR dysfunction (CF unlikely), 103 patients with CF and pancreatic sufficiency (CF-PS) and 62 with CF and pancreatic insufficiency (CF-PI). RESULTS: The CFTR dysfunction group had more lower respiratory tract infections (p = 0.01), more isolation of CF pathogens (p<0.001) and clubbing (p = 0.001) than the CF unlikely group, but less frequent respiratory tract infections with CF pathogens than the CF-PS group (p = 0.05). Patients in the CF-PS group had a milder phenotype than those with PI. Many features showed stepwise changes through the patient groups. CONCLUSION: Patients with intermediate sweat chloride values and two CFTR mutations or an abnormal NPD measurement have a CF-like phenotype compatible with CFTR dysfunction and, as a group, differ phenotypically from patients with intermediate sweat chloride values in whom further CF diagnostic tests are normal as well as from CF-PS and CF-PI patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 All five had the F508del mutation associated with S945L, a mutation considered as a class II mutation. Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

[hide] New horizons in the treatment of cystic fibrosis. Br J Pharmacol. 2011 May;163(1):173-83. doi: 10.1111/j.1476-5381.2010.01137.x. Cuthbert AW
New horizons in the treatment of cystic fibrosis.
Br J Pharmacol. 2011 May;163(1):173-83. doi: 10.1111/j.1476-5381.2010.01137.x., [PMID:21108631]

Abstract [show]
Cystic fibrosis (CF) is a lethal, recessive, genetic disease affecting approximately 1 in 2500 live births among Caucasians. The CF gene codes for a cAMP/PKA-dependent, ATP-requiring, membrane chloride ion channel, generally found in the apical membranes of many secreting epithelia and known as CFTR (cystic fibrosis transmembrane conductance regulator). There are currently over 1700 known mutations affecting CFTR, many of which give rise to a disease phenotype. Around 75% of CF alleles contain the DeltaF508 mutation in which a triplet codon has been lost, leading to a missing phenylalanine at position 508 in the protein. This altered protein fails to be trafficked to the correct location in the cell and is generally destroyed by the proteasome. The small amount that does reach the correct location functions poorly. Clearly the cohort of patients with at least one DeltaF508 allele are a major target for therapeutic intervention. It is now over two decades since the CF gene was discovered and during this time the properties of CFTR have been intensely investigated. At long last there appears to be progress with the pharmaco-therapeutic approach. Ongoing clinical trials have produced fascinating results in which clinical benefit appears to have been achieved. To arrive at this point ingenious ways have been devised to screen very large chemical libraries for one of two properties: (i) agents promoting trafficking of mutant CFTR to, and insertion into the membrane, and known as correctors or (ii) agents which activate appropriately located mutant CFTR, known as potentiators. The best compounds emerging from these programmes are then used as chemical scaffolds to synthesize other compounds with appropriate pharmaceutical properties, hopefully with their pharmacological activity maintained or even enhanced. In summary, this approach attempts to make the mutant CFTR function in place of the real CFTR. A major function of CFTR in healthy airways is to maintain an adequate airway surface liquid (ASL) layer. In CF the position is further confounded since epithelial sodium channels (ENaC) are no longer regulated and transport salt and water out of the airways to exacerbate the lack of ASL. Thus an additional possibility for treatment of CF is to use agents that inhibit ENaC either alone or as adjuncts to CFTR correctors and/or potentiators. Yet a further way in which a pharmacological approach to CF can be considered is to recruit alternative chloride channels, such as calcium-activated chloride channel (CaCC), to act as surrogates for CFTR. A number of P2Y(2) receptor agonists have been investigated that operate by increasing Ca(2+)(i) which in turn activates CaCC. Some of these compounds are currently in clinical trials. The knowledge base surrounding the structure and function of CFTR that has accumulated in the last 20 years is impressive. Translational research feeding from this is now yielding compounds that provide real prospects for a pharmacotherapy for this disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
251 In one of these, VRT-325 rescued CFTR mutants R258G, S945L and H949Y as well as DF508 CFTR (Loo et al., 2005). Login to comment

[hide] Association between genotype and pulmonary phenoty... J Cyst Fibros. 2011 May;10(3):187-92. doi: 10.1016/j.jcf.2011.01.005. Epub 2011 Feb 26. Geborek A, Hjelte L
Association between genotype and pulmonary phenotype in cystic fibrosis patients with severe mutations.
J Cyst Fibros. 2011 May;10(3):187-92. doi: 10.1016/j.jcf.2011.01.005. Epub 2011 Feb 26., [PMID:21354377]

Abstract [show]
BACKGROUND: Despite numerous studies a clear relationship between genotype and pulmonary phenotype has not been established within the group pancreatic insufficient cystic fibrosis (CF) patients. We studied the relationship between class I and class II mutations and pulmonary function in Swedish patients with known CFTR functional classification. METHODS: 170 CF patients with two class II mutations, 18 with two class I mutations and 78 with a combination of class I and II mutations were included in the study. Spirometry was performed when patients were in an optimal clinical condition. RESULTS: Patients with two class I mutations had lower lung function (FEV(1) and FVC) compared to the group with either a combination of class I and II mutations or two class II mutations. CONCLUSION: CF patients carrying two class I mutations risk developing more severe lung disease compared to patients with at least one class II mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 Class I/class I Class I/class II Class II/class II 1717-1 G-NA/1717-1 G-NA n=1 3659delC/S945L n=1 F508del/F508del n=165 3659delC/3659delC n=5 3659delC/F508del n=23 F508del/S945L n=5 3659delC/394delTT n=7 394delTT/F508del n=38 394delTT/394delTT n=4 621+1 G-NT/F508del n=6 R553X/E60X n=1 E60X/F508del n=4 G542X/F508del n=1 R553X/F508del n=2 W79R/F508del n=1 W1282X/F508del n=1 1717-1 G-NA/F508del n=1 Total 18 78 170 The other class combinations are not shown. Login to comment
98 Class I Class II Class III Class IV Class V 1717-1 G-NA F508del G551D 297 C-NA 2789+5 G-NA 3659delC S945L R560T R117C 3849+10 kb CNT 394delTT R347P A455E R553X T 3381 3849+10 kb C-T 621+1 G-NT E60X G542X W79R W1282X decline of pulmonary function was more rapid in patients with pancreatic insufficiency, mainly class II mutations, compared to CF patients with normal pancreatic function [4]. Login to comment

[hide] COMMD1-mediated ubiquitination regulates CFTR traf... PLoS One. 2011 Mar 31;6(3):e18334. Drevillon L, Tanguy G, Hinzpeter A, Arous N, de Becdelievre A, Aissat A, Tarze A, Goossens M, Fanen P
COMMD1-mediated ubiquitination regulates CFTR trafficking.
PLoS One. 2011 Mar 31;6(3):e18334., [PMID:21483833]

Abstract [show]
The CFTR (cystic fibrosis transmembrane conductance regulator) protein is a large polytopic protein whose biogenesis is inefficient. To better understand the regulation of CFTR processing and trafficking, we conducted a genetic screen that identified COMMD1 as a new CFTR partner. COMMD1 is a protein associated with multiple cellular pathways, including the regulation of hepatic copper excretion, sodium uptake through interaction with ENaC (epithelial sodium channel) and NF-kappaB signaling. In this study, we show that COMMD1 interacts with CFTR in cells expressing both proteins endogenously. This interaction promotes CFTR cell surface expression as assessed by biotinylation experiments in heterologously expressing cells through regulation of CFTR ubiquitination. In summary, our data demonstrate that CFTR is protected from ubiquitination by COMMD1, which sustains CFTR expression at the plasma membrane. Thus, increasing COMMD1 expression may provide an approach to simultaneously inhibit ENaC absorption and enhance CFTR trafficking, two major issues in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Two ICL3 mutations (S945L, D979A) are associated with the CF phenotype (Figure 1A), suggesting the importance of this region in the maturation and/or function of CFTR [16,17]. Login to comment
70 Asterisks indicate the position of two class II mutations: S945L and D979A. Login to comment
111 COMMD1 regulates CFTR ubiquitination through an ICL3 motif As part of the yeast two-hybrid screen, targeted two-hybrid tests between COMMD1 and ICL3 mutants S945L and D979A were conducted. Login to comment
112 A loss of interaction was observed with S945L, suggesting that the substitution of Ser-945 disrupts the ICL3/ COMMD1 interaction in yeast in contrast to that of Asp-979 (data not shown). Login to comment
184 doi:10.1371/journal.pone.0018334.g005 interaction between COMMD1 and the S945L-ICL3 mutant. Login to comment

[hide] Pharmacological therapy for cystic fibrosis: from ... J Cyst Fibros. 2011 Jun;10 Suppl 2:S129-45. Becq F, Mall MA, Sheppard DN, Conese M, Zegarra-Moran O
Pharmacological therapy for cystic fibrosis: from bench to bedside.
J Cyst Fibros. 2011 Jun;10 Suppl 2:S129-45., [PMID:21658632]

Abstract [show]
With knowledge of the molecular behaviour of the cystic fibrosis transmembrane conductance regulator (CFTR), its physiological role and dysfunction in cystic fibrosis (CF), therapeutic strategies are now being developed that target the root cause of CF rather than disease symptoms. Here, we review progress towards the development of rational new therapies for CF. We highlight the discovery of small molecules that rescue the cell surface expression and defective channel gating of CF mutants, termed CFTR correctors and CFTR potentiators, respectively. We draw attention to alternative approaches to restore epithelial ion transport to CF epithelia, including inhibitors of the epithelial Na(+) channel (ENaC) and activators of the Ca(2+)-activated Cl(-) channel TMEM16A. The expertise required to translate small molecules identified in the laboratory to drugs for CF patients depends on our ability to coordinate drug development at an international level and our ability to provide pertinent biological information using suitable disease models.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
100 [29] BHK cells F508del, R258G, S945L, H949Y cAMP-stimulated iodide efflux, biochemistry VRT-325 (1-10 μM) rescued F508del-CFTR and other mutants after 48 h incubation of BHK cells at 37°C. VRT-325 also rescues misprocessed P-gp mutants and acts as P-gp inhibitor. Login to comment

[hide] Comparison of the gating behaviour of human and mu... J Physiol. 1998 Apr 15;508 ( Pt 2):379-92. Lansdell KA, Delaney SJ, Lunn DP, Thomson SA, Sheppard DN, Wainwright BJ
Comparison of the gating behaviour of human and murine cystic fibrosis transmembrane conductance regulator Cl- channels expressed in mammalian cells.
J Physiol. 1998 Apr 15;508 ( Pt 2):379-92., 1998-04-15 [PMID:9508803]

Abstract [show]
1. To investigate the function of the murine cystic fibrosis transmembrane conductance regulator (CFTR), a full-length cDNA encoding wild-type murine CFTR was assembled and stably expressed in Chinese hamster ovary (CHO) cells. 2. Like human CFTR, murine CFTR formed Cl- channels that were regulated by cAMP-dependent phosphorylation and intracellular ATP. However, murine CFTR Cl- channels had a reduced single-channel conductance and decreased open probability (Po) compared with those of human CFTR. 3. Analysis of the dwell time distributions of single channels suggested that the reduced Po of murine CFTR was caused by both decreased residence in the open state and transitions to a new closed state, described by an intermediate closed time constant. 4. For both human and murine CFTR, ATP and ADP regulated the rate of exit from the long-lived closed state. 5. 5'-Adenylylimidodiphosphate (AMP-PNP) and pyrophosphate, two compounds that disrupt cycles of ATP hydrolysis, stabilized the open state of human CFTR. However, neither agent locked murine CFTR Cl- channels open, although AMP-PNP increased the Po of murine CFTR. 6. The data indicate that although human and murine CFTR have many properties in common, some important differences in function are observed. These differences could be exploited in future studies to provide new understanding about CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
218 Consistent with this latter possibility, deletion of nineteen residues from the second intracellular loop (ICL2) promoted transitions to a subconductance state, while the I-V relationships of the mutations S945L and G970R located in ICL3 showed weak outward rectification in contrast to that of wild-type CFTR (Xie, Drumm, Ma & Davis, 1995; Seibert, Linsdell, Loo, Hanrahan, Riordan & Clarke, 1996b). Login to comment

[hide] Structure and function of the CFTR chloride channe... Physiol Rev. 1999 Jan;79(1 Suppl):S23-45. Sheppard DN, Welsh MJ
Structure and function of the CFTR chloride channel.
Physiol Rev. 1999 Jan;79(1 Suppl):S23-45., [PMID:9922375]

Abstract [show]
Structure and Function of the CFTR Chloride Channel. Physiol. Rev. 79, Suppl.: S23-S45, 1999. - The cystic fibrosis transmembrane conductance regulator (CFTR) is a unique member of the ABC transporter family that forms a novel Cl- channel. It is located predominantly in the apical membrane of epithelia where it mediates transepithelial salt and liquid movement. Dysfunction of CFTR causes the genetic disease cystic fibrosis. The CFTR is composed of five domains: two membrane-spanning domains (MSDs), two nucleotide-binding domains (NBDs), and a regulatory (R) domain. Here we review the structure and function of this unique channel, with a focus on how the various domains contribute to channel function. The MSDs form the channel pore, phosphorylation of the R domain determines channel activity, and ATP hydrolysis by the NBDs controls channel gating. Current knowledge of CFTR structure and function may help us understand better its mechanism of action, its role in electrolyte transport, its dysfunction in cystic fibrosis, and its relationship to other ABC transporters.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
168 Although, Xenopus CFTR hadships of the mutations S945L and G970R in ICL3 showed weak outward rectification in contrast to that of wild-type a pattern of gating similar to human CFTR, the human-Xenopus CFTR chimera hX1-6 showed a pattern of gatingCFTR (114, 148). Login to comment

[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]

Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4. Login to comment

[hide] Regulation of Activation and Processing of the Cys... J Biol Chem. 2012 Oct 11. Wang G, Duan DD
Regulation of Activation and Processing of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) by a Complex Electrostatic Interaction between the Regulatory Domain and Cytoplasmic Loop 3.
J Biol Chem. 2012 Oct 11., [PMID:23060444]

Abstract [show]
NEG2, a short C-terminal segment (817-838) of the unique regulatory (R) domain of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel, has been reported to regulate CFTR gating in response to cAMP-dependent R domain phosphorylation. The underlying mechanism, however, is unclear. Here, K946 of cytoplasmic loop 3 (CL3) is proposed as counter-ion of D835, D836 or E838 of NEG2 to prevent channel activation by PKA. R764 or R766 of the S768 phosphorylation site of the R domain is proposed to promote channel activation possibly by weakening the putative CL3-NEG2 electrostatic attraction. First, not only D835A, D836A and E838A but also K946A reduced the PKA dependent CFTR activation. Second, both K946D and D835R/D836R/E838R mutants were activated by ATP and curcumin to a different extent. Third, R764A and R766A mutants enhanced the PKA-dependent activation. On the other hand, it is very exciting that D835R/D836R/E838R and K946D/H950D and H950R exhibited normal channel processing and activity while D835R/D836R/E838R/K946D/H950D was misprocessed and silent in response to forskolin. Further, D836R and E838R played a critical role in the asymmetric electrostatic regulation of CFTR processing and S768 phosphorylation may not be involved. Thus, a complex interfacial interaction among CL3, NEG2 and the S768 phosphorylation site may be responsible for the asymmetric electrostatic regulation of CFTR activation and processing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
152 On the other hand, S945L and H949Y, found in patients with cystic fibrosis, are close to K946 and H950 of CL3 and stop maturation of the protein (31). Login to comment
191 However, S945L and H949Y, found in patients with CF, are close to Lys-946 and His-950 of CL3 and stop maturation of the protein (31). Login to comment

[hide] Retrospective analysis of stored dried blood spots... J Cyst Fibros. 2012 Jul;11(4):332-6. doi: 10.1016/j.jcf.2012.01.001. Epub 2012 Feb 1. Barben J, Gallati S, Fingerhut R, Schoeni MH, Baumgartner MR, Torresani T
Retrospective analysis of stored dried blood spots from children with cystic fibrosis and matched controls to assess the performance of a proposed newborn screening protocol in Switzerland.
J Cyst Fibros. 2012 Jul;11(4):332-6. doi: 10.1016/j.jcf.2012.01.001. Epub 2012 Feb 1., [PMID:22300503]

Abstract [show]
BACKGROUND: Newborn screening (NBS) for Cystic Fibrosis (CF) has been introduced in many countries, but there is no ideal protocol suitable for all countries. This retrospective study was conducted to evaluate whether the planned two step CF NBS with immunoreactive trypsinogen (IRT) and 7 CFTR mutations would have detected all clinically diagnosed children with CF in Switzerland. METHODS: IRT was measured using AutoDELFIA Neonatal IRT-Kit in stored NBS cards. RESULTS: Between 2006 and 2009, 66 children with CF were reported, 4 of which were excluded for various reasons (born in another country, NBS at 6 months, no informed consent). 98% (61/62) had significantly higher IRT compared to matched control group. There was one false negative IRT result in an asymptomatic child with atypical CF (normal pancreatic function and sweat test). CONCLUSIONS: All children but one with atypical CF would have been detected with the planned two step protocol.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 CFTR mutations Alleles found Percentage of total Homozygous (n) F508del a 86 68.2 30 3905insT a 4 3.2 1 G542X a 3 2.4 - R553X a 3 2.4 1 W1282X a 2 1.6 - 1717-1 GNA a 2 1.6 - N1303K a 0 0.0 - S549R 3 2.4 1 Q525X 3 2.4 - Y1092X 2 1.6 - 3120+1 GNA b 2 1.6 1 2347delG 2 1.6 - 2176insC 1 0.8 - 3659delC 1 0.8 - 3359delCTCTG 1 0.8 - W1089X 1 0.8 - 711+1 GNT 1 0.8 - D1152H 1 0.8 - G1244E 1 0.8 - R1066C 1 0.8 - R31C 1 0.8 - R347P 1 0.8 - R74W 1 0.8 - S945L 1 0.8 - T501I 1 0.8 - K68X 1 0.8 - Total 126 100.0% 34 a Seven most common CF-gene mutations in Switzerland ("Swiss panel")=79.4% (100/126) of alleles. Login to comment

[hide] Validation of high-resolution DNA melting analysis... J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7. Audrezet MP, Dabricot A, Le Marechal C, Ferec C
Validation of high-resolution DNA melting analysis for mutation scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7., [PMID:18687795]

Abstract [show]
High-resolution melting analysis of polymerase chain reaction products for mutation scanning, which began in the early 2000s, is based on monitoring of the fluorescence released during the melting of double-stranded DNA labeled with specifically developed saturation dye, such as LC-Green. We report here the validation of this method to scan 98% of the coding sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. We designed 32 pairs of primers to amplify and analyze the 27 exons of the gene. Thanks to the addition of a small GC-clamp at the 5' ends of the primers, one single melting domain and one identical annealing temperature were obtained to co-amplify all of the fragments. A total of 307 DNA samples, extracted by the salt precipitation method, carrying 221 mutations and 21 polymorphisms, plus 20 control samples free from variations (confirmed by denaturing high-performance liquid chromatography analysis), was used. With the conditions described in this study, 100% of samples that carry heterozygous mutations and 60% of those with homozygous mutations were identified. The study of a cohort of 136 idiopathic chronic pancreatitis patients enabled us to prospectively evaluate this technique. Thus, high-resolution melting analysis is a robust and sensitive single-tube technique for screening mutations in a gene and promises to become the gold standard over denaturing high-performance liquid chromatography, particularly for highly mutated genes such as CFTR, and appears suitable for use in reference diagnostic laboratories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Sequences of the Primers Used for CFTR Analysis by HRM, GC Size, Amplicon Length, Number of Positive Controls Validated for Each Exon, and Positive Controls for Routine Analysis Exon Primer Sequences GC length Amplicon length (bp) Introns Number of heterozygous- positive controls Number of homozygous- positive controls Recommended control 1 LSCFE1Fmod 5Ј-CCGCCGCCGTTGAGCGGCAGGCACC-3Ј 8 200 bp 74 4 125GϾC LSCFE1Rmod 5Ј-CCGCCGCCGGCACGTGTCTTT CCGAAGCT-3Ј 8 19 M1I 2 2i5b 5Ј-CAAATCTGTATGGAGACC-3Ј 0 194 bp 39 5 R31C 2i3Љ 5Ј-CAACTAAACAATGTACATGAAC-3Ј 0 4 296ϩ1GϾT 3 LSCFe3Fmod LSCFe3Rmod 5Ј-CGCCGTTAAGGGAAATAGGACAA CTAAAATA-3Ј 5 276 bp 44 10 2 R75Q 5Ј-CCGCCGATTCACCAGATTTCGTAGTC-3Ј 6 66 G85V 4 LSCFe4FmodC 5Ј-CCGCCGCCGCCCGTGTTGAAATT CTCAGGGT-3Ј 12 361 bp 52 14 1 R117H LSCFe4RmodC 5Ј-CCGCCGCCCACATGTACGATAC AGAATATATGTGCC-3Ј 9 26 574delA 5 LSCFE5Fmod 5Ј-CCGCCGGTTGAAATTATCTAACTTTCC-3Ј 6 201 bp 13 8 624delT LSCFE5Rmod 5Ј-CCGAACTCCGCCTTTCCAGTTGT-3Ј 3 48 711ϩ1GϾT 6a LSCF6aFmod2 5Ј-CCGCCGGGGTGGAAGAT ACAATGACACCTG-3Ј 5 317 bp 25 8 C225X LSCF6aRmod2 5Ј-CCGCCGCCGCGATGCATAGAG CAGTCCTGGTT-3Ј 11 66 L206W 6b LSCFE6bFmod 5Ј-CGCGCCGCCGGATTTAC AGAGATCAGAGAG-3Ј 10 239 bp 0 2 1 R258G LSCFE6Brmod 5Ј-CCGCCGCCGAGGTGGA GTCTACCATGA-3Ј 8 66 1001ϩ11CϾT 7 LSCFE7Fmod2 5Ј-CCGCCGCCCTCTCCCTGAATTT TATTGTTATTGTTT-3Ј 13 326 bp 7 11 1078delT LSCFE7Rmod2 5Ј-CCCGCCGCCCTATAATGCAG CATTATGGT-3Ј 10 7 1248ϩ1GϾT 8 LSCFE8Fmod 5Ј-CCGGAATGCATTAATGCTAT TCTGATTC-3Ј 4 199 bp 32 7 W401X LSCFE8Rmod 5Ј-CCCGCAGTTAGGTGTTTAG AGCAAACAA-3Ј 4 18 1249-5AϾG 9 LSCFe9Fmod2 5Ј-CCGCCGCCGGGAATTATTTGAGAA AGCAAAACA-3Ј 8 279 bp 0 3 D443Y LSCFe9Rmod2 5Ј-CCGCCGCGAAAATACCTTCCAG CACTACAAACTAGAAA-3Ј 8 57 A455E 10 LSCF10FmodD 5Ј-CGCCGTTATGGGAGAACTGG AGCCTTCAGAG-3Ј 5 275 bp 0 15 1 F508del LSCF10RmodD 5Ј-CCGCAGACTAACCGATTGAAT ATGGAGCC-3Ј 4 68 E528E 11 h11i5 5Ј-TGCCTTTCAAATTCAGATTGAGC-3Ј 0 197 bp 42 13 2 G542X 11i3ter 5Ј-ACAGCAAATGCTTGCTAGACC-3Ј 0 17 G551D 12 LSCFE12Fmod 5Ј-CGCGTCATCTACACTAGATGACCAG-3Ј 4 244 bp 43 15 G576A 1898 ϩ 1GϾALSCFE12Rmod 5Ј-CCGGAGGTAAAATGCAATCTATGATG-3Ј 3 63 13 LSCF13AFmod 5Ј-CCGCCGCCGGAGACATATTG CAATAAAGTAT-3Ј 9 38 20 I601F LSCF13ARmod 5Ј-GCCTGTCCAGGAGACAGGA GCATCTC-3Ј 2 R668C LSCF13BFmod 5Ј-CCGCCGCAATCCTAACTGAG ACCTTACACCG-3Ј 2 R668C LSCF13BRmod 5Ј-CCGCCGATCAGGTTCAGGA CAGACTGC-3Ј 3 346 bp 2184insA LSCF13CFmod 5Ј-CCGCGGTGATCAGCACTGGCCC-3Ј 6 301 bp 77 L749L LSCF13CRmod 5Ј-CCGCGCGCGCGGCCAGTTTCTTG AGATAACCTTCT-3Ј 13 259 bp V754M LSCF13DFmod 5Ј-CGTGTCACTGGCCCCTCAGGC-3Ј 1 221 bp I807M LSCF13DRmof 5Ј-CCGCCGCCGCTAATCCTATGA TTTTAGTAAAT-3Ј 9 220 bp 2622ϩ1GϾA LSCf13FFmod 5Ј-CGCGGTGCAGAAAGAAGAAAT TCAATCCTAACTG-3Ј 4 R668C LSCF13FRmod 5Ј-CCGCCGTGCCATTCATTTGT AAGGGAGTCT-3Ј 6 2184insA 14a LSCF14aFmodB 5Ј-CCGACCACAATGGTGGCAT GAAACTG-3Ј 3 239 bp 35 7 1 T854T LSCF14aRmodB 5Ј-CCGCCGACTTTAAATCCAGTAAT ACTTTACAATAGAACA-3Ј 6 7 W846X 14b LSCF14bFmod 5Ј-CCGGAGGAATAGGTGAAGAT-3Ј 2 179 bp 38 4 2752-5GϾT LSCF14bRmodb 5Ј-CCGTACATACAAACATAGTGGATT-3Ј 3 59 2789ϩ5GϾT 15 LSCFE15Fmod 5Ј-CGCGCCGTGTATTGGAAA TTCAGTAAGTAACTTTGG-3Ј 7 412 bp 33 16 T908S LSCFE15Rmod 5Ј-CCGCAGCCAGCACTGCCAT TAGAAA-3Ј 4 68 S945L (table continues) phisms that we have chosen to exclude. Login to comment
171 Results of CFTR Analysis by HRM on 136 Samples of Patients with Idiopathic Chronic Pancreatitis (ICP) Exon Number of positive samples Mutations identified Variants identified New positive controls 1 14 14 125GϾC 2 1 1 R31C 3 9 1 G85E 7 R75Q 1 R74W 4 4 1 R117G 1 I148T R117G 1 R117H 1 A120T 5 1 1 L188P L188P 6a 5 1 V201M 1 A221A A221A 3 875ϩ40 AϾG 6b 27 1 M284T 26 1001ϩ11CϾT M284T 7 1 1 L320V L320V 8 0 0 9 1 1 D443Y 10 16 8 F508del 8 E528E 11 1 1 G542X 12 6 4 G576A 1 Y577Y L568F 1 L568F 13 7 1 S737F 4 R668C S737F 1 V754M L644L 1 L644L 14a 53 52 T854T T854TϩI853I 1 T854TϩI853I 14b 0 0 15 3 1 L967S T908S 1 T908S 1 S945L 16 0 0 17a 10 7 L997F 1 3271ϩ18CϾT 3271 ϩ 3AϾG 1 3271 ϩ 3 AϾG 1 Y1014C 17b 3 1 L1096L L1096L 1 H1054DϩG1069R 1 3272-33AϾG H1054DϩG1069R 3272-33AϾG 18 2 1 D1152H E1124del 1 E1124del 19 5 5 S1235R poly 20 7 1 W1282X 5 P1290P 1 D1270N 21 2 1 N1303K 1 T1299T 22 0 0 23 1 0 4374ϩ13 AϾG 24 43 40 Q1463Q 2 Y1424Y 1 Q1463QϩY1024Y ing domain of a gene brings an excellent sensitivity for heterozygote detection that is very close to 100%. Login to comment

[hide] Analysis of the CFTR gene in Iranian cystic fibros... J Cyst Fibros. 2008 Mar;7(2):102-9. Epub 2007 Jul 27. Alibakhshi R, Kianishirazi R, Cassiman JJ, Zamani M, Cuppens H
Analysis of the CFTR gene in Iranian cystic fibrosis patients: identification of eight novel mutations.
J Cyst Fibros. 2008 Mar;7(2):102-9. Epub 2007 Jul 27., [PMID:17662673]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most common inherited disorder in Caucasian populations, with over 1400 mutations identified in the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene. Mutations in the CFTR gene may be also causative for CBAVD (Congenital Bilateral Absence of the Vas Deferens). The type and distribution of mutations varies widely between different countries and/or ethnic groups, and is relatively unknown in Iran. We therefore performed a comprehensive analysis of the CFTR gene in Iranian CF patients. METHODS: 69 Iranian CF patients, and 1 CBAVD patient, were analysed for mutations in the complete coding region, and its exon/intron junctions, of their CFTR genes, using different methods, such as ARMS (amplification refractory mutation system)-PCR, SSCP (single stranded conformation polymorphism) analysis, restriction enzyme digestion analysis, direct sequencing, and MLPA (Multiplex Ligation-mediated Probe Amplification). RESULTS: CFTR mutation analysis revealed the identification of 37 mutations in 69 Iranian CF patients. Overall, 81.9% (113/138) CFTR genes derived from Iranian CF patients could be characterized for a disease-causing mutation. The CBAVD patient was found to be homozygous for the p.W1145R mutation. The most common mutations were p.F508del (DeltaF508) (18.1%), c.2183_2184delAAinsG (2183AA>G) (6.5%), p.S466X (5.8%), p.N1303K (4.3%), c.2789+5G>A (4.3%), p.G542X (3.6%), c.3120+1G>A (3.6%), p.R334W (2.9%) and c.3130delA (2.9%). These 9 types of mutant CFTR genes totaled for 52% of all CFTR genes derived from the 69 Iranian CF patients. Eight mutations, c.406-8T>C, p.A566D, c.2576delA, c.2752-1_2756delGGTGGCinsTTG, p.T1036I, p.W1145R, c.3850-24G>A, c.1342-?_1524+?del, were found for the first time in this study. CONCLUSIONS: We identified 37 CFTR mutations in 69 well characterized Iranian CF patients, obtaining a CFTR mutation detection rate of 81.9%, the highest detection rate obtained in the Iranian population so far. These findings will assist in genetic counseling, prenatal diagnosis and future screening of CF in Iran.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 1 c.406-3TNC I3 T to C at 406-3 mRNA splicing defect 1 p.R170H E5 G to A at 641 Arg to His at 170 1 p.D192G E5 A to G at 707 Asp to Gly at 192 2 p.R334W E7 C to T at 1132 Arg to Trp at 334 4 c.1525-1GNA I9 G to A at 1525-1 mRNA splicing defect 2 p.F508del E10 Deletion of CTT from 1653 Deletion of Phe at 508 25 p.S466X E10 C to G at 1529 Ser to stop at 466 8 c.1677delTA E10 Deletion of TA from 1677 Frame shift 2 p.G542X E11 G to T at 1756 Gly to stop at 542 5 p.S549R E11 T to G at 1779 Ser to Arg at 549 2 p.A566D E12 C to A at 1829 Ala to Asp at 566 2 c.1898+1GNT I12 G→T at 1898+1 mRNA splicing defect 2 c.2183_2184delAAinsG E13 A to G at 2183 and deletion of A at 2184 Frame shift 9 c.2576delA E13 Deletion of A at 2576 Frame shift 1 c.2043delG E13 Deletion of A at 2043 Frame shift 1 c.2184insA E13 Insertion of A after 2184 Frame shift 1 p.R785X E13 C to T at 2485 Arg to stop at 785 2 c.2752-1_2756delGGTGGCinsTTG I14a/ Deletion of GGTGGC mRNA splicing defect 2 E14b From 2752-1 to 2756 and insertion TTG c.2789+5GNA I14b G to A at 2789+5 mRNA splicing defect 6 p.S945L E15 C to Tat 2966 Ser to Leu at 945 2 c.3120+1GNA I16 G to A at 3120+1 mRNA splicing defect 5 c.3121-1GNA I16 G to A at 3121-1 mRNA splicing defect 2 c.3130delA E17a Deletion of A at 3130 Frame shift 4 p.T1036I E17a C to T at 3239 Thr to Ile at 1036 1 p.R1066C E17b C to T at 3328 Arg to Cys at 1066 1 p.L1077P E17b T to C at 3362 Leu to Pro at 1077 1 p.T1086I E17b C to T at 3389 Thr to Ile at 1086 1 p.R1162X E19 C to T at 3616 Arg to stop at 1162 2 p.K1177X E19 A to T at 3361 Lys to stop at 1177 2 c.3850-24GNA I19 G to A at 3850-24 mRNA splicing defect? Login to comment
66 Results A total of 69 unrelated CF patients (38 male and 31 female; aged between 2 months and 15 years) of Iranian Table 2 Genotype of CFTR genes in 53 Iranian patients Genotype Exon/intron Number of patients p.F508del/p.F508del E10/E10 10 p.F508del/p.R1162X E10/E19 2 p.F508del/p.T1036I E10/E17a 1 p.F508del/p.R1066C E10/E17b 1 p.F508del/c.1342-?_1524+?del E10/E9 1 p.S466X/p.S466X E10/E10 4 c.2183_2184delAAinsG/ c.2183_2184delAAinsG E13/E13 4 c.2183_2184delAAinsG/c.186- ?_296+?del E13/E2 1 p.N1303K/p.N1303K E21/E21 2 p.N1303K/p.S945L E21/E15 1 p.N1303K/c.1677delTA E21/E10 1 p.G542X/p.G542X E11/E11 2 p.G542X/c.2789+5GNA E11/I14b 1 c.3120+1GNA/c.3120+1GNA I16/I16 2 c.3120+1GNA/c.3121-1GNA I16 1 c.3121-1GNA/p.T1086I I16/E17b 1 c.3130delA/c.3130delA E17a/E17a 2 p.D192G/p.D192G E5/E5 1 p.R334W/p.R334W E7/E7 1 p.R334W/p.S945L E7/E15 1 p.R334W/p.L1077P E7/E17b 1 c.1525-1GNA/c.1525-1GNA I9/I9 1 p.S549R/p.S549R E11/E11 1 p.A566D/p.A566D E12/E12 1 c.1898+1GNT/c.1898+1GNT I12/I12 1 c.2576delA/p.S1455X/ E13/E24 1 c.2184insA/c.1677delTA E10/E13 1 p.R785X/p.R785X E13/E13 1 c.2752-1_2756delGGTGGCinsTTG/ c.2752-1_2756delGGTGGCinsTTG I14a/E14b 1 c.2789+5GNA/c.2789+5GNA I14b/I14b 1 p.K1177X/p.K1177X E19/E19 1 c.406-?_1716+?del/c.406-?_1716+?del E4-E10/E4-E10 1 Total 53 origin were extensively studied for the presence of mutations in the CFTR gene, for the presence of the deep intronic 3849+10 kbC→T mutation, and large deletions/ duplications. Login to comment
65 Results A total of 69 unrelated CF patients (38 male and 31 female; aged between 2 months and 15 years) of Iranian Table 2 Genotype of CFTR genes in 53 Iranian patients Genotype Exon/intron Number of patients p.F508del/p.F508del E10/E10 10 p.F508del/p.R1162X E10/E19 2 p.F508del/p.T1036I E10/E17a 1 p.F508del/p.R1066C E10/E17b 1 p.F508del/c.1342-?_1524+?del E10/E9 1 p.S466X/p.S466X E10/E10 4 c.2183_2184delAAinsG/ c.2183_2184delAAinsG E13/E13 4 c.2183_2184delAAinsG/c.186- ?_296+?del E13/E2 1 p.N1303K/p.N1303K E21/E21 2 p.N1303K/p.S945L E21/E15 1 p.N1303K/c.1677delTA E21/E10 1 p.G542X/p.G542X E11/E11 2 p.G542X/c.2789+5GNA E11/I14b 1 c.3120+1GNA/c.3120+1GNA I16/I16 2 c.3120+1GNA/c.3121-1GNA I16 1 c.3121-1GNA/p.T1086I I16/E17b 1 c.3130delA/c.3130delA E17a/E17a 2 p.D192G/p.D192G E5/E5 1 p.R334W/p.R334W E7/E7 1 p.R334W/p.S945L E7/E15 1 p.R334W/p.L1077P E7/E17b 1 c.1525-1GNA/c.1525-1GNA I9/I9 1 p.S549R/p.S549R E11/E11 1 p.A566D/p.A566D E12/E12 1 c.1898+1GNT/c.1898+1GNT I12/I12 1 c.2576delA/p.S1455X/ E13/E24 1 c.2184insA/c.1677delTA E10/E13 1 p.R785X/p.R785X E13/E13 1 c.2752-1_2756delGGTGGCinsTTG/ c.2752-1_2756delGGTGGCinsTTG I14a/E14b 1 c.2789+5GNA/c.2789+5GNA I14b/I14b 1 p.K1177X/p.K1177X E19/E19 1 c.406-?_1716+?del/c.406-?_1716+?del E4-E10/E4-E10 1 Total 53 origin were extensively studied for the presence of mutations in the CFTR gene, for the presence of the deep intronic 3849+10 kbC࢐T mutation, and large deletions/ duplications. Login to comment

[hide] Spectrum of mutations in CFTR in Finland: 18 years... J Cyst Fibros. 2005 Dec;4(4):233-7. Epub 2005 Jul 26. Kinnunen S, Bonache S, Casals T, Monto S, Savilahti E, Kere J, Jarvela I
Spectrum of mutations in CFTR in Finland: 18 years follow-up study and identification of two novel mutations.
J Cyst Fibros. 2005 Dec;4(4):233-7. Epub 2005 Jul 26., [PMID:16051530]

Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) is low in the isolated Finnish population and the Finnish CF mutation spectrum has differed from many European countries. METHODS: We have analyzed the mutation spectrum and the geographical distribution of CF mutations in Finland covering the last 18 years (1987-2004). RESULTS: A total of 14 mutations were identified; two of them new, 774insT and S589T (G>C at 1,898). The overall coverage of mutations was 97% (99/102 chromosomes). The most frequent mutations were F508del and 394delTT, found in 36% (37/102) and 35% (36/102) of the CF chromosomes respectively. Of the rare mutations, a mutation of presumable Slavic origin, CFTRdele2.3 (21 kb), was enriched in a rural isolate with a frequency of 5,9% (6/102), and a mutation that possibly indicates Swedish influence, 3659delC, was scattered throughout the country with a similar frequency of 5,9% (6/102). G542X, R1162X, R117H, 3732delA, 1,898 + 3A >C, S1196X, S945L, W57R, 774insT and S589T were each identified in a number of chromosomes from one to three. CONCLUSIONS: Our observations of the Finnish CF mutation spectrum fit well with the characteristics of Finland as a population of multiple local founder effects.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 G542X, R1162X, R117H, 3732delA, 1898+3A>C, S1196X, S945L, W57R, 774insT and S589T were each identified in a number of chromosomes from one to three. Login to comment
94 394delTT has been suggested to have a Table 1 Spectrum of CFTR mutations in Finland Mutation Recommended nomenclature/nucleotide Recommended nomenclature/protein Exon/Intron N % F508del c.1520_1522delTCT p.Phe508del E 10 37 36 394delTT c.262_263delTT p.Leu88fs E 3 36 35 CFTRdele2,3(21kb) E2 and E3 6 5.9 3659delC c.3528delC p.Lys1177fs E 19 6 5.9 1898+3A>C c.1766+3A>C I 12 3 2.9 R117H c.350G>A p.Arg117His E 4 2 2 S945L c.2834C>T p.Ser945Leu E 15 2 2 W57R c.169T>C p.Trp57Arg E 3 1 1 774insT c.642_643insT p.Ile215fs E 6a 1 1 G542X c.1624G>T p.Gly542X E 11 1 1 S589T c.1766G>C p.Ser589Thr E 12 1 1 R1162X c.3484C>T p.Arg1162X E 19 1 1 S1196X c.3587C>G p.Ser1196X E 19 1 1 3732delA c.3600delA p.Asp1201fs E 19 1 1 Unknown 2.9 Total 102 100 Reference sequence is Genbank NM_000492.2. Login to comment
95 394delTT has been suggested to have a Table 1 Spectrum of CFTR mutations in Finland Mutation Recommended nomenclature/nucleotide Recommended nomenclature/protein Exon/Intron N % F508del c.1520_1522delTCT p.Phe508del E 10 37 36 394delTT c.262_263delTT p.Leu88fs E 3 36 35 CFTRdele2,3(21kb) E2 and E3 6 5.9 3659delC c.3528delC p.Lys1177fs E 19 6 5.9 1898+3A>C c.1766+3A>C I 12 3 2.9 R117H c.350G>A p.Arg117His E 4 2 2 S945L c.2834C>T p.Ser945Leu E 15 2 2 W57R c.169T>C p.Trp57Arg E 3 1 1 774insT c.642_643insT p.Ile215fs E 6a 1 1 G542X c.1624G>T p.Gly542X E 11 1 1 S589T c.1766G>C p.Ser589Thr E 12 1 1 R1162X c.3484C>T p.Arg1162X E 19 1 1 S1196X c.3587C>G p.Ser1196X E 19 1 1 3732delA c.3600delA p.Asp1201fs E 19 1 1 Unknown 3 2.9 Total 102 100 Reference sequence is Genbank NM_000492.2. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
73 Genomic DNA Samples Used for Mutation Evaluation on the APEX Array Mutations validated with native DNA CFTRdel 2,3 (21 kb) 394delTT G85E R75X 574delA Y122X R117C R117H 621 ϩ 1GϾT 621 ϩ 3AϾG 711 ϩ 1GϾT I336K R334W R347P IVS8-5T IVS8-7T IVS8-9T A455E ⌬F508 ⌬I507 1677delTA 1717 - 1GϾA G542X G551D R553X R560T S549N 1898 ϩ 1GϾA 1898 ϩ 1GϾC 2183AAϾG 2043delG R668C 2143delT 2184delA 2184insA 2789 ϩ 5GϾA S945L 3120 ϩ 1GϾA I1005R 3272 - 26AϾG R1066C G1069R Y1092X (CϾA) 3500 - 2AϾT R1158X R1162X 3659delC S1235R 3849 ϩ 10 kb CϾT W1282X primer. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 Table 1. Continued Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) R1070W 1 0.55 0.19 R1158X 1 0.55 0.19 R1438W 1 0.55 0.19 R334W 2 1.09 0.39 R352W 1 0.55 0.19 R553X 2 1.09 0.39 R668C 2 1.09 0.39 R74W 3 1.64 0.58 R75X 3 1.64 0.58 S1235R 2 1.09 0.39 S492F 2 1.09 0.39 S549N 1 0.55 0.19 S573CS573C 1 0.55 0.19 S945L 1 0.55 0.19 T351S 1 0.55 0.19 T501A 2 1.09 0.39 T604ST604S 1 0.55 0.19 V11I 1 0.55 0.19 V201 mol/L 1 0.55 0.19 V232D 2 1.09 0.39 V754 mol/L 1 0.55 0.19 W1089X 2 1.09 0.39 W1098C 1 0.55 0.19 W1204X 4 2.19 0.78 Y563N 1 0.55 0.19 Y913XY913X 1 0.55 0.19 85 different mutations 183 100.00 35.60 Novel variants are in boldface, mutations on the ACMG/ACOG panel are italicized. Login to comment
186 Table 3. Continued CFTR mutations Alleles Relative mutation frequency (%) (of 317) G567A 1 Ͻ1 S573C 1 Ͻ1 E585X 1 Ͻ1 T604S 1 Ͻ1 F693L 1 Ͻ1 V754 mol/L 1 Ͻ1 2108delA 1 Ͻ1 2184delA 1 Ͻ1 2215insG 1 Ͻ1 2585delT 1 Ͻ1 2752 - 6TϾC 1 Ͻ1 E831X 1 Ͻ1 D836Y 1 Ͻ1 Y913X 1 Ͻ1 S945L 1 Ͻ1 L967S 1 Ͻ1 3171delC 1 Ͻ1 3199del6 1 Ͻ1 3271 ϩ 8AϾG 1 Ͻ1 R1066H 1 Ͻ1 R1070W 1 Ͻ1 Y1092X 1 Ͻ1 W1098C 1 Ͻ1 3500 - 2AϾT 1 Ͻ1 4016insT 1 Ͻ1 4374 ϩ 13AϾG 1 Ͻ1 D1152H 1 Ͻ1 R1158X 1 Ͻ1 R1162X 1 Ͻ1 W1282X 1 Ͻ1 N1303K 1 Ͻ1 Q1313X 1 Ͻ1 P1372L 1 Ͻ1 R1438W 1 Ͻ1 Total 317 100 Table 3. Login to comment

[hide] High heterogeneity of CFTR mutations and unexpecte... J Cyst Fibros. 2004 Dec;3(4):265-72. des Georges M, Guittard C, Altieri JP, Templin C, Sarles J, Sarda P, Claustres M
High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France.
J Cyst Fibros. 2004 Dec;3(4):265-72., [PMID:15698946]

Abstract [show]
In this report, we present updated spectrum and frequency of mutations of the CFTR gene that are responsible for cystic fibrosis (CF) in Languedoc-Roussillon (L-R), the southwestern part of France. A total of 75 different mutations were identified by DGGE in 215 families, accounting for 97.6% of CF genes and generating 88 different mutational genotypes. The frequency of p.F508del was 60.23% in L-R versus 67.18% in the whole country and only five other mutations (p.G542X, p.N1303K, p.R334W, c.1717-1G>A, c.711+1G>T) had a frequency higher than 1%. The mutations were scattered over 20 exons or their border. This sample representing only 5.7% of French CF patients contributed to 24% of CFTR mutations reported in France. This is one of the highest molecular allelic heterogeneity reported so far in CF. We also present the result of a neonatal screening program based on a two-tiered approach "IRT/20 mutations/IRT" analysis on blood spots, implemented in France with the aim to improve survival and quality of life of patients diagnosed before clinical onset. This 18-month pilot project showed an unexpected low incidence of CF (1/8885) in South of France, with only six CF children detected among 43,489 neonates born in L-R, and 13 among 125,339 neonates born in Provence-Alpes-Cote-d'Azur (PACA).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 of chromosomes (frequency %) p.M1V 1 1 (0.23) p.M1K 1 1 (0.23) c.300delA 3 1 (0.23) p.P67L 3 1 (0.23) c.359insT 3 1 (0.23) p.G85E 3 3 (0.70) c.394delTT 3 1 (0.23) p.Q98R 4 1 (0.23) p.R117H 4 2 (0.47) p.Y122X 4 2 (0.47) p.Y161N 4 1 (0.23) c.621+1GNT intron 4 1 (0.23) c.621+2TNG intron 4 1 (0.23) p.I175V 5 2 (0.47) c.711+1GNT intron 5 5 (1.16) p.L206W 6 3 (0.70) p.Q220X 6 1 (0.23) p.L227R 6 1 (0.23) c.1078delT 7 2 (0.47) p.R334W 7 7 (1.63) p.R347P 7 2 (0.47) c.1215delG 7 1 (0.23) c.T5 intron 8 1 (0.23) p.D443Y 9 1 (0.23) p.I506T 10 1 (0.23) p.I507del 10 4 (0.93) p.F508del 10 259 (60.23) p.F508C 10 1 (0.23) c.1677delTA 10 1 (0.23) c.1717-8GNA intron 10 1 (0.23) c.1717-1GNA intron 10 6 (1.40) p.G542X 11 23 (5.35) p.S549R 11 1 (0.23) p.G551D 11 2 (0.47) p.R553X 11 1 (0.23) c1811+1.6kbANG intron 11 4 (0.93) c.1812-1GNA intron 11 1 (0.23) p.T582I 12 1 (0.23) p.E585X 12 2 (0,47) c.1898+1GNA intron 12 1 (0.23) [c.1898+5GNA ;p.E725K] intron 12 1 (0.23) c.1898+73TNG intron 12 1 (0.23) c.2183AANG 13 4 (0.93) c.2184insA 13 1 (0.23) p.K710X 13 4 (0.93) c.2423delG 13 1 (0.23) p.S776X 13 1 (0.23) c.2493ins8 13 1 (0.23) p.R792X 13 1 (0.23) p.K830X 13 1 (0.23) p.D836Y 14a 1 (0.23) p.W846X1 14a 1 (0.23) c.2711delT 14a 1 (0.23) c.2789+5GNA intron 14b 3 (0.70) p.S945L 15 3 (0.70) p.D993Y 16 1 (0.23) c.3129del4 17a 1 (0.23) c.3195del6 17a 1 (0.23) c.3272-26ANG intron 17a 1 (0.23) [c.3395insA ;pI148T] 17b/4 1 (0,23) p.Y1092X 17b 3 (0.70) Table 1 (continued) Mutation Location exon/intron No. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 b 3905insT, 1811+1.6kbA>G, S945L, S1251N, Y122X, 2711delT, R117H, E60X, 2184insA, E585X, L558S, S1235R, D1152H, K710X, Q493X, A455E, G178R, I148T, 574delA. Login to comment
140 Non-F508del Mutations Found as Homozygous in a Sample of 3,710 Patients With Cystic Fibrosis Mutation n 711+1G>T 8 G542X 7 N1303K 7 2183delAA>G 5 W1282X 4 G551D 3 3905insT 3 R334W 2 R347P 2 1078delT 2 1811+1.6kbA>G 2 2113delA 2 Y1092X 2 R1162X 2 306insA 1 E92K 1 G178R 1 L227R 1 1677delTA 1 1717-1G>A 1 1717-8G>A 1 R553X 1 S549R(T>G) 1 R560S 1 V562I 1 Y569D 1 2711delT 1 S945L 1 R1158X 1 I1234V 1 3849+10kbC>T 1 Q1313X 1 del25kb 1 E831X 1 I175V 1 G314V 1 L1077P 1 produce a small quantity of functional protein as a result of a variable proportion of normal CFTR mRNA transcripts in addition to the abnormal ones (class V); 3) they are located in sites known to generate less severe mutants (external loops, residues lining the pore); and/or 4) they have been observed in CF with pancreatic sufficiency, CBAVD, and/or CF-related attenuated phenotypes only. Login to comment

[hide] Rapid characterization of the variable length poly... Hum Mutat. 1997;10(2):108-15. Friedman KJ, Heim RA, Knowles MR, Silverman LM
Rapid characterization of the variable length polythymidine tract in the cystic fibrosis (CFTR) gene: association of the 5T allele with selected CFTR mutations and its incidence in atypical sinopulmonary disease.
Hum Mutat. 1997;10(2):108-15., [PMID:9259194]

Abstract [show]
The CFTR intron 8 variable length polythymidine tract modulates the cystic fibrosis (CF) phenotype associated with the mutation R117H. To explore whether other mutations reside on multiple intron 8 backgrounds with discernible impacts on phenotype, we developed an allele-specific PCR assay to characterize this locus. Our approach types samples rapidly without the use or radioisotopes. Polythymidine alleles were identified for mutations either associated with a wide range of clinical phenotypes (R117H, R347P, G85E, D1152H, R334W, 2789 + 5 G > A, 3849 + 10kb C > T), and/or located at hypermutable CpG loci (R117H, 3845 + 10kb C > T, R553X, R334W, S945L and R75Q). R117H was detected in cis with each of three alleles (5T, 7T, 9T) at the intron 8 locus. The novel R117H-9T association was detected in a 10-month African-American male with borderline-to-mildly elevated sweat chloride values (approximately 50-66 mEq/L). All other mutations studied were associated with 7T except 3849 + 10kb C > T, which was detected on both 7T and 9T backgrounds, but not 5T. Three individuals with a delta F508/3849 + 10kb C > T genotype were 9T,9T and had pancreatic sufficiency and normal sweat chloride values, whereas 15 others who carried 3849 + 10kb C > T on a 7T background had variable pancreatic function (sufficient, n = 12, insufficient, n = 3), and variable sweat chloride values (normal, n = 12, elevated, n = 3). Surprisingly, when not associated with known CFTR mutations, 5T was detected with elevated frequency among individuals with sinopulmonary disease of ill-defined etiology, but with some characteristics of variant CF. In summary, the 5T allele was not found in cis with CF-causing mutations besides R117H, but an elevated 5T allele frequency in variant CF patients suggests 5T may be associated with disease in some situations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Polythymidine alleles were identified for mutations either associated with a wide range of clinical phenotypes (R117H, R347P, G85E, D1152H, R334W, 2789+5 G>A, 3849+10kb C>T), and/or located at hypermutable CpG loci (R117H, 3849+10kb C>T, R553X, R334W, S945L and R75Q). Login to comment
37 We report the development of a rapid, nonisotopic assay that facilitates typing of this locus and utilize it to explore the role of the polythymidine tract alleles in thepathogenesisofCF.Mutationsassociatedwithclini- calheterogeneity(R347P,G85E,D1152H,R334W,and 3849 + 10kb C>T) and/or occurring at hypermutable loci (3849 + 10kb C>T, R334W, S945L, R553X, and R75Q) were analyzed for their association with different intron 8 alleles in CF and atypical patients. Login to comment
39 Mutation screening was performed for R553X (Cutting et al., 1990), R334W (Gasparini et al., 1991), G85E (Zielenski et al., 1991a), S945L (Claustres et al., 1993), 3849 + 10kb C>T (Highsmith et al., 1994), R117H and R347P (Dean et al., 1990), 2789+5G>A (Highsmith et al., 1997), D1152H (Highsmith, per. Login to comment
43 For R553X, G85E, S945L, 3849 + 10KB C>T, and R334W, the digested samples were electrophoresed at 100 V for 2 hr in 4% agarose gels (3:1 Nusieve: SeaKem, FMC Bioproducts, Rockland, ME). Login to comment
94 Association of Selected CFTR Mutations with Intron 8 Polythymidine Alleles Chromosomes In cis with In cis with In cis with Mutation Site CpG locus 5T 7T 9T R75Qa EXON 3 Y 0 8 0 G85E EXON 3 N 0 5 0 R117H EXON 4 Y 8 5 1 R334W EXON 7 Y 0 4 0 R347P EXON 7 N 0 7 0 R553X EXON 11 Y 0 7 0 2789+5 G>A INTRON 14B N 0 5 0 S945L EXON 15 Y 0 3 0 D1152H EXON 18 N 0 7 0 3849+10kb C>T INTRON 19 Y 0 15 2 a Sequence variant. Login to comment

[hide] SSCP analysis: a blind sensitivity trial. Hum Mutat. 1997;10(1):65-70. Jordanova A, Kalaydjieva L, Savov A, Claustres M, Schwarz M, Estivill X, Angelicheva D, Haworth A, Casals T, Kremensky I
SSCP analysis: a blind sensitivity trial.
Hum Mutat. 1997;10(1):65-70., [PMID:9222762]

Abstract [show]
Studies of the sensitivity of SSCP analysis usually have been performed under conditions contrary to the rules of quality control trials and have produced widely different results. We have performed a blind trial of the sensitivity of SSCP analysis for the detection of mutations in fragments up to 500 bp in length under a fixed single set of electrophoretic conditions. The mutation detection rate was 84%. In addition, we have identified a second mutation in nine samples. All these mutations are polymorphisms, including a novel polymorphism 1248 + 52T/C first reported in the present work.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment
89 Mutations detected by the referring laboratories using SSCP analysis. This group included mutations 621+1(G→T), 621+2(T→G), Y122X, G551D, and S945L. Login to comment
90 They had been detected after preliminary restriction digestion (mutations G551D and S945L) or under two different SSCP conditions (mutations 621+1(G→T), 621+2(T→G) and Y122X) (see Table 1). Login to comment

[hide] Cytoplasmic loop three of cystic fibrosis transmem... J Biol Chem. 1996 Nov 1;271(44):27493-9. Seibert FS, Linsdell P, Loo TW, Hanrahan JW, Riordan JR, Clarke DM
Cytoplasmic loop three of cystic fibrosis transmembrane conductance regulator contributes to regulation of chloride channel activity.
J Biol Chem. 1996 Nov 1;271(44):27493-9., [PMID:8910333]

Abstract [show]
To examine the contribution of the large cytoplasmic loops of the cystic fibrosis transmembrane conductance regulator (CFTR) to channel activity, the three point-mutations (S945L, H949Y, G970R) were characterized that have been detected in the third cytoplasmic loop (CL3, residues 933-990) in patients with cystic fibrosis. Chinese hamster ovary cell lines stably expressing wild-type CFTR or mutant G970R-CFTR yielded polypeptides with apparent masses of 170 kDa as the major products, whereas the major products of mutants S945L-CFTR and H949Y-CFTR had apparent masses of 150 kDa. The 150-kDa forms of CFTR were sensitive to endoglycosidase H digestion, indicating that these mutations interfered with maturation of the protein. Increased levels of mature CFTR (170 kDa) could be obtained for mutant H949Y when cells were grown at a lower temperature (26 degrees C) or incubated in the presence of 10% glycerol. For all mutants, the open probability (P0) of the CFTR channels was significantly altered. S945L-CFTR and G970R-CFTR showed a severe reduction in the P0, whereas the H949Y mutation doubled the P0 relative to wild-type. The changes in P0 predominantly resulted from an alteration of the mean burst durations which suggests that CL3 is involved in obtaining and/or maintaining stability of the open state. In addition, mutants S945L and G970R had current-voltage relationships that were not completely linear over the range +/-80 mV, but showed slight outward rectification. The fact that CL3 mutations can have subtle effects on channel conductance indicates that this region may be physically close to the inner mouth of the pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Cytoplasmic Loop Three of Cystic Fibrosis Transmembrane Conductance Regulator Contributes to Regulation of Chloride Channel Activity* (Received for publication, May 3, 1996, and in revised form, August 22, 1996) Fabian S. Seibert‡, Paul Linsdell§¶, Tip W. Loo, John W. Hanrahan§ʈ, John R. Riordan**‡‡, and David M. Clarke§§ From the Medical Research Council Group in Membrane Biology, Departments of Medicine and Biochemistry, University of Toronto, Toronto, Ontario, Canada, M5S 1A8, the §Department of Physiology, McGill University, Montreal, Quebec, Canada, H3G 1Y6, and the **Mayo Graduate School of Medicine and Department of Biochemistry and Molecular Biology, S. C. Johnson Medical Research Center, Mayo Clinic Scottsdale, Scottsdale, Arizona 85259 To examine the contribution of the large cytoplasmic loops of the cystic fibrosis transmembrane conductance regulator (CFTR) to channel activity, the three point-mutations (S945L, H949Y, G970R) were characterized that have been detected in the third cytoplasmic loop (CL3, residues 933-990) in patients with cystic fibrosis. Login to comment
1 Chinese hamster ovary cell lines stably expressing wild-type CFTR or mutant G970R-CFTR yielded polypeptides with apparent masses of 170 kDa as the major products, whereas the major products of mutants S945L-CFTR and H949Y-CFTR had apparent masses of 150 kDa. Login to comment
5 S945L-CFTR and G970R-CFTR showed a severe reduction in the P0, whereas the H949Y mutation doubled the P0 relative to wild-type. Login to comment
7 In addition, mutants S945L and G970R had current-voltage relationships that were not completely linear over the range ؎80 mV, but showed slight outward rectification. Login to comment
35 The aim of the present study was to examine the functional significance of a previously uninvestigated domain, CL3 (predicted residues: 933-990, connecting TMs 8 and 9 of CFTR; Fig. 1), by characterizing the three different point-mutations that have been identified in CL3 from patients with CF (S945L (Claustres et al., 1993), H949Y (Ghanem et al., 1994), and G970R (Cuppens et al., 1993)). Login to comment
54 Western blotting with the CFTR-specific monoclonal antibody M3A7 (Kartner et al., 1992) demonstrated that wild-type and G970R-mutant CFTRs yielded fully mature protein (170 kDa, band C) as the major product, whereas mutants S945L and H949Y yielded little of the mature form (Fig. 2). Login to comment
58 These findings indicate that the S945L and H949Y mutations cause a defect in the biosynthetic processing pathways of CFTR maturation. Login to comment
62 In comparison to a control sample which remained at 37 °C without glycerol, it was observed that for the severely affected mutant S945L these procedures did not improve maturation of CFTR. Login to comment
68 Very little stimulation occurred in cells expressing S945L-CFTR in agreement with the severe inhibition of protein maturation described above. Login to comment
116 For each mutant, however, the level of channel activity was clearly different from wild-type CFTR (Fig. 7); both S945L and G970R channels showed a lower level of activity than wild-type, while for H949Y-CFTR activity appeared to be higher than wild-type. Login to comment
117 This was confirmed by channel mean open probability (P0) measurements; S945L-CFTR and G970R-CFTR had significantly lower mean P0 values than wild-type channels, and the mean P0 of H949Y channels was significantly greater than observed for wild-type (Fig. 8A). Login to comment
118 Analysis of channel burst kinetics indicated that for each mutant the alteration in P0 was mainly the result of a change in open burst duration (Fig. 8B), with a smaller change in interburst duration also contributing to the reduced P0 seen in S945L (Fig. 8C). Login to comment
122 Both S945L and G970R mutants, however, had I-V relationships which were not completely linear over this voltage range, but instead showed slight outward rectification (Fig. 9, A and C). Login to comment
123 In S945L-CFTR, this outward rectification was due to a significant reduction in current at negative membrane potentials compared to the wild-type channel (Fig. 9, A and D), while in G970R outward rectification resulted from increased current at positive potentials (Fig. 9, C and D). Login to comment
125 The reasons for the outward rectification seen in both S945L and G970R are unclear; however, the fact that CL3 mutations can have subtle effects on channel conductance suggests that this region may be physically located close to the inner mouth of the CFTR chloride channel pore. Login to comment
128 The most striking effect due to the amino acid substitutions was a drastically altered P0 of the mutant CFTRs relative to wild-type CFTR, with S945L and G970R decreasing the P0 of the channel and H949Y doubling its P0. Login to comment
131 Within the framework of this model, the altered duration of the open state observed in the present study indicates that mutations in CL3 can affect events at NBF2 or affect communication from NBF2 to the pore. Mutations within CL3 can have opposite effects of either prolonging (H949Y) or dramatically decreasing (S945L, G970R) the duration of the open state. Login to comment
145 tances due to mutations S945L and G970R show that mutagenesis of residues in CL3 has a subtle influence on pore properties, suggesting that CL3 may contribute to a region around the inner mouth of the pore. Login to comment
161 Examples of wild-type, S945L, H949Y, and G970R CFTR channel currents recorded from inside-out patches at a membrane potential of -30 mV. Login to comment
34 The aim of the present study was to examine the functional significance of a previously uninvestigated domain, CL3 (predicted residues: 933-990, connecting TMs 8 and 9 of CFTR; Fig. 1), by characterizing the three different point-mutations that have been identified in CL3 from patients with CF (S945L (Claustres et al., 1993), H949Y (Ghanem et al., 1994), and G970R (Cuppens et al., 1993)). Login to comment

[hide] Screening Young syndrome patients for CFTR mutatio... Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7. Friedman KJ, Teichtahl H, De Kretser DM, Temple-Smith P, Southwick GJ, Silverman LM, Highsmith WE Jr, Boucher RC, Knowles MR
Screening Young syndrome patients for CFTR mutations.
Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7., [PMID:7551394]

Abstract [show]
Young syndrome is characterized by obstructive azoospermia associated with chronic sinobronchial disease of an infectious nature, but normal sweat-gland and pancreatic function as well as normal nasal potential differences. Congenital bilateral absence of the vas deferens (CBAVD) in some patients arises from mutations within the cystic fibrosis (CF) transmembrane regulator (CFTR) gene. Because of some similarities between Young syndrome, CF, and CBAVD, we evaluated 13 patients with Young syndrome, including screening for more than 30 different mutations within the CFTR gene. The mean age of the patients was 43 yr (range, 32 to 50 yr), and all were of northern European extraction. The sweat chloride concentration was normal in all patients (mean = 29 mEq/L; range, 8 to 43 mEq/L). Most had intermittent bronchial and sinus infections, but none was chronically colonized with Staphylococcus aureus or Pseudomonas aeruginosa. The FEV1 was normal or only mildly reduced in most patients (mean = 74%; range, 48 to 100% predicted). Of 26 Young syndrome chromosomes, we identified one with the recognized CF mutation delta F508. The incidence of CFTR mutations (1 in 26) did not differ significantly from the expected carrier frequency in this population. In summary, it is unlikely that the typical Young syndrome patient has a clinical disease associated with CFTR mutation on both alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No. Login to comment

[hide] Association of pancreatic adenocarcinoma, mild lun... Clin Chem. 1994 Oct;40(10):1972-4. Tsongalis GJ, Faber G, Dalldorf FG, Friedman KJ, Silverman LM, Yankaskas JR
Association of pancreatic adenocarcinoma, mild lung disease, and delta F508 mutation in a cystic fibrosis patient.
Clin Chem. 1994 Oct;40(10):1972-4., [PMID:7522998]

Abstract [show]
A case of adenocarcinoma of the pancreas and mild lung disease in a 39-year-old man homozygous for the delta F508 cystic fibrosis mutation is presented. Cystic fibrosis is the most common lethal genetic disease in Caucasians, and is most commonly associated with severe obstructive lung disease. To our knowledge, this is only the fifth case of adenocarcinoma of the pancreas in a CF patient to be reported and the first case for which molecular data are available. The rare incidence of this type of malignancy in the general population suggests a possible association of CF with this malignant disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 CorrelatIon of phenotype and genotype of CFTR mutations Key phenotypic Lung disease SweatC1 Exocnne pancreas function Vasdeferens Associated CFTR mutations Pancreatic InsuffIcIent Pancreatic sufficient Normalsweat C1 Severe Less severe Relatively mild Elevated Elevated Normal Insufficient Sufficient Sufficient Absent Absent Absent SF508, G542X, R553X, G5510, Ni 303K, Wi 282X, RI 17H, and others 2789 + 5G>A, R117H, R334W, R347P, A455E, P574H, S945L, G85E, and others G551S, R117H, 3849 + 10kb C>T, and others Congenitalabsence of the vas deferens None Normal or elevated Sufficient Absent F508C, Ri 17H, Di D1152H, and others FIg. 2. Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment

[hide] Analysis of the 27 exons and flanking regions of t... Hum Mol Genet. 1993 Aug;2(8):1209-13. Claustres M, Laussel M, Desgeorges M, Giansily M, Culard JF, Razakatsara G, Demaille J
Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France.
Hum Mol Genet. 1993 Aug;2(8):1209-13., [PMID:7691344]

Abstract [show]
In order to characterize the non-delta F508 mutations that account for 36% of cystic fibrosis (CF) chromosomes in Southern France in a sample of 137 patients, we have systematically screened the entire coding region and adjacent sequences of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by the single strand conformation polymorphism (SSCP) technique followed by direct sequencing of the mutant DNAs. We identified 13 novel mutations (9 reported in this paper) and 4 novel rare nucleotide sequence variations. Forty different mutations including delta F508, located in 15 exons, account for only 91.2% of mutants in a population originating from Southern France, in contrast with a recent report on the Celtic population of Brittany demonstrating that 90% of mutations can be detected with only three mutations. We present a very large spectrum of different CF mutations identified in a small geographical area.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation? Login to comment
43 S945L. Login to comment
95 SSCP SSCP Seance C-T- 3032 T or C A T G T S945L T-C- \ C G T Sequence Figure 7. Login to comment
97 Left, identification of mutation S945L and familial segregation analyzed by SSCP (after digestion of PCR fragments by Taql). Login to comment

[hide] Crucial role for phylogenetically conserved cytopl... J Biol Chem. 2013 Aug 2;288(31):22207-18. doi: 10.1074/jbc.M113.476218. Epub 2013 Jun 13. Cheepala SB, Bao J, Nachagari D, Sun D, Wang Y, Zhong TP, Naren AP, Zheng J, Schuetz JD
Crucial role for phylogenetically conserved cytoplasmic loop 3 in ABCC4 protein expression.
J Biol Chem. 2013 Aug 2;288(31):22207-18. doi: 10.1074/jbc.M113.476218. Epub 2013 Jun 13., [PMID:23766510]

Abstract [show]
The ABC transporter ABCC4 is recognized as an ATP-dependent exporter of endogenous substances as well as an increasing variety of anionic chemotherapeutics. A loss-of-function variant of zebrafish Abcc4 was identified with a single amino acid substitution in the cytoplasmic loop T804M. Because this substituted amino acid is highly conserved among ABCC4 orthologs and is located in cytoplasmic loop 3 (CL3), we investigated the impact of this mutation on human and zebrafish Abcc4 expression. We demonstrate that zebrafish Abcc4 T804M or human ABCC4 T796M exhibit substantially reduced expression, coupled with impaired plasma membrane localization. To understand the molecular basis for the localization defect, we developed a homology model of zebrafish Abcc4. The homology model suggested that the bulky methionine substitution disrupted side-chain contacts. Molecular dynamic simulations of a fragment of human or zebrafish CL3 containing a methionine substitution indicated altered helicity coupled with reduced thermal stability. Trifluoroethanol challenge coupled with circular dichroism revealed that the methionine substitution disrupted the ability of this fragment of CL3 to readily form an alpha-helix. Furthermore, expression and plasma membrane localization of these mutant ABCC4/Abcc4 proteins are mostly rescued by growing cells at subphysiological temperatures. Because the cystic fibrosis transmembrane conductance regulator (ABCC7) is closely related to ABCC4, we extended this by engineering certain pathogenic CFTR-CL3 mutations, and we showed they destabilized human and zebrafish ABCC4. Altogether, our studies provide the first evidence for a conserved domain in CL3 of ABCC4 that is crucial in ensuring its proper plasma membrane localization.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
199 Notably, disease-related point mutations in CFTR CL3 at positions S945L and H949Y (Fig. 5A) (44) affected maturation of CFTR (26). Login to comment
238 Furthermore, we extended these studies to show that other mutations in CL3 (analogous to those in CFTR (S945L and H949Y)) that also disrupt its helical properties reduce protein expression. Login to comment
198 Notably, disease-related point mutations in CFTR CL3 at positions S945L and H949Y (Fig. 5A) (44) affected maturation of CFTR (26). Login to comment
237 Furthermore, we extended these studies to show that other mutations in CL3 (analogous to those in CFTR (S945L and H949Y)) that also disrupt its helical properties reduce protein expression. Login to comment

[hide] CFTR gene mutations and asthma in the Norwegian En... Respir Med. 2006 Dec;100(12):2121-8. Epub 2006 May 5. Munthe-Kaas MC, Lodrup Carlsen KC, Carlsen KH, Skinningsrud B, Haland G, Devulapalli CS, Pettersen M, Eiklid K
CFTR gene mutations and asthma in the Norwegian Environment and Childhood Asthma study.
Respir Med. 2006 Dec;100(12):2121-8. Epub 2006 May 5., [PMID:16678395]

Abstract [show]
BACKGROUND: Several candidate genes have been implicated in the etiology of asthma, including the gene coding for the cystic fibrosis transmembrane conductance regulator (CFTR). Mutations in the CFTR gene result in derangements of mucociliary clearance. Homozygotes for CFTR mutations develop cystic fibrosis (CF), a disorder characterized mainly by lung and pancreas disease. OBJECTIVE: To investigate whether there was an increased frequency of CFTR mutations in asthma patients. METHODS: Seven hundred and three subjects aged 10-11 years from the environment and childhood asthma (ECA) study were included in the present study. Possible associations between asthma, reduced lung function, bronchial hyperresponsiveness (BHR), and increased or decreased nitrogen oxide (NO) levels (based on structural parental interview, spirometry, PD20 methacholine challenge test and exhaled NO measurements), and the five most common CFTR mutations in Norway (DeltaF508, R117H, R117C, 4005+2T-->C, 394delTT), the modulating polymorphisms IVS8(TG)mTn and the IVS8-5T were investigated. RESULTS: No association were found between asthma, reduced lung function, BHR or exhaled NO levels and CF heterozygosity. However, the IVS8(TG)11T7 haplotype was associated with normal lung function. CONCLUSIONS: Our results do not support the hypothesis that CFTR mutations or polymorphisms play a role in the pathogenesis of asthma in children. However, the distribution of Tn(TG)m haplotypes differed between individuals with reduced lung function and individuals with normal lung function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 CFTR mutation Alleles (%) F508del 184 (62.2) R117C 12 (4.1) R117H 12 394delTT 11 (3.8) 4005+2T-C 11 G551D 6 (2.0) 3659delC 5 (1.7) E60X 4 (1.4) V232D 4 1525-2A-G 3 (1.0) N1303K 3 G542X 2 (0.7) E279X 2 R75X 2 S912X 2 E116X 1 (0.3) L295Q 1 R347L 1 Q493X 1 I506L 1 I507del 1 R553X 1 G576A 1 621-1G-T 1 2183AA-G 1 S945L 1 R1162X 1 I1234V 1 3849+10 kbC-T 1 W1282X 1 Unknown 18 (6.5) Total alleles 296 (100%) Mutations detected with OLA31 m kit-74%. Login to comment

[hide] Correctors of DeltaF508 CFTR restore global confor... FASEB J. 2013 Feb;27(2):536-45. doi: 10.1096/fj.12-216119. Epub 2012 Oct 26. He L, Kota P, Aleksandrov AA, Cui L, Jensen T, Dokholyan NV, Riordan JR
Correctors of DeltaF508 CFTR restore global conformational maturation without thermally stabilizing the mutant protein.
FASEB J. 2013 Feb;27(2):536-45. doi: 10.1096/fj.12-216119. Epub 2012 Oct 26., [PMID:23104983]

Abstract [show]
Most cystic fibrosis is caused by the deletion of a single amino acid (F508) from CFTR and the resulting misfolding and destabilization of the protein. Compounds identified by high-throughput screening to improve DeltaF508 CFTR maturation have already entered clinical trials, and it is important to understand their mechanisms of action to further improve their efficacy. Here, we showed that several of these compounds, including the investigational drug VX-809, caused a much greater increase (5- to 10-fold) in maturation at 27 than at 37 degrees C (<2-fold), and the mature product remained short-lived (T(1/2) approximately 4.5 h) and thermally unstable, even though its overall conformational state was similar to wild type, as judged by resistance to proteolysis and interdomain cross-linking. Consistent with its inability to restore thermodynamic stability, VX-809 stimulated maturation 2-5-fold beyond that caused by several different stabilizing modifications of NBD1 and the NBD1/CL4 interface. The compound also promoted maturation of several disease-associated processing mutants on the CL4 side of this interface. Although these effects may reflect an interaction of VX-809 with this interface, an interpretation supported by computational docking, it also rescued maturation of mutants in other cytoplasmic loops, either by allosteric effects or via additional sites of action. In addition to revealing the capabilities and some of the limitations of this important investigational drug, these findings clearly demonstrate that DeltaF508 CFTR can be completely assembled and evade cellular quality control systems, while remaining thermodynamically unstable. He, L., Kota, P., Aleksandrov, A. A., Cui, L., Jensen, T., Dokholyan, N. V., Riordan, J. R. Correctors of DeltaF508 CFTR restore global conformational maturation without thermally stabilizing the mutant protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
181 B, C) HEK293 cells were transiently transfected with CFTR with misprocessing mutations located in CL1 (H139R), CL2 (R258G), and CL3 (S945L) (B), or in NBD1 (èc;I507 and R560T; C). Login to comment

[hide] Distribution of CFTR mutations in the Czech popula... J Cyst Fibros. 2013 Sep;12(5):532-7. doi: 10.1016/j.jcf.2012.12.002. Epub 2012 Dec 29. Krenkova P, Piskackova T, Holubova A, Balascakova M, Krulisova V, Camajova J, Turnovec M, Libik M, Norambuena P, Stambergova A, Dvorakova L, Skalicka V, Bartosova J, Kucerova T, Fila L, Zemkova D, Vavrova V, Koudova M, Macek M, Krebsova A, Macek M Jr
Distribution of CFTR mutations in the Czech population: positive impact of integrated clinical and laboratory expertise, detection of novel/de novo alleles and relevance for related/derived populations.
J Cyst Fibros. 2013 Sep;12(5):532-7. doi: 10.1016/j.jcf.2012.12.002. Epub 2012 Dec 29., [PMID:23276700]

Abstract [show]
BACKGROUND: This two decade long study presents a comprehensive overview of the CFTR mutation distribution in a representative cohort of 600 Czech CF patients derived from all regions of the Czech Republic. METHODS: We examined the most common CF-causing mutations using the Elucigene CF-EU2v1 assay, followed by MLPA, mutation scanning and/or sequencing of the entire CFTR coding region and splice site junctions. RESULTS: We identified 99.5% of all mutations (1194/1200 CFTR alleles) in the Czech CF population. Altogether 91 different CFTR mutations, of which 20 were novel, were detected. One case of de novo mutation and a novel polymorphism was revealed. CONCLUSION: The commercial assay achieved 90.7%, the MLPA added 1.0% and sequencing increased the detection rate by 7.8%. These comprehensive data provide a basis for the improvement of CF DNA diagnostics and/or newborn screening in our country. In addition, they are relevant to related Central European populations with lower mutation detection rates, as well as to the sizeable North American "Bohemian diaspora".

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 The Elucigene CF-EU2v1ࡊ assay was shown to achieve sufficient mutation detection rates for multi-tier CF NBS (i.e. more than 85%), although the I336K and S945L, with frequency over 0.5% (Table 1), should also be included in the Czech national screening panel [1]. Login to comment
89 Mutations/HGVS nomenclature/ Mutations/traditional nomenclature, legacy name/ Czech Republic 2012 (this study) (N=1200) Slovakia 2010 (N=856) Eastern Hungary 2011 (N=80) Germany Bavaria 2002 (N=250) Austria Tyrol 1997 (N=126) Austria NorthEast, North- North 2002 (N=118) Poland (N=1726) c.1521_1523delCTT F508del 67.42 66.80 70.00 74.00 74,60 70.30 57.0 c.54-5940_273+10250del21 kb CFTRdele2,3/21kb 5.75 2.26 5.00 1.2* 2.6# NA 1.80 c.1652GNA G551D 2.91 b0.50 0.00 6.40 1.60 2.50 0.50 c.3909CNG N1303K 2.42 2.03 5.00 2.40 0.00 NA 1.80 c.1624GNT G542X 2.00 4.06 3.75 3.20 2.40 5.10 2.60 c.3718-2477CNT 3849+10kbCNT 1.67 4.28 0.00 NA 0.00 3.40 2.70 c.1766+1GNA 1898+1GNA 1.42 b0.50 0.00 NA 0.00 NA NA c.1040GNC R347P 0.92 1.10 1.25 0.80 1.60 2.50 NA c.2012delT 2143delT 0.92 1.10 0.00 NA 0.00 NA NA c.3140-26ANG 3272-26ANG 0.67 b0.50 0.00 NA 0.00 NA NA c.3846GNA W1282X 0.58 b0.50 0.00 NA 0.00 NA 0.70 c.1007TNA I336K 0.58 0.00 0.00 NA 0.00 NA NA c.1657CNT R553X 0.50 0.90 0.00 1.20 0.00 NA 1.90 c.2657+5GNA 2789+5GNA 0.50 0.00 0.00 NA 2.40 NA NA c.2834CNT S945L 0.50 0.00 0.00 NA 0.00 NA NA c.2052_2053insA 2184insA 0.42 1.58 5.00 NA 0.00 NA NA Legend: data for Slovakia [12], Eastern Hungary [14], Germany-Bavaria [13], Austria-Tyrol [18], Austria North East and North West [13], Poland and *[8], and # [16]. Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
86 For example, the baseline level of chloride transport and ivacaftor response was higher for mutant CFTR forms associated with mild defects in CFTR processing (e.g., E56K, P67L, L206W, A455E, D579G, S945L, S977F, A1067T, R1070Q, R1070W, F1074L, and D1270N) than for those associated with severe defects in CFTR processing (e.g., F508del, H1054D, R1066H). Login to comment
89 For mutant CFTR forms that have multiple defects (e.g., R117H, F508del, S945L, R1070Q, A1067T, R1070W, and R347P), the relative impact of each defect is likely to affect the magnitude of the baseline chloride transport and ivacaftor response in vitro and in a clinical setting. Login to comment
92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3. Login to comment

[hide] Enhancing the Potency of F508del Correction: A Mul... J Pharmacol Clin Toxicol. 2013 Aug 28;1(1):1007. Kirby EF, Heard AS, Wang XR
Enhancing the Potency of F508del Correction: A Multi-Layer Combinational Approach to Drug Discovery for Cystic Fibrosis.
J Pharmacol Clin Toxicol. 2013 Aug 28;1(1):1007., [PMID:24855632]

Abstract [show]
With better understanding of the cellular and molecular pathophysiology underlying cystic fibrosis (CF), novel drugs are being developed that specifically target the molecular defects of the cystic fibrosis transmembrane conductance regulator (CFTR), a cAMP-activated chloride channel on the plasma membrane that causes CF. Starting with cell-based high-throughput screening, small molecules have been identified that are able to fix specific molecular defects of various disease-causing CFTR mutants. With the successful development of ivacaftor, a "potentiator" that enhances CFTR chloride channel activity, new types of small-molecule compounds that "correct" the misfolding and misprocessing of the most common CF-causing mutation, F508del, are actively being sought for. Recent studies focused on the potential mechanisms of action of some of the investigational CFTR "correctors" shed new light on how the F508del mutant can be targeted in an attempt to ameliorate the clinical symptoms associated with CF. A multi-layer combinational approach has been proposed to achieve the high-potency correction necessary for significant clinical outcome. The mechanistic insights obtained from such studies will shape the future therapeutics development for the vast majority of CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 VRT-325 was found to rescue not only F508del CFTR but also other CFTR processing mutants such as R258G, S945L, and H949Y, and processing mutants of P-glycoprotein (P-gp), a drug pump that also belongs to the ABC transporter family [29]. Login to comment

[hide] Mechanisms of CFTR functional variants that impair... PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul. LaRusch J, Jung J, General IJ, Lewis MD, Park HW, Brand RE, Gelrud A, Anderson MA, Banks PA, Conwell D, Lawrence C, Romagnuolo J, Baillie J, Alkaade S, Cote G, Gardner TB, Amann ST, Slivka A, Sandhu B, Aloe A, Kienholz ML, Yadav D, Barmada MM, Bahar I, Lee MG, Whitcomb DC
Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.
PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul., [PMID:25033378]

Abstract [show]
CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

[hide] Comprehensive CFTR gene analysis of the French cys... Genet Med. 2015 Feb;17(2):108-16. doi: 10.1038/gim.2014.113. Epub 2014 Aug 14. Audrezet MP, Munck A, Scotet V, Claustres M, Roussey M, Delmas D, Ferec C, Desgeorges M
Comprehensive CFTR gene analysis of the French cystic fibrosis screened newborn cohort: implications for diagnosis, genetic counseling, and mutation-specific therapy.
Genet Med. 2015 Feb;17(2):108-16. doi: 10.1038/gim.2014.113. Epub 2014 Aug 14., [PMID:25122143]

Abstract [show]
PURPOSE: Newborn screening (NBS) for cystic fibrosis (CF) was implemented throughout France in 2002. It involves a four-tiered procedure: immunoreactive trypsin (IRT)/DNA/IRT/sweat test [corrected] was implemented throughout France in 2002. The aim of this study was to assess the performance of molecular CFTR gene analysis from the French NBS cohort, to evaluate CF incidence, mutation detection rate, and allelic heterogeneity. METHODS: During the 8-year period, 5,947,148 newborns were screened for cystic fibrosis. The data were collected by the Association Francaise pour le Depistage et la Prevention des Handicaps de l'Enfant. The mutations identified were classified into four groups based on their potential for causing disease, and a diagnostic algorithm was proposed. RESULTS: Combining the genetic and sweat test results, 1,160 neonates were diagnosed as having cystic fibrosis. The corresponding incidence, including both the meconium ileus (MI) and false-negative cases, was calculated at 1 in 4,726 live births. The CF30 kit, completed with a comprehensive CFTR gene analysis, provides an excellent detection rate of 99.77% for the mutated alleles, enabling the identification of a complete genotype in 99.55% of affected neonates. With more than 200 different mutations characterized, we confirmed the French allelic heterogeneity. CONCLUSION: The very good sensitivity, specificity, and positive predictive value obtained suggest that the four-tiered IRT/DNA/IRT/sweat test procedure may provide an effective strategy for newborn screening for cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Some molecular defects that could belong to either the CF-causing group or the CFTR-related disorders group (group A/B) were reported in patients presenting a broad spectrum of phenotypes from classic CF to mild monosymptomatic presentations.16 These are four missense mutations (p.Leu206Trp (L206W), p.Arg347His (R347H), p.Asp1152His (D1152H), and p.Ser945Leu (S945L)) and three splice mutations (c.2657+5G>A (2789+5G>A), c.3718-2477C>T (3849+10kbC>T), and c.1210-34TG(13);1210-12T(5) (TG13T5)). Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
356 S945L lies within the main lateral tunnel, and might thus impair access to the pore. Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
385 [Gly576Ala;Arg668Cys] D579G c.1736A>G CF-PS varying clinical consequence p.Asp579Gly E585X c.1753G>T CF-PI CF-causing p.Glu585* H609L c.1826A>T CFTR-RD nd p.His609Leu A613T c.1837G>A CF-PS nd p.Ala613Thr D614G c.1841A>G CF-PS unknown significance p.Asp614Gly 2143delT c.2012delT CF-PS CF-causing p.Leu671* 2183AA>G c.2051_2052delAAinsG CF-PI,CF-PS CF-causing p.Lys684SerfsX38 2184insA c.2052_2053insA CF-PI CF-causing p.Gln685ThrfsX4 R709X c.2125C>T CF-PI CF-causing p.Arg709* L732X c.2195T>G CF-PI CF-causing p.Leu732* R764X c.2290C>T CF-PI CF-causing p.Arg764* Q779X c.2335C>T uncertain: CF-PI and/or CF-PS nd p.Gln779* E831X c.2491G>T CF-PS CF-causing p.Glu831* Y849X c.2547C>A CF-PI CF-causing p.Tyr849* ex14b-17bdel c.2620-674_3367+198del9858 CF-PI nd 2789+5G>A c.2657+5G>A CF-PI,CF-PS CF-causing 2790-2A>G c.2658-2A>G CF-PS nd S912L c.2735C>T uncertain: found only with an unknown allele in trans nd p.Ser912Leu S945L c.2834C>T CF-PS CF-causing p.Ser945Leu S977F c.2930C>T CFTR-RD varying clinical consequence p.Ser977Phe L997F c.2991G>C CF-PS,CFTR-RD,CBAVD non CF-causing p.Leu997Phe ex17a-18del c.2988+1173_3468+2111del8600 CF-PI nd P1013L c.3038C>T CFTR-RD nd p.Pro1013Leu Y1032C c.3095A>G CFTR-RD nd p.Tyr1032Cys 3272-26A>G c.3140-26A>G CF-PS CF-causing L1065P c.3194T>C CF-PI,CF-PS CF-causing p.Leu1065Pro L1065R c.3194T>G uncertain: CF-PI and/or CF-PS nd p.Leu1065Arg R1066C c.3196C>T CF-PI CF-causing p.Arg1066Cys R1066H c.3197G>A CF-PI CF-causing p.Arg1066His G1069R c.3205G>A uncertain: found only with an unknown allele in trans varying clinical consequence p.Gly1069Arg Continued on next page of 0.021). Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment