ABCC7 p.Arg347His
| Admin's notes: | Class III (gating defect) Veit et al. |
| ClinVar: |
c.1039C>T
,
p.Arg347Cys
?
, not provided
c.1040G>A , p.Arg347His D , Pathogenic c.1040G>T , p.Arg347Leu D , Pathogenic c.1040G>C , p.Arg347Pro D , Pathogenic |
| CF databases: |
c.1040G>C
,
p.Arg347Pro
D
, CF-causing ; CFTR1: This mutation destroys a Hha I restriciton site and creates an NcoI site and occurred in a family diagnosed as PS. The mutation have been identified and analyzed using the SSCP technique.
c.1040G>A , p.Arg347His D , CF-causing ; CFTR1: The patient is of Italian origin and carries the [delta]F508 mutation on the other chromosome. Initially we thought this was the same mutation as R347 because it destroys the same hhai site; however, R347H does not create the NcoI site. c.1040G>T , p.Arg347Leu (CFTR1) D , A nucleotide change, G->T at position 1172, was detected leading to R347L. The other chromosome carries a [delta]F508. This mutation was found on one chromosome among 150 CF chromosomes screened. c.1039C>T , p.Arg347Cys (CFTR1) ? , This mutation was identified by DGGE and direct sequencing. |
| Predicted by SNAP2: | A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (71%), I: D (95%), K: D (95%), L: D (80%), M: D (95%), N: D (95%), P: D (75%), Q: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%), |
| Predicted by PROVEAN: | A: N, C: D, D: D, E: N, F: D, G: D, H: N, I: D, K: N, L: N, M: N, N: N, P: N, Q: N, S: N, T: N, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]
Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.
Comments [show]
None has been submitted yet.
No. Sentence Comment
415 Clain et al. [201] showed that R347H was associated with mild defective ClÀ channel activity and that D979A defect led to misprocessing.
X
ABCC7 p.Arg347His 16442101:415:31
status: NEW[hide] Cystic fibrosis-associated mutations at arginine 3... J Biol Chem. 1999 Feb 26;274(9):5429-35. Cotten JF, Welsh MJ
Cystic fibrosis-associated mutations at arginine 347 alter the pore architecture of CFTR. Evidence for disruption of a salt bridge.
J Biol Chem. 1999 Feb 26;274(9):5429-35., 1999-02-26 [PMID:10026154]
Abstract [show]
Arginine 347 in the sixth transmembrane domain of cystic fibrosis transmembrane conductance regulator (CFTR) is a site of four cystic fibrosis-associated mutations. To better understand the function of Arg-347 and to learn how mutations at this site disrupt channel activity, we mutated Arg-347 to Asp, Cys, Glu, His, Leu, or Lys and examined single-channel function. Every Arg-347 mutation examined, except R347K, had a destabilizing effect on the pore, causing the channel to flutter between two conductance states. Chloride flow through the larger conductance state was similar to that of wild-type CFTR, suggesting that the residue at position 347 does not interact directly with permeating anions. We hypothesized that Arg-347 stabilizes the channel through an electrostatic interaction with an anionic residue in another transmembrane domain. To test this, we mutated anionic residues (Asp-924, Asp-993, and Glu-1104) to Arg in the context of either R347E or R347D mutations. Interestingly, the D924R mutation complemented R347D, yielding a channel that behaved like wild-type CFTR. These data suggest that Arg-347 plays an important structural role in CFTR, at least in part by forming a salt bridge with Asp-924; cystic fibrosis-associated mutations disrupt this interaction.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 To better understand the function of Arg-347 and to learn how mutations at this site disrupt channel activity, we mutated Arg-347 to Asp, Cys, Glu, His, Leu, or Lys and examined single-channel function.
X
ABCC7 p.Arg347His 10026154:1:122
status: NEW12 At least four CF-associated mutations have been identified at position 347 in M6: R347C, R347H, R347L, and R347P, suggesting that Arg-347 is important for CFTR structure and function (13-15).2 Early studies by Sheppard et al. (7) showed that mutation of Arg-347 to proline significantly decreased single-channel conductance with little effect on CFTR trafficking to the plasma membrane.
X
ABCC7 p.Arg347His 10026154:12:89
status: NEW14 Interestingly, mutation of Arg-347 to a histidine (R347H) produced a channel that displayed pH-dependent conductance and anomalous mole-fraction behavior (8).
X
ABCC7 p.Arg347His 10026154:14:27
status: NEWX
ABCC7 p.Arg347His 10026154:14:51
status: NEW18 For example, mutation of this site could lead to a change in MSD conformation and loss of an anion-binding site(s) elsewhere; protonation of His-347 might then rescue the conformation of the R347H mutant.
X
ABCC7 p.Arg347His 10026154:18:191
status: NEW25 We examined the cytosolic pH (pHc)-dependent behavior of CFTR-R347H and that of the other residue 347 mutants both with (R347C, R347D, R347E, and R347K) and without (R347L) a pHc-titratable residue.
X
ABCC7 p.Arg347His 10026154:25:62
status: NEW26 The conductance of CFTR-R347H is pHc-dependent.
X
ABCC7 p.Arg347His 10026154:26:24
status: NEW37 9, Issue of February 26, pp. 5429-5435, 1999 (c) 1999 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. This paper is available on line at http://www.jbc.org tion may exist in one of two states, either protonated or deprotonated, we tested the hypothesis that CFTR-R347H may display two pHc-dependent conductance states, which it did.
X
ABCC7 p.Arg347His 10026154:37:304
status: NEW40 Moreover, like CFTR-R347H, all the other residue 347 mutants, except R347K, displayed two pHc-dependent conductance states over a similar pHc range.
X
ABCC7 p.Arg347His 10026154:40:20
status: NEW69 RESULTS pHc-dependent Conductance of Residue 347 Mutants-To determine whether R347H exhibits two discrete conductance states, we studied single channels in excised, inside-out patches.
X
ABCC7 p.Arg347His 10026154:69:78
status: NEW74 from R347H displaying two pHc-dependent conductance states, OL and OB.
X
ABCC7 p.Arg347His 10026154:74:5
status: NEW86 Visual inspection suggested that the lifetimes of OL and OB states were also influenced by the nature of the residue at position 347: R347E and R347H tended to have longer dwell times in the OL and OB states, whereas R347L, R347C, and R347D tended to display shorter dwell times.
X
ABCC7 p.Arg347His 10026154:86:144
status: NEW91 Single-channel Conductance of Residue 347 Mutants-To determine whether the residue at position 347 affects single-channel conductance and not merely the conductance state of the channel, we examined the I-V relationship and slope conductance of the mutants with slower pHc-dependent kinetics, R347H and R347E, as well as R347K.
X
ABCC7 p.Arg347His 10026154:91:293
status: NEW94 The single-channel conductance at pHc 6.0 of wild-type CFTR, R347K, and the OB state of R347E and R347H were all very similar (in pS): 7.7 Ϯ 0.4, 8.3 Ϯ 0.6, 7.4 Ϯ 0.4, and 6.9 Ϯ 0.2, respectively (n ϭ 3 for each).
X
ABCC7 p.Arg347His 10026154:94:98
status: NEW95 The single-channel conductance of the OL states of R347E and R347H at pHc 6.0 were also very similar (in pS): 1.5 Ϯ 0.1 and 1.6 Ϯ 0.1, respectively (n ϭ 3 and 4 for each).
X
ABCC7 p.Arg347His 10026154:95:61
status: NEW107 Dwell-time Analysis of OL and OB States-We performed a dwell-time analysis of the lifetimes of the OL and OB states of R347E and R347H to enable more quantitative comparisons between them and to better understand their pHc dependence.
X
ABCC7 p.Arg347His 10026154:107:129
status: NEW113 The observable pK (0 mV) for the equilibrium between OL and OB of R347E and R347H were 6.4 and 6.3, respectively. The faster kinetics of R347D, R347C, and R347L made dwell-time analysis for these mutants less reliable.
X
ABCC7 p.Arg347His 10026154:113:76
status: NEW119 Single-channel I-V relationships for R347E (OL and OB states), R347H (OL and OB states), R347K, R347D/D924R, and wild-type CFTR at pHc 6.0. n ϭ 2-4 at each data point.
X
ABCC7 p.Arg347His 10026154:119:63
status: NEW125 Fig. 4B shows quantitatively that at pHc 6.0 the OL and OB states for R347E and R347H were both influenced by the transmembrane voltage.
X
ABCC7 p.Arg347His 10026154:125:80
status: NEW128 The degree of voltage dependence was similar for both mutants despite the charge differences at residue 347 and yielded a z of 0.25 and 0.21 for R347E and R347H, respectively. The voltage dependence was asymmetrically disposed between the rate of entry into the OB state and the rate of exit from OB (Fig. 4B).
X
ABCC7 p.Arg347His 10026154:128:163
status: NEW130 The rate of exit from the OB state (B -1 ) was more voltage-dependent than the rate of exit from the OL state (L -1 ) for both mutants (␦ ϭ 0.8 versus 1 - ␦ ϭ 0.2 for R347E and ␦ ϭ 0.7 versus 1 - ␦ ϭ 0.3 for R347H).
X
ABCC7 p.Arg347His 10026154:130:276
status: NEW134 A, dwell-time analysis in the OL and OB conductance states versus pHc for R347E and R347H.
X
ABCC7 p.Arg347His 10026154:134:84
status: NEW144 B, dwell times (pHc 6.0) in the OL state (closed symbols) or OB state (open symbols) versus voltage for R347E (left, circles) and R347H (right, squares).
X
ABCC7 p.Arg347His 10026154:144:130
status: NEW147 arises from charge movement through a voltage field and since R347E and R347H displayed similar voltage dependences and carry different charges at position 347, residue 347 is not likely moving through a transmembrane potential during interchange between OL and OB states.
X
ABCC7 p.Arg347His 10026154:147:72
status: NEW171 Additionally, the single-channel slope conductances of R347H and R347E were the same in both OB and OL states.
X
ABCC7 p.Arg347His 10026154:171:55
status: NEW210 The Arg-347 residue is targeted by several CF-associated mutations, R347C, R347H, R347L, and R347P (13-15).2 Our data suggest that CF-associated as well as other mutations at residue 347 affect CFTR similarly.
X
ABCC7 p.Arg347His 10026154:210:75
status: NEW[hide] Proportion of cystic fibrosis gene mutations not d... JAMA. 1999 Jun 16;281(23):2217-24. Mak V, Zielenski J, Tsui LC, Durie P, Zini A, Martin S, Longley TB, Jarvi KA
Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia.
JAMA. 1999 Jun 16;281(23):2217-24., 1999-06-16 [PMID:10376575]
Abstract [show]
CONTEXT: Infertile men with obstructive azoospermia may have mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, many of which are rare in classic cystic fibrosis and not evaluated in most routine mutation screening. OBJECTIVE: To assess how often CFTR mutations or sequence alterations undetected by routine screening are detected with more extensive screening in obstructive azoospermia. DESIGN: Routine screening for the 31 most common CFTR mutations associated with the CF phenotype in white populations, testing for the 5-thymidine variant of the polythymidine tract of intron 8 (IVS8-5T) by allele-specific oligonucleotide hybridization, and screening of all exons through multiplex heteroduplex shift analysis followed by direct DNA sequencing. SETTING: Male infertility clinic of a Canadian university-affiliated hospital. SUBJECTS: Of 198 men with obstructive (n = 149) or nonobstructive (n = 49; control group) azoospermia, 64 had congenital bilateral absence of the vas deferens (CBAVD), 10 had congenital unilateral absence of the vas deferens (CUAVD), and 75 had epididymal obstruction (56/75 were idiopathic). MAIN OUTCOME MEASURE: Frequency of mutations found by routine and nonroutine tests in men with obstructive vs nonobstructive azoospermia. RESULTS: Frequency of mutations and the IVS8-5T variant in the nonobstructive azoospermia group (controls) (2% and 5.1% allele frequency, respectively) did not differ significantly from that in the general population (2% and 5.2%, respectively). In the CBAVD group, 72 mutations were found by DNA sequencing and IVS8-5T testing (47 and 25, respectively; P<.001 and P = .002 vs controls) vs 39 by the routine panel (P<.001 vs controls). In the idiopathic epididymal obstruction group, 24 mutations were found by DNA sequencing and IVS8-5T testing (12 each; P=.01 and P=.14 vs controls) vs 5 by the routine panel (P=.33 vs controls). In the CUAVD group, 2 mutations were found by routine testing (P=.07 vs controls) vs 4 (2 each, respectively; P=.07 and P=.40 vs controls) by DNA sequencing and IVS8-5T testing. The routine panel did not identify 33 (46%) of 72, 2 (50%) of 4, and 19 (79%) of 24 detectable CFTR mutations and IVS8-5T in the CBAVD, CUAVD, and idiopathic epididymal obstruction groups, respectively. CONCLUSIONS: Routine testing for CFTR mutations may miss mild or rare gene alterations. The barrier to conception for men with obstructive infertility has been overcome by assisted reproductive technologies, thus raising the concern of iatrogenically transmitting pathogenic CFTR mutations to the progeny.
Comments [show]
None has been submitted yet.
No. Sentence Comment
28 Analysis for 31 of the most common CFTR mutations found within the white CF population,60 consisting of ⌬F508, W1282X, G542X, G551D, N1303K, R553X, G85E, R117H, S549N, V520F, R334W, A455E, R347P, R1162X, Y122X, S549R, 621+1G→T, ⌬I507, R560T, R347H, 3659delC, Q493X, 1898+1G→T, 711+1G→T, 3849+10C→T, 1717-1G→A, 3849+4A→G, 3905insT, 1078delT, 2183AA→G, and 2789+5G→A. Briefly, the technique involved amplification by polymerase chain reaction61 of the relevant exons, followed by digestion with appropriate restriction endonucleases and acrylamide gel electrophoresis with ethidium bromide staining.
X
ABCC7 p.Arg347His 10376575:28:263
status: NEW[hide] Two buffer PAGE system-based SSCP/HD analysis: a g... Eur J Hum Genet. 1999 Jul;7(5):590-8. Liechti-Gallati S, Schneider V, Neeser D, Kraemer R
Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease.
Eur J Hum Genet. 1999 Jul;7(5):590-8., [PMID:10439967]
Abstract [show]
The large size of many disease genes and the multiplicity of mutations complicate the design of an adequate assay for the identification of disease-causing variants. One of the most successful methods for mutation detection is the single strand conformation polymorphism (SSCP) technique. By varying temperature, gel composition, ionic strength and additives, we optimised the sensitivity of SSCP for all 27 exons of the CFTR gene. Using simultaneously SSCP and heteroduplex (HD) analysis, a total of 80 known CF mutations (28 missense, 22 frameshift, 17 nonsense, 13 splicesite) and 20 polymorphisms was analysed resulting in a detection rate of 97.5% including the 24 most common mutations worldwide. The ability of this technique to detect mutations independent of their nature, frequency, and population specificity was confirmed by the identification of five novel mutations (420del9, 1199delG, R560S, A613T, T1299I) in Swiss CF patients, as well as by the detection of 41 different mutations in 198 patients experimentally analysed. We present a three-stage screening strategy allowing analysis of seven exons within 5 hours and analysis of the entire coding region within 1 week, including sequence analysis of the variants. Additionally, our protocol represents a general model for point mutation analysis in other genetic disorders and has already been successfully established for OTC deficiency, collagene deficiency, X-linked myotubular myopathy (XLMTM), Duchenne and Becker muscular dystrophy (DMD, BMD), Wilson disease (WD), Neurofibromatosis I and II, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, and defects in mitochondrial DNA. No other protocol published so far presents standard SSCP/HD conditions for mutation screening in different disease genes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
20 The distribution of analysed known mutations is similar to that of the total number of mutations in the entire CFTR gene: missense mutations account for 35% (G27E, G85E, R117H, A120T, I148T, H199Y, R334W, T338I, R347P, R347H, A455E, M718K, S5449N, S5449I, G551D, R560T, R560S, S945L, S977P, I1005R, R1066C, R1070Q, M1101K, D1152H, S1235R, R1283M, N1303K, N1303H), followed by 28% of frameshift mutations (175delC, 394delTT, 457TAT- > G, 905delG, 1078delT, I507, F508, 1609delCA, 1677delTA, 2143delT, 2176insC, 218delA, 2184insA, 2869insG, 3659delC, 3732delA, 3821delT, 3905insT, 4016insT, 4172delGC, 4382delA), 21% of nonsense mutations (Q30X, Q39X, Q220X, W401X, Q525X, G542X, Q552X, R553X, V569X, E585X, K710X, R792X, Y1092X, R1162X, S1255X, W1282X, E1371X), and 16% of splice site mutations (621 + 1G- > T, 711 + 1G- > T, 711 + 5G- > A, 1717-1G- > A, 1898 + 1G- > A, 1898 + 5G- > T, 2789 + 5G- > A, 3271 + 1G- > A, 3272-26A- > G, 3601-17T- > C, 3849 + 4A- > G, 3849 + 10kbC- > T, 4374 + 1G- > T).
X
ABCC7 p.Arg347His 10439967:20:219
status: NEW44 Three mutations (R1066C, M1101K, E1371X) could only be identified after restriction enzyme digestion of the amplification product, and five mutations (711 + 1G- > T, R347H, T338I, Y1092X, S1255X) were discovered in the uncut, but not in the digested, PCR product.
X
ABCC7 p.Arg347His 10439967:44:166
status: NEW[hide] Analysis of 31 CFTR mutations by polymerase chain ... J Med Screen. 1999;6(2):67-9. Gasparini P, Arbustini E, Restagno G, Zelante L, Stanziale P, Gatta L, Sbaiz L, Sedita AM, Banchieri N, Sapone L, Fiorucci GC, Brinson E, Shulse E, Rappaport E, Fortina P
Analysis of 31 CFTR mutations by polymerase chain reaction/oligonucleotide ligation assay in a pilot screening of 4476 newborns for cystic fibrosis.
J Med Screen. 1999;6(2):67-9., [PMID:10444722]
Abstract [show]
OBJECTIVES: Molecular biological testing for genetic diseases has grown rapidly, but speed, accuracy, specificity, sensitivity, throughput, and cost become more important as large scale screening is considered. This is a pilot study of an assay for the simultaneous detection of up to 31 cystic fibrosis mutations in a multicentre population based screening of 4476 Italian newborns. METHODS: The assay is a polymerase chain reaction, followed by an oligonucleotide ligation assay (PCR/OLA) and finally a sequence coded separation. It allows the detection of up to 31 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Guthrie spots were used as a source of template DNA. RESULTS: 144 carriers were detected during the analysis of 4476 samples, which translates into a carrier frequency of 1/31.1. Forty two carriers were detected from 1341 samples in Pavia (1/31.9), 53 from 1574 in Turin (1/29.7), and 49 from 1561 in San Giovanni Rotondo (1/31.8). Fifteen different mutations were detected, the most common being delta F508 (0.625). Other common mutations included G542X (16 of 144), which was particularly common in southern Italy (14 of 49), N1303K (8 of 144), and R117H (8 of 144), detected only in the northern centres. CONCLUSIONS: PCR/OLA is a robust, accurate, user friendly method for cystic fibrosis screening of newborns using blood spots in a semiautomated way at a low cost per mutation (0.8 Euro).
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 Table 1 Mutations analysed in the CFTR gene using polymerase chain reaction/oligonucleotide litigation assay/sequence coded separation Mutation Location Nucleotide Result F508 Exon 10 3 bp deletion Deletion of Phe-508 I507 Exon 10 3 bp deletion Deletion of Ile-507 (or -506) Q493X Exon 10 C-1609 →→ T Gln-493 → Stop V520F Exon 10 G-1690 → T Val-520 → Phe 1717-1G → A Intron 10 G-1717-1 → A 3`-splice site mutation G542X Exon 11 G-1756 → T Gly-542 → Stop G551D Exon 11 G-1784 → A Gly-551 → Asp R553X Exon 11 C-1789 → T Arg-553 → Stop R560T Exon 11 G-1811 → C Arg-560 → Thr S549R Exon 11 T-1779 → G Ser-549 → Arg S549N Exon 11 G-1778 → A Ser-549 → Asn 3849+10 kb C → T Intron 19 C-3849+10 kb → T Splice mutation 3849+4A → G Intron 19 A-3849+4 → G Splice mutation R1162X Exon 19 C-3616 → T Arg-1162 → Stop 3659delC Exon 19 1 bp deletion Frameshift W1282X Exon 20 G-3978 → A Trp-1282 → Stop 3905insT Exon 20 1 bp insertion Frameshift N1303K Exon 21 C-4041 → G Asn-1303 → Lys G85E Exon 3 G-386 → A Gly-85 → Glu 621+1G → T Intron 4 G-621+1 → T 5`-splice site mutation R117H Exon 4 G-482 → A Arg-117 → His Y122X Exon 4 T-498 → A Tyr-122 → Stop 711+1G → T Intron 5 G-711+1 → T 5`-splice site mutation 1078delT Exon 7 1 bp deletion Frameshift R347P Exon 7 G-1172 → C Arg-347 → Pro R347H Exon 7 G-1172 → A Arg-347 → His R334W Exon 7 C-1132 → T Arg-334 → Trp A455E Exon 9 C-1496 → A Ala-455 → Glu 1898+1G → A Intron 12 G-1898+1 → A 5`-splice site mutation 2184delA Exon 13 Deletion A-2184; A-2183 → G Frameshift 2789+5G → A Intron 14B G-2789+5 → A Splice mutation Table 2 Summary of cystic fibrosis screening results No of samples analysed Normal subjects Carriers Carrier frequency Turin 1574 1521 53 1/29.7 Pavia 1341 1299 42 1/31.9 San Giovanni Rotondo 1561 1512 49 1/31.8 Total 4476 4332 144 1/31.1 Table 3 Detailed list of mutations detected in the Italian population Centre F508 G542X R347P 2183-AG N1303K 711+1GT 1717-1A R347H R117H 1898+1G 2789+5G W1282X R1162X I507 Other TO 33 2 1 1 5 1 1 2 3 2 2 - - - PV 27 - - 1 2 - 1 - 5 - 1 2 1 1 SGR 30 14 2 1 1 1 - - - - - - - - TO, Dipartimento di Patologia Clinica, Ospedale Infantile "Regina Margherita, Torino; PV, Istituto di Anatomia Patologica, Sezione di Anatomia Patologica, Università di Pavia, Pavia; SGR, Servizio di Genetica Medica and Divisione di Neonatologia, IRCCS Casa Sollievo della SoVerenza, San Giovanni Rotondo, Foggia.
X
ABCC7 p.Arg347His 10444722:46:1559
status: NEWX
ABCC7 p.Arg347His 10444722:46:2281
status: NEW[hide] CFTR gene mutations and male infertility. Andrologia. 2000 Mar;32(2):71-83. Stuhrmann M, Dork T
CFTR gene mutations and male infertility.
Andrologia. 2000 Mar;32(2):71-83., [PMID:10755189]
Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are a relatively frequent cause of male infertility. Depending on their molecular consequences, CFTR mutations may either result in typical cystic fibrosis (CF), one of the most common autosomal recessive disorders, which is characterized by chronic lung disease, pancreatic exocrine insufficiency, an increase in the concentration of sweat electrolytes and male infertility, due to obstructive azoospermia, or in atypical (often monosymptomatic) forms of CF such as congenital absence of the vas deferens (bi- or unilateral), bilateral ejaculatory duct obstruction or bilateral obstructions within the epididymides. All males with idiopathic obstructive azoospermia bear an increased risk for CF offspring. Couples requesting microsurgical epididymal sperm aspiration and in vitro fertilization, e.g. intracytoplasmic sperm injection, should be offered genetic counselling and molecular genetic analysis of the CFTR gene, if male infertility due to obstructive azoospermia is the underlying cause.
Comments [show]
None has been submitted yet.
No. Sentence Comment
84 CFTR mutations and male fertility Disorder Number of Proportion of Most frequent mutations (%) patients mutated alleles (%) Ethnic origin Reference CBAVD 17 20.6* DF508 (20.6) French Dumur et al. (1990b) CBAVD 25 38.0 DF508 (26.0) Northern European Anguiano et al. (1992) CBAVD 12 41.7 DF508 (20.8) French Culard et al. (1994) CBAVD 49 45.9 DF508 (32.6), R117H (6.1) Caucasians Oates & Amos (1994) CBAVD 47 21.3 DF508 (8.5), D1152H (3.2) Mostly Askenazim Augarten et al. (1994) CBAVD 30 41.7 DF508 (15.0), G542X (6.7), R117H (3.3) Spanish Casals et al. (1994) CBAVD 67 44.8 DF508 (20.9), R117H (4.5), W1282X (3.7) French Mercier et al. (1995) CBAVD 102 65.7+a DF508 (21.6), 5T (21.1), R347H (2.4) Caucasians Chillon et al. (1995) CBAVD 45 75.6+b DF508 (25.6), 5T (25.6), R117H (3.3), W1282X (3.3) French Costes et al. (1995) CBAVD 25 52.0+c 5T (26.0), DF508 (12.0), R117H (6.0) Caucasian Jarvi et al. (1995) CBAVD 70 68.6+d 5T (25.7), DF508 (19.3), W1282X (7.9) Mostly Caucasian Zielenski et al. (1995) CBAVD 101 79.2+e DF508 (26.2), R117H (11.4), 5T (12.9) Mostly German Do¨rk et al. (1997) CUAVD 10 5.0 DF508 (5.0) Spanish Casals et al. (1995) CUAVD 21 19.0 DF508 (9.5), R117H (4.8) Caucasian Mickle et al. (1995) BEDO 7 78.6 DF508 (28.5), 5T (21.4), R117H (14.3) Mostly German Meschede et al. (1997) IASV 16 3.1 I1139V (3.1) Mostly German Meschede et al. (1997) Azoospermia† 17 23.5+c 5T (14.7), R117H (5.9) DF508 (2.9) Caucasian Jarvi et al. (1995) Azoospermia 21 9.5 DF508 (2.4), G551D (2.4), R117H (2.4), G542X (2.4) Caucasian van der Ven et al. (1996) Spermatogenic failure 18 5.5+c G542X (2.8), 5T (2.8) Caucasian Jarvi et al. (1995) Spermatogenic failure 80 8.7 G542X (4.4), DF508 (3.1) Caucasian van der Ven et al. (1996) Spermatogenic failure 75 2.7+f DF508 (1.3), R117H (0.6), 5T (0.6) Dutch Tuerlings et al. (1998) *Testing only for DF508; +testing included the 5T allele; a-f, frequency of the 5T allele in the general population: a5.2%, n=498; b5.3%, n=131; c,dnot determined; e4.8%, n=186; f3.7%, n=212; †azoospermia with normal vas deferens and bilateral epididymal obstruction.
X
ABCC7 p.Arg347His 10755189:84:685
status: NEW[hide] Histological and genetic analysis and risk assessm... Hum Reprod. 2000 Jul;15(7):1613-8. Viville S, Warter S, Meyer JM, Wittemer C, Loriot M, Mollard R, Jacqmin D
Histological and genetic analysis and risk assessment for chromosomal aberration after ICSI for patients presenting with CBAVD.
Hum Reprod. 2000 Jul;15(7):1613-8., [PMID:10875876]
Abstract [show]
Intracytoplasmic sperm injection (ICSI) has opened a new field in the treatment of male infertility, leading to a debate concerning its genetic safety. In this study we present an analysis of 11 patients presenting congenital bilateral absence of the vas deferens (CBAVD). In all 11 cases, genetic counselling, histological analysis of testicular biopsies, cystic fibrosis transmembrane conductance regulator (CFTR) mutation screenings of both partners and spermatozoa three-colour fluorescent in-situ hybridization (FISH) analysis were performed. A total of 31 CFTR mutations were screened and mutations were found in eight out of 11 cases, with DeltaF508 being the most common mutation found. Histological analyses showed that seven out of 11 patients had normal tubule/membrane/interstitium (TMI) and Johnsen scores, while the remaining four patients had mild impairment of testicular parenchyma. The average aneuploidy rate was 6.8 +/- 3.9% compared with two control subjects with 4.4 and 5.4% aneuploidy rates respectively, using FISH analysis. After ICSI, the fertilization and pregnancy rates were 66.2 and 22.7% respectively. Thus, in our case of CBAVD, the risk of chromosomal aberration following ICSI, in the absence of a CFTR mutation in the male patient and/or in his partner, was not higher than in normal fertile men. Furthermore, the pregnancy success rate following ICSI of these CBAVD patients was comparable to the general ICSI population, even when histological analysis showed limited spermatogenesis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
49 These samples were at least one mutation, three patients (27%) presented only washed once in phosphate-buffered saline (PBS) and placed in an the ∆F508 mutation and five (45%) presented compound area previously delimited with a diamond pen on superfrosted slides heterozygosity for ∆F508/R347H, ∆F508/R117C, ∆F508/5T, (CML, France).
X
ABCC7 p.Arg347His 10875876:49:302
status: NEW60 TMI score Johnsen score CF mutation screening Sweat test Karyotype Family history 1 1 12 NF ND ND No 2 1 12 ∆F508/NF ND Normal No 3 3 11 R117H-7T/5T ND Normal No 4 3 11 NF ND Normal Yes 5 1 11 ∆F508/NF ND Normal No 6 2 11 ∆F508/R347H ND ND Yes 7 4 10 ∆F508/5T ND ND No 8 3 10 ∆F508/NF Neg ND No 9 1 11 NF Pos ND No 10 2 11 ∆F508/R117C Pos ND Yes 11 2 11 ∆F508/D443Y Pos ND No TMI ϭ tubule/membrane/interstitium; CF ϭ cystic fibrosis; ND ϭ not determined; Neg ϭ negative; Pos ϭ positive; NF ϭ not found in 31 screened mutations, including ∆F508, R117H and the variant IVS5T.
X
ABCC7 p.Arg347His 10875876:60:249
status: NEW[hide] Mutations of the cystic fibrosis gene, but not cat... Am J Gastroenterol. 2000 Aug;95(8):2061-7. Ockenga J, Stuhrmann M, Ballmann M, Teich N, Keim V, Dork T, Manns MP
Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.
Am J Gastroenterol. 2000 Aug;95(8):2061-7., [PMID:10950058]
Abstract [show]
OBJECTIVE: We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. METHODS: Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). RESULTS: No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CONCLUSIONS: CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.
Comments [show]
None has been submitted yet.
No. Sentence Comment
54 Finally, we tested all samples for the presence of mutations or variants R75Q, I336K, R347H, IVS8-5T (5T allele), 1716G3A, 2143delT, 2789ϩ5G3A, Y1092X, 3272-26A3G, D1152H, and CFTRdel2,3 (21kb) by PCR and restriction enzyme digestion with the respective enzymes (for mutation references, see http://www.genet.
X
ABCC7 p.Arg347His 10950058:54:86
status: NEW[hide] Effect of genistein on native epithelial tissue fr... Br J Pharmacol. 2000 Aug;130(8):1884-92. Mall M, Wissner A, Seydewitz HH, Hubner M, Kuehr J, Brandis M, Greger R, Kunzelmann K
Effect of genistein on native epithelial tissue from normal individuals and CF patients and on ion channels expressed in Xenopus oocytes.
Br J Pharmacol. 2000 Aug;130(8):1884-92., [PMID:10952679]
Abstract [show]
The flavonoid genistein has been shown to activate a Cl(-) conductance in various cell types expressing CFTR. We examined if similar effects can be observed when genistein is applied to native ex vivo tissues from human respiratory tract and rectum. We further compared the effects when genistein was applied to oocytes of Xenopus laevis expressing CFTR. In oocytes, both wtCFTR and DeltaF508-CFTR were activated by genistein while both cyclic AMP (K(v)LQT1) and Ca(2+) (SK4) activated K(+) channels were inhibited at high concentrations of genistein. Biopsies from nasal polyps and rectal mucosa were obtained from normal individuals (non-CF) and CF patients and in the presence of amiloride (10 micromol l(-1); mucosal side) the effects of genistein were assessed using a perfused Ussing chamber. In non-CF airway epithelia, genistein (50 micromol l(-1); mucosal side) increased lumen negative I(sc) but had no additional effects on tissues pre-stimulated with IBMX and forskolin (100 micromol l(-1) and 1 micromol l(-1); both sides). In non-CF rectal biopsies, in the presence of amiloride (10 micromol l(-1); mucosal side) and indomethacin (10 micromol l(-1); basolateral side), genistein increased lumen negative I(sc) and enabled cholinergic (carbachol; CCH, 100 micromol l(-1); basolateral side) stimulation of Cl(-) secretion indicating activation of luminal CFTR Cl(-) channels. However, after stimulation with IBMX/forskolin, genistein induced opposite effects and significantly inhibited CCH activated I(sc). In CF airway and intestinal tissues genistein failed to induce Cl(-) secretion. Thus, genistein is able to activate luminal CFTR Cl(-) conductance in non-CF tissues and mutant CFTR in oocytes. However, additional inhibitory effects on basolateral K(+) conductance and missing effects in native CF tissues do not support the use for pharmacological intervention in CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
30 In all CF patients from whom rectal biopsies were studied DNA analysis was carried out for the following CFTR mutations: DF508; R117H and S108F in exon 4; R347P, R347H, I336K and T338I in exon 7; S549N, G551D, R553X, G542X, Q552X, 1717-1 G?A in exon 11; W1282X and 3905insT in exon 20; N1303K in exon 21 and 3849+10kB C?T in intron 19.
X
ABCC7 p.Arg347His 10952679:30:162
status: NEW[hide] Prenatal detection by real-time quantitative PCR a... Clin Chem. 2000 Sep;46(9):1417-20. Costes B, Girodon E, Vidaud D, Flori E, Ardalan A, Conteville P, Fanen P, Niel F, Vidaud M, Goossens M
Prenatal detection by real-time quantitative PCR and characterization of a new CFTR deletion, 3600+15kbdel5.3kb (or CFTRdele19).
Clin Chem. 2000 Sep;46(9):1417-20., [PMID:10973878]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 The mutations tested were S549N, S549R, R553X, G551D, V520F, ⌬I507, ⌬F508, Q493X, 1717-1G3A, G542X, R560T, R347P, R347H, 3849ϩ4A3G, W1282X, R334W, 1078delT, 3849ϩ10kbC3T, R1162X, N1303K, 3659delC, 3905insT, A455E, R117H, Y122X, 2183AA3G, 2789ϩ5G3A, 1898ϩ1G3A, 621ϩ1G3T, 711ϩ1G3T, and G85E.
X
ABCC7 p.Arg347His 10973878:51:128
status: NEW[hide] Two mild cystic fibrosis-associated mutations resu... J Biol Chem. 2001 Mar 23;276(12):9045-9. Epub 2000 Dec 15. Clain J, Fritsch J, Lehmann-Che J, Bali M, Arous N, Goossens M, Edelman A, Fanen P
Two mild cystic fibrosis-associated mutations result in severe cystic fibrosis when combined in cis and reveal a residue important for cystic fibrosis transmembrane conductance regulator processing and function.
J Biol Chem. 2001 Mar 23;276(12):9045-9. Epub 2000 Dec 15., 2001-03-23 [PMID:11118444]
Abstract [show]
The number of complex cystic fibrosis transmembrane conductance regulator (CFTR) genotypes identified as having double-mutant alleles with two mutations inherited in cis has been growing. We investigated the structure-function relationships of a severe cystic fibrosis (CF)-associated double mutant (R347H-D979A) to evaluate the contribution of each mild mutation to the phenotype. CFTR mutants expressed in HeLa cells were analyzed for protein biosynthesis and Cl(-) channel activity. Our data show that R347H is associated with mild defective Cl(-) channel activity and that the D979A defect leads to misprocessing. The mutant R347H-D979A combines both defects for a dramatic decrease in Cl(-) current. To decipher the molecular mechanism of this phenotype, single and double mutants with different charge combinations at residues 347 and 979 were constructed as charged residues were involved in this complex genotype. These studies revealed that residue 979, located in the third cytoplasmic loop, is critical for CFTR processing and Cl(-) channel activity highlighting the role of charged residues. These results have also important implications for CF, as they show that two mutations in cis can act in concert to alter dramatically CFTR function contributing to the wide phenotypic variability of CF disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 We investigated the structure-function relationships of a severe cystic fibrosis (CF)-associated double mutant (R347H-D979A) to evaluate the contribution of each mild mutation to the phenotype.
X
ABCC7 p.Arg347His 11118444:1:112
status: NEW3 Our data show that R347H is associated with mild defective Cl-channel activity and that the D979A defect leads to misprocessing.
X
ABCC7 p.Arg347His 11118444:3:19
status: NEW4 The mutant R347H-D979A combines both defects for a dramatic decrease in Cl- cur- rent.
X
ABCC7 p.Arg347His 11118444:4:11
status: NEW13 The recent discovery of severe CF associated with a ⌬F508/ R347H-D979A compound heterozygote genotype in two related patients suffering from pancreatic insufficiency and severe respiratory symptoms suggests that the R347H-D979A mutation has an important influence on CFTR processing and/or function (7).
X
ABCC7 p.Arg347His 11118444:13:66
status: NEWX
ABCC7 p.Arg347His 11118444:13:223
status: NEW14 At least four CF-associated mutations have been identified in isolation at position 347 (R347C, R347H, R347L, and R347P) and two at position 979 (D979A and D979V), suggesting that Arg-347 and Asp-979 are important for CFTR structure and/or function.
X
ABCC7 p.Arg347His 11118444:14:96
status: NEW15 The mutation D979A was found in isolation in a patient with a congenital bilateral absence of the vas deferens (8) and the R347H mutation in CF patients with pancreatic sufficiency, congenital bilateral absence of the vas deferens, and no or mild pulmonary symptoms (7).
X
ABCC7 p.Arg347His 11118444:15:123
status: NEW16 As the R347H mutation is mostly associated with mild CF, it was suggested that the D979A mutation has a significant effect on CFTR function when combined in cis with R347H.
X
ABCC7 p.Arg347His 11118444:16:7
status: NEWX
ABCC7 p.Arg347His 11118444:16:166
status: NEW18 The mutations R347H and D979A replace positively charged (Arg) and negatively charged (Asp) residues with ones that are uncharged (His and Ala, respectively) at physiological pH.
X
ABCC7 p.Arg347His 11118444:18:14
status: NEW19 The present study investigates the structure-function relationships of the R347H-D979A double mutant, and as charged residues are involved in this complex genotype, single and double mutants with different charge combinations at residues 347 and 979 were constructed.
X
ABCC7 p.Arg347His 11118444:19:75
status: NEW21 Our data show that R347H is associated with defective chloride channel activity and that the D979A defect leads to misprocessing.
X
ABCC7 p.Arg347His 11118444:21:19
status: NEW22 The mutant R347H-D979A combines both defects for a dramatic decrease in Cl- current.
X
ABCC7 p.Arg347His 11118444:22:11
status: NEW58 We first studied the maturation of CFTR in HeLa cells to determine why patients with the R347H-D979A-CFTR allele suffered from severe CF.
X
ABCC7 p.Arg347His 11118444:58:89
status: NEW64 Immunoprecipitation experiments show that both wild-type and CF-associated mutants R347H, D979A, and R347H-D979A-CFTR cells produced mature, fully glycosylated protein (Fig. 1A; band C), whereas none of the mock-transfected cells produced CFTR (data not shown).
X
ABCC7 p.Arg347His 11118444:64:83
status: NEWX
ABCC7 p.Arg347His 11118444:64:101
status: NEW65 However, the D979A and R347H-D979A mutants produced significantly less band C (59 and 56% of the total CFTR; ratio C/(BϩC)) than wild-type and R347H-CFTR (92 and 91%; see Fig. 1B).
X
ABCC7 p.Arg347His 11118444:65:23
status: NEWX
ABCC7 p.Arg347His 11118444:65:149
status: NEW66 This indicates that the R347H-D979A mutation caused a misprocessing defect.
X
ABCC7 p.Arg347His 11118444:66:24
status: NEW67 The turnover of immature and mature forms of wild-type and R347H-D979A-CFTR proteins was further investigated by pulse-chase experiments (Fig. 1C).
X
ABCC7 p.Arg347His 11118444:67:59
status: NEW68 The kinetics of wild-type and R347H-D979A core-glycosylated and mature forms of CFTR were identical, whereas the efficiency of conversion to mature band C was lower for the mutant.
X
ABCC7 p.Arg347His 11118444:68:30
status: NEW82 C, pulse-chase experiments showing the turnover of the immature and mature forms of wild-type and R347H-D979A-CFTR (results are representative of two independent experiments).
X
ABCC7 p.Arg347His 11118444:82:98
status: NEW84 Altogether, these results indicate that D979A is responsible for the defective processing of R347H-D979A-CFTR and that a negative charge at 979 residue is necessary for proper CFTR processing.
X
ABCC7 p.Arg347His 11118444:84:93
status: NEW93 We separated the contributions of the R347H and D979A mutations to R347H-D979A-CFTR whole-cell Cl- current production studying both single and double mutants.
X
ABCC7 p.Arg347His 11118444:93:38
status: NEWX
ABCC7 p.Arg347His 11118444:93:67
status: NEW96 Mean changes in cAMP-activated currents recorded at 20 mV from R347H (29.4 Ϯ 12.2 pA/pF; n ϭ 8), D979A (67.9 Ϯ 18.9 pA/pF; n ϭ 5), and R347H-D979A (1.2 Ϯ 0.8 pA/pF; n ϭ 9) mutants were significantly different (p Ͻ 0.05) from wild-type (130.2 Ϯ 34.7 pA/pF; n ϭ 5), corresponding to 23, 52, and 1% of the wild-type Cl- current (Fig. 2D).
X
ABCC7 p.Arg347His 11118444:96:63
status: NEWX
ABCC7 p.Arg347His 11118444:96:159
status: NEW97 R347H, D979A, and R347H-D979A were also significantly different from each other (p Ͻ 0.01).
X
ABCC7 p.Arg347His 11118444:97:0
status: NEWX
ABCC7 p.Arg347His 11118444:97:18
status: NEW98 As R347H processing is similar to wild-type, the small Cl- current produced by R347H reflected defective channel properties, as demonstrated by single-channel studies (9).
X
ABCC7 p.Arg347His 11118444:98:3
status: NEWX
ABCC7 p.Arg347His 11118444:98:79
status: NEW100 Thus these data indicate that the R347H-D979A double mutant combined at least D979A misprocessing and the R347H Cl-channel defect to produce a very severe phenotype.
X
ABCC7 p.Arg347His 11118444:100:34
status: NEWX
ABCC7 p.Arg347His 11118444:100:106
status: NEW101 Charge-reversal Mutants-Taking into account the functional defects that result when Arg-347 and Asp-979 are each replaced with an uncharged amino acid such as His (uncharged at pH 7.3) and Ala (R347H and D979A), we constructed additional mutants with different charge combinations at residues 347 and 979, including the R347D-D979R double mutant in which the positive and negative charges were swapped.
X
ABCC7 p.Arg347His 11118444:101:194
status: NEW102 The processing of R347D was similar to those of R347H and the wild-type (Fig. 3, open bars).
X
ABCC7 p.Arg347His 11118444:102:48
status: NEW109 C, current-voltage (I-V) curve in HeLa cells expressing R347H (filled circle), D979A (filled triangle), and R347H-D979A (filled square) mutants.
X
ABCC7 p.Arg347His 11118444:109:56
status: NEWX
ABCC7 p.Arg347His 11118444:109:108
status: NEW118 essing of D979R, R347H-D979R, and R347D-D979R was differently impaired (Fig. 3; gray bars).
X
ABCC7 p.Arg347His 11118444:118:17
status: NEW123 The Cl- current of R347D-D979R (2.8 Ϯ 1.7 pA/pF; n ϭ 9) was not significantly different from those of D979R and R347H-D979A (Fig. 2D).
X
ABCC7 p.Arg347His 11118444:123:124
status: NEW127 Clinical data suggested that R347H and D979A, two mild CF-associated mutations, can produce severe CF similar to that of ⌬F508 homozygotes when combined in cis.
X
ABCC7 p.Arg347His 11118444:127:29
status: NEW129 D979A reduces the amount of CFTR protein at the cell membrane, whereas R347H generates a defective Cl-channel.
X
ABCC7 p.Arg347His 11118444:129:71
status: NEW130 The mutant R347H-D979A combines both defects for a dramatic decrease in Cl- current.
X
ABCC7 p.Arg347His 11118444:130:11
status: NEW131 The magnitude of Cl- current in vitro paralleled the severity of the disease, with D979A (congenital bilateral absence of the vas deferens) Ͼ R347H (mild CF) Ͼ R347H-D979A (severe CF).
X
ABCC7 p.Arg347His 11118444:131:148
status: NEWX
ABCC7 p.Arg347His 11118444:131:172
status: NEW143 First, several lines of experimental evidence indicate that there is probably no direct salt bridge between Arg-347 and Asp-979: (i) removal of either the positive charge at position 347 (R347H and R347D) or the negative charge at position 979 (D979A, D979V, and D979R) has different effects on CFTR processing; (ii) the double-neutral (R347H-D979A) and reversed-charged (R347D-D979R) replacements for Arg-347 and Asp-979 do not lead to the recovery of wild-type processing.
X
ABCC7 p.Arg347His 11118444:143:188
status: NEWX
ABCC7 p.Arg347His 11118444:143:337
status: NEW[hide] Prevalence of CFTR mutations in hypertrypsinaemia ... Clin Genet. 2001 Jan;59(1):42-7. Scotet V, De Braekeleer M, Audrezet MP, Lode L, Verlingue C, Quere I, Mercier B, Dugueperoux I, Codet JP, Moineau MP, Parent P, Ferec C
Prevalence of CFTR mutations in hypertrypsinaemia detected through neonatal screening for cystic fibrosis.
Clin Genet. 2001 Jan;59(1):42-7., [PMID:11168024]
Abstract [show]
Nowadays, most of the neonatal screening programs for cystic fibrosis (CF) combine the assay of immunoreactive trypsinogen (IRT) with the analysis of the most common mutations of the CFTR gene. The efficiency of this strategy is now well established, but the identification of heterozygotes among neonates with increased IRT is perceived as a drawback. We proposed to assess the heterozygosity frequency among the children with hypertrypsinaemia detected through the CF screening program implemented in Brittany (France) 10 years ago, to describe the CFTR mutations detected in them and to determine the frequency of the IVS8-5T variant. The molecular analysis relies, in our protocol, on the systematic analysis of three exons of the gene (7-10-11). A total of 160,019 babies were screened for CF in western Brittany between 1992 and 1998. Of the 1964 newborns with increased IRT (1.2%), 60 were CF and 213 were carriers. Heterozygosity frequency was 12.8%), i.e. 3 times greater than in the general population (3.9%; p < 10(-6)), Variability of mutations detected in carriers was greater than in CF children (21 mutations versus 10) and a high proportion of mild mutations or variants (A349V, R297Q, R347H, V317A, G544S, R553G, etc) was observed in carriers. The allelic frequency of the 5T (5.6%) was not significantly increased in this cohort. This study is consistent with previous ones in finding a significantly higher rate of heterozygotes than expected among neonates with hypertrypsinaemia. The strategy of screening used here allows to highlight the variability of mutations detected in heterozygotes and to show that severe mutations, as well as mild mutations, have been observed in neonates with hypertrypsinaemia. If there is no doubt that neonatal hypertrypsinaemia is associated with an elevated frequency of carriers, the underlying mechanisms remain obscure.
Comments [show]
None has been submitted yet.
No. Sentence Comment
11 Variability of mutations detected in carriers was greater than in CF children (21 mutations versus 10) and a high proportion of mild mutations or variants (A349V, R297Q, R347H, V317A, G544S, R553G, etc) was observed in carriers.
X
ABCC7 p.Arg347His 11168024:11:170
status: NEW74 We noted, among heterozygous children, a high proportion of mild mutations (R297Q, R347H, M348K, A349V, G544S) or for which the pathogenicity is yet impossible to determine (V317A, V322A, R553G).
X
ABCC7 p.Arg347His 11168024:74:83
status: NEW75 The R347H mutation was found at an abnormally high frequency in carrier babies (n=9, i.e. 4.2% of the mutated alleles), whereas only one CF child carrying this mutation was identified over the same period (1.0%).
X
ABCC7 p.Arg347His 11168024:75:4
status: NEW[hide] Frequency of cystic fibrosis transmembrane conduct... Chest. 2001 Mar;119(3):762-7. Marchand E, Verellen-Dumoulin C, Mairesse M, Delaunois L, Brancaleone P, Rahier JF, Vandenplas O
Frequency of cystic fibrosis transmembrane conductance regulator gene mutations and 5T allele in patients with allergic bronchopulmonary aspergillosis.
Chest. 2001 Mar;119(3):762-7., [PMID:11243954]
Abstract [show]
STUDY OBJECTIVE: To assess the frequency of cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in patients with allergic bronchopulmonary aspergillosis (ABPA). DESIGN: Case-control study. All subjects in the study were screened for the presence of 13 mutations in the CFTR gene (R117H, 621 + 1G(-)>T, R334 W, Delta F508, Delta I507, 1717-1G(-)>A, G542X, R553X, G551D, R1162X, 3849 + 10kbC(-)>T, W1282X, and N1303K). Moreover, they were also screened for the presence of the 5T variant in intron 8. SETTING: University hospital and community-based hospital. PATIENTS: Twenty-one white patients with ABPA participated in the study. The presence of CFTR mutations was also investigated in 43 white subjects with allergic asthma who did not show sensitization to Aspergillus fumigatus and in 142 subjects seeking genetic counseling for diseases other than cystic fibrosis (CF). RESULTS: Six patients with ABPA were found to be heterozygous for one CFTR mutation, including Delta F508 (n = 2), G542X (n = 1), R1162X (n = 1), 1717-1G(-)>A (n = 1), and R117H (n = 1). The 5T allele was not detected in ABPA patients. None of the ABPA patients showed sweat chloride concentrations > 60 mEq/L. The frequency of CFTR mutation carriers was significantly higher in ABPA patients (6 of 21 patients; 28.5%) than in control asthmatic subjects (2 of 43 subjects; 4.6%; p = 0.01) and in subjects seeking genetic counseling (6 of 142 subjects; p < 0.001). CONCLUSION: These findings indicate that in patients without a clinical diagnosis of CF, CFTR gene mutations could be involved in the development of ABPA, in association with other genetic or environmental factors.
Comments [show]
None has been submitted yet.
No. Sentence Comment
78 One of these patients was identified as a compound heterozygote (⌬F5085/ R347H), and she was reclassified as having atypical CF.
X
ABCC7 p.Arg347His 11243954:78:80
status: NEW91 In the study by Miller et al,12 only one ABPA patient was identified as carrying two CFTR mutations (⌬F508/R347H).
X
ABCC7 p.Arg347His 11243954:91:114
status: NEW[hide] [Cystic fibrosis and normal sweat chloride values:... Rev Mal Respir. 2001 Sep;18(4 Pt 1):443-5. Lebecque P, Leal T, Godding V
[Cystic fibrosis and normal sweat chloride values: a case-report].
Rev Mal Respir. 2001 Sep;18(4 Pt 1):443-5., [PMID:11547256]
Abstract [show]
In a suggestive context, normal sweat chloride values (<60 mmol/L) do not always suffice to exclude the diagnosis of CF.CASE-REPORT: A 19-year-old female presented with a diagnosis of bronchiectasis. Her past medical history was noteworthy for the onset of respiratory symptoms in the infancy, colonization of the respiratory tract by Pseudomonas aeruginosa for three years and previous treatment for allergic bronchopulmonary aspergillosis. She was heterozygote for the DeltaF 508 mutation of the CFTR gene. Sweat chloride values were repeatedly normal, ranging from 25 to 46 mmol/L. The diagnosis of CF was confirmed by the identification of a second CFTR mutation (D1152H) and the demonstration of typical nasal potential.CONCLUSION: It is now estimated that approximately 2% of CF patients will present an "atypical" phenotype with sweat chloride values<60 mmol/L. For these patients, the diagnosis can be confirmed by the identification of a CF-causing mutation in each CFTR allele or in vivo demonstration of CFTR dysfunction by nasal potential difference study.
Comments [show]
None has been submitted yet.
No. Sentence Comment
73 Dans des situations d`hétérozygotie composite, la présence de certaines d`entre elles a pu être associée de manière occasionnelle ou parfois plus consistante avec un taux de chlorure dans la sueur inférieur à 60 voire même (dans de très rares cas) 30 mmol/L. Dans ce singulier petit groupe, figurent notamment les mutations 3 849 + 10kb C→T, A455E, R117H, , R347H, G551S, D1152H.
X
ABCC7 p.Arg347His 11547256:73:415
status: NEW[hide] Mutations of the cystic fibrosis gene in patients ... Am J Gastroenterol. 2001 Sep;96(9):2657-61. Truninger K, Malik N, Ammann RW, Muellhaupt B, Seifert B, Muller HJ, Blum HE
Mutations of the cystic fibrosis gene in patients with chronic pancreatitis.
Am J Gastroenterol. 2001 Sep;96(9):2657-61., [PMID:11569691]
Abstract [show]
OBJECTIVE: Several studies have reported an increased frequency of cystic fibrosis gene mutations in idiopathic but not in alcoholic chronic pancreatitis. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis has not been analyzed. The aim of our study was to determine the frequency of cystic fibrosis gene mutations in patients with chronic pancreatitis with long-term follow-up and to see whether patients with mutations have a clinically different natural course compared to those without mutations. METHODS: Eighty two patients with chronic pancreatitis and 11 patients with recurrent acute pancreatitis of our well defined pancreatitis cohort were screened for the 31 most common cystic fibrosis gene mutations. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis was assessed. RESULTS: A cystic fibrosis gene mutation was detected in five of 49 patients with alcoholic chronic pancreatitis (10.2%; 2.3 times the expected frequency) and in three of 14 patients with idiopathic-juvenile chronic pancreatitis (21.4%; 4.8 times the expected frequency). No mutations were found in the remaining patients with chronic pancreatitis of rare causes, hereditary pancreatitis, and recurrent acute pancreatitis. The frequency of pancreatic calcifications was significantly higher in patients with alcoholic chronic pancreatitis without mutations. This result was not confirmed in patients with idiopathic-juvenile chronic pancreatitis. The duration of pain and the frequency of exocrine and endocrine insufficiency was comparable in both subgroups irrespective of the mutation status. CONCLUSION: Our data indicate a significantly increased frequency of cystic fibrosis gene mutations both in patients with alcoholic and idiopathic-juvenile chronic pancreatitis. The natural course was similar in patients with mutations compared to those without mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
56 Using multiplex PCR, 15 genomic fragments were amplified which contain the following mutations: ⌬F508, ⌬I507, Q493X, V520F, 1717-1G3A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ϩ 10kbC3T, 3849 ϩ 4A3G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 ϩ 1G3T, R117H, Y122X, 711 ϩ 1G3T; 1078delT, R347P, R347H, R334W, A455E, 1898 ϩ 1G3A, 2183AA3G, 2789 ϩ 5G3A.
X
ABCC7 p.Arg347His 11569691:56:349
status: NEW[hide] Cystic fibrosis phenotype evaluation and paternity... Hum Reprod. 2001 Oct;16(10):2093-7. Josserand RN, Bey-Omar F, Rollet J, Lejeune H, Boggio D, Durand DV, Durieu I
Cystic fibrosis phenotype evaluation and paternity outcome in 50 males with congenital bilateral absence of vas deferens.
Hum Reprod. 2001 Oct;16(10):2093-7., [PMID:11574497]
Abstract [show]
BACKGROUND: Most infertile males with congenital bilateral absence of vas deferens (CBAVD) carry mutations on the cystic fibrosis transmembrane conductance regulator gene and may express mild cystic fibrosis (CF) symptoms. Barriers to paternity for these men can now be overcome by assisted reproduction. Our aims were to investigate the CF-related phenotype and clinical outcome for 50 patients with CBAVD seen at a CF adult centre between 1992 and 1999. METHODS AND RESULTS: The investigation of the patients included screening for 22 CF mutations and identification of the poly-T variant of intron 8, sweat testing, clinical investigation for CF-related extra-genital manifestations, and genetic counselling. CFTR mutations were detected on 56 alleles of the 50 patients. A total of 15 (30%) was compound heterozygote and 26 (52%) heterozygote. In all, 38% of the patients had a positive sweat test. Four patients were diagnosed with typical CF not detected previously. Twenty-one patients became fathers following ICSI (eight cases), artificial insemination by donor or IVF with sperm donor (seven cases) or through adoption (six cases). A mail survey allowed the identification of CF-related clinical symptoms. Information on the occurrence of CF-related symptoms was obtained for 58.5% of patients: in the absence of initial symptoms, no new clinical signs were reported. CONCLUSION: Patients diagnosed with CBAVD need genetic counselling before assisted reproduction. Even when no wish for paternity is expressed, CF gene screening should be associated with at least a sweat test and clinical evaluation because of possible mild forms of CF disease. Medical follow-up did not reveal any new symptoms.
Comments [show]
None has been submitted yet.
No. Sentence Comment
30 Leukocytes samples were analysed for a series of 22 CF mutations including the five most frequently encountered in our region (The CF Genotype Consortium, 1994): ∆F508, G542X, N1303K, 1717-G-A, 885E; and 17 others: R117H, R334W, R347H, R347P, 556delA, S549N, S549I, S549R, G551D, R553X, R560T, G1244E, S1255X, W1282X, R1283K, 3898ins C, D1270N.
X
ABCC7 p.Arg347His 11574497:30:236
status: NEW40 sCFTR mutation was detected in 56 alleles of the 50 patients: ∆F508 in 30 alleles, R117H in six, D1270N in two, G542X in one, 1717ϩG-A in one, 2789ϩ5G-A in one, R347H in one and the 5T allele in 14.
X
ABCC7 p.Arg347His 11574497:40:180
status: NEW45 Description of the 50 men with CBAVD:CF genotype and phenotype Number age CF SCC CF-related (years) genotype (mmol/l) symptoms 1 29 ∆F508/R117H 59 2 35 ∆F508/R117H 54 3 24 ∆F508/R117H 43 4 33 ∆F508/R117H 39 5 26 ∆F508/5T 90 S/B 6 27 ∆F508/5T 67 S 7 32 ∆F508/5T 55 8 30 ∆F508/5T 51 9 31 ∆F508/5T 44 10 44 ∆F508/5T 38 S 11 36 ∆F508/5T 36 S 12 54 ∆F508/5T 21 S 13 31 R117H/R347H 79 S 14 36 1717G-A/5T 50 S 15 32 5T/5T 77 P/DM 16 27 ∆F508/- 94 S 17 41 ∆F508/- 90 S/B 18 30 ∆F508/- 88 19 30 ∆F508/- 82 S 20 32 ∆F508/- 81 21 25 ∆F508/- 79 22 31 ∆F508/- 79 23 27 ∆F508/- 75 S 24 43 ∆F508/- 70 25 38 ∆F508/- 65 26 34 ∆F508/- 52 S 27 31 ∆F508/- 47 S 28 35 ∆F508/- 40 S 29 26 ∆F508/- 39 S 30 25 ∆F508/- 36 31 33 ∆F508/- 33 32 37 ∆F508/- 28 S 33 36 ∆F508/- 18 S 34 33 G542X/- 45 S 35 37 D1270N/- 116 36 34 D1270N/- 103 S/P 37 46 R117H/- 95 39 37 2789ϩ5G-A/- 100 S 40 27 5T/- 90 S 38 30 5T/- 51 44 38 5T/- 45 41 30 -/- 57 S 42 35 -/- 52 S 43 36 -/- 46 B (tobacco) 45 33 -/- 40 S 46 31 -/- 36 S/asthma 47 32 -/- 28 B (tobacco) 48 28 -/- 28 49 30 -/- 26 50 35 -/- 20 S SCC ϭ sweat chloride concentration.
X
ABCC7 p.Arg347His 11574497:45:454
status: NEW49 Results of assisted reproduction procedures Number CF genotype CF mutation in Assisted reproduction procedure women ICSI IVFSD AID adoption 1 ∆F508/R117H 0 failure success 2 ∆F508/R117H failure 3 ∆F508/R117H failure 4 ∆F508/R117H 0 5 ∆F508/5T 0 6 ∆F508/5T success 7 ∆F508/5T ∆F508/- failure 1 8 ∆F508/5T success 9 ∆F508/5T failure 1 10 ∆F508/5T 0 1 11 ∆F508/5T 0 12 ∆F508/5T failure failure 13 R117H/R347H failure failure 14 1717G-A/5T failure 15 5T/5T 0 16 ∆F508/- ∆F508/- 0 success 17 ∆F508/- 0 1 18 ∆F508/- 0 19 ∆F508/- failure 20 ∆F508/- ∆F508/- 0 success 21 ∆F508/- success 22 ∆F508/- failure 23 ∆F508/- failure 24 ∆F508/- in process 25 ∆F508/- 0 1 26 ∆F508/- failure 27 ∆F508/- failure 28 ∆F508/- success 29 ∆F508/- 0 success 30 ∆F508/- failure success 31 ∆F508/- 0 1 32 ∆F508/- 0 33 ∆F508/- success 34 G542X/- failure failure 35 D1270N/- success 36 D1270N/- 0 37 R117H/- failure 39 2789ϩ5G-A/- in process 40 5T/- ∆F508/- 0 38 5T/- failure 44 5T/- 0 success 41 -/- success 42 -/- failure 43 -/- 0 45 -/- in process 46 -/- 0 47 -/- 0 success 48 -/- failure 49 -/- failure 50 -/- success IVFSD ϭ IVF with sperm donor; AID ϭ artificial insemination by donor.
X
ABCC7 p.Arg347His 11574497:49:491
status: NEW[hide] ATB(0)/SLC1A5 gene. Fine localisation and exclusio... Eur J Hum Genet. 2001 Nov;9(11):860-6. Larriba S, Sumoy L, Ramos MD, Gimenez J, Estivill X, Casals T, Nunes V
ATB(0)/SLC1A5 gene. Fine localisation and exclusion of association with the intestinal phenotype of cystic fibrosis.
Eur J Hum Genet. 2001 Nov;9(11):860-6., [PMID:11781704]
Abstract [show]
The Na+-dependent amino acid transporter named ATB(0) was previously found to be located in 19q13.3 by fluorescence in situ hybridisation. Genetic heterogeneity in the 19q13.2-13.4 region, syntenic to the Cystic Fibrosis Modulator Locus 1 (CFM1) in mouse, seemed to be associated to the intestinal phenotypic variation of cystic fibrosis (CF). We performed fine chromosomal mapping of ATB(0) on radiation hybrid (RH) panels G3 and TNG. Based on the most accurate location results from TNG-RH panel, mapping analysis evidenced that ATB(0) is localised between STS SHGC-13875 (D19S995) and STS SHGC-6138 in 19q13.3, that corresponds with the immediately telomeric/distal segment of the strongest linkage region within the human CFM1 (hCFM1) syntenic region. Regarding to the genomic structure and exon organisation, our results show that the ATB(0) gene is organised into eight exons. The knowledge of the genomic structure allowed us to perform an exhaustive mutational analysis of the gene. Evaluation of the possible implication of ATB(0) in the intestinal phenotype of CF was performed on the basis of the functional characteristics of the encoded protein, its apparent relevance to meconium ileus (MI) and position in relation to the hCFM1 syntenic region. We have analysed this gene in samples from CF patients with and without MI. Several sequence variations in the ATB(0) gene were identified, although none of them seemed to be related to the intestinal phenotype of CF. Even though no particular allele or haplotype in ATB(0) appears to be associated to CF-MI disease, new SNPs identified should be useful in segregation and linkage disequilibrium analyses in families affected by other disorders caused by the impairment of neutral amino acid transport.
Comments [show]
None has been submitted yet.
No. Sentence Comment
151 Statistical analysis showed that the higher incidence for P17A and the lower incidence for V512L observed in the general population Table 3 CFTR mutations of the CF patients under study with and without meconium ileus (MI) CF-non MI CF-MI CFTR mutations n CFTR mutations n F508del/R117H 2 F508del/F508del 7 F508del/R334W 3 F508del/L365P 1 F508del/R347P 1 F508del/G542X 1 F508del/621+1G4Ta 1 F508del/621+IG4Ta 1 F508del/M1101K 1 F508del/R1066C 1 F508del/1609delCAa 1 F508del/W1089X 1 F508del/2789+5G4Aa 3 F508del/R1162X 1 F508del/3849+10kbC4T 1 F508del/1609delCAa 1 G542X/G85E 1 F508del/Q1281X 1 G542X/V232D 1 F508del/1811+1.6kbA4G 1 G542X/1811+1.6kb A4Ga 1 F508del/2789+5G4Aa 1 G542X/2789+5G4A 1 F508del/2869insG 1 Q890X/L206W 1 F508del/unknown 1 1811+1.6kbA4G/P205S 1 I507del/I507del 1 R1162X/3272-26A4G 1 G542X/1078delT 1 N1303K/R347H 1 G542X/1811+1.6kbA4Ga 1 N1303K/A1006E+5T 1 S549R/CFTR50kbdel 1 2789+5G4A/405+1G4A 1 R1066C/R1066C 1 W1282X/712-1G4T 1 a CF patient with a sibling presenting identical CFTR genotype and discordance of intestinal phenotype.
X
ABCC7 p.Arg347His 11781704:151:831
status: NEW[hide] Cystic fibrosis mutation testing in Italy. Genet Test. 2001 Fall;5(3):229-33. Bombieri C, Pignatti PF
Cystic fibrosis mutation testing in Italy.
Genet Test. 2001 Fall;5(3):229-33., [PMID:11788089]
Abstract [show]
In Italy, Cystic fibrosis (CF) mutation frequency differences have been observed in different regions. In the northeastern Veneto and Trentino Alto Adige regions, a complete cystic fibrosis transmembrane conductance regulator (CFTR) gene screening in CF patients detected through a newborn screening program has identified about 90% of the mutations. In these two regions, the current detection rate using a CF screening panel containing the 16 most common mutations is 86.6%. CF mutations in some other Italian regions have not been so thoroughly analysed. Available data indicate that a more general national screening panel comprising 31 mutations may detect about 75% of all CF mutations in Italy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
44 CF GENE MUTATIONS IN ITALY Number of alleles Frequency Cumulative Mutation screened (%) frequency (%) DF508 3442 51.07 51.07 N1303K 3056 4.84 55.91 G542X 3082 4.83 60.75 2183 AA ® G 2596 2.66 63.41 R1162X 2580 2.42 65.83 1717-1 G ® A 2892 2.11 67.94 W1282X 2600 1.23 69.17 R553X 2882 1.15 70.31 T338I 2306 0.69 71.01 R347P 2642 0.61 71.61 711 1 5 G ® A 2454 0.57 72.18 G85E 1980 0.40 72.59 621 1 1 G ® T 2594 0.39 72.97 R334W 2366 0.30 73.27 R352Q 2112 0.24 73.50 S549N 2118 0.24 73.74 R347H 2184 0.18 73.92 L1077P 1840 0.16 74.09 R1158X 1878 0.16 74.25 541del C 1884 0.16 74.40 R1066H 1918 0.16 74.56 E585X 1922 0.16 74.72 Q552X 2172 0.14 74.86 D1152H 1824 0.11 74.97 2790-2 A ® G 1862 0.11 75.07 3132 del TG 1862 0.11 75.18 3667ins 4 1876 0.11 75.29 DI507 1914 0.10 75.39 1898 1 3 A ® G 1920 0.10 75.50 G1244E 1960 0.10 75.60 1784 del G 2052 0.10 75.69 From Rendine et al. (1997).
X
ABCC7 p.Arg347His 11788089:44:506
status: NEW[hide] Genetic and clinical features of false-negative in... Acta Paediatr. 2002;91(1):82-7. Padoan R, Genoni S, Moretti E, Seia M, Giunta A, Corbetta C
Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis.
Acta Paediatr. 2002;91(1):82-7., [PMID:11883825]
Abstract [show]
A study was performed on the delayed diagnosis of cystic fibrosis (CF) in infants who had false-negative results in a neonatal screening programme. The genetic and clinical features of false-negative infants in this screening programme were assessed together with the efficiency of the screening procedure in the Lombardia region. In total, 774,687 newborns were screened using a two-step immunoreactive trypsinogen (IRT) (in the years 1990-1992), IRT/IRT + delF508 (1993-1998) or IRT/IRT + polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) protocol (1998-1999). Out of 196 CF children born in the 10 y period 15 were false negative on screening (7.6%) and molecular analysis showed a high variability in the genotypes. The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E. In three patients no mutation was identified after denaturing gradient gel electrophoresis of the majority of CFTR gene exons. Conclusion: The clinical phenotypes of CF children diagnosed by their symptoms at different ages were very mild. None of them presented with a severe lung disease. The majority of them did not seem to have been damaged by the delayed diagnosis. The combination of IRT assay plus genotype analysis (1998-1999) appears to be a more reliable method of detecting CF than IRT measurement alone or combined with only the delF508 mutation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
34 It was initially performed by polyacrylamide gel electrophoretic (PAGE) analysis for the delF508 mutation, and later by polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) (31 mutations: G85E, 621 ‡ 1G ® T, R117H, Y122X, 711 ‡ 1G ® T, 1078delT, R347P, R347H, R334W, A455E, 1898 ‡ 1G ® A, 2183-AA ® G, 2789 ‡ 5G ® A, DelF508, I507del, Q493X, V520F, 1717-1G ® A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ‡ 10kbC ® T, 3849 ‡ 4A ® G, R1162X, 3659delC, W1282X, 3905insT, N1303K) (14).
X
ABCC7 p.Arg347His 11883825:34:297
status: NEW[hide] Mutations of the cystic fibrosis gene and intermed... Am J Respir Crit Care Med. 2002 Mar 15;165(6):757-61. Lebecque P, Leal T, De Boeck C, Jaspers M, Cuppens H, Cassiman JJ
Mutations of the cystic fibrosis gene and intermediate sweat chloride levels in children.
Am J Respir Crit Care Med. 2002 Mar 15;165(6):757-61., 2002-03-15 [PMID:11897640]
Abstract [show]
The incidence of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in children with intermediate sweat chloride levels is unknown. The results of 2,349 sweat tests performed at two Belgian university hospitals were reviewed. Intermediate chloride concentrations were observed in 98 subjects (4.2%), 68 being younger than 18 years of age. Forty-three children could be traced and their parents agreed to take part in the study. Exhaustive analysis of the CFTR gene disclosed a total of 24 putative mutations (27.9%). Three subjects were found to carry only one CFTR mutation, whereas 10 harbored one mutation on both CFTR genes. These 10 children were investigated in detail. At the time of writing, the mean age (+/-SD) of this group is 8.9 years (+/-4.2 years). Nine children are pancreatic sufficient. Three have been asymptomatic for more than two years, whereas the others display, to different degrees, clinical features suggestive of CF. The sweat chloride concentration is slightly higher in this group (39.4 +/- 5.4 mM) than in subjects without CFTR mutation (35.2 +/- 4.4 mM, p < 0.05). The nasal potential difference was abnormal in five of the nine subjects tested. In this study, 23% of children displaying intermediate sweat chloride levels were found to carry a putative mutation on both CFTR genes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
77 C→T (6-9), R347H (12), G551S (13), D1152H (14), R117H (15, 16), and R117C (17) mutations.
X
ABCC7 p.Arg347His 11897640:77:18
status: NEW[hide] The relationship between genotype and exercise tol... Am J Respir Crit Care Med. 2002 Mar 15;165(6):762-5. Selvadurai HC, McKay KO, Blimkie CJ, Cooper PJ, Mellis CM, Van Asperen PP
The relationship between genotype and exercise tolerance in children with cystic fibrosis.
Am J Respir Crit Care Med. 2002 Mar 15;165(6):762-5., 2002-03-15 [PMID:11897641]
Abstract [show]
The relationship between fitness and genotype in children with cystic fibrosis (CF) and at least one copy of the DeltaF508 mutation was examined. Genotype was classified according to the second CF mutation. Fitness was measured by peak aerobic capacity (using a modified Bruce protocol during treadmill exercise) and anaerobic power (using the Wingate test on a cycle ergometer). The class of cystic fibrosis transmembrane regulator proteins (CFTR) mutation was statistically related with aerobic capacity, peak anaerobic power, body mass index, lung function (forced expiratory volume in one second), and disease severity as measured by the Shwachman score. Patients with mutations causing defective CFTR production (Class I) or processing (Class II) had a significantly lower peak aerobic capacity (28.6 +/- 4.2 ml/kg/min and 31.7 +/- 5.4 ml/kg/min, respectively) than those with a mutation conferring defective regulation of CFTR (Class III) (43.9 +/- 6.4 ml/kg/min). The peak anaerobic power in subjects with mutations inducing decreased CFTR conduction (Class IV) or CFTR mRNA (Class V), were significantly higher (11.4 +/- 1.7 and 11.6 +/- 1.5 watts/kg, respectively) than children with Class I (9.7 +/- 1.4 watts/kg), Class II (9.8 +/- 1.4 watts/kg), or Class III (10.5 +/- 1.8 watts/kg) mutations. There were no statistically significant differences in the lung function of patients with the different mutations. These results indicate a relationship between CF genotype and some measures of fitness, the mechanisms of which remain to be determined.
Comments [show]
None has been submitted yet.
No. Sentence Comment
82 II ⌬F508 (36), W1282X (1) III G551D (10), N1303K (4), R560T (2), A559T (1) IV R117H (14), R347H (3) V 3849 ϩ 10KbC→T (7), 3120G→A (3) AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE VOL 165 2002 All patients were recruited from a single center, and the sample size of this study was large compared with previously published studies of exercise capacity in children with CF (21).
X
ABCC7 p.Arg347His 11897641:82:97
status: NEW[hide] Sinobronchial allergic mycosis: the SAM syndrome. Chest. 2002 May;121(5):1670-6. Venarske DL, deShazo RD
Sinobronchial allergic mycosis: the SAM syndrome.
Chest. 2002 May;121(5):1670-6., [PMID:12006459]
Abstract [show]
We contend that the presence of concomitant allergic fungal sinusitis (AFS) and allergic bronchopulmonary mycosis in the same patient represents an expression of the same process of fungal hypersensitivity in the upper and lower airways. We have termed this process the SAM syndrome, an acronym for sinobronchial allergic mycosis. Diagnostic criteria have been established for the SAM syndrome, and the clinical characteristics of one previously unreported and four previously reported patients have been tabulated. Patients with the SAM syndrome have chronic sinusitis involving multiple sinuses, asthma, immediate cutaneous reactivity to fungal allergens, peripheral eosinophilia, and radiographic evidence of bronchiectasis. Total serum IgE levels are usually elevated as well. A variety of chest radiographic abnormalities may occur, ranging from mass lesions to diffuse pulmonary infiltrates and even normal findings on chest radiographs. Patients present for an evaluation of either sinus or lung disease and, at that time, demonstrate no clinical features that distinguish them from patients with isolated sinus or lung disease. All patients reported to date have had clinical responses to therapy with corticosteroids. We postulate that SAM is underdiagnosed in patients with AFS, a disease recently reported from medical centers in the southeastern and western United States. Moreover, since our patient had a mutation in the cystic fibrosis transmembrane conductor regulator (CFTR) gene, we further hypothesize that CFTR gene mutations may play an important role in the pathogenesis of the SAM syndrome.
Comments [show]
None has been submitted yet.
No. Sentence Comment
115 Miller et al11 analyzed the CFTR gene in 11 patients with ABPM and found that 1 patient carried two CF mutations (⌬F508/R347H) and 5 patients carried one mutation (⌬F508, 4 patients; R117H, 1 patient).
X
ABCC7 p.Arg347His 12006459:115:127
status: NEW[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]
Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL.
X
ABCC7 p.Arg347His 12007216:109:3842
status: NEW112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL.
X
ABCC7 p.Arg347His 12007216:112:1643
status: NEW[hide] Prenatal detection of cystic fibrosis by ultrasono... J Med Genet. 2002 Jun;39(6):443-8. Scotet V, De Braekeleer M, Audrezet MP, Quere I, Mercier B, Dugueperoux I, Andrieux J, Blayau M, Ferec C
Prenatal detection of cystic fibrosis by ultrasonography: a retrospective study of more than 346 000 pregnancies.
J Med Genet. 2002 Jun;39(6):443-8., [PMID:12070257]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
196 The heterozygous fetuses carried a severe molecular abnormality (∆F508 (n=9) or G542X (n=1)), except one who carried a mild mutation (R347H).
X
ABCC7 p.Arg347His 12070257:196:141
status: NEW202 Therefore, the second mutation Table 1 Incidence of cystic fibrosis and CF heterozygosity among fetuses with echogenic bowel in Brittany, France (1991-2000) Fetuses with echogenic bowel 142 Affected fetuses Number 14 Incidence 1/10 Genotypes ∆F508/∆F508 9 ∆F508/4005+1G→A 1 ∆F508/3129del4 1 ∆F508/Q220X 1 ∆F508/W1282X 1 ∆F508/1717-1G→A 1 CF incidence in the general population during the present study 1/2987 Risk of CF: echogenic bowel fetuses/general population 294 Heterozygous fetuses Number 11 Incidence 1/13 Mutations ∆F508 9 G542X 1 R347H 1 CF heterozygosity in the general population during the present study 1/28 Risk of CF heterozygosity: echogenic bowel fetuses/general population 2.2 Letter www.jmedgenet.com will be identified in 88.5% of the 22.6% of fetuses for which the first analysis identified only one mutation (that is, in 20.0% of all CF fetuses).
X
ABCC7 p.Arg347His 12070257:202:610
status: NEW244 This was also observed in heterozygotes, excepted for one case (mutation R347H).
X
ABCC7 p.Arg347His 12070257:244:73
status: NEW[hide] Predicting the risk of cystic fibrosis with abnorm... Am J Med Genet. 2002 Jun 15;110(2):109-15. Muller F, Simon-Bouy B, Girodon E, Monnier N, Malinge MC, Serre JL
Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases.
Am J Med Genet. 2002 Jun 15;110(2):109-15., 2002-06-15 [PMID:12116247]
Abstract [show]
Hyperechogenic fetal bowel is prenatally detected by ultrasound during the second trimester of pregnancy in 0.1-1.8% of fetuses. It has been described as a normal variant but has often been associated with severe diseases, notably cystic fibrosis (CF). The aim of our study was to determine the risk of CF in a prospective study of 641 fetuses with ultrasonographically abnormal fetal bowel and the residual risk when only one mutation is detected in the fetus. Fetal cells and/or parental blood cells were screened for CFTR mutations. Two screening steps were used, the first covering the mutations most frequently observed in French CF patients (mutation detection rate of 70-90%) and, when a CF mutation was detected, a DGGE-sequencing strategy. We observed a 3.1% risk of CF when a digestive tract anomaly was prenatally observed at routine ultrasound examination. The risk was higher when hyperechogenicity was associated with bowel dilatation (5/29; 17%) or with the absence of gall bladder (2/8; 25%). The residual risk of CF was 11% when only one CF mutation was detected by the first screening step, thereby justifying in-depth screening. Mutations associated with severe CF (DeltaF508 mutation) were more frequently observed in these ultrasonographically and prenatally detected CF cases. However, the frequency of heterozygous cases was that observed in the normal population, which demonstrates that heterozygous carriers of CF mutations are not at increased risk for hyperechogenic bowel. In conclusion, fetal bowel anomalies indicate a risk of severe cystic fibrosis and justify careful CFTR molecular analysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
52 T, 1078delT, R347P, R347H, R334W, A455E, 1898 þ 1G !
X
ABCC7 p.Arg347His 12116247:52:20
status: NEW[hide] Genotype-phenotype correlation in cystic fibrosis:... Am J Med Genet. 2002 Jul 22;111(1):88-95. Salvatore F, Scudiero O, Castaldo G
Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes.
Am J Med Genet. 2002 Jul 22;111(1):88-95., 2002-07-22 [PMID:12124743]
Abstract [show]
More than 1,000 mutations have been identified in the cystic fibrosis (CF) transmembrane regulator (CFTR) disease gene. The impact of these mutations on the protein and the wide spectrum of CF phenotypes prompted a series of Genotype-Phenotype correlation studies. The CFTR genotype is invariably correlated with pancreatic status-in about 85% of cases with pancreatic insufficiency and in about 15% of cases with pancreatic sufficiency. The correlations between the CFTR genotype and pulmonary, liver, and gastrointestinal expression are debatable. The heterogeneous phenotype in CF patients bearing the same genotype or homozygotes for nonsense mutations implicated environmental and/or genetic factors in the disease. However, the discordant phenotype observed in CF siblings argued against a major role of environmental factors and suggested that genes other than CFTR modulate the CF phenotype. A locus that modulates gastrointestinal expression was identified in mice and subsequently in humans. By analyzing nine CF patients discordant for meconium ileus we were able to show that this locus had a dominant effect. Moreover, in a collaborative study we found a higher rate of polymorphisms in beta-defensin genes 1 and 2 in CF patients and in controls. In another multicenter study mutations in alpha-1 antitrypsin (A1AT) and mannose binding lectin genes were found to be independent risk factors for liver disease in CF patients. The body of evidence available suggests that the variegated CF phenotype results from complex interactions between numerous gene products.
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 A series of mutations usually associated with pancreatic sufficiency have been identified and defined as ''mild`` with reference to pancreatic status [Kerem et al., 1989c]: G85E, G91R, R117H, E193K, P205S, R334W, T338I, R347H, R347L, R347P, R352Q, A455E, S492F, S549N, P574H, D579G, 711 þ 5 G > A, C866Y, F1052V, H1054D, R1066H, R1068H, H1085R, D1152H, S1159P, S1251N, F1286S, G1349D, 2789 þ 5 G > A, and 3849 þ 10kb C > T [Dean et al., 1990; Cutting et al., 1990a; Cremonesi et al., 1992; Highsmith et al., 1994].
X
ABCC7 p.Arg347His 12124743:46:220
status: NEW[hide] Screening for cystic fibrosis in newborn infants: ... J Med Screen. 2002;9(2):60-3. Corbetta C, Seia M, Bassotti A, Ambrosioni A, Giunta A, Padoan R
Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population.
J Med Screen. 2002;9(2):60-3., [PMID:12133923]
Abstract [show]
OBJECTIVE: To assess the performance of a two tier neonatal screening programme (IRT/DNA/IRT) for cystic fibrosis, based on immunoreactive trypsinogen (IRT) followed by direct cystic fibrosis transmembrane conductance regulator (CFTR) gene analysis (based on a panel of up to 31 mutations) in hypertrypsinaemic newborn infants and to compare it with a previous screening protocol. SETTING: The study comprised all the newborn infants in the period 1 October 1998 to 31 December 1999 in the Lombardia region, north western Italy. METHODS: The screening strategy consisted of an immunoreactive trypsinogen assay from dried blood spots, a polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (PCR-OLA), and a sequence code separation. RESULTS: 104 609 newborn infants were screened. 1457 hypertrypsinaemic infants (1.39%) were analysed with the PCR-OLA assay. 18 newborn homozygotes or compound heterozygotes for CFTR mutations were identified and referred to the cystic fibrosis (CF) centre at a mean age of 3 weeks. 125 infants presenting only one mutation were recalled for a sweat test: a diagnosis of CF was made in 13 infants, and parents of 112 neonates identified as carriers (1:13) received genetic counselling. The remaining 1314 hypertrypsinaemic newborn infants were recalled for IRT retesting and 177 were referred for a sweat test because the second IRT measurement was above the cut off value. Among this group a further two infants were diagnosed with CF (1.1%) leading to a CF prevalence of 1:3170. CONCLUSIONS: This strategy resulted in an early and accurate diagnosis of CF. The IRT/DNA/IRT protocol with an OLA assay was shown to be useful in an Italian population with a genetic heterogeneity, leading to the identification of 94% of infants with CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
266 Mutations identified by the assay are G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183-AA→G, 2789+5G→A, delF508, I507del, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, and N1303K.
X
ABCC7 p.Arg347His 12133923:266:109
status: NEW285 The CFTR mutations identified and their frequencies among carriers were as follows: delF508 (72 chromosomes, 64.2%), N1303K (12, 10.7%), R117H (9, 8%), G542X (7, 6.25%), R347H, R1162X, 2789+5G→A (2 alleles each, 1.8%), 1898+1G→A, 1717-1G→A, W1282X, 2183-AA→G, 621+1G→T, and 3849+10kbC→T (1, 0.9%).
X
ABCC7 p.Arg347His 12133923:285:170
status: NEW[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]
Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997).
X
ABCC7 p.Arg347His 12151438:20:695
status: NEW[hide] Spatial and temporal distribution of cystic fibros... Hum Genet. 2002 Sep;111(3):247-54. Epub 2002 Aug 1. Scotet V, Gillet D, Dugueperoux I, Audrezet MP, Bellis G, Garnier B, Roussey M, Rault G, Parent P, De Braekeleer M, Ferec C
Spatial and temporal distribution of cystic fibrosis and of its mutations in Brittany, France: a retrospective study from 1960.
Hum Genet. 2002 Sep;111(3):247-54. Epub 2002 Aug 1., [PMID:12215837]
Abstract [show]
Cystic fibrosis (CF) is the most common severe inherited disorder that affects children in Caucasian populations. The aim of this study was to define the spatial and temporal distribution of CF and its mutations in Brittany (western France) where the frequency of the disease is high. We retrospectively registered all CF patients born in Brittany since 1960 by cross-checking various data sources (e.g. medical care centres, genetics laboratories, hospital archives). Councils were contacted so that the place of residence of patients at birth could be determined. Moreover, the spectrum of CF transmembrane conductance regulator (CFTR) mutations and their spatial distribution across Brittany were determined. A total of 520 patients was registered in this study. The incidence of CF was assessed according to administrative (department, district) and diocesan divisions of Brittany and its evolution analysed over four decades. The incidence of CF was 1/2630, with a west/east gradient that was confirmed over time (Finistere: 1/2071 vs Ille-et-Vilaine: 1/3286). At present, the incidence of CF is decreasing, mainly as a result of prenatal diagnosis. An excellent mutation detection rate of 99.7% was obtained. Western Brittany presented a specific spectrum of mutations: 1078delT (9.4% of mutated alleles in the diocese of Cornouaille), G551D (7.7% in the diocese of Leon), 4005+1G-->A (2.9% in Cornouaille) and W846X (1.5% in western Brittany). On the other hand, the eastern region showed a spectrum more similar to the overall picture in France as a whole. This study enabled a precise measurement of the incidence of CF in Brittany to be obtained. The high frequency of the CFTR mutated alleles may result from founder effects and genetic drifts. Moreover, the study brings together the regional specificities of the CFTR gene and highlights disparities that exist in this part of France, both in incidence and in mutation distribution. These are attributable to different degrees of isolation and of population movements between the eastern and western parts of the region. Given that this is the first time that such a detailed study of the CFTR gene has been performed on a large population, this heightened knowledge of the epidemiology of CF in Brittany should provide a basis for the improvement of diagnostic strategies and refinement of genetic counselling.
Comments [show]
None has been submitted yet.
No. Sentence Comment
118 His genotype was ∆F508/∆F508 Mutation Exon Basse-Bretagne Haute-Bretagne Brittanya ∆F508 10 446 75.6% 224 73.7% 672 75.0% 1078delT 7 31 5.3% 3 1.0% 34 3.8% G551D 11 21 3.6% 12 3.9% 33 3.7% N1303K 21 3 0.5% 9 3.0% 12 1.3% W846X 14a 9 1.5% 1 0.3% 10 1.1% 2789+5G→A 14b 3 0.5% 6 2.0% 9 1.0% 1717-1G→A 11 5 0.8% 3 1.0% 8 0.9% Y1092X 17b 1 0.2% 6 2.0% 7 0.8% 4005+1G→A 20 6 1.0% 1 0.3% 7 0.8% E60X 3 3 0.5% 3 1.0% 6 0.7% 621+1G→T 4 3 0.5% 3 1.0% 6 0.7% R347H 7 6 1.0% 0 0.0% 6 0.7% S492F 10 2 0.3% 3 1.0% 5 0.6% G542X 11 4 0.7% 1 0.3% 5 0.6% 3272-26A→G 17b 2 0.3% 3 1.0% 5 0.6% R117H 4 3 0.5% 1 0.3% 4 0.4% G91R 3 3 0.5% 0 0.0% 3 0.3% ∆I507 10 1 0.2% 2 0.7% 3 0.3% R553X 11 3 0.5% 0 0.0% 3 0.3% W1282X 20 2 0.3% 1 0.3% 3 0.3% A72D 3 0 0.0% 2 0.7% 2 0.2% G85E 3 0 0.0% 2 0.7% 2 0.2% F311L 7 0 0.0% 2 0.7% 2 0.2% 1221delCT 7 2 0.3% 0 0.0% 2 0.2% R560K 11 0 0.0% 2 0.7% 2 0.2% 2622+1G→A 13 2 0.3% 0 0.0% 2 0.2% S945L 15 0 0.0% 2 0.7% 2 0.2% I1234V 19 2 0.3% 0 0.0% 2 0.2% G1249R 20 2 0.3% 0 0.0% 2 0.2% 3905insT 20 2 0.3% 0 0.0% 2 0.2% Unidentified - 3 0.5% 0 0.0% 3 0.3% Total - 590 65.7% 304 34.3% 896 100% IVS17bTA, IVS17bCA) of Irish, Scottish, English, Breton and Czech subjects who were carriers of this mutation, and showed that all these alleles carried a unique haplotype (16-7-17), testifying to the Celtic origin of this mutation (Cashman et al. 1995).
X
ABCC7 p.Arg347His 12215837:118:497
status: NEW[hide] Demographics of the UK cystic fibrosis population:... Eur J Hum Genet. 2002 Oct;10(10):583-90. McCormick J, Green MW, Mehta G, Culross F, Mehta A
Demographics of the UK cystic fibrosis population: implications for neonatal screening.
Eur J Hum Genet. 2002 Oct;10(10):583-90., [PMID:12357328]
Abstract [show]
The objective was to determine the composition of the Cystic Fibrosis (CF) Population attending specialist UK CF centres in terms of age, gender, age at diagnosis, genotype and ethnicity. With the planned introduction of the national CF screening programme in the UK, cystic fibrosis transmembrane regulator (CFTR) mutations were compared between different ethnic groups enabling a UK-specific frequency of mutations to be defined. Data were analysed from the patient biographies held in the UK CF Database (see www.cystic-fibrosis.org.uk). The currently registered population of 5,274 CF patients is 96.3% Caucasian with a male preponderance that significantly increases with age. The majority of the 196 non-Caucasian CF patients are from the Indian Subcontinent (ISC), of which one in 84 UK CF patients are of Pakistani origin. The commonest CFTR mutation, deltaF508, is found in 74.1% of all CF chromosomes. In the Caucasian CF population, 57.5% are deltaF508 homozygotes but the UK ISC CF population with only 24.7%, has significantly fewer deltaF508 homozygotes patients (95% confidence interval (CI) 0.2-0.4). The distribution of Caucasian patients with deltaF508/deltaF508, deltaF508/Other and Other/Other does not fit the expected distribution with a Hardy-Weinberg model unless those patients without a detected mutation are excluded (P<0.001). The UK CF Database has shown the UK CF population to have distinct characteristics separate from the North American and European CF Registries. The ISC group contains many mutations not recognised by current genetic analysis, and one in four ISC patients have no CFTR mutations identified. The CFTR analysis proposed for the screening programme would detect 96% of patients registered in the database, but is unlikely to achieve the desired >80% detection rates in the ethnic minority groups. Screen-positive, non-Caucasian infants without an identifiable CFTR mutation should be referred for a sweat test and genetic counselling when serum trypsinogen concentrations remain elevated after birth.
Comments [show]
None has been submitted yet.
No. Sentence Comment
83 The additional eleven are S549N, 3849+4A?G, 3905insT, 2789+5G?A, Y122X, 711+1G?T, R347P, R347H, R334W, A455E and 3281AA?G.
X
ABCC7 p.Arg347His 12357328:83:89
status: NEW[hide] Highest heterogeneity for cystic fibrosis: 36 muta... Am J Med Genet. 2002 Dec 1;113(3):250-7. Kilinc MO, Ninis VN, Dagli E, Demirkol M, Ozkinay F, Arikan Z, Cogulu O, Huner G, Karakoc F, Tolun A
Highest heterogeneity for cystic fibrosis: 36 mutations account for 75% of all CF chromosomes in Turkish patients.
Am J Med Genet. 2002 Dec 1;113(3):250-7., 2002-12-01 [PMID:12439892]
Abstract [show]
We analyzed the CFTR locus in 83 Turkish cystic fibrosis patients to identify mutations, haplotypes, and the carrier frequency in the population. We detected 36 different mutations in 125 (75%) of the total 166 CF chromosomes. Seven novel mutations were identified: four missense (K68E, Q493P, E608G, and V1147I), two splice-site (406 -3T > C and 3849 +5G > A), and one deletion (CFTRdele17b,18). The data showed that the Turkish population has the highest genetic heterogeneity at the CFTR locus reported so far. The results of this thorough molecular analysis at the CFTR locus of a population not of European descent shows that CF is not uncommon in all such populations. The large number of mutations present, as well as the high heterogeneity in haplotypes associated with the mutations suggests that most of the mutations have persisted for a long time in the population. Consistently, the carrier frequency is assessed to be high, indicating that the disease in the population is ancient.
Comments [show]
None has been submitted yet.
No. Sentence Comment
131 Our results were quite different than those of the collaborated work on CF mutations in European countries, which reported E92X and R347H to be as frequent as 1677delTA in Turkey [Estivill et al., 1997].
X
ABCC7 p.Arg347His 12439892:131:132
status: NEW[hide] Analysis of cystic fibrosis transmembrane conducta... Am J Med Genet A. 2003 Jul 1;120A(1):72-6. Timmreck LS, Gray MR, Handelin B, Allito B, Rohlfs E, Davis AJ, Gidwani G, Reindollar RH
Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina.
Am J Med Genet A. 2003 Jul 1;120A(1):72-6., 2003-07-01 [PMID:12794695]
Abstract [show]
The relationship between cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations and congenital absence of the uterus and vagina (CAUV) was examined. CFTR mutations have previously been associated with congenital bilateral absence of the vas deferens (CBAVD). CBAVD is caused by a disruption in the vas deferens, a Wolffian duct derivative. Because the embryologic development of the Mullerian ducts directly depends on the prior normal development of the Wolffian ducts, the same gene products may be necessary for normal embryologic development of both ductal systems. This study evaluated the role of CFTR mutations in the development of CAUV. DNA samples from 25 patients with CAUV were tested for the presence of 33 of the most common CFTR mutations. Protein-coding DNA fragments from the CFTR gene were amplified in vitro by the polymerase chain reaction (PCR) and analyzed for mutations using allele-specific oligonucleotide (ASO) probes. Two patients were heterozygous for CFTR mutations. One was heterozygous for the W1282X mutation and the other was heterozygous for the DeltaF508 mutation. The incidence of the 33 CFTR mutations found in the patients with CAUV (8%) was twice that found in the general population (4%), but much less than the incidence of CFTR mutations in men with CBAVD (80%). This data suggests that it is unlikely for CFTR mutations to cause CAUV in females as they cause CBAVD in some males. Furthermore, the data suggest that CAUV in females may be the same disorder as CBAVD in males who do not have CFTR mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
82 CFTR Gene Mutations Tested DF508 R334W Y1092X 5T variant Y122X R347H G542X S549R 3,849 þ 4 G551D 3,849 þ 10 kb 2,789 þ 5 W1282X R553X 711 þ 1 3,905 þ T 621 þ 1 1,898 þ 1 N1303K 1,717À1 R1162X R117H 1078dT A455E D1507 Q493X 218dA R347P V520F G85E R560T S549N 3659dC Wolffian duct must occur at a time when the Mu¨llerian duct is no longer dependent on the Wolffian duct for development.
X
ABCC7 p.Arg347His 12794695:82:63
status: NEW[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]
Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.
Comments [show]
None has been submitted yet.
No. Sentence Comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering.
X
ABCC7 p.Arg347His 12815607:64:596
status: NEW76 Number Frequency Number Frequency 1652_1655del 3 bp F508del 384 75.6% 196 73.1% 582 74.8% 1784G>A G551D 17 3.3% 12 4.5% 29 3.7% 1078delT 25 4.9% 3 1.1% 28 3.6% 4041C>G N1303K 3 0.6% 8 3.0% 11 1.4% 2670G>A W846X2 7 1.4% 1 0.4% 8 1.0% 1717-1G>A 5 1.0% 3 1.1% 8 1.0% 3408C>A Y1092X 1 0.2% 6 2.2% 7 0.9% 2789+5G>A 2 0.4% 4 1.5% 6 0.8% 4005+1G>A 5 1.0% 1 0.4% 6 0.8% 310G>T E60X 3 0.6% 2 0.7% 5 0.6% 621+1G>T 2 0.4% 3 1.1% 5 0.6% 1172G>A R347H 5 1.0% 5 0.6% 1756G>T G542X 4 0.8% 1 0.4% 5 0.6% 482G>A R117H 3 0.6% 1 0.4% 4 0.5% 3272-26A>G 2 0.4% 2 0.7% 4 0.5% 1648_1653delATC I507del 1 0.2% 2 0.7% 3 0.4% 1789C>T R553X 3 0.6% 3 0.4% 3978G>A W1282X 2 0.4% 1 0.4% 3 0.4% Unidentified Unidentified 3 0.6% 3 0.4% Total Total 508 100.0% 268 100.0% 778 100.0% Basse-Bretagne Haute-Bretagne Brittany * Amino acid change Nucleotide change Table 3: Distribution of the Main CFTR Nutations Observed in the Irish Cohorts (Dublin and Cork) The 62 mutations detected in Brittany combined to give 81 different genotypes in CF patients.
X
ABCC7 p.Arg347His 12815607:76:433
status: NEW[hide] Molecular consequences of cystic fibrosis transmem... Gut. 2003 Aug;52(8):1159-64. Ahmed N, Corey M, Forstner G, Zielenski J, Tsui LC, Ellis L, Tullis E, Durie P
Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas.
Gut. 2003 Aug;52(8):1159-64., [PMID:12865275]
Abstract [show]
BACKGROUND AND AIMS: We tested the hypothesis that the actual or predicted consequences of mutations in the cystic fibrosis transmembrane regulator gene correlate with the pancreatic phenotype and with measures of quantitative exocrine pancreatic function. METHODS: We assessed 742 patients with cystic fibrosis for whom genotype and clinical data were available. At diagnosis, 610 were pancreatic insufficient, 110 were pancreatic sufficient, and 22 pancreatic sufficient patients progressed to pancreatic insufficiency after diagnosis. RESULTS: We identified mutations on both alleles in 633 patients (85.3%), on one allele in 95 (12.8%), and on neither allele in 14 (1.9%). Seventy six different mutations were identified. The most common mutation was DeltaF508 (71.3%) followed by G551D (2.9%), G542X (2.3%), 621+1G-->T (1.2%), and W1282X (1.2%). Patients were categorized into five classes according to the predicted functional consequences of each mutation. Over 95% of patients with severe class I, II, and III mutations were pancreatic insufficient or progressed to pancreatic insufficiency. In contrast, patients with mild class IV and V mutations were consistently pancreatic sufficient. In all but four cases each genotype correlated exclusively with the pancreatic phenotype. Quantitative data of acinar and ductular secretion were available in 93 patients. Patients with mutations belonging to classes I, II, and III had greatly reduced acinar and ductular function compared with those with class IV or V mutations. CONCLUSION: The predicted or known functional consequences of specific mutant alleles correlate with the severity of pancreatic disease in cystic fibrosis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
309 Table 2 Genotype classification according to the functional consequences of CFTR gene mutations Pancreatic status Class I Class II Class III Class IV Class V PS F1 , 875+1G→C(2) F, F (1) F, G551D (1) F, R117H (11) F,3849+10kbC→T (5) F, G85E2 (1) F, R347H (3) F,3272-26A→G (4) F, S1251N (2) F,A445E (3) F, D614G (1) F,P574H (2) F, R347P (1) F,3120G>A (1) R117H,R117H (1) F, 5T (8) F, L1335P (1) F,2789+5G→A (1) F,P67L (1) F,R347P/R347H (1) F,V232D(2) R334W, R334W(1) PS→PI F,3659delC (1) F,F (15) F,G551D (1) F, I1234V (1) F,2184insA (1) F,R560T (1) PI F, G542X (27) F,F (365) F, G551D (28) F, 621+1G→T (13) F, R560T (7) F,R553X (7) F, N1303K (9) F, R1162X (6) F,L1077P (2) F, 3659delC (5) F, I48T (1) F, 1717-1G→A (5) F,A559T (1) F, W1282X (5) F, G85E2 (2) F, 711+1G→T (5) G551D,G551D(1) F,2184delA(4) F,H199R (1) W1282X,W1282X (4) F,I1072T(1) F,Y1092X (3) F,S549 (R75Q) (1) F,556delA (3) F, Q493X (3) F,4016InsT (3) F, 3120+1G→A (2) F, G551D/R553X (2) F,Q814X(2) F,1154insTC (2) F,441delA (1) F, 4326delTC (1) F,Q552X(1) F,3007delG (1) F,2184insA (1) F, 4010del4 (1) F,3905insT (1) F,1078delT(1) F,E1104X (1) F,3876delA (1) F,4374+1G→T (1) F,E585X (1) F, E60X (1) CFTR, cystic fibrosis transmembrane regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency.
X
ABCC7 p.Arg347His 12865275:309:263
status: NEWX
ABCC7 p.Arg347His 12865275:309:457
status: NEW[hide] Mutation analysis of the cystic fibrosis transmemb... Eur J Hum Genet. 2003 Sep;11(9):687-92. Perri F, Piepoli A, Stanziale P, Merla A, Zelante L, Andriulli A
Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis.
Eur J Hum Genet. 2003 Sep;11(9):687-92., [PMID:12939655]
Abstract [show]
Susceptibility to alcoholic chronic pancreatitis (ACP) could be genetically determined. Mutations in cationic trypsinogen (PRSS1), cystic fibrosis transmembrane conductance regulator (CFTR), and serine protease inhibitor, Kazal type 1 (SPINK1) genes have been variably associated with both the hereditary and the idiopathic form of chronic pancreatitis (CP). Our aim was to analyze the three genes in ACP patients. Mutational screening was performed in 45 unrelated ACP patients and 34 patients with alcoholic liver disease (ALD). No mutation of PRSS1 was found in ACP and ALD patients. Three mutations of CFTR were detected in four ACP patients with a prevalence (8.9%) not significantly different from that observed (3.0%) in ALD patients and from that expected (3.2%) in our geographical area. Neither compound heterozygotes for CFTR nor trans-heterozygotes for CFTR/SPINK1 were found. One ACP patient (2.2%) was found to carry the most common mutation (N34S) of SPINK1 compared to none of the ALD patients (P=NS). In five other patients (two with ACP and three with ALD) other rare variants, including P55S, were found. In contrast with the hereditary and the idiopathic forms of CP, in which mutations of PRSS1, CFTR, and SPINK1 genes may occur, ACP is still a "gene(s)-orphan" disease. The supposed genetic susceptibility to ACP relies on other yet unknown gene(s) which could affect the alcohol metabolism or modulate the pancreatic inflammatory response to alcohol abuse.
Comments [show]
None has been submitted yet.
No. Sentence Comment
33 Mutation screening of the CFTR gene The 31 most frequent mutations (F508del, I507del, G551D, G542X, N1303K, 1717-1G4A, W1282X, R553X, R347P, R347H, R334W, 3849+10kb C4T, R117H, 621+1G4T, A455E, S549N, R560T, S549R, V520F, Q493X, 3849+ 4A4G, 1078delT, R1162X, 3659delC, 3905insT, Y122X, 2183delAA4G, 2789+5G4A, 1898+1G4A, 711+1G4T, and G85E) were examined with the polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (OLA, Applied Biosystems, Foster City, CA, USA) and finally a sequence-coded separation.
X
ABCC7 p.Arg347His 12939655:33:141
status: NEW[hide] The phenotypic consequences of CFTR mutations. Ann Hum Genet. 2003 Sep;67(Pt 5):471-85. Rowntree RK, Harris A
The phenotypic consequences of CFTR mutations.
Ann Hum Genet. 2003 Sep;67(Pt 5):471-85., [PMID:12940920]
Abstract [show]
Cystic fibrosis is a common autosomal recessive disorder that primarily affects the epithelial cells in the intestine, respiratory system, pancreas, gall bladder and sweat glands. Over one thousand mutations have currently been identified in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene that are associated with CF disease. There have been many studies on the correlation of the CFTR genotype and CF disease phenotype; however, this relationship is still not well understood. A connection between CFTR genotype and disease manifested in the pancreas has been well described, but pulmonary disease appears to be highly variable even between individuals with the same genotype. This review describes the current classification of CFTR mutation classes and resulting CF disease phenotypes. Complex disease alleles and modifier genes are discussed along with alternative disorders, such as disseminated bronchiectasis and pancreatitis, which are also thought to result from CFTR mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
181 Clain et al. investigated the complex allele with two mild mutations (R347H-D979A) previously identified in pancreatic sufficient CF patients and CBAVD patients respectively (Clain et al. 2001).
X
ABCC7 p.Arg347His 12940920:181:70
status: NEW182 R347H was found to be associated with moderately defective Cl-channel activity whereas D979A led to misprocessing of CFTR.
X
ABCC7 p.Arg347His 12940920:182:0
status: NEW183 The double mutant, R347H-D979A, combined both defects and dramatically decreased the Cl- current.
X
ABCC7 p.Arg347His 12940920:183:19
status: NEW[hide] High allelic heterogeneity between Afro-Brazilians... Genet Test. 2003 Fall;7(3):213-8. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, Phillips JA 3rd, Allito B, Heim RA, Sugarman EA, Probst CM, Faucz F, Culpi L
High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing.
Genet Test. 2003 Fall;7(3):213-8., [PMID:14641997]
Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by at least 1,000 different mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR). To determine the frequency of 70 common worldwide CFTR mutations in 155 Euro-Brazilian CF patients and in 38 Afro-Brazilian CF patients, we used direct PCR amplification of DNA from a total of 386 chromosomes from CF patients born in three different states of Brazil. The results show that screening for seventy mutations accounts for 81% of the CF alleles in Euro-Brazilians, but only 21% in the Afro-Brazilian group. We found 21 different mutations in Euro-Brazilians and only 7 mutations in Afro-Brazilians. The frequency of mutations and the number of different mutations detected in Euro-Brazilians are different from Northern European and North American populations, but similar to Southern European populations; in Afro-Brazilians, the mix of CF-mutations is different from those reported in Afro-American CF patients. We also found significant differences in detection rates between Euro-Brazilian (75%) and Afro-Brazilian CF patients (21%) living in the same state, Minas Gerais. These results, therefore, have implications for the use of DNA-based tests for risk assessment in heterogeneous populations like the Brazilians. Further studies are needed to identify the remaining CF mutations in the different populations and regions of Brazil.
Comments [show]
None has been submitted yet.
No. Sentence Comment
63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes.
X
ABCC7 p.Arg347His 14641997:63:1456
status: NEWX
ABCC7 p.Arg347His 14641997:63:1552
status: NEWX
ABCC7 p.Arg347His 14641997:63:1648
status: NEW[hide] Improved detection of cystic fibrosis mutations in... Hum Reprod. 2004 Mar;19(3):540-6. Epub 2004 Jan 29. Danziger KL, Black LD, Keiles SB, Kammesheidt A, Turek PJ
Improved detection of cystic fibrosis mutations in infertility patients with DNA sequence analysis.
Hum Reprod. 2004 Mar;19(3):540-6. Epub 2004 Jan 29., [PMID:14998948]
Abstract [show]
BACKGROUND: Accurate determination of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene is critical for genetic counselling and treatment of obstructive azoospermia. Of concern is that detection rates with routine CFTR mutation panels vary widely depending on patient ancestry; and such panels have limited value for azoospermic patients, who are more likely to carry rare mutations. An alternative approach offers comprehensive, CFTR mutation analysis by a DNA sequence method. We investigated whether this method could improve CFTR detection rates in men with obstructive azoospermia in a prospective study of men with obstructive azoospermia and their partners who were referred for genetic counselling and testing at one of two institutions. METHODS: Sixteen patients with congenital absence of the vas deferens (CAVD, n = 14) or idiopathic obstructive azoospermia (n = 2) were studied. DNA from all patients was analysed for mutations by the DNA sequence method. In addition to this method, six men underwent CFTR analysis by a common 25 or 31 mutation panel coupled with poly T analysis. In 10 subjects, common mutation panel findings were inferred from DNA sequence method results. RESULTS: Overall, 12/16 (75%) azoospermic patients had one or more CFTR mutations and/or 5T alleles, including 12 mutations in 10 patients (two compound heterozygotes) and seven 5T alleles in six patients (one homozygote). The sequence method detected all mutations and three variants of unknown significance. By comparison, the common mutation panels detected only 3/12 mutations (25%) and 0/3 variants. CONCLUSION: The DNA sequence method detects more CFTR mutations than common mutation panels. Given the serious, clinical consequences of transmitting such mutations, this study underscores the importance of accurate, CFTR mutation detection in men with obstructive azoospermia and their partners.
Comments [show]
None has been submitted yet.
No. Sentence Comment
59 Polyacrylamide gels were analysed for the presence of mutations following staining in ethidium bromide (EtBr) and image capture under UV using the Gel Doc 1000 system Table I. List of CFTR mutations included in common mutation panels American College of Medical Genetics CF panel (25 mutations) DF508 G542X G551D R117H W1282X N1303K R1162X 3849+10kbC®T DI507 R553X 1717-1G®A 621+1G®T R560T 3659delC 3120+1G®A I148T G85E R334W A455E 1898+1G®A 2148delA 711+1G®T 2789+5G®A R347P 1078delT Six additional mutations and one polymorphism in UCSF panel (31 mutations) Y1092X R347H 3849+4 Q493X 3905insT S549N F508C (polymorphism) (BioRad).
X
ABCC7 p.Arg347His 14998948:59:602
status: NEW[hide] Mutations of the CFTR gene in Turkish patients wit... Hum Reprod. 2004 May;19(5):1094-100. Epub 2004 Apr 7. Dayangac D, Erdem H, Yilmaz E, Sahin A, Sohn C, Ozguc M, Dork T
Mutations of the CFTR gene in Turkish patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2004 May;19(5):1094-100. Epub 2004 Apr 7., [PMID:15070876]
Abstract [show]
BACKGROUND: Mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) can cause congenital bilateral absence of the vas deferens (CBAVD) as a primarily genital form of cystic fibrosis. The spectrum and frequency of CFTR mutations in Turkish males with CBAVD is largely unknown. METHODS: We investigated 51 Turkish males who had been diagnosed with CBAVD at the Hacettepe University, Ankara, for the presence of CFTR gene mutations by direct sequencing of the coding region and exon/intron boundaries. RESULTS: We identified 27 different mutations on 72.5% of the investigated alleles. Two-thirds of the patients harboured CFTR gene mutations on both chromosomes. Two predominant mutations, IVS8-5T and D1152H, accounted for more than one-third of the alleles. Five mutations are described for the first time. With one exception, all identified patients harboured at least one mutation of the missense or splicing type. Presently available mutation panels would have uncovered only 7-12% of CFTR alleles in this population cohort. CONCLUSIONS: Although cystic fibrosis is relatively rare in Turkey, CFTR mutations are responsible for the majority of CBAVD in Turkish males. Because of a specific mutation profile, a population-specific panel should be recommended for targeted populations such as CBAVD in Turkey or elsewhere.
Comments [show]
None has been submitted yet.
No. Sentence Comment
35 We next screened for six further CFTR gene mutations of the coding region and ¯anking intron sequences by previously described restriction-enzyme based methods: G85E, D110H, R347H, 2789+5G®A, D1152H, N1303K (DoÈrk et al., 1994a, 1997).
X
ABCC7 p.Arg347His 15070876:35:179
status: NEW40 Finally, the 5'-UTR and minimum promoter region were Table I. CFTR gene mutations identi®ed in 51 CBAVD patients Mutation Location Nucleotide alteration Predicted effect Allele frequency (%) Reference IVS8-5T Intron 8 Deletion of 2T between 1342±12 and 1342±6 Aberrant splicing 20 (19.6)a Chu et al. 1993 D1152H Exon 18 G®C at 3586 Amino acid substitution 15 (14.7)a Highsmith et al. 1992* D110H Exon 4 G®C at 460 Amino acid substitution 3 (2.9) Dean et al. 1990 DF508 Exon 10 Deletion of 3 nt at 1652±1655 Amino acid deletion 3 (2.9) Kerem et al. 1989 2789+5G®A Intron 14b G®A at 2789+5 Aberrant splicing 3 (2.9) Highsmith et al. 1997 L997F Exon 17a G®C at 3123 Amino acid substitution 3 (2.9) Fanen et al. 1992b CFTRdele2 (ins186) Introns 1±2 Deletion of 8.1 kb and insertion of 186 bp In-frame-deletion 2 (2.0) DoÈrk et al. 2000b R347H Exon 7 G®A at 1172 Amino acid substitution 2 (2.0) Cremonesi et al. 1992 E831X Exon 14a G®T at 2623 Truncation 2 (2.0) Ferec et al. 1992* 1767del6 Exon 11 Deletion of 6 nt at 1767±1773 In-frame-deletion 2 (2.0) (a) This study 3041-15T®G Intron 15 T®G at 3041±15 Aberrant splicing?
X
ABCC7 p.Arg347His 15070876:40:888
status: NEW56 Several mutations were already known as `mild' alleles in cystic ®brosis, e.g. D110H, R347H or 2789+5G®A, and have been described previously in studies of patients with CBAVD.
X
ABCC7 p.Arg347His 15070876:56:91
status: NEW67 One mutant allele was identi®ed in six patients (11.7%), of whom two carried clearly pathogenic mutations (DF508 and R347H, respectively) and four harboured unclassi®ed variants.
X
ABCC7 p.Arg347His 15070876:67:122
status: NEW72 CFTR genotypes in 51 patients with congenital bilateral absence of the vas deferens Mutation genotypes IVS8-(TG)mTn M470V n (%) Two mutations detected: D1152H/D1152H (TG)11 7T/ (TG)11 7T V/V 5 (9.8) IVS8-5T/IVS8-5T (TG)13 5T/ (TG)13 5T M/M 2 (3.9) (TG)12 5T/ (TG)13 5T M/V 1 (1.9) (TG)12 5T/ (TG)12 5T V/V 1 (1.9) IVS8-5T/D1152H (TG)12 5T/ (TG)11 7T V/V 2 (3.9) IVS8-5T/DF508 (TG)12 5T/ (TG)10 9T M/V 2 (3.9) IVS8-5T/2789+5G®A (TG)12 5T/ (TG)10 7T M/V 2 (3.9) IVS8-5T/365insT (TG)13 5T/ (TG)11 7T M/V 1 (1.9) IVS8-5T/D110H (TG)12 5T/ (TG)11 7T M/V 1 (1.9) IVS8-5T/E585X (TG)12 5T/ (TG)10 7T M/V 1 (1.9) IVS8-5T/2752-15C®G (TG)12 5T/ (TG)11 7T V/V 1 (1.9) IVS8-5T/M952I (TG)12 5T/ (TG)10 7T M/V 1 (1.9) IVS8-5T/3120+1G®A (TG)12 5T/ (TG)11 7T V/V 1 (1.9) D1152H/A349V (TG)10 7T/ (TG)11 7T M/V 1 (1.9) D1152H/2789+5G®A (TG)10 7T/ (TG)11 7T M/V 1 (1.9) D1152H/G1130A (TG)10 7T/ (TG)11 7T M/V 1 (1.9) CFTRdele2(ins186)/ IVS8-6T (TG)13 6T/ (TG)11 7T M/V 1 (1.9) CFTRdele2(ins186)/D110H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) E831X/D110H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) E831X/1677delTA (TG)11 7T/ (TG)11 7T V/V 1 (1.9) R334Q/R347H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) 1767del6/1767del6 (TG)11 7T/ (TG)11 7T V/V 1 (1.9) 3041-15T®G/3041-15T®G (TG)12 7T/ (TG)12 7T M/M 1 (1.9) 3041-13del7/3041-13del7 (TG)10 7T/ (TG)10 7T M/M 1 (1.9) R1070W/3272-26A®G (TG)10 7T/ (TG)11 7T M/V 1 (1.9) I853F/L997F (TG)11 7T/ (TG)10 9T V/V 1 (1.9) One mutation detected: L997F/?
X
ABCC7 p.Arg347His 15070876:72:1133
status: NEW74 (TG)12 5T/ (TG)10 7T M/V 1 (1.9) R347H/?
X
ABCC7 p.Arg347His 15070876:74:33
status: NEW[hide] A finger sweat chloride test for the detection of ... Pancreas. 2004 Apr;28(3):e80-5. Naruse S, Ishiguro H, Suzuki Y, Fujiki K, Ko SB, Mizuno N, Takemura T, Yamamoto A, Yoshikawa T, Jin C, Suzuki R, Kitagawa M, Tsuda T, Kondo T, Hayakawa T
A finger sweat chloride test for the detection of a high-risk group of chronic pancreatitis.
Pancreas. 2004 Apr;28(3):e80-5., [PMID:15084988]
Abstract [show]
OBJECTIVES: Mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene are associated with chronic pancreatitis in Caucasians. We developed a simple method for measuring finger sweat chloride concentration to test whether CFTR dysfunction underlies chronic pancreatitis in Japan where cystic fibrosis (CF) is rare. METHODS: We studied 25 patients with chronic (21 alcoholic and 4 idiopathic) pancreatitis and 25 healthy volunteers. Sweat chloride concentrations were measured by a finger sweat chloride test. We analyzed DNA for 20 common CFTR mutations in Europeans, 9 CF-causing mutations in Japanese, and 2 polymorphic loci, a poly-T tract and (TG) repeats, at intron 8. RESULTS: Thirteen patients (52%) had sweat chloride levels >60 mmol/L, a level consistent with CF, while only 4 (16%) healthy subjects exceeded this level. The 29 CF mutations and the 5T allele were detected in neither the patients nor controls. The (TG) 12 allele was common in both the patients (58%) and controls (48%). The (TG) 12/12 genotype was common in alcoholic pancreatitis (29%) compared with the (TG) 11/11 (10%). Patients with the (TG) 12/12 genotype had significantly higher sweat chloride concentrations than the controls. CONCLUSION: CFTR dysfunction as evidenced by a finger sweat chloride test is present in about half of Japanese patients with chronic pancreatitis, suggesting that this test may be useful for detecting the high-risk group. A higher proportion of the (TG) 12 allele may be a genetic background for elevated sweat chloride concentrations in Japanese patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 The 9 CF-causing mutations (R75X, Q98R, M152R, R347H, L441P, L571S, D979A, H1085R, and T1086I) in Japa- nese20,25-28 were screened by SNP typing with Masscode System (Shimadzu, Kyoto, Japan).
X
ABCC7 p.Arg347His 15084988:51:47
status: NEW[hide] Genetic evidence for CFTR dysfunction in Japanese:... J Med Genet. 2004 May;41(5):e55. Fujiki K, Ishiguro H, Ko SB, Mizuno N, Suzuki Y, Takemura T, Yamamoto A, Yoshikawa T, Kitagawa M, Hayakawa T, Sakai Y, Takayama T, Saito M, Kondo T, Naruse S
Genetic evidence for CFTR dysfunction in Japanese: background for chronic pancreatitis.
J Med Genet. 2004 May;41(5):e55., [PMID:15121783]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
219 The nine CF causing (R75X, Q98R, M152R, R347H, L441P, L571S, D979A, H1085R, and T1086I) and two non-CF causing (Q1352H and R1453W) mutations in Japanese6 22-24 were screened by SNP typing with a Masscode system (Shimadzu, Kyoto, Japan) and confirmed by sequence analysis in positive and equivocal cases.
X
ABCC7 p.Arg347His 15121783:219:40
status: NEW[hide] Relation of sweat chloride concentration to severi... Pediatr Pulmonol. 2004 Sep;38(3):204-9. Davis PB, Schluchter MD, Konstan MW
Relation of sweat chloride concentration to severity of lung disease in cystic fibrosis.
Pediatr Pulmonol. 2004 Sep;38(3):204-9., [PMID:15274098]
Abstract [show]
In cystic fibrosis (CF), sweat chloride concentration has been proposed as an index of CFTR function for testing systemic drugs designed to activate mutant CFTR. This suggestion arises from the assumption that greater residual CFTR function should lead to a lower sweat chloride concentration, as well as protection against severe lung disease. This logic gives rise to the hypothesis that the lower the sweat chloride concentration, the less severe the lung disease. In order to test this hypothesis, we studied 230 patients homozygous for the DeltaF508 allele, and 34 patients with at least one allele associated with pancreatic sufficiency, born since January 1, 1955, who have pulmonary function data and sweat chloride concentrations recorded in our CF center database, and no culture positive for B. cepacia. We calculated a severity index for pulmonary disease, using an approach which takes into account all available pulmonary function data as well as the patient's current age and survival status. Patients with alleles associated with pancreatic sufficiency had significantly better survival (P = 0.0083), lower sweat chloride concentration (81.4 +/- 23.8 vs. 103.2 +/- 14.2 mEq/l, P < 0.0001), slower rate of decline of FEV(1) % predicted (-0.75 +/- 0.34 vs. -2.34 +/- 0.17% predicted per year), and a better severity index than patients homozygous for the DeltaF508 allele (median 73rd percentile vs. median 55th percentile, P = 0.0004). However, the sweat chloride concentration did not correlate with the severity index, either in the population as a whole, or in the population of patients with alleles associated with pancreatic sufficiency, who are thought to have some residual CFTR function. These data suggest that, by itself, sweat chloride concentration does not necessarily predict a milder pulmonary course in patients with cystic fibrosis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
26 T (12); A455E (1); D1270N; G85E (3); R117H (4); R334W (1); R347H (1); T347P (6); 2859 þ 5 G !
X
ABCC7 p.Arg347His 15274098:26:59
status: NEW[hide] Use of fecal elastase-1 to classify pancreatic sta... J Pediatr. 2004 Sep;145(3):322-6. Borowitz D, Baker SS, Duffy L, Baker RD, Fitzpatrick L, Gyamfi J, Jarembek K
Use of fecal elastase-1 to classify pancreatic status in patients with cystic fibrosis.
J Pediatr. 2004 Sep;145(3):322-6., [PMID:15343184]
Abstract [show]
OBJECTIVE: To test the hypothesis that some patients with cystic fibrosis (CF) are misclassified as pancreatic insufficient, using fecal elastase-1 (FE-1) to define pancreatic status. STUDY DESIGN: Subjects with CF at 33 CF centers filled out questionnaires and submitted a stool specimen that was analyzed for FE-1. Subjects taking pancreatic enzyme supplements (PES) were asked to discontinue them and perform a 3-day fecal fat balance study if their FE-1 was >200 microg/g stool and they had never had pancreatitis. RESULTS: The median value for FE-1 in 1215 subjects was 0 microg/g stool (range, 0-867). There was a significant difference between patients who had been prescribed PES (n=1131) and those who had FE-1 <200 microg/g stool (n=1074; P<.0001). Sixty-seven subjects met criteria for discontinuation of PES. The mean coefficient of fat absorption for these subjects was 96.1%. CONCLUSIONS: FE-1 is an accurate, easily obtained screening test to classify pancreatic status in patients with CF. This information is important for prognostication, treatment, and to avoid misclassification in clinical research. Measurement of FE-1 should become a standard of care for patients with CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
116 FE-1 values in subjects with CFTR mutations associated with pancreatic sufficiency11 N Mean (mg/g stool) Median (mg/g stool) Range (mg/g stool) Subjects with at least one PS allele* FE-1 >200 mg/g stool 16 584 582.9 349-773 FE-1 <200 mg/g stool 5 64.4 74.8 0-125 Subjects with at least one PS variable alleley FE-1>200 mg/g stool 29 496.2 493.6 224-798 FE-1 <200 mg/g stool 13 76.1 65.9 0-187 *Pancreatic sufficient dominant CF alleles G551S R117H R347H P574H R334W R352Q T3381 yVariable pancreatic sufficient CF mutations G85E 3849 + 10 kb C fi T R347P 2789 + 5G fi A A455E In summary, FE-1 is an accurate, easily obtained screening test to classify patients with CF as PI or PS.
X
ABCC7 p.Arg347His 15343184:116:448
status: NEW[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]
Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.
Comments [show]
None has been submitted yet.
No. Sentence Comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene.
X
ABCC7 p.Arg347His 15371903:35:341
status: NEW[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]
Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively.
X
ABCC7 p.Arg347His 15371908:77:322
status: NEW[hide] Nasal airway ion transport is linked to the cystic... Thorax. 2004 Nov;59(11):971-6. Fajac I, Hubert D, Guillemot D, Honore I, Bienvenu T, Volter F, Dall'Ava-Santucci J, Dusser DJ
Nasal airway ion transport is linked to the cystic fibrosis phenotype in adult patients.
Thorax. 2004 Nov;59(11):971-6., [PMID:15516474]
Abstract [show]
BACKGROUND: This study was conducted to determine whether the major nasal airway ion transport abnormalities in cystic fibrosis (that is, defective cAMP regulated chloride secretion and basal sodium hyperabsorption) are related to the clinical expression of cystic fibrosis and/or to the genotype. METHODS: Nasal potential difference was measured in 79 adult patients with cystic fibrosis for whom clinical status, respiratory function, and CFTR genotype were determined. RESULTS: In univariate and multivariate analysis, patients with pancreatic insufficiency were more likely to have low responses to low chloride (odds ratio (OR) 8.6 (95% CI 1.3 to 58.5), p = 0.03) and isoproterenol (OR 11.2 (95% CI 1.3 to 93.9), p = 0.03) solutions. Similarly, in univariate and multivariate analysis, patients with poor respiratory function (forced expiratory volume in 1 second <50% of predicted value) were more likely to have an enhanced response to amiloride solution (OR 3.7 (95% CI 1.3 to 11.0), p = 0.02). However, there was no significant relationship between nasal potential difference and the severity of the genotype. CONCLUSIONS: Nasal epithelial ion transport in cystic fibrosis is linked to the clinical expression of the disease. The pancreatic status appears to be mostly related to the defect in epithelial chloride secretion whereas the respiratory status is mostly related to abnormal sodium transport and the regulatory function of the CFTR protein.
Comments [show]
None has been submitted yet.
No. Sentence Comment
219 RESULTS Patients Four of the 79 CF patients included in the study had a normal sweat test; three were compound heterozygous for the F508D mutation and the R117H, D1152H and R347H mutations, respectively, and one patient was compound heterozygous for the G542X and 3849+10 kb (C)R (T) mutations.
X
ABCC7 p.Arg347His 15516474:219:173
status: NEW[hide] Destabilization of the transmembrane domain induce... J Biol Chem. 2005 Feb 11;280(6):4968-74. Epub 2004 Nov 10. Choi MY, Partridge AW, Daniels C, Du K, Lukacs GL, Deber CM
Destabilization of the transmembrane domain induces misfolding in a phenotypic mutant of cystic fibrosis transmembrane conductance regulator.
J Biol Chem. 2005 Feb 11;280(6):4968-74. Epub 2004 Nov 10., 2005-02-11 [PMID:15537638]
Abstract [show]
Two phenotypic missense mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) channel pore (L346P and R347P in transmembrane (TM) segment 6) involve gain of a proline residue, but only L346P represents a significant loss of segment hydropathy. We show here that, for synthetic peptides corresponding to sequences of CFTR TM6 segments, circular dichroism spectra of wild type and R347P TM6 in membrane mimetic environments are virtually identical, but L346P loses approximately 50% helicity, implying a membrane insertion defect in the latter mutant. A similar defect was observed in the corresponding double-spanning ("hairpin") TM5/6-L346P synthetic peptide. Examination of the biogenesis of CFTR revealed that the full-length protein harboring the L346P mutation is rapidly degraded at the endoplasmic reticulum (ER), whereas the wild type and the R347P protein process normally. Furthermore, a second site mutation (R347I) that restores in vitro membrane insertion and folding of the TM5/6-L346P peptide also rescues the folding and cell surface chloride channel function of full-length L346P CFTR. The correlated in vitro/in vivo results demonstrate that destabilizing local hydrophobic character represents a sufficient signal for marking CFTR as a non-native protein by the ER quality control, with accompanying deleterious consequences to global protein folding events.
Comments [show]
None has been submitted yet.
No. Sentence Comment
58 Construction and Expression of CFTR Variants in Mammalian Cells-The L346P, R347P, and R347H CFTR mutants were constructed FIG. 1.
X
ABCC7 p.Arg347His 15537638:58:86
status: NEW116 WT, L346P, R347P, L346P/R347I, and R347H CFTR expression was assayed by immunoblotting, using the mouse monoclonal anti-HA Ab.
X
ABCC7 p.Arg347His 15537638:116:35
status: NEW138 The R347H missense mutation, associated with a mild functional defect of CFTR channel activity, was also expressed at the same level as the WT CFTR, confirming previous reports (31).
X
ABCC7 p.Arg347His 15537638:138:4
status: NEW[hide] First study of CF mutations in the CFTR gene of Ir... J Trop Pediatr. 2004 Dec;50(6):359-61. Jalalirad M, Houshmand M, Mirfakhraie R, Goharbari MH, Mirzajani F
First study of CF mutations in the CFTR gene of Iranian patients: detection of DeltaF508, G542X, W1282X, A120T, R117H, and R347H mutations.
J Trop Pediatr. 2004 Dec;50(6):359-61., [PMID:15537723]
Abstract [show]
Thirty-seven unrelated Iranian CF families were screened for the presence of seven common mutations (DeltaF508, G542X, W1282X, G551D, N1303K, 1717-1G-->A, and 621-1G-->T) using ARMS PCR and exons 4 and 7 of the CFTR gene by SSCP method. This study resulted in the identification of 26.8 per cent of all CF alleles: DeltaF508 (16.2 per cent), W1282X (4 per cent), G542X (2.7 per cent), R117H (1.3 per cent), R347H (1.3 per cent), and A120T (1.3 per cent) mutations were detected. To the best of our knowledge, it is the first report of an Asian subject carrying the A120T mutation. Our findings suggest heterogeneity in the Iranian population, stressing the need to draw attention to sequence analysis in order to find population-specific mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
15 Most of the families in whom ∆F508, W1282X, and G542X mutations BRIEF REPORTS Journal of Tropical Pediatrics Vol. 50, No.
X
ABCC7 p.Arg347His 15537723:15:261
status: NEW16 6 359 First Study of CF Mutations in the CFTR Gene of Iranian Patients: Detection of ∆F508, G542X, W1282X, A120T, R117H, and R347H Mutations by M. Jalalirad,a,b M. Houshmand,a R. Mirfakhraie,a M. H. Goharbari,a and F. Mirzajania a National Research Center for Genetic Engineering and Biotechnology (NRCGEB),Tehran, Iran b Biology Department, Gilan University, Rasht, Iran Summary Thirty-seven unrelated Iranian CF families were screened for the presence of seven common mutations (∆F508, G542X, W1282X, G551D, N1303K, 1717-1G→A, and 621-1G→T) using ARMS PCR and exons 4 and 7 of the CFTR gene by SSCP method.
X
ABCC7 p.Arg347His 15537723:16:132
status: NEWX
ABCC7 p.Arg347His 15537723:16:173
status: NEW17 This study resulted in the identification of 26.8 per cent of all CF alleles: ∆F508 (16.2 per cent), W1282X (4 per cent), G542X (2.7 per cent), R117H (1.3 per cent), R347H (1.3 per cent), and A120T (1.3 per cent) mutations were detected.
X
ABCC7 p.Arg347His 15537723:17:173
status: NEW32 The next two most common mutations were W1282X (4 per cent) and G542X (2.7 per cent), which have high frequencies in Mediterranean countries.11 R347H, which has the highest incidence in Turkey,8 was detected in a Turkish child residing in north-west Iran with normal sweat chloride values.
X
ABCC7 p.Arg347His 15537723:32:11
status: NEWX
ABCC7 p.Arg347His 15537723:32:87
status: NEWX
ABCC7 p.Arg347His 15537723:32:110
status: NEWX
ABCC7 p.Arg347His 15537723:32:144
status: NEWX
ABCC7 p.Arg347His 15537723:32:160
status: NEW33 As regards R347H mutation and sex, two female patients carrying genotypes ∆F508/R347H and ∆F508/R347H + D979A have been reported so far.12,13 Our R347H compound case is the first female who does not carry the ∆F508 mutation as the other CF allele.
X
ABCC7 p.Arg347His 15537723:33:11
status: NEWX
ABCC7 p.Arg347His 15537723:33:87
status: NEWX
ABCC7 p.Arg347His 15537723:33:110
status: NEWX
ABCC7 p.Arg347His 15537723:33:160
status: NEW31 The next two most common mutations were W1282X (4 per cent) and G542X (2.7 per cent), which have high frequencies in Mediterranean countries.11 R347H, which has the highest incidence in Turkey,8 was detected in a Turkish child residing in north-west Iran with normal sweat chloride values.
X
ABCC7 p.Arg347His 15537723:31:144
status: NEW[hide] Late diagnosis defines a unique population of long... Am J Respir Crit Care Med. 2005 Mar 15;171(6):621-6. Epub 2004 Dec 10. Rodman DM, Polis JM, Heltshe SL, Sontag MK, Chacon C, Rodman RV, Brayshaw SJ, Huitt GA, Iseman MD, Saavedra MT, Taussig LM, Wagener JS, Accurso FJ, Nick JA
Late diagnosis defines a unique population of long-term survivors of cystic fibrosis.
Am J Respir Crit Care Med. 2005 Mar 15;171(6):621-6. Epub 2004 Dec 10., 2005-03-15 [PMID:15591474]
Abstract [show]
Although the median survival for patients with cystic fibrosis (CF) is 32.9 years, a small group of patients live much longer. We analyzed the genotype and phenotype of CF patients 40 years and older seen between 1992 and 2004 at the National Jewish Medical and Research Center (n = 55). These patients were divided into two groups according to age at diagnosis: an early diagnosis (ED) group, median age at diagnosis 2.0 years (range 0.1-15 years, n = 28), and a late diagnosis (LD) group, median age of diagnosis 48.8 years (range 24-72.8 years, n = 27). Consistent with the hypothesis that the CFTR genotype affects the age at diagnosis, CFTR DeltaF508 homozygous individuals were more common in the ED group. Although patients in the ED group were predominantly male, the majority of LD patients were female. Patients with CF diagnosed late had a significantly lower prevalence of pancreatic insufficiency and CF-related diabetes, and better lung function. Fewer patients in the LD groups were infected with Pseudomonas aeruginosa, whereas a greater percentage had cultures positive for nontuberculous mycobacteria. This is the largest cohort of older patients with CF described to date, and our findings indicate that patients diagnosed as adults differ distinctly from survivors of long-term CF diagnosed as children.
Comments [show]
None has been submitted yet.
No. Sentence Comment
117 GENOTYPE DISTRIBUTION Early Diagnosis Late Diagnosis ⌬F508/⌬F508 10 1 ⌬F508/⌬I507 1 ⌬F508/G551D 1 ⌬F508/M1101K 1 ⌬F508/P67L/11027T 1 ⌬F508/3120G-A 1 ⌬F508/2789ϩ5G-A 1 2 ⌬F508/W1282X 1 ⌬F508/621ϩ1G-T 1 ⌬F508/R347P 1 ⌬F508/3849ϩ10kbC-T 1 1 ⌬F508/A455E 2 ⌬F508/R347H 2 ⌬F508/D1152H 1 ⌬508/I148T 1 ⌬F508/R117H 1 ⌬F508/Y109N 1 ⌬F508/IVS8-5T 1 ⌬F508/unknown 3 5 S1251N/D1152H 1 G542X/R117C 1 R117H/G551D 1 W1282X/D1152H 1 Unknown 4 4 Values represent number of individuals in each diagnostic group with each genotype.
X
ABCC7 p.Arg347His 15591474:117:381
status: NEW[hide] Cystic fibrosis: an overview. J Clin Gastroenterol. 2005 Apr;39(4):307-17. Turcios NL
Cystic fibrosis: an overview.
J Clin Gastroenterol. 2005 Apr;39(4):307-17., [PMID:15758625]
Abstract [show]
Cystic fibrosis (CF) is one of the most common inherited disorders of white populations. The isolation and cloning of the gene in CF that encodes the production of a transport protein that acts as an apical membrane chloride channel, termed cystic fibrosis transmembrane conductance regulator (CFTR), have improved our understanding of the disorder's pathophysiology and has aided diagnosis, but has also revealed the disease's complexity. Gene replacement therapy is still far from being used in patients with CF, mostly because of difficulties in targeting the appropriate cells. Life expectancy of patients with this disorder has greatly improved over past decades because of better symptomatic treatment strategies. This article summarizes advances in understanding and treatment of CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
56 T R334W A455E R347H 2789 5G !
X
ABCC7 p.Arg347His 15758625:56:14
status: NEW[hide] Cystic fibrosis carriers have higher neonatal immu... Am J Med Genet A. 2005 Jun 1;135(2):142-4. Castellani C, Picci L, Scarpa M, Dechecchi MC, Zanolla L, Assael BM, Zacchello F
Cystic fibrosis carriers have higher neonatal immunoreactive trypsinogen values than non-carriers.
Am J Med Genet A. 2005 Jun 1;135(2):142-4., 2005-06-01 [PMID:15832355]
Abstract [show]
Following cystic fibrosis (CF) neonatal screening implementation, a high frequency of heterozygotes has been reported among neonates with elevated immunoreactive trypsinogen (IRT) and normal sweat chloride levels. We studied the relationship between normal IRT values and CF heterozygosity: 10,000 neonates were screened for CF by IRT measurement and tested for 40 CF mutations; the 294 carriers detected were coupled with newborns negative to the same genetic testing, and the two groups' IRT levels compared. Heterozygotes had higher IRT levels than their controls (mean 35.32 vs. 27.58 microg/L, P<0.001). Even within normal trypsinogen range, the probability of being a CF carrier increases with neonatal IRT concentration.
Comments [show]
None has been submitted yet.
No. Sentence Comment
40 Distribution and Classification of the Tested Mutations in the Normal IRT Heterozygote Population Under Study Mutations Type of mutation Class of mutation Number of cases F508del Severe II 161 N1303K Severe II 19 G542X Severe I 19 711 þ 5G > A - V 15 R117H Mild IV 13 R1162X Severe I 13 R553X Severe I 11 G85E - IV 8 2183AA > G Severe I 8 1717-1G > A Severe I 8 R334Q Mild - 4 Q552X Severe I 4 W1282X Severe I 3 2789 þ 5G > A Mild V 2 1898 þ 3A > G Mild V 2 T338I Mild IV 1 R709X Severe I 1 R347H Mild IV 1 3849 þ 10KbC > T Mild V 1 Total 294 Other tested mutations: 1078delTn1609delCAn1717-8g/an394delTTn457TAT> Gn541delCn621 þ 1g/tn711 þ 1g/tnA559TnDI507nG551DnR1158XnR334Wn R347PnR352QnS549InS549NnS549Ra/cn2790-2G > An1811 þ 1.2KbA > G; 711þ5G > A and G85E not categorized in type of mutation; R334Q not categorized in class of mutation.
X
ABCC7 p.Arg347His 15832355:40:506
status: NEW[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]
Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.
Comments [show]
None has been submitted yet.
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C !
X
ABCC7 p.Arg347His 15880796:58:305
status: NEW[hide] Multiple mutation analysis of the cystic fibrosis ... Mol Hum Reprod. 2005 Jun;11(6):463-8. Epub 2005 May 20. Sanchez-Garcia JF, Benet J, Gutierrez-Mateo C, Luis Seculi J, Monros E, Navarro J
Multiple mutation analysis of the cystic fibrosis gene in single cells.
Mol Hum Reprod. 2005 Jun;11(6):463-8. Epub 2005 May 20., [PMID:15908456]
Abstract [show]
PGD is becoming an alternative to prenatal diagnosis. The combination of IVF techniques with the PCR technology allows for the detection of genetic abnormalities in first polar bodies from oocytes and blastomeres from cleavage-stage embryos. Dealing with a genetic disease with a heterogeneous spectrum of mutations like cystic fibrosis, one of the objectives of centres offering PGD is the application of simple and efficient protocols that allow for the detection of a wide range of mutations with a single procedure. In the present work, 29 normal loci and the 31 most frequent cystic fibrosis transmembrane conductance regulator (CFTR) mutations in Southern Europe could be detected at the same time in single cells applying a modified and improved primer extension preamplification-PCR. Two different Taq polymerases were tested in isolated buccal cells heterozygous for several mutations. The protocol that gave statistically significant better results was also successful in oocytes and their first polar bodies.
Comments [show]
None has been submitted yet.
No. Sentence Comment
62 G, R1162X, 3659delC, W1282X, 3905insT, N1303K, 1078delT, R347P, R347H and R334W labelled with TET (green) and A455E, 1898þ1G.A, 2183AA.G, 2789þ5G.A, G85E, 621þ1G.T, R117H, Y122X and 711þ1G.T labelled with HEX (yellow).
X
ABCC7 p.Arg347His 15908456:62:64
status: NEW[hide] Genotype-phenotype correlation for pulmonary funct... Thorax. 2005 Jul;60(7):558-63. de Gracia J, Mata F, Alvarez A, Casals T, Gatner S, Vendrell M, de la Rosa D, Guarner L, Hermosilla E
Genotype-phenotype correlation for pulmonary function in cystic fibrosis.
Thorax. 2005 Jul;60(7):558-63., [PMID:15994263]
Abstract [show]
BACKGROUND: Since the CFTR gene was cloned, more than 1000 mutations have been identified. To date, a clear relationship has not been established between genotype and the progression of lung damage. A study was undertaken of the relationship between genotype, progression of lung disease, and survival in adult patients with cystic fibrosis (CF). METHODS: A prospective cohort of adult patients with CF and two CFTR mutations followed up in an adult cystic fibrosis unit was analysed. Patients were classified according to functional effects of classes of CFTR mutations and were grouped based on the CFTR molecular position on the epithelial cell surface (I-II/I-II, I-II/III-V). Spirometric values, progression of lung disease, probability of survival, and clinical characteristics were analysed between groups. RESULTS: Seventy four patients were included in the study. Patients with genotype I-II/I-II had significantly lower current spirometric values (p < 0.001), greater loss of pulmonary function (p < 0.04), a higher proportion of end-stage lung disease (p < 0.001), a higher risk of suffering from moderate to severe lung disease (odds ratio 7.12 (95% CI 1.3 to 40.5)) and a lower probability of survival than patients with genotype I-II/III, I-II/IV and I-II/V (p < 0.001). CONCLUSIONS: The presence of class I or II mutations on both chromosomes is associated with worse respiratory disease and a lower probability of survival.
Comments [show]
None has been submitted yet.
No. Sentence Comment
209 To study the decline in pulmonary function between groups the ANOVA method (repeated measures) was used with baseline and current spirometric values as dependent variables, genotype groups as the independent variable, and age and evolution time as Table 1 CFTR mutation according to functional classification Class Molecular dysfunction Mutation I Defective protein production G542X, 711+1GRT, 1609delCA, R1162X, 1717-8GRA, W1282X, 1782delA, Q890X, 1898+3ARG, CFTRdele19, 936delTA II Defective protein processing F508del, N1303K, I507del, R1066C III Defective protein regulation D1270N, G551D IV Defective protein conductance L206W, R334W, R117H, R347H, D836Y, P205S V Partially defective production or processing 2789+5GRA, 1811+1.6kbARG, 3849+10kbCRT, 3272+26GRA Table 2 Groups based on genotype in CF adult patients Functional classes Genotype No of subjects I-I G542X/W1282X 1 R1162X/1898+3ARG 1 R1162X/CFTRdele19 1 I-II F508del/G542X 5 F508del/711+1GRT 2 F508del/1717-8GRA 1 F508del/936delTA 1 F508del/R1162X 1 N1303K/1609delCA 1 I-III G542X/D1270N+R74W 1 711+1G-T/G551D 1 I-IV G542X/P205S 1 Q890X/R334W 1 1609delCA/R347H 1 I-V G542X/2789+5GRT 2 G542X/1811+1.6kbARG 1 1782delA/2789+5GRA 1 1609delCA/1811+1.6kbARG 1 II-II F508del/F508del 21 F508del/N1303K 1 F508del/R1066C 1 II-III F508del/D1270N+R74W 1 I507del/D1270N+R74W 1 II-IV F508del/L206W 4 F508del/R334W 3 F508del/R117H 3 F08del/R347H 2 F508del/D836Y 1 II-V F508del/2789+5GRA 5 F508del/3849+10kbCRT 2 F508del/1811+1.6kbARG 2 F508del/3272+26GRA 1 N1303K/1811+1.6kbARG 1 N1303K/2789+5GRA 1 adjusted variables.
X
ABCC7 p.Arg347His 15994263:209:647
status: NEWX
ABCC7 p.Arg347His 15994263:209:1121
status: NEWX
ABCC7 p.Arg347His 15994263:209:1391
status: NEW220 Sweat tests were positive (sweat chloride concentration >60 mEq/l) in all but three patients (pair of CFTR mutations: I507del/ D1270N+1274W, F508del/D836Y, and F508del/R347H, respectively).
X
ABCC7 p.Arg347His 15994263:220:168
status: NEW[hide] Genetics of idiopathic disseminated bronchiectasis... Semin Respir Crit Care Med. 2003 Apr;24(2):179-84. Luisetti M, Pignatti PF
Genetics of idiopathic disseminated bronchiectasis.
Semin Respir Crit Care Med. 2003 Apr;24(2):179-84., [PMID:16088537]
Abstract [show]
Bronchiectasis is an abnormal dilation of bronchi, consequent to the destruction of their walls. It is included in the category of obstructive pulmonary diseases, along with chronic obstructive pulmonary disease (COPD), asthma, and cystic fibrosis. In approximately 50% of cases, bronchiectasis is associated with underlying conditions; in the remainder, known causes are not ascertainable (idiopathic bronchiectasis). A search for genetic determinants of this phenotype, with the cystic fibrosis gene as a candidate, has been performed by three independent groups. The results of this search agreed on the association of bronchiectasis with cystic fibrosis gene mutations and polymorphisms. The cystic fibrosis gene is also associated with bronchiectasis due to rheumatoid arthritis and allergic bronchopulmonary aspergillosis. A few other genes have been investigated in idiopathic bronchiectasis, with negative results. Idiopathic bronchiectasis is, therefore, to be considered as an obstructive multifactorial disorder belonging to the category of cystic fibrosis monosymptomatic diseases (or CFTR-opathies), whose pathogenesis is influenced by environmental factors and other undetermined genes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
67 Eleven ABPA subjects, all but one with Bx, either central or disseminated, and with a normal sweat test, were analyzed for CFTR gene mutations.24 Six ABPA subjects carried at least one CF mutation (p < 0.003 vs the general population), one patient carried two CF mutations (⌬F508/R347H), and five were heterozygous for one CF mutation (four ⌬F508 and one R117H).
X
ABCC7 p.Arg347His 16088537:67:287
status: NEW[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2003 Dec;24(6):629-38. Gallati S
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2003 Dec;24(6):629-38., [PMID:16088579]
Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene, which encodes a protein expressed in the apical membrane of exocrine epithelial cells. CFTR functions principally as a cyclic adenosine monophosphate (cAMP)-induced chloride channel and appears capable of regulating other ion channels. Mutations affect CFTR through a variety of molecular mechanisms, which can produce little or no functional gene product at the apical membrane. More than 1000 different disease-causing mutations within the CFTR gene have been described. The potential of a mutation to contribute to the phenotype depends on its type, localization in the gene, and the molecular mechanism as well as on interactions with secondary modifying factors. Genetic testing can confirm a clinical diagnosis of CF and can be used for infants with meconium ileus, for carrier detection in individuals with positive family history and partners of proven CF carriers, and for prenatal diagnostic testing if both parents are carriers. Studies of clinical phenotype in correlation with CFTR genotype have revealed a very complex relationship demonstrating that some phenotypic features are closely determined by the underlying mutations, whereas others are modulated by modifier genes, epigenetic mechanisms, and environment.
Comments [show]
None has been submitted yet.
No. Sentence Comment
50 In effect, virtually no func- Table 2 Unusually Common Cystic Fibrosis Mutations in Specific Populationsa Total Exon/ Number Number Frequency Mutation Intron Ethnic Origin Observed Screened (%) 296+12T→C intron 02 Pakistani 02 24 8.33 E60X exon 03 Belgian 06 394 1.52 G91R exon 03 French 04 266 1.50 394delTT exon 03 Scandinavian 78 1588 4.91 457TAT→G exon 04 Austrian 04 334 1.20 Y122X exon 04 Réunion Island 14 29 48.27 I148T exon 04 French Canadian 06 66 9.09 711+5G→A intron 05 Italian (North East) 06 225 2.67 1078delT exon 07 Celtic 27 475 5.68 1161delC exon 07 Pakistani 02 24 8.33 T338I exon 07 Italian, Sardinian 04 86 4.65 Q359K/T360K exon 07 Georgian Jews 07 8 87.50 R347H exon 07 Turkish 04 134 2.98 1609delCA exon 10 Spanish 03 96 3.12 1677delTA exon 10 Bulgarian 05 222 2.25 S549I exon 11 Arabs 02 40 5.00 Q552X exon 11 Italian (North East) 03 225 1.33 A559T exon 11 African-American 02 79 2.53 1811+1.2kbA→G intron 11 Spanish 22 1068 2.06 1898+5G→T intron 12 Chinese 03 10 30.00 1949del84 exon 13 Spanish 02 136 1.47 2143delT exon 13 Russian 04 118 3.39 2183AA→G exon 13 Italian (North East) 21 225 9.33 2184insA exon 13 Russian 03 118 2.54 3120+1G→A intron 16 African-American 14 112 12.50 3272-26A→G intron 17a Portugese, French 06 386 1.55 R1066C exon 17b Portugese 05 105 4.76 R1070Q exon 17b Bulgarian 04 166 2.41 Y1092X exon 17b French Canadian, 11 725 1.52 French M1101K exon 17b Hutterite 22 32 68.75 3821delT exon 19 Russian 03 118 2.54 S1235R exon 19 French (South) 04 340 1.18 S1251N exon 20 Dutch, Belgian 11 792 1.39 S1255X exon 20 African-American 02 79 2.53 3905insT exon 20 Swiss 45 982 4.58 Amish, Arcadian 13 86 15.12 W1282X Exon 20 Jewish-Ashkenazi 50 95 52.63 R1283M exon 20 Welsh 03 183 1.64 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/.
X
ABCC7 p.Arg347His 16088579:50:704
status: NEW[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]
Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.
Comments [show]
None has been submitted yet.
No. Sentence Comment
47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T.
X
ABCC7 p.Arg347His 16126774:47:265
status: NEW[hide] Combining immunoreactive trypsinogen and pancreati... J Pediatr. 2005 Sep;147(3):302-5. Sarles J, Berthezene P, Le Louarn C, Somma C, Perini JM, Catheline M, Mirallie S, Luzet K, Roussey M, Farriaux JP, Berthelot J, Dagorn JC
Combining immunoreactive trypsinogen and pancreatitis-associated protein assays, a method of newborn screening for cystic fibrosis that avoids DNA analysis.
J Pediatr. 2005 Sep;147(3):302-5., [PMID:16182665]
Abstract [show]
OBJECTIVES: To evaluate the performance of a strategy in which, after immunoreactive trypsinogen (IRT) determination, genetic analysis is replaced by a biological test, the pancreatitis-associated protein (PAP) enzyme-linked immunosorbent assay (ELISA). STUDY DESIGN: The French newborn screening program includes cystic fibrosis (CF) screening by the IRT/CFTR mutation strategy. PAP was assayed on screening cards, in parallel with IRT, in all newborns from 5 French regions (n = 204,749). Analysis of PAP values in CF and non-CF newborns with elevated IRT allowed direct comparison between the current strategy and the proposed IRT/PAP strategy. RESULTS: A protocol in which newborns with IRT >50 ng/mL and PAP >1.8 ng/mL and those with IRT >100 ng/mL and PAP >1.0 ng/mL are directly recalled for sweat testing would have the same performance as the IRT/CFTR mutation strategy. CONCLUSIONS: The IRT/PAP strategy is an alternative for CF newborn screening, which avoids the drawbacks of genetic analysis and is cheaper and easier to implement than the current IRT/CFTR mutation strategy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
38 Among the 48 babies screened as having CF, 43 presented with symptoms compatible with CF or abnormal sweat test results ($60 mEq/L), but 5 were classified as having a borderline form of CF because they exhibited no symptoms, had normal sweat test results (<60 mEq/L), and mild mutations [R117H, TG12-T5(IVS8), S1251N, L997F, R347H], and they did not evolve toward CF status (appearance of clinical symptoms or elevation of sweat test) after more than 1 year of follow-up.
X
ABCC7 p.Arg347His 16182665:38:325
status: NEW[hide] Cystic fibrosis transmembrane regulator gene carri... Gut. 2005 Nov;54(11):1661-2. McWilliams R, Highsmith WE, Rabe KG, de Andrade M, Tordsen LA, Holtegaard LM, Petersen GM
Cystic fibrosis transmembrane regulator gene carrier status is a risk factor for young onset pancreatic adenocarcinoma.
Gut. 2005 Nov;54(11):1661-2., [PMID:16227367]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
277 R McWilliams Department of Oncology and Department of Medicine, Mayo Clinic, Rochester, Minnesota, USA W E Highsmith Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, Minnesota, USA K G Rabe, M de Andrade, L A Tordsen Department of Health Sciences Research, Mayo Clinic, Rochester, Minnesota, USA Conflict of interest: None declared. Table 1 Comparison of CFTR mutation frequencies detected in the young onset pancreatic cancer cohort versus the clinical database Young onset pancreatic cancer cases (,60 y old at diagnosis, n = 166) Mayo Clinic clinical database reference group (n = 5349) No % No % CFTR mutation non-carriers 152 91.6 5132 95.9 CFTR mutation carriers 14 8.4 217 4.1 Mutation distribution DF508 12 85.7 155 71.4 R177H 1 7.1 28 12.9 G551D 6 2.8 2789+5G.A 6 2.8 G542X 4 1.8 N1303K 1 7.1 3 1.4 1717-1G.T 2 0.9 3849+10kbC.T 2 0.9 A455E 2 0.9 R1162X 2 0.9 R347H 1 0.5 R553X 1 0.5 3905insT 1 0.5 621+1G.T 1 0.5 W1282X 1 0.5 1898+1G.A 1 0.5 R560T 1 0.5 Young onset pancreatic cancer cases were more frequent carriers of the CFTR mutations compared with patients in the control database (odds ratio 2.18 (95% confidence interval 1.24-3.29); p = 0.006).
X
ABCC7 p.Arg347His 16227367:277:892
status: NEW[hide] Association of common haplotypes of surfactant pro... Pediatr Pulmonol. 2006 Mar;41(3):255-62. Choi EH, Ehrmantraut M, Foster CB, Moss J, Chanock SJ
Association of common haplotypes of surfactant protein A1 and A2 (SFTPA1 and SFTPA2) genes with severity of lung disease in cystic fibrosis.
Pediatr Pulmonol. 2006 Mar;41(3):255-62., [PMID:16429424]
Abstract [show]
Most individual cystic fibrosis transmembrane conductance regulator (CFTR) mutations appear not to correlate directly with severity of lung damage in cystic fibrosis (CF). Components of innate immunity, namely, mannose-binding lectin (MBL2), and surfactant protein A1 and A2 genes (SFTPA1 and SFTPA2), were shown to be critical in pulmonary host defenses. A pilot association study was conducted to identify genetic modifiers of lung disease in adult patients with CF. The structural and promoter (-221x/y) variants of MBL2, variants at codons 19, 50, 62, and 219 of SFTPA1, and at codons 9, 91, and 223 for SFTPA2, were studied in 135 adults with CF and compared to their forced expired volume in 1 sec (FEV1), diffusion of CO (DLCO), and other pulmonary scores. Predicted FEV1 was significantly lower in adults with the SFTPA1 6A3 allele and SFTPA2 1A1) allele (P = 0.01 and 0.009, respectively). The extended haplotype 6A3/1A1, which includes SFTPA1 and SFTPA2, was associated with lower pulmonary function, using FEV1 (P = 0.005) and poor pulmonary scores which were determined by American Medical Association, American Thoracic Society, and modified Shwachman-Kulczycki scores. Lower FEV1 and DLCO values were associated with MBL2 coding variants in those who had the DeltaF508 CFTR mutation (P = 0.03 and 0.004, respectively). These results support the current hypothesis that variants in pulmonary host defense molecules are potentially genetic modifiers of pulmonary disease in CF. Further work in larger populations is required to provide important new insights into the pathogenesis of CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
33 Complementary mutations were identified in 51 CF subjects: R117H (4), R347H (1), R347P (1), G542X (7), G551D (4), 1717-1G-A (2), 2789 þ 5G > A(3), 3120 þ 1G > A (2), 3659delC (3), 3849 þ 10kbC>T (6), 394delTT (1), 621 þ 1G>T (4), 711 þ 1G > T (1), G85E (1), I507 (1), N1303K (2), R352Q (1), R553X (2), R560T (1), and W1282X (4).
X
ABCC7 p.Arg347His 16429424:33:70
status: NEW[hide] Detection of F508del mutation in cystic fibrosis t... Singapore Med J. 2006 Feb;47(2):129-33. Zilfalil BA, Sarina S, Liza-Sharmini AT, Oldfield NJ, Stenhouse SA
Detection of F508del mutation in cystic fibrosis transmembrane conductance regulator gene mutation among Malays.
Singapore Med J. 2006 Feb;47(2):129-33., [PMID:16435054]
Abstract [show]
INTRODUCTION: Cystic fibrosis (CF) is one of the common genetic disorders in the western world. It has been reported to be very rare in Asian populations. According to the Cystic Fibrosis Genetic Analysis Consortium, more than 1,000 mutations of the CF gene have been identified. The CF gene, named the cystic fibrosis transmembrane conductance regulator (CFTR), is located on chromosome 7 and composed of 27 exons. This study aims to detect possible CFTR gene mutations in Malays. METHODS: We analysed 50 blood samples from healthy Malays with no symptoms of CF. DNA was extracted from blood using commercially available extraction kits (Eppendorf, Germany). Identification of CFTR gene mutation was performed using the CF OLA (Oligonucleotide Ligation Assay) kit (Applied Biosystems, USA). The PCR-ligation products were electrophoresed on eight percent sequagel using an ABI PRISM 377 genetic analyser (Applied Biosystems, USA). Electrophoresis data was analysed using the Genotyper software and a report of the CF genotype for all loci tested was created using the CF Genotyper Template software. Out of 50, one sample (two percent) was detected to have the F508del mutation (3bp deletion at exon 10), which is one of the most common CFTR gene mutations in Caucasians. RESULTS: The F508del mutation allele was detected in one subject. This indicates that she was a CF carrier. CONCLUSION: We report the finding of a carrier of the F508del mutation of the CFTR gene in the Malay population. Our finding revealed that CF could also affect the Malay population. Larger studies are necessary to determine the exact gene frequency of this population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
55 MUTATIONS R553X G551D 1507 del F508 del 1717-1 G>A G542X R560T R347P W1282X R334W 1078 Del T 3849 + 10KB C>T R1162X N1303K 3659 Del C A455E R117H 2183 AA>G 2789+5 G>A 1898 +1 G>A 621+1 G>T 711+1 G>T G85E S549N S549R V520F Q493X R347H 3849 +4 A>G 3905 INS T Y122X 4 software before running the gel electrophoresis in 1X TBE using ABI PRISM® 377 Genetic Analyzer (Applied Biosystems, USA) for 45 minutes.
X
ABCC7 p.Arg347His 16435054:55:228
status: NEW[hide] Molecular analysis of the IVS8-T splice variant 5T... Mol Hum Reprod. 2006 Jul;12(7):469-73. Epub 2006 May 19. Radpour R, Gilani MA, Gourabi H, Dizaj AV, Mollamohamadi S
Molecular analysis of the IVS8-T splice variant 5T and M470V exon 10 missense polymorphism in Iranian males with congenital bilateral absence of the vas deferens.
Mol Hum Reprod. 2006 Jul;12(7):469-73. Epub 2006 May 19., [PMID:16714368]
Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) is responsible for 2-6% of male infertility in which mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene have been identified. To investigate CBAVD at the molecular level in Iran, we have characterized the mutations in the CFTR gene in 106 patients with this condition. None had clinical manifestations of cystic fibrosis (CF). We also analysed a DNA variant (the 5T allele) in a noncoding region of CFTR, which causes reduced levels of the normal CFTR protein and M470V exon 10 missense polymorphism. Five of the 106 patients with CBAVD had mutations in both copies of the CFTR gene, and none of them had the 5T allele. Eighty-five patients had a mutation in at least one copy of CFTR, and of these patients, 46 had one 5T allele (in 11 cases, two alleles and in 35 cases, just one allele of 5T was detected). In 21 patients, no CFTR and 5T mutations were found (19.81%). 5T/M470 genotype was found in 19 patients, 5T/V470 was found in 3 and 5T with heterozygote form of M470V was found in 24 CBAVD patients. In CBAVD patients, 28 F508del carriers were identified. Most of our patients with CBAVD have mutations in the CFTR gene. The combination of the 5T allele in one copy of the CFTR gene with a CF mutation in the other copy is the most common cause of CBAVD in Iran. The 5T allele mutation has a wide range of clinical presentations and revealed a high frequency, occurring in patients with CBAVD or moderate forms of CF and infertile men.
Comments [show]
None has been submitted yet.
No. Sentence Comment
55 The analysis of the entire coding sequence allowed us to identify 16 different mutations in CBAVD patients, 13 mutations identified by kit and 3 mutations identified by genome scan (R347H, R553X and 1540A/G) (Table III).
X
ABCC7 p.Arg347His 16714368:55:182
status: NEW90 Mutation geno types IVS8-PolyT M470V n (%) Two mutations detected F508del/R117H 9T/9T M/M 1 (0.94) F508del/621+1G>T 7T/7T V/V 1 (0.94) 1540A/G/1540A/G 7T/7T M/M 2 (1.89) R347H/R117H 9T/7T M/V 1 (0.94) G551D/IVS8-5T 7T/5T M/V 2 (1.89) F508del/IVS8-5T 7T/5T M/V 8 (7.55) 9T/5T M/M 6 (5.67) 1717-1G>A/IVS8-5T 7T/5T M/V 4 (3.77) R117H/IVS8-5T 7T/5T M/V 2 (1.89) 621+1G>T/IVS8-5T 7T/5T M/V 3 (2.83) 9T/5T M/M 2 (1.89) 1540A/G/IVS8-5T 7T/5T M/V 2 (1.89) R553X/IVS8-5T 7T/5T M/V 1 (0.94) IVS8-5T/IVS8-5T 5T/5T V/V 3 (2.83) 5T/5T M/M 8 (7.55) One mutation detected G85E/- 7T/7T V/V 2 (1.89) G551D/- 9T/7T V/V 1 (0.94) 621+1G>T/- 7T/7T M/M 2 (1.89) 9T/7T M/V 1 (0.94) R334W/- 7T/7T M/V 1 (0.94) F508del/- 7T/7T M/V 7 (6.60) 9T/7T M/M 3 (2.83) 9T/9T M/V 2 (1.89) IVS8-5T/- 5T/7T M/M 3 (2.83) 5T/9T M/V 2 (1.89) 1717-1G>A/- 7T/7T M/V 3 (2.83) 9T/7T M/V 2 (1.89) R117H/- 7T/7T M/M 2 (1.89) 9T/7T M/V 1 (0.94) 2789+5G>A/- 7T/7T M/M 1 (0.94) 3120+1G>A/- 9T/7T M/V 2 (1.89) R560T/- 9T/7T M/V 1 (0.94) N1303K/- 9T/7T V/V 1 (0.94) 1651A/G/- 7T/7T M/V 1 (0.94) R553X/- 9T/7T M/V 1 (0.94) No mutation detected -/- 7T/7T M/M 12 (11.32) -/- 9T/9T M/M 3 (2.83) -/- 9T/7T M/V 6 (5.66) Table IV.
X
ABCC7 p.Arg347His 16714368:90:170
status: NEW[hide] CFTR 5T variant has a low penetrance in females th... Genet Med. 2006 Jun;8(6):339-45. Sun W, Anderson B, Redman J, Milunsky A, Buller A, McGinniss MJ, Quan F, Anguiano A, Huang S, Hantash F, Strom C
CFTR 5T variant has a low penetrance in females that is partially attributable to its haplotype.
Genet Med. 2006 Jun;8(6):339-45., [PMID:16778595]
Abstract [show]
PURPOSE: The study's purpose was to understand the molecular basis for different clinical phenotypes of the 5T variant, a tract of 5 thymidines in intron 8 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which disrupts processing of CFTR mRNA and reduces synthesis from the corresponding CFTR alleles. METHOD: We analyzed the polymorphic TG dinucleotide repeat adjacent to the 5T variant in intron 8 and the codon 470 in exon 10. Patients selected for this study were positive for both the 5T variant and the major cystic fibrosis mutation, Delta F508. Almost all Delta F508 mutation alleles occur in a 10TG-9T-470M haplotype. Therefore, it is possible to determine the haplotype of the 5T variant in trans. RESULTS: Of the 74 samples analyzed, 41 (55%) were 11TG-5T-470M, 31 (42%) were 12TG-5T-470V, and 2 (3%) were 13TG-5T-470M. Of the 49 cases for which we had clinical information, 17.6% of females (6/34) and 66.7% of males (10/15) showed symptoms resembling atypical cystic fibrosis. The haplotype with the highest penetrance in females (42% or 5/12) and more than 80% (5/6) in males is 12TG-5T-470V. We also evaluated 12 males affected with congenital bilateral absence of vas deferens and positive for the 5T variant; 10 of 12 had the 12TG-5T-470V haplotype. CONCLUSION: Overall, the 5T variant has a milder clinical consequence than previously estimated in females. The clinical presentations of the 5T variant are associated with the 5T-12TG-470M haplotype.
Comments [show]
None has been submitted yet.
No. Sentence Comment
55 These mutations include R347H, S549N, S549R, 3876delA, 394delT, 3905insT, and V520F, in addition to the 25-mutation core panel recommended by ACMG/ACOG for population-based CF screening.
X
ABCC7 p.Arg347His 16778595:55:24
status: NEW[hide] Molecular study of (TG)m(T)n polymorphisms in Iran... J Androl. 2007 Jul-Aug;28(4):541-7. Epub 2007 Feb 21. Radpour R, Gourabi H, Gilani MA, Dizaj AV
Molecular study of (TG)m(T)n polymorphisms in Iranian males with congenital bilateral absence of the vas deferens.
J Androl. 2007 Jul-Aug;28(4):541-7. Epub 2007 Feb 21., [PMID:17314234]
Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) is a frequent cause of obstructive azoospermia. Nearly 75% of men with CBAVD have at least 1 detectable common mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The different alleles at the (TG)(m)(T)(n) polymorphic locus at the 3' end of human CFTR intron 8 determine the efficiency of exon 9 splicing. To study the CFTR gene mutations and (TG)(m)(T)(n) polymorphisms in Iranian CBAVD patients with presumed low CF frequency and to better understand the complex regulation of exon 9 splicing among our study population, we analyzed CFTR mutations and (TG)(m)(T)(n) polymorphisms in 112 Iranian CBAVD, 7 congenital unilateral absence of the vas deferens males from Iran, and 84 fertile males as controls. Moreover, we compared the rate of CFTR transcripts with exon 9 (9+) with reduction of the (T)(n) repeat in our study population. Our study showed that the 5T mutation was present with high frequency in our patients. Longer (TG)(m) polymorphic tracts increase the proportion of exon 9 deletion transcripts but only when activated by the 5T allele. The combination of the 5T allele in 1 copy of the CFTR gene with a CF mutation in the other copy is the most common cause of CBAVD in the Iranian population. We also observed the highest level of exon 9+ splicing efficiency among the tested samples with the (TG)(12)(T)(7) allele, which represents the most common intron 8 splice variant allele in the general population. Our results support the idea that a putative role of the (T)(n) repeat is to distance the (TG)(m) repeat from the 3' splice site and that the different alleles at the (T)(n) locus affect the efficiency by which the splice acceptor consensus sequence is recognized.
Comments [show]
None has been submitted yet.
No. Sentence Comment
77 CFTR gene mutations in 112 CBAVD patients and 7 CBAVD patients* Samples Mutation genotype3 (TG)m(T)n n (%) CBAVD Two mutations detected (5 /112 5 4.46%) F508del / R117H (TG)10 9T / (TG)10 9T 1 (0.89) F508del / 621+1G.T (TG)11 7T / (TG)11 7T 1 (0.89) 1540A/G / 1540A/G (TG)11 7T / (TG)11 7T 2 (1.79) R347H / R117H (TG)10 9T / (TG)11 7T 1 (0.89) One mutation detected with one 5T allele (32 / 112 5 28.57%) G551D / - (TG)10 7T/ (TG)13 5T 2 (1.79) F508del / - (TG)12 7T/ (TG)13 5T 8 (7.14) (TG)11 9T/ (TG)13 5T 6 (5.36) 1717-1G.A / - (TG)11 7T/ (TG)12 5T 4 (3.57) R117H / - (TG)12 7T/ (TG)13 5T 2 (1.79) 621+1G.T / - (TG)11 7T/ (TG)13 5T 3 (2.68) 2 (1.79) 1540A/G / - (TG)11 7T/ (TG)13 5T 2 (1.79) R553X / - (TG)12 7T/ (TG)13 5T 1 (0.89) Y122H / -4 (TG)11 7T / (TG)13 5T 1 (0.89) T338A / -4 (TG)10 7T / (TG)13 5T 1 (0.89) No mutation detected with two 5T alleles (11 / 112 5 9.82%) - / - (TG)12 5T / (TG)13 5T 3 (2.68) - / - (TG)13 5T / (TG)13 5T 8 (7.14) One mutation detected without 5T allele (35 / 112 5 31.25%) G85E / - (TG)11 7T / (TG)11 7T 2 (1.79) G551D / - (TG)10 9T / (TG)12 7T1 1 (0.89) 621+1G.T / - (TG)11 7T / (TG)11 7T 2 (1.79) (TG)10 9T / (TG)11 7T 1 (0.89) R334W / - (TG)12 7T / (TG)10 7T 1 (0.89) F508del / - (TG)11 7T / (TG)11 7T 7 (6.25) (TG)11 9T / (TG)12 7T 3 (2.68) (TG)10 9T / (TG)10 9T 2 (1.79) 1717-1G.A / - (TG)11 7T / (TG)12 7T 3 (2.68) (TG)10 9T / (TG)11 7T 2 (1.79) R117H/- (TG)12 7T / (TG)12 7T 2 (1.79) (TG)10 9T / (TG)11 7T 1 (0.89) 2789+5G.A / - (TG)10 7T / (TG)11 7T 1 (0.89) 3120+1G.A / - (TG)10 9T / (TG)11 7T 2 (1.79) R560T / - (TG)10 9T / (TG)11 7T 1 (0.89) N1303K / - (TG)10 9T / (TG)11 7T 1 (0.89) 1651A/G / - (TG)11 7T / (TG)12 7T 1 (0.89) R553X / - (TG)10 9T / (TG)10 7T 1 (0.89) K536X / -4 (TG)10 9T / (TG)10 9T 1 (0.89) No mutation detected with one 5T alleles (7 / 112 5 6.25%) - / - (TG)13 5T / (TG)12 7T 3 (2.68) - / - (TG)13 5T / (TG)10 9T 4 (3.57) No mutation detected (22 / 112 5 19.64%) - / - (TG)11 7T / (TG)11 7T 12 (10.71) - / - (TG)11 7T / (TG)12 7T 1 (1.79) - / - (TG)10 9T / (TG)10 9T 3 (2.68) - / - (TG)10 9T / (TG)11 7T 6 (5.36) CUAVD One mutation detected without 5T allele (2 / 7 5 28.57%) R334W / - (TG)10 9T / (TG)11 7T 1 (14.29) R117H / - (TG)11 7T / (TG)11 7T 1 (14.29) No mutation detected with one 5T alleles (3 / 7 5 42.86%) - / - (TG)11 9T / (TG)13 5T 2 (28.57) - / - (TG)10 7T / (TG)13 5T 1 (14.29) No mutation detected (2 / 7 5 28.57%) - / - (TG)10 9T / (TG)12 7T 2 (28.57) * CBAVD indicates congenital bilateral absence of the vas deferens; CUAVD, congenital unilateral absence of the vas deferens.
X
ABCC7 p.Arg347His 17314234:77:299
status: NEW[hide] Contribution of the CFTR gene, the pancreatic secr... Clin Genet. 2007 May;71(5):451-7. Tzetis M, Kaliakatsos M, Fotoulaki M, Papatheodorou A, Doudounakis S, Tsezou A, Makrythanasis P, Kanavakis E, Nousia-Arvanitakis S
Contribution of the CFTR gene, the pancreatic secretory trypsin inhibitor gene (SPINK1) and the cationic trypsinogen gene (PRSS1) to the etiology of recurrent pancreatitis.
Clin Genet. 2007 May;71(5):451-7., [PMID:17489851]
Abstract [show]
Acute recurrent/chronic pancreatitis (CP) is a complex multigenic disease. This is a case-control study consisting of 25 Greek patients with CP and a control population of 236 healthy Greek subjects. The whole coding area and neighboring intronic regions of the three genes were screened. Seventeen of 25 patients (68%) had mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene: nine compound heterozygotes with either mild or severe mutations and eight heterozygotes. Four patients (16%) carried CFTR-modulating haplotypes V470-TG11-T5 and V470-TG12-T7. All were negative for PRSS1 gene mutations, while variants c.486C/T and c.738C/T were found in nine patients each, three homozygotes for the minor alleles. Two carried SPINK1 gene mutation p.N34S, one being transheterozygote with CFTR mutation p.F1052V. The promoter variant -253T>C was found in four individuals (one homozygous for the minor allele), all four being transheterozygotes with mutations in the CFTR gene as well. Finally two carried c.272C/T in the 3' untranslated region, one being a p.N34S carrier as well. In total, 80% (20/25) of patients had a molecular defect in one or both of the CFTR and SPINK1 genes, suggesting that mutations/variants in the CFTR plus or minus mutations in the SPINK1, but not the PRSS1 gene, may confer a high risk for recurrent pancreatitis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
63 Nine patients (36%) were compound heterozygotes for two CFTR mutations, both mild (class IV or V): p.I148T/p.R75Q, c.278915G.A/p.R75Q or mild and severe: three with p.F508del/p.R334W and four withc.444delA/p.R334W,p.E822X/c.278915G.A, p.E822X/p.R347H and p.F508del/c.3272226A.G, each.
X
ABCC7 p.Arg347His 17489851:63:245
status: NEW83 This could especially apply for p.R334W, p.R347H, p.R1070Q, p.R75Q and c.278915G.A, for which the difference in mutation frequency between patients and classic CF cohort, reached statistical significance (Table 2).
X
ABCC7 p.Arg347His 17489851:83:43
status: NEW90 Mutations and variants in the CFTR gene CFTR mutation/variant Patients with pancreatitis, n ¼ 25 (%) Controlsa , n ¼ 211 (%) Classic patients with CF, n ¼ 426 (%) p vs controls p vs patients with CF p.F508del 5 (10) 2 (0.47) 465 (54.6) ,0.0001 ,0.0001 p.R334W 4 (8) - 7 (8.2) 0.00011 0.0019 c.444delA 1 (2) - 1 (0.1) c.278915G.A 2 (4) - 11 (1.3) 0.011 CFTRdel2,3 (21 kb) 1 (2) - 2 (0.2) c.E822X 2 (4) - 12 (1.5) 0.011 p.R347H 1 (2) - - 0.055 p.R1070Q 3 (6) 1 (0.24) 7 (0.8) 0.004 0.013 p.G576A 1 (2) - 1 (0.1) p.F1052V 1 (2) 4 (0.95) 1 (0.1) p.I148T 1 (2) - 1 (0.1) c.3272226A.G 1 (2) - 7 (0.82) p.R75Q 2 (4) 4 (0.95) 1 (0.1) 0.0086 c.2752215G/C 1 (2) 4 (1) 5 (0.6) TG11T7 26 (52) 286 (67.7) ND TG11T5 2 (4) 5 (1.18) ND TG10T7 8 (16) 79 (18.7) ND TG10T9 8 (16) 14 (3.3) ND 0.0005 TG12T7 2 (4) 8 (1.9) ND M470 6 (12) 48 (11.4) ND V470 8 (16) 166 (39.3) ND 0.008 CF, cystic fibrosis; ND, not determined.
X
ABCC7 p.Arg347His 17489851:90:435
status: NEW[hide] Misfolding of the cystic fibrosis transmembrane co... Biochemistry. 2008 Feb 12;47(6):1465-73. Epub 2008 Jan 15. Cheung JC, Deber CM
Misfolding of the cystic fibrosis transmembrane conductance regulator and disease.
Biochemistry. 2008 Feb 12;47(6):1465-73. Epub 2008 Jan 15., 2008-02-12 [PMID:18193900]
Abstract [show]
Understanding the structural basis for defects in protein function that underlie protein-based genetic diseases is the fundamental requirement for development of therapies. This situation is epitomized by the cystic fibrosis transmembrane conductance regulator (CFTR)-the gene product known to be defective in CF patients-that appears particularly susceptible to misfolding when its biogenesis is hampered by mutations at critical loci. While the primary CF-related defect in CFTR has been localized to deletion of nucleotide binding fold (NBD1) residue Phe508, an increasing number of mutations (now ca. 1,500) are being associated with CF disease of varying severity. Hundreds of these mutations occur in the CFTR transmembrane domain, the site of the protein's chloride channel. This report summarizes our current knowledge on how mutation-dependent misfolding of the CFTR protein is recognized on the cellular level; how specific types of mutations can contribute to the misfolding process; and describes experimental approaches to detecting and elucidating the structural consequences of CF-phenotypic mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
91 Mutants R334W, R347H/P also cause changes in ion conduction or regulation (74, 75).
X
ABCC7 p.Arg347His 18193900:91:15
status: NEW115 WT, L346P, R347P, L346P/R347I, and R347H CFTR expression was assayed by immunoblotting, using the mouse monoclonal anti-HA Ab. Equal loading of proteins was verified by visualizing the Na+/K+-ATPase (lower panel).
X
ABCC7 p.Arg347His 18193900:115:35
status: NEW137 When the biogenesis of corresponding full-length CFTR mutants was examined in this context, the protein harboring the L346P mutation was found to be unstable, while the wild type, R347P, along with the R347H mutant protein, processed normally (Figure 4A).
X
ABCC7 p.Arg347His 18193900:137:202
status: NEW[hide] N-terminal CFTR missense variants severely affect ... Hum Mutat. 2008 May;29(5):738-49. Gene GG, Llobet A, Larriba S, de Semir D, Martinez I, Escalada A, Solsona C, Casals T, Aran JM
N-terminal CFTR missense variants severely affect the behavior of the CFTR chloride channel.
Hum Mutat. 2008 May;29(5):738-49., [PMID:18306312]
Abstract [show]
Over 1,500 cystic fibrosis transmembrane conductance regulator (CFTR) gene sequence variations have been identified in patients with cystic fibrosis (CF) and related disorders involving an impaired function of the CFTR chloride channel. However, detailed structure-function analyses have only been established for a few of them. This study aimed evaluating the impact of eight N-terminus CFTR natural missense changes on channel behavior. By site-directed mutagenesis, we generated four CFTR variants in the N-terminal cytoplasmic tail (p.P5L, p.S50P, p.E60K, and p.R75Q) and four in the first transmembrane segment of membrane-spanning domain 1 (p.G85E/V, p.Y89C, and p.E92K). Immunoblot analysis revealed that p.S50P, p.E60K, p.G85E/V, and p.E92K produced only core-glycosylated proteins. Immunofluorescence and whole cell patch-clamp confirmed intracellular retention, thus reflecting a defect of CFTR folding and/or trafficking. In contrast, both p.R75Q and p.Y89C had a glycosylation pattern and a subcellular distribution comparable to the wild-type CFTR, while the percentage of mature p.P5L was considerably reduced, suggesting a major biogenesis flaw on this channel. Nevertheless, whole-cell chloride currents were recorded for all three variants. Single-channel patch-clamp analyses revealed that the channel activity of p.R75Q appeared similar to that of the wild-type CFTR, while both p.P5L and p.Y89C channels displayed abnormal gating. Overall, our results predict a major impact of the CFTR missense variants analyzed, except p.R75Q, on the CF phenotype and highlight the importance of the CFTR N-terminus on channel physiology.
Comments [show]
None has been submitted yet.
No. Sentence Comment
133 Genotype^Phenotype Correlation in the N-Terminal CFTR MissenseVariants Under Studyà Missense varianta Phenotype Second allele (number of patients)b p.P5L CF p.F508del (1), p.P205S (1) p.S50P CBAVD p.F508del (1), p.E115del (1) p.E60K CF p.G542X (1), p.I507del (1) p.R75Q HT p.F508del (3), p.E725K (1) B p.R347H (1), p.R75Q (1), n.i. (4) Br c.1584G4A (2), c.1210-7_1210-6delTT (1), n.i.(3) NT p.F508del (1) CP c.1584G4A (1), n.i. (3) MI n.i. (1) CUAVD n.i. (2) OZ n.i. (2) Normal p.R75Q (1), c.2052_2053insA (1), n.i. (1) p.G85E CF p.F508del (8), p.G542X (2), p.I507del (1), c.580-1G4T (1), p.G85E (1), c.1477_ 1478delCA (1) CBAVD p.G576A (1) HT p.L997F (1),WT (1) p.G85V CF p.F508del (2), p.G542X (2), p.Y1092X (1), c.265715G4A (1), p.A1006E, c.1210-7_1210- 6delTT (1), n.i. (1) p.Y89C CF n.i. (1)c p.E92K CF p.F508del (2), p.Q890X (1), p.L206W (1) CBAVD c.1210-7_1210-6delTT (1) ÃThe recommendations for mutation nomenclature (www.hgvs.org/mutnomen/) were used to name CFTR gene sequence variations at both the nucleotide level and the protein level.
X
ABCC7 p.Arg347His 18306312:133:309
status: NEW[hide] Mutations at arginine 352 alter the pore architect... J Membr Biol. 2008 Mar;222(2):91-106. Epub 2008 Apr 18. Cui G, Zhang ZR, O'Brien AR, Song B, McCarty NA
Mutations at arginine 352 alter the pore architecture of CFTR.
J Membr Biol. 2008 Mar;222(2):91-106. Epub 2008 Apr 18., [PMID:18421494]
Abstract [show]
Arginine 352 (R352) in the sixth transmembrane domain of the cystic fibrosis transmembrane conductance regulator (CFTR) previously was reported to form an anion/cation selectivity filter and to provide positive charge in the intracellular vestibule. However, mutations at this site have nonspecific effects, such as inducing susceptibility of endogenous cysteines to chemical modification. We hypothesized that R352 stabilizes channel structure and that charge-destroying mutations at this site disrupt pore architecture, with multiple consequences. We tested the effects of mutations at R352 on conductance, anion selectivity and block by the sulfonylurea drug glipizide, using recordings of wild-type and mutant channels. Charge-altering mutations at R352 destabilized the open state and altered both selectivity and block. In contrast, R352K-CFTR was similar to wild-type. Full conductance state amplitude was similar to that of wild-type CFTR in all mutants except R352E, suggesting that R352 does not itself form an anion coordination site. In an attempt to identify an acidic residue that may interact with R352, we found that permeation properties were similarly affected by charge-reversing mutations at D993. Wild-type-like properties were rescued in R352E/D993R-CFTR, suggesting that R352 and D993 in the wild-type channel may interact to stabilize pore architecture. Finally, R352A-CFTR was sensitive to modification by externally applied MTSEA+, while wild-type and R352E/D993R-CFTR were not. These data suggest that R352 plays an important structural role in CFTR, perhaps reflecting its involvement in forming a salt bridge with residue D993.
Comments [show]
None has been submitted yet.
No. Sentence Comment
21 Alternatively, Cotten and Welsh (1999) reported that R347 plays an important role in regulating the overall structure of the CFTR pore; R347P-CFTR exhibited significantly decreased single-channel conductance and unstable channel openings, while R347H-CFTR displayed a pH-dependent conductance and anomalous mole-fraction behavior.
X
ABCC7 p.Arg347His 18421494:21:245
status: NEW[hide] Evaluation and use of a synthetic quality control ... Hum Mutat. 2008 Aug;29(8):1063-70. Berwouts S, Gordon JT, Rundell CA, Barton DE, Dequeker E
Evaluation and use of a synthetic quality control material, included in the European external quality assessment scheme for cystic fibrosis.
Hum Mutat. 2008 Aug;29(8):1063-70., [PMID:18470946]
Abstract [show]
Assuring high quality within the field of genetic testing is fundamental, as the results can have considerable impact on the patient and his or her family. The use of appropriate quality control (QC) samples is therefore essential. Diagnostic laboratories mainly use patient samples as QC material, which of course include a maximum of two mutations per sample. Bearing in mind that some assays (such as for cystic fibrosis [CF] testing) can test for more than 100 mutations, multiplex QC materials including more than two mutations could save valuable time and reagents. Based on this need, synthetic multiplex controls have been developed by Maine Molecular Quality Controls, Inc. (MMQCI) for CF. A synthetic control, containing six homozygous mutations and one polymorphism for CF transmembrane conductance regulator (CFTR), was evaluated by distributing it through the CF external quality assessment (EQA) scheme, along with the EQA samples in 2005. A total of 197 participants returned results of the yearly EQA scheme and 133 laboratories participated in the evaluation of the synthetic sample. Respectively, 76% and 73% of the participants were assigned as successful. This evaluation study revealed that the multiplex QC material performed well in the majority of assays and could be useful in method validation, as a tool to challenge interpretation skills, and as potential proficiency testing (PT) material.
Comments [show]
None has been submitted yet.
No. Sentence Comment
72 The MMQCI-CF-P1 control distributed to EQA participants contained six homozygous mutations and one polymorphism: R553X (c.1657C4T, p.Arg553X), I507del (c.1519_1521delATC, p.Ile507del), R117 H (c.350G4A, p.Arg117His), 394delTT (c.262_263delTT, p.Leu88fs), 2183AA4G (c.2051_2052delAAinsG, p.Lys684fs), R347 H (c.1040G4A, p.Arg347His), and 5 T (c.1210-12T[5]).
X
ABCC7 p.Arg347His 18470946:72:323
status: NEW135 Mutations 2183AA4G (c.2051_2052delAAinsG, p.Lys684fs) and R347 H (c.1040G4A, p.Arg347His) cross-react with 2184delA (c.2052delA, p.Lys684fs) and R347P (c.1040G4C, p.Arg347Pro), respectively, in many CFTR detection methods.
X
ABCC7 p.Arg347His 18470946:135:79
status: NEW136 This explains why seven laboratories made genotype errors (missing 2183AA4G (c.2051_2052delAAinsG, p.Lys684fs) and R347 H (c.1040G4A, p.Arg347His)) and/or reported mutations not present in the QCS (2184delA (c.2052delA, p.Lys684fs) and R347P (c.1040G4C, p.Arg347Pro)); they encountered difficulties in interpreting typical cross-reaction patterns that are explained in the manual of the assays.
X
ABCC7 p.Arg347His 18470946:136:136
status: NEW157 ErrorTypes for the QCS in More Detail, for the LaboratoriesThat Used Only One Detection Assayà Genotype error Genotype Detection assay Number of labs Expected Reported Comment OLA-CFASR v2.0 1 R117 H hom ^ Correct on raw data INNO-LiPA CFTR36 1 R117 H hom R117 H het No signal for wt R117 H visible on copy of the raw data, could be very weak on original raw data INNO-LiPA CFTR36 1 R553X hom R553X het No signal for wt R553X visible on copy of the raw data, could be very weak on original raw dataI507del hom I507del/F508del Sequencing 2 R347 H hom ^ No complete raw data received Sequencing 1 I507del hom ^ No raw data received Additional mutation(s) reported Detection assay Number of labs Additional mutation(s) Comment OLA-CFASR v3.0 US 1 2184delAa hom Software called it INNO-LiPA CFTR36 3 A455E het (3labs), F508del (1lab) No signal for mut A455E visible on copy of the raw data, could be very weak on original raw data ARMS-ElucigeneTM CF29 3 2184delAa (3labs), R347P (3labs), 1717-1G4A (3labs), 3849110kbC4T (2labs) Cross reaction with 2183AA4Gb and R347 H and no full compatibility of MMQCI-CF-P1and ARMS method: no control bands visible ARMS-ElucigeneTM CF29 1CF-HT 1 2184delAa , R347P Cross reaction with 2183AA4Gb and R347H Sequencing 1 W1282X het, N1303 K het No raw data received ASPE-CFTR 4014 Tag-It 1 71111G4T het No raw data received Genotype error 1 additional mutation(s) reported Genotype Detection assay Number of labs Expected Reported Comment Additional mutation(s) Comment OLA-CFASR v3.0 EU 1 R117 H hom ^ No raw data received; probably 2183AA4Gb missed, but 2184delAa reported due to cross reaction 2184delAa hom No raw data received, probably due to cross-reaction with 2183AA4Gb 394delTTc hom 394delTTc het 2183AA4Gb hom ^ INNO-LiPA CFTR36 1 R553X hom I507del hom R553X het I507del/ F508del No signal for wt R553X visible on copy of the raw data, could be very weak on original raw data G542X het A455E het No signal for mut G542X and mut A455E visible on copy of the raw data, could be very weak on original raw data INNO-LiPA CFTR36 1 Italian regional 1 R553X hom R553X het No signal for wt R553X visible on copy of the raw data, could be very weak on original raw data Q552X het Misinterpretation: wt and mut signal for Q552X not visible, but this is a normal reaction pattern when R553X is hom present; the lab reported R553X het ARMS-ElucigeneTM CF29 1 I507del hom ^ No full compatibility of MMQCI- CF-P1 and ARMS method: no control bands R347P Cross-reaction with R347H2183AA4Gb hom ^ ÃIf the zygosity is not mentioned in the table, the laboratory did not report it.
X
ABCC7 p.Arg347His 18470946:157:1236
status: NEW[hide] Unique mutations of the cystic fibrosis transmembr... Intern Med. 2009;48(15):1327-31. Epub 2009 Aug 3. Izumikawa K, Tomiyama Y, Ishimoto H, Sakamoto N, Imamura Y, Seki M, Sawai T, Kakeya H, Yamamoto Y, Yanagihara K, Mukae H, Yoshimura K, Kohno S
Unique mutations of the cystic fibrosis transmembrane conductance regulator gene of three cases of cystic fibrosis in Nagasaki, Japan.
Intern Med. 2009;48(15):1327-31. Epub 2009 Aug 3., [PMID:19652440]
Abstract [show]
Cystic fibrosis (CF), the most common lethal hereditary disorder in Caucasians, is quite rare in Southeast Asia including Japan. Here, we report three CF cases encountered in Nagasaki, Japan. Case 1; a 24-year-old man with dyspnea and cough was diagnosed as CF with a missense mutation Q98R in exon 4 and a polymorphic 125C in exon 1 in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Case 2; a 13-year-old woman born of consanguineous parents was diagnosed as CF with homozygous Q98R mutations in exon 4. Case 3; a 29-year-old woman complaining of cough and sputum was diagnosed as CF with a heterozygous R347H mutation in exon 7 and a polymorphic 125C in exon 1. These mutations have been previously reported in Caucasian patients, but are considered very rare. Although the numbers of individuals with CF are very limited, the profiles of CFTR mutations in those patients are likely diverse in Japan.
Comments [show]
None has been submitted yet.
No. Sentence Comment
4 Case 3; a 29-year-old woman complaining of cough and sputum was diagnosed as CF with a heterozygous R347H mutation in exon 7 and a polymorphic 125C in exon 1.
X
ABCC7 p.Arg347His 19652440:4:100
status: NEW16 The other novel or rare mutations such as R347H, D 979A, 1724delAG, H1085R, M152R and 1540del10 have The Second Department of Internal Medicine, Nagasaki University School of Medicine, Nagasaki, Department of Respiratory Medicine, National Hospital Organization Minami-Kyushu National Hospital, Kagoshima, Department of Respiratory Medicine, National Hospital Organization Ureshino Medical Center, Ureshino, Department of Laboratory Medicine, Nagasaki University School of Medicine, Nagasaki and Department of Respiratory Medicine, Respiratory Center, Toranomon Hospital, Tokyo Received for publication January 20, 2009; Accepted for publication April 14, 2009 Correspondence to Dr. Koichi Izumikawa, koizumik@nagasaki-u.ac.jp Figure1.
X
ABCC7 p.Arg347His 19652440:16:42
status: NEW60 Heterozygous R347H mutation in exon 7 and a polymorphic 125C in exon 1 were present by CFTR mutation screening.
X
ABCC7 p.Arg347His 19652440:60:13
status: NEW66 Locus of CFTR mutationCase Age Sex CP sinusitis CBAVD PFD test (%) sweat chloride concentration (mmol/L) Mutation (variant) Exon Mutation (variant) Exon 1 24 M - + + 17.0 94.0 125C 1 Q98R 4 2 13 F + - - 67.0 54.8 Q98R 4 Q98R 4 3 29 F - + - 69.8 60.0 125C 1 R347H 7 CP, consanguineous parents; CBAVD, congenital bilateral absence of the vas deferens; PFD, pancreatic functional diagnostant.
X
ABCC7 p.Arg347His 19652440:66:257
status: NEW90 The R347H mutation which was detected in Case 3 was originally reported in 1992 in a CF patient with mild phenotype (18).
X
ABCC7 p.Arg347His 19652440:90:4
status: NEW91 The clinical features of CF patients with R347H mutation were characterized as mild pulmonary symptoms and all men were infertile accompanied by CBAVD (7).
X
ABCC7 p.Arg347His 19652440:91:42
status: NEW92 Although a few cases with R347H mutations with F508del on the other allele were previously reported in Japan and Italy (7, 18), no cases with R347H/125C mutation have been reported before.
X
ABCC7 p.Arg347His 19652440:92:26
status: NEWX
ABCC7 p.Arg347His 19652440:92:142
status: NEW98 The mutations detected were Q 98R in Cases 1 and 2, and R347H in Case 3, although they were heterozygous in Cases 1 and 3.
X
ABCC7 p.Arg347His 19652440:98:56
status: NEW[hide] Non-classic cystic fibrosis associated with D1152H... Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15. Burgel PR, Fajac I, Hubert D, Grenet D, Stremler N, Roussey M, Siret D, Languepin J, Mely L, Fanton A, Labbe A, Domblides P, Vic P, Dagorne M, Reynaud-Gaubert M, Counil F, Varaigne F, Bienvenu T, Bellis G, Dusser D
Non-classic cystic fibrosis associated with D1152H CFTR mutation.
Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15., [PMID:19843100]
Abstract [show]
BACKGROUND: Limited knowledge exists on phenotypes associated with the D1152H cystic fibrosis transmembrane conductance regulator (CFTR) mutation. METHODS: Subjects with a D1152H allele in trans with another CFTR mutation were identified using the French Cystic Fibrosis Registry. Phenotypic characteristics were compared with those of pancreatic insufficient (PI) and pancreatic sufficient (PS) cystic fibrosis (CF) subjects in the Registry (CF cohort). RESULTS: Forty-two subjects with D1152H alleles were identified. Features leading to diagnosis included chronic sinopulmonary disease (n = 25), congenital absence of the vas deferens (n = 11), systematic neonatal screening (n = 4), and genetic counseling (n = 2). Median age at diagnosis was 33 [interquartile range (IQR, 24-41)] years in D1152H subjects. Median sweat chloride concentrations were 43.5 (39-63) mmol/l in D1152H subjects and were markedly lower than in PI and PS CF subjects (p < 0.05). Bronchiectasis was present in 67% of D1152H subjects, but Pseudomonas aeruginosa colonization and pancreatic insufficiency were present in <30% of subjects. Estimated rates of decline in forced expiratory volume in 1 s (FEV(1)) were lower in D1152H subjects vs PI CF subjects (p < 0.05). None of the D1152H subjects identified since 1999 had died or required lung transplantation. CONCLUSIONS: When present in trans with a CF-causing mutation, D1152H causes significant pulmonary disease, but all subjects had prolonged survival.
Comments [show]
None has been submitted yet.
No. Sentence Comment
42 The CF genetic analysis panel used in France seeks for 32 mutations: G85E, 394delTT, 621+1G>T, 711+1G>T, R334W, R347P, R347H, 1078delT, 5T/7T/9T, A455E, F508del, I507del, V520F, 1717-1G>A, G542X, G551D, R553X, R560T, S549R (T>G), S549N, 1898+1G>A, 2183AA>G, 2184delA, 2789+5G>A, 3120+1G>A, R1162X, 3659delC, 3849+10kbC>T, W1282X, 3905insT, 3876delA, N1303K.
X
ABCC7 p.Arg347His 19843100:42:119
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... Cancer. 2010 Jan 1;116(1):203-9. McWilliams RR, Petersen GM, Rabe KG, Holtegaard LM, Lynch PJ, Bishop MD, Highsmith WE Jr
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations and risk for pancreatic adenocarcinoma.
Cancer. 2010 Jan 1;116(1):203-9., 2010-01-01 [PMID:19885835]
Abstract [show]
BACKGROUND: Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are common in white persons and are associated with pancreatic disease. The purpose of this case-control study was to determine whether CFTR mutations confer a higher risk of pancreatic cancer. METHODS: In a case-control study, the authors compared the rates of 39 common cystic fibrosis-associated CFTR mutations between 949 white patients with pancreatic adenocarcinoma and 13,340 white controls from a clinical laboratory database for prenatal testing for CFTR mutations. The main outcome measure was the CFTR mutation frequency in patients and controls. RESULTS: Overall, 50 (5.3%) of 949 patients with pancreatic cancer carried a common CFTR mutation versus 510 (3.8%) of 13,340 controls (odds ratio [OR], 1.40; 95% confidence interval [CI], 1.04-1.89; P = .027). Among patients who were younger when their disease was diagnosed (<60 years), the carrier frequency was higher than in controls (OR, 1.82; 95% CI, 1.14-2.94; P = .011). In patient-only analyses, the presence of a mutation was associated with younger age (median 62 vs 67 years; P = .034). In subgroups, the difference was seen only among ever-smokers (60 vs 65 years, P = .028). Subsequent sequencing analysis of the CFTR gene detected 8 (16%) compound heterozygotes among the 50 patients initially detected to have 1 mutation. CONCLUSIONS: Carrying a disease-associated mutation in CFTR is associated with a modest increase in risk for pancreatic cancer. Those affected appear to be diagnosed at a younger age, especially among smokers. Clinical evidence of antecedent pancreatitis was uncommon among both carriers and noncarriers of CFTR mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
84 (%) of Controls, n513,340 Significance Not detected 899 (94.7) 12,830 (96.2) OR, 1.40 (95% CI, 1.04-1.89) Detected 50 (5.3) 510 (3.8) P¼.027 DF508*,y 35 (70) 354 (69.4) R117H*,z 5 (10) 71 (13.9) G551D*,y 1 (2) 11 (2.2) N1303K*,y 1 (2) 8 (1.6) G542X*,y 8 (1.6) 1717-1G>A*,y 7 (1.4) 278915G>A* 6 (1.2) R553X*,y 6 (1.2) W1282X*,y 5 (10) 5 (1.0) R347H 5 (1.0) R1162X*,y 4 (0.8) 62111G>T*,y 4 (0.8) R560T*,y 3 (0.6) R347P* 1 (2) 2 (0.4) A455E* 2 (0.4) 3849110kbC>T* 2 (0.4) 394delTT 2 (0.4) G85E* 2 (0.4) 3905insTy 2 (0.4) 189811G>A* 2 (0.4) 2183AA>G 1 (0.2) 2184delA*,y 1 (0.2) 71111G>T*,y 1 (0.2) V520F 1 (0.2) S549Ry 1 (2) DI507*,y 1 (2) OR indicates odds ratio; CI, confidence interval.
X
ABCC7 p.Arg347His 19885835:84:347
status: NEW[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]
Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.
Comments [show]
None has been submitted yet.
No. Sentence Comment
48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT.
X
ABCC7 p.Arg347His 19897426:48:177
status: NEW89 Mutations found in the homozygous (n=2) and heterozygous (n=20) diagnosed foetuses are the following: ΔF508/ΔF508 (n=1), 711+5G→A/711+5G→A (n=1), ΔF508/P5L (n=1), 2183AA→G/S42F (n=1), ΔF508/ D1445N (n=1), 711+5G→A/ΔF508 (n=1), G542X/E527G (n=1), N1303K/1717-1 G→A (n=1), R117H/E527G (n=1), ΔF508/2183AA→G (n=1), ΔF508/D1152H (n=1), R347H/ ΔF508 (n=1), ΔF508/G542X (n=2), ΔF508/N1303K (n=2), R1162X/ΔF508 (n=3), N1303K/D1152H (n=3).
X
ABCC7 p.Arg347His 19897426:89:416
status: NEW97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction.
X
ABCC7 p.Arg347His 19897426:97:546
status: NEWX
ABCC7 p.Arg347His 19897426:97:865
status: NEW[hide] The importance of sweat testing for older siblings... J Pediatr. 2009 Dec;155(6):928-930.e1. Munck A, Houssin E, Roussey M
The importance of sweat testing for older siblings of patients with cystic fibrosis identified by newborn screening.
J Pediatr. 2009 Dec;155(6):928-930.e1., [PMID:19914431]
Abstract [show]
We report cystic fibrosis (CF) care center instructions for sweat testing in older siblings after implementation of the French nationwide newborn screening program, and we evaluate the incidence of unrecognized CF. Nearly 9% of families with an infant screened for CF were unaware of an affected older sibling. We strongly recommend sweat testing for all first-degree older children.
Comments [show]
None has been submitted yet.
No. Sentence Comment
32 Thus, if we consider our 7 symptom-free siblings, 2 had mutations associated with classical CF disease, 1 with variable phenotype expression (an intermediate chloride ST: 50 mmol/L, F508del/R347H) and 4 children (from 3 families) combined a severe mutation with R117H against a background polythymidine sequence of intron 8 7 T-9 T, with 2 ST that were positive.
X
ABCC7 p.Arg347His 19914431:32:190
status: NEW[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]
Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.
Comments [show]
None has been submitted yet.
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure).
X
ABCC7 p.Arg347His 20059485:64:699
status: NEW57 PI prevalence and in silico prediction scores for 13 most frequent missense mutations identified in Canadian CF patients Mutation Total PI Total (PI + PS) PI prevalence Class PANTHER scorea POLYPHENa SIFTa p.R334W 1 9 0.11 CF-PS -7.4419 Possibly damaging 0.01 p.P67L 2 14 0.14 CF-PS -4.1736 Probably damaging 0 p.R347P 2 12 0.17 CF-PS -7.5259 Possibly damaging 0.01 p.R347H 1 5 0.20 CF-PS -6.8327 Possibly damaging 0 p.A455E 8 39 0.21 CF-PS -8.8641 Probably damaging 0 p.L206W 4 19 0.21 CF-PS -8.5817 Possibly damaging 0 p.P574H 4 7 0.57 CF-PI/PSb -8.1252 Probably damaging 0 p.G85E 15 24 0.63 CF-PI/PSb -7.3194 Possibly damaging 0 p.M1101K 22 33 0.67 CF-PI/PSb -5.8849 Probably damaging 0.01 p.R1066C 7 8 0.88 CF-PI -7.7424 Probably damaging 0 p.G551D 56 59 0.95 CF-PI -9.5654 Probably damaging 0 p.N1303K 47 49 0.96 CF-PI -9.7687 Probably damaging 0 p.V520F 7 7 1.00 CF-PI -7.1652 Benign 0 aPANTHER scores range from zero to negative values (maximum -12).
X
ABCC7 p.Arg347His 20059485:57:368
status: NEW129 A disparity in prediction scores between two mild CF-PS mutations (p.R347H and p.R347P) that confer an amino acid change in the same position of the protein points to another limitation of these tools.
X
ABCC7 p.Arg347His 20059485:129:69
status: NEW[hide] Association of cystic fibrosis genetic modifiers w... Fertil Steril. 2010 Nov;94(6):2122-7. Epub 2010 Jan 25. Havasi V, Rowe SM, Kolettis PN, Dayangac D, Sahin A, Grangeia A, Carvalho F, Barros A, Sousa M, Bassas L, Casals T, Sorscher EJ
Association of cystic fibrosis genetic modifiers with congenital bilateral absence of the vas deferens.
Fertil Steril. 2010 Nov;94(6):2122-7. Epub 2010 Jan 25., [PMID:20100616]
Abstract [show]
OBJECTIVE: To investigate whether genetic modifiers of cystic fibrosis (CF) lung disease also predispose to congenital bilateral absence of the vas deferens (CBAVD) in association with cystic fibrosis transmembrane conductance regulator (CFTR) mutations. We tested the hypothesis that polymorphisms of transforming growth factor (TGF)-beta1 (rs 1982073, rs 1800471) and endothelin receptor type A (EDNRA) (rs 5335, rs 1801708) are associated with the CBAVD phenotype. DESIGN: Genotyping of subjects with clinical CBAVD. SETTING: Outpatient and hospital-based clinical evaluation. PATIENT(S): DNA samples from 80 subjects with CBAVD and 51 healthy male controls from various regions of Europe. This is one of the largest genetic studies of this disease to date. INTERVENTION(S): None. MAIN OUTCOME MEASURE(S): Genotype analysis. RESULT(S): For single nucleotide polymorphism (SNP) rs 5335, we found increased frequency of the CC genotype among subjects with CBAVD. The difference was significant among Turkish patients versus controls (45.2% vs. 19.4%), and between all cases versus controls (36% vs. 15.7%). No associations between CBAVD penetrance and polymorphisms rs 1982073, rs 1800471, or rs 1801708 were observed. CONCLUSION(S): Our findings indicate that endothelin receptor type A polymorphism rs 5335 may be associated with CBAVD penetrance. To our knowledge, this is the first study to investigate genetic modifiers relevant to CBAVD.
Comments [show]
None has been submitted yet.
No. Sentence Comment
68 Portuguese CFTR alleles Spanish CFTR alleles Turkish CFTR alleles 5T 22 F508del 11 5T 20 F508del 14 5T 9 D1152H 14 R334W 5 D443Ya 3 D110H 3 R117H 3 G576Aa 3 F508del 2 S1235R 3 R668Ca 3 3041-11del7 2 N1303K 2 G542X 2 1767del6 2 P205S 2 R117H 2 2789þ5G>A 2 D614G 2 V232D 2 CFTRdele2(ins186) 2 G542X 1 L997F 1 3120þ1G>A 1 L206W 1 H609R 1 G1130A 1 V562I 1 N1303H 1 M952I 1 I507del 1 L206W 1 365insT 1 3272-26A>G 1 3272-26A/G 1 E585X 1 2789þ5G>A 1 L15P 1 2752-15C>G 1 G576Aa 1 R347H 1 R334Q 1 R668Ca 1 2689insG 1 R347H 1 CFTRdele2,3 1 R1070W 1 E831X 1 L1227S 1 I 1027T 1 R1070W 1 E831X 1 3272-26A>G 1 L997F 1 I853F 1 A349V 1 6T 1 Note: CFTR ¼ cystic fibrosis transmembrane conductance regulator.
X
ABCC7 p.Arg347His 20100616:68:487
status: NEWX
ABCC7 p.Arg347His 20100616:68:523
status: NEW[hide] Incidence, prevalence, etiology, and prognosis of ... Dig Dis Sci. 2010 Oct;55(10):2988-98. Epub 2010 Jan 28. Joergensen M, Brusgaard K, Cruger DG, Gerdes AM, de Muckadell OB
Incidence, prevalence, etiology, and prognosis of first-time chronic pancreatitis in young patients: a nationwide cohort study.
Dig Dis Sci. 2010 Oct;55(10):2988-98. Epub 2010 Jan 28., [PMID:20108119]
Abstract [show]
BACKGROUND/AIMS: Publications on etiology of chronic pancreatitis (CP) are infrequent. Etiologies today encompass genetic disorders. We wanted to describe etiologies of today and identify patients with genetic disorders like hereditary pancreatitis (HP), mutations in Serine Protease Inhibitor Kazal type1 (SPINK1), and the Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR) among patients formerly considered to have idiopathic CP. METHODS: Data on patients diagnosed with first-time CP < 30 years of age in Denmark identified in the Danish National Registry of Patients were retrieved. Patients previously considered to have idiopathic pancreatitis were offered genetic counseling and evaluation for HP, SPINK1, and CFTR mutations. RESULTS: In the period 1980-2004, 580 patients < 30 years of age presented with CP, the standardized prevalence ratio of CP increased from 11.7 per 100,000 person years in 1980-1984 to 17.0 per 100,000 in 2000-2004 (p < 0.001). The odds ratio (OR) having gallstone-related CP increased in the latter time period, especially in women, that of alcohol-induced CP decreased over time. OR having idiopathic CP increased in the latter period; 50% of patients with idiopathic pancreatitis accepted genetic reevaluation; 28 patients had a genetic mutation that totally or partly could explain their pancreatitis, nine of these had two, and 11 patients had HP. CONCLUSION: The prevalence of CP, especially in women, increased over time. Genetic causes that partly or totally could explain the CP were found in 54.90% (95% CI (40.45-68.62)) of those with idiopathic CP, as a minimum estimation 1.9% (95% CI (1.00-3.47)) of the total cohort had HP.
Comments [show]
None has been submitted yet.
No. Sentence Comment
49 1G [ T, F508del, S549 N, I507del, S549R, 2184delA, G551D, G85E, N1303 K, R560T, R117H, R347H, R347P, R334 W, 2789 ?
X
ABCC7 p.Arg347His 20108119:49:87
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... Am J Respir Crit Care Med. 2010 May 15;181(10):1078-84. Epub 2010 Feb 18. Bienvenu T, Sermet-Gaudelus I, Burgel PR, Hubert D, Crestani B, Bassinet L, Dusser D, Fajac I
Cystic fibrosis transmembrane conductance regulator channel dysfunction in non-cystic fibrosis bronchiectasis.
Am J Respir Crit Care Med. 2010 May 15;181(10):1078-84. Epub 2010 Feb 18., 2010-05-15 [PMID:20167849]
Abstract [show]
RATIONALE: Although in patients with diffuse bronchiectasis (DB) and a normal sweat test the presence of one mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene is frequently observed, its pathogenic role in the development of DB remains unclear. OBJECTIVES: To evaluate the association between CFTR heterozygosity and CFTR protein dysfunction in the airways of patients with DB. METHODS: Nasal potential difference was measured in 122 patients with DB of unknown origin and with a normal sweat test (Cl(-) < 60 mmol/L). They were classified according to the presence of CFTR mutations: zero (85 patients), one (22 patients), or two mutations (15 patients). Control groups comprised 26 healthy subjects, 38 obligate heterozygotes for CFTR, and 92 patients with classic cystic fibrosis (CF) with an abnormal sweat test (Cl(-) > or = 60 mmol/L). Patients classified as mild-CF were carrying at least one mild mutation and patients classified as severe-CF were homozygous for the F508del mutation. MEASUREMENTS AND MAIN RESULTS: There was a continuum of airway CFTR dysfunction in the study population as shown by nasal potential difference measurements, ranging from normal values in healthy subjects, to intermediate values in subjects with DB, to highly abnormal values in subjects classified as severe-CF. This continuum of airway CFTR dysfunction was thus strongly associated with defects in the CFTR gene. Moreover, among patients with DB, a similar continuum in intermediate nasal potential difference was identified that was associated with the bearing of zero, one, or two CFTR mutations. These electrophysiological phenotypes and CFTR genotypes were also associated with the clinical phenotype, as shown by the frequency of Staphylococcus aureus and Pseudomonas aeruginosa bronchial colonization. CONCLUSIONS: Our study supports the hypothesis that a unique CFTR mutation may have pathogenic consequences in patients with DB.
Comments [show]
None has been submitted yet.
No. Sentence Comment
82 GENOTYPE AND PHENOTYPE OF PATIENTS WITH DIFFUSE BRONCHIECTASIS BEARING TWO CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR MUTATIONS Patient No. Age (yr) Sex (M/F) CFTR Mutations Sweat Cl2 (mmol/L) Basal PD (mV) NPD Index Age at Onset (yr) FEV1 (% pred) Bacteria Colonization 1 55 F F508del/D1152H 19 219 1.00 54 99 Sa 2 71 F F508del/G576A-R668C 29 223 0.44 70 114 None 3 24 M G542X/3849110kbCT 52 224 1.22 10 78 Pa 4 41 F 394delTT/D1152H 19 225 0.30 41 89 Sa 5 31 M 3849110kbC.T/3849110kbC.T 35 230 0.64 2 30 Sa/Pa 6 74 F G542X/S912L 40 233 0.19 60 106 None 7 50 M W1282X/D1152H 35 236 1.00 10 32 Pa 8 42 F F508del/D1152H 13 240 0.68 30 32 Pa 9 56 F F508del/IVS8-5T 30 242 0.70 10 70 None 10 45 F 394delTT/D1152H 25 242 0.71 18 62 Sa/Pa 11 74 F W1282X/D1152H 25 244 0.66 12 56 Pa 12 23 F S1206X/D1152H 19 244 0.68 13 107 None 13 41 F R553X/R851L-T351S 31 248 0.50 35 72 Pa 14 58 M F508del/R117H-7T 46 251 0.61 45 35 Sa/Pa 15 53 F F508del/R347H 49 258 0.63 40 77 Pa Definition of abbreviations: Cl2 5 chloride; F 5 female; M 5 male; NPD index 5 nasal potential difference index 5 e(response to øCl2 and iso/response to amil); a cut off .
X
ABCC7 p.Arg347His 20167849:82:943
status: NEW[hide] Measurement of nasal potential difference in young... Thorax. 2010 Jun;65(6):539-44. Sermet-Gaudelus I, Girodon E, Roussel D, Deneuville E, Bui S, Huet F, Guillot M, Aboutaam R, Renouil M, Munck A, des Georges M, Iron A, Thauvin-Robinet C, Fajac I, Lenoir G, Roussey M, Edelman A
Measurement of nasal potential difference in young children with an equivocal sweat test following newborn screening for cystic fibrosis.
Thorax. 2010 Jun;65(6):539-44., [PMID:20522854]
Abstract [show]
BACKGROUND: A challenging problem arising from cystic fibrosis (CF) newborn screening is the significant number of infants with hypertrypsinaemia (HIRT) with sweat chloride levels in the intermediate range and only one or no identified CF-causing mutations. OBJECTIVES: To investigate the diagnostic value for CF of assessing CF transmembrane conductance regulator (CFTR) protein function by measuring nasal potential difference in children with HIRT. METHODS: A specially designed protocol was used to assess nasal potential difference (NPD) in 23 young children with HIRT (3 months-4 years) with inconclusive neonatal screening. Results were analysed with a composite score including CFTR-dependent sodium and chloride secretion. Results were correlated with genotype after extensive genetic screening and with clinical phenotype at follow-up 3 years later. RESULTS: NPD was interpretable for 21 children with HIRT: 13 had NPD composite scores in the CF range. All 13 were finally found to carry two CFTR mutations. At follow-up, nine had developed a chronic pulmonary disease consistent with a CF diagnosis. The sweat test could be repeated in nine children, and six had sweat chloride values >or=60 mmol/l. Of the eight children with normal NPD scores, only two had two CFTR mutations, both wide-spectrum mutations. None had developed a CF-like lung disease at follow-up. The sweat test could be reassessed in five of these eight children and all had sweat chloride values <60 mmol/l. CF diagnosis was ruled out in six of these eight children. CONCLUSION: Evaluation of CFTR function in the nasal epithelium of young children with inconclusive results at CF newborn screening is a useful diagnostic tool for CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
91 Of the three patients with two CFTR mutations in the HIRT-Nl group, one carried a mutation without any clinical consequence (3849+45G/A), while the other two carried F508del in trans with the R347H broad-spectrum mutation, or the CFTR-RD-associated mutation R117H.
X
ABCC7 p.Arg347His 20522854:91:192
status: NEW130 Table 3 Genotypes of the children with HIRT according to the diagnostic score cut-off in the 21 patients with reliable NPD tests; results after extensive genetic analysis CFTR genotypes Diagnosis score >0.27 (8 patients) £0.27 (13 patients) A/A 0 F508del/621+3A/G F508del/Q1291R A/AB F508del/R347H F508del/R117H;T7 W846X/R117C n¼2 F508del/R1070W 2183AA/G/L206W F508del/3272-26A/G F508del/R117H;T7; n¼4 A/D 0 F508del/R933G G551D/R352Q B/D G622D/3849+45G/A 0 A/0 F508del/0 n¼2 0 0/0 3 0 0, no identified mutation; A, CF-causing mutation; B, mutation associated with cystic CFTR-related disorders; C, mutation with no clinical consequence ; D, mutation of unknown or uncertain clinical relevance; AB, mutation that is associated with a wide phenotypic spectrum that might belong to either group A or B. CFTR, cystic fibrosis transmembrane conductance regulator; HIRT, hypertrypsinaemia; NPD, nasal potential difference.
X
ABCC7 p.Arg347His 20522854:130:297
status: NEW[hide] Identification of the second CFTR mutation in pati... Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26. Giuliani R, Antonucci I, Torrente I, Grammatico P, Palka G, Stuppia L
Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols.
Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26., [PMID:20657600]
Abstract [show]
Congenital bilateral absence of vas deferens (CBAVD) is a manifestation of the mildest form of cystic fibrosis (CF) and is characterized by obstructive azoospermia in otherwise healthy patients. Owing to the availability of assisted reproductive technology, CBAVD patients can father children. These fathers are at risk of transmitting a mutated allele of the CF transmembrane conductance regulator (CFTR) gene, responsible for CF, to their offspring. The identification of mutations in both CFTR alleles in CBAVD patients is a crucial requirement for calculating the risk of producing a child with full-blown CF if the female partner is a healthy CF carrier. However, in the majority of CBAVD patients, conventional mutation screening is not able to detect mutations in both CFTR alleles, and this difficulty hampers the execution of correct genetic counselling. To obtain information about the most represented CFTR mutations in CBAVD patients, we analysed 23 CBAVD patients, 15 of whom had a single CFTR mutation after screening for 36 mutations and the 5T allele. The search for the second CFTR mutation in these cases was performed by using a triplex approach: (i) first, a reverse dot-blot analysis was performed to detect mutations with regional impact; (ii) next, multiple ligation-dependent probe amplification assays were conducted to search for large rearrangements; and (iii) finally, denaturing high-performance liquid chromatography was used to search for point mutations in the entire coding region. Using these approaches, the second CFTR mutation was detected in six patients, which increased the final detection rate to 60.8%.
Comments [show]
None has been submitted yet.
No. Sentence Comment
58 INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator.
X
ABCC7 p.Arg347His 20657600:58:568
status: NEW[hide] A new complex allele of the CFTR gene partially ex... Genet Med. 2010 Sep;12(9):548-55. Lucarelli M, Narzi L, Pierandrei S, Bruno SM, Stamato A, d'Avanzo M, Strom R, Quattrucci S
A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation.
Genet Med. 2010 Sep;12(9):548-55., [PMID:20706124]
Abstract [show]
PURPOSE: To evaluate the role of complex alleles, with two or more mutations in cis position, of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in the definition of the genotype-phenotype relationship in cystic fibrosis (CF), and to evaluate the functional significance of the highly controversial L997F CFTR mutation. METHODS: We evaluated the diagnosis of CF or CFTR-related disorders in 12 unrelated subjects with highly variable phenotypes. According to a first CFTR mutational analysis, subjects appeared to be compound heterozygotes for a classic mutation and the L997F mutation. A further CFTR mutational analysis was conducted by means of a protocol of extended sequencing, particularly suited to the detection of complex alleles. RESULTS: We detected a new [R117L; L997F] CFTR complex allele in the four subjects with the highest sweat test values and CF. The eight subjects without the complex allele showed the most varied biochemical and clinical outcome and were diagnosed as having mild CF, CFTR-related disorders, or even no disease. CONCLUSIONS: The new complex allele partially explains the variable phenotype in CF subjects with the L997F mutation. CFTR complex alleles are likely to have a role in the definition of the genotype-phenotype relationship in CF. Whenever apparently identical CFTR-mutated genotypes are found in subjects with divergent phenotypes, an extensive mutational search is mandatory.
Comments [show]
None has been submitted yet.
No. Sentence Comment
103 In vivo findings and, in some cases, in vitro functional characterizations have been reported for [F508C; S1251N],38 [R347H; D979A],39,40 [R74W; D1270N],41 [G628R; S1235R],42,43 [M470V; S1235R],42 [S912L; G1244V],44 [R117H; (TG)mTn],45-47 [R117C; (TG)mTn],46 [S1235R; (TG)mT5],48 [G576A; R668C],10,49 [V562I; A1006E],49 [R352W; P750L],49 [1198_1203del TGGGCT; 1204GϾA],49 [V754M; CFTRdele3_10,14b_16],50 and [F508del; I1027T].51 These complex alleles have been found in patients with either CF or CFTR-RD, although more often in the former.
X
ABCC7 p.Arg347His 20706124:103:118
status: NEW[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]
Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function.
X
ABCC7 p.Arg347His 20932301:74:998
status: NEWX
ABCC7 p.Arg347His 20932301:74:1019
status: NEW[hide] Low abundance of sweat duct Cl- channel CFTR in bo... Am J Physiol Regul Integr Comp Physiol. 2011 Mar;300(3):R605-15. Epub 2011 Jan 12. Brown MB, Haack KK, Pollack BP, Millard-Stafford M, McCarty NA
Low abundance of sweat duct Cl- channel CFTR in both healthy and cystic fibrosis athletes with exceptionally salty sweat during exercise.
Am J Physiol Regul Integr Comp Physiol. 2011 Mar;300(3):R605-15. Epub 2011 Jan 12., [PMID:21228336]
Abstract [show]
To understand potential mechanisms explaining interindividual variability observed in human sweat sodium concentration ([Na(+)]), we investigated the relationship among [Na(+)] of thermoregulatory sweat, plasma membrane expression of Na(+) and Cl(-) transport proteins in biopsied human eccrine sweat ducts, and basal levels of vasopressin (AVP) and aldosterone. Lower ductal luminal membrane expression of the Cl(-) channel cystic fibrosis transmembrane conductance regulator (CFTR) was observed in immunofluorescent staining of sweat glands from healthy young adults identified as exceptionally "salty sweaters" (SS) (n = 6, P < 0.05) and from patients with cystic fibrosis (CF) (n = 6, P < 0.005) compared with ducts from healthy young adults with "typical" sweat [Na(+)] (control, n = 6). Genetic testing of healthy subjects did not reveal any heterozygotes ("carriers") for any of the 39 most common disease-causing CFTR mutations in the United States. SS had higher baseline plasma [AVP] compared with control (P = 0.029). Immunostaining to investigate a potential relationship between higher plasma [AVP] (and sweat [Na(+)]) and ductal membrane aquaporin-5 revealed for all groups a relatively sparse and location-dependent ductal expression of the water channel with localization primarily to the secretory coil. Availability of CFTR for NaCl transport across the ductal membrane appears related to the significant physiological variability observed in sweat salt concentration in apparently healthy humans. At present, a heritable link between healthy salty sweaters and the most prevalent disease-causing CFTR mutations cannot be established.
Comments [show]
None has been submitted yet.
No. Sentence Comment
114 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X.
X
ABCC7 p.Arg347His 21228336:114:133
status: NEW119 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X.
X
ABCC7 p.Arg347His 21228336:119:133
status: NEW[hide] Cystic fibrosis carrier testing in an ethnically d... Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7. Rohlfs EM, Zhou Z, Heim RA, Nagan N, Rosenblum LS, Flynn K, Scholl T, Akmaev VR, Sirko-Osadsa DA, Allitto BA, Sugarman EA
Cystic fibrosis carrier testing in an ethnically diverse US population.
Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7., [PMID:21474639]
Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) and the frequency of specific disease-causing mutations vary among populations. Affected individuals experience a range of serious clinical consequences, notably lung and pancreatic disease, which are only partially dependent on genotype. METHODS: An allele-specific primer-extension reaction, liquid-phase hybridization to a bead array, and subsequent fluorescence detection were used in testing for carriers of 98 CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations among 364 890 referred individuals with no family history of CF. RESULTS: One in 38 individuals carried one of the 98 CFTR mutations included in this panel. Of the 87 different mutations detected, 18 were limited to a single ethnic group. African American, Hispanic, and Asian individuals accounted for 33% of the individuals tested. The mutation frequency distribution of Caucasians was significantly different from that of each of these ethnic groups (P < 1 x 10(1)). CONCLUSIONS: Carrier testing using a broad mutation panel detects differences in the distribution of mutations among ethnic groups in the US.
Comments [show]
None has been submitted yet.
No. Sentence Comment
123 CFTR mutationsa Individuals, n p.F508del/p.R117H 16 5T/9T 1 7T/9T 15 p.F508del/p.D1152H 3 p.R117H/p.R117H, 7T/7T 2 p.D1152H/p.D1152H 2 p.W1282X/p.D1152H 2 p.D1152H/p.G551D 1 c.3717ϩ12191CϾT/p.R352Q 1 c.3717ϩ12191CϾT/c.3717ϩ12191CϾT 1 p.F508del/c.3717ϩ12191CϾT 1 p.F508del/p.L206W 1 p.F508del/p.R117C 1 p.F508del/p.R347H 1 p.F508del/p.R347P 1 p.R117H/p.W1282X, 7T/7T 1 p.R117H/p.G551D, 7T/7T 1 p.R117H/p.G542X, 7T/9T 1 a Human Genome Variation Society nomenclature [Ogino et al. (23)].
X
ABCC7 p.Arg347His 21474639:123:362
status: NEW[hide] Clinical outcomes in infants with cystic fibrosis ... Pediatr Pulmonol. 2011 Apr 29. doi: 10.1002/ppul.21475. Ren CL, Desai H, Platt M, Dixon M
Clinical outcomes in infants with cystic fibrosis transmembrane conductance regulator (CFTR) related metabolic syndrome.
Pediatr Pulmonol. 2011 Apr 29. doi: 10.1002/ppul.21475., 2011-04-29 [PMID:21538969]
Abstract [show]
An unavoidable outcome of cystic fibrosis newborn screening (CF NBS) programs is the detection of infants with an indeterminate diagnosis. The United States CF Foundation recently proposed the term cystic fibrosis transmembrane conductance regulator related metabolic syndrome (CRMS) to describe infants with elevated immunoreactive trypsinogen (IRT) on NBS who do not meet diagnostic criteria for CF. The objective of this study was to describe the clinical outcomes of infants with CRMS identified through an IRT/DNA algorithm. We reviewed the records of all infants with CRMS diagnosed at our CF Center from 2002 to 2010. We identified 12 infants, and compared them to 27 infants diagnosed with CF by NBS. Compared to CF patients, CRMS patients were more likely to be pancreatic sufficient as assessed by fecal elastase measurement (100% vs. 8%, P < 0.01). Their weight for age percentile was normal from birth. A positive oropharyngeal (OP) culture for Pseudomonas aeruginosa (Pa) was found in 25% of CRMS patients. One patient with the F508del/R117H/7T genotype was reassigned the diagnosis of CF after he had a positive OP culture for Pa, and his follow up sweat Cl at 1 year of life was 73 mmol/L. CF patients were more likely to receive oral antibiotics and be hospitalized for pulmonary symptoms. Our results indicate that CRMS patients can develop signs of CF disease, but have a milder clinical course than CF infants. Close initial monitoring of these patients is warranted. Pediatr. Pulmonol. (c) 2011 Wiley-Liss, Inc.
Comments [show]
None has been submitted yet.
No. Sentence Comment
60 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1-CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected.
X
ABCC7 p.Arg347His 21538969:60:510
status: NEW61 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1- CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected.
X
ABCC7 p.Arg347His 21538969:61:511
status: NEW[hide] Pharmacological therapy for cystic fibrosis: from ... J Cyst Fibros. 2011 Jun;10 Suppl 2:S129-45. Becq F, Mall MA, Sheppard DN, Conese M, Zegarra-Moran O
Pharmacological therapy for cystic fibrosis: from bench to bedside.
J Cyst Fibros. 2011 Jun;10 Suppl 2:S129-45., [PMID:21658632]
Abstract [show]
With knowledge of the molecular behaviour of the cystic fibrosis transmembrane conductance regulator (CFTR), its physiological role and dysfunction in cystic fibrosis (CF), therapeutic strategies are now being developed that target the root cause of CF rather than disease symptoms. Here, we review progress towards the development of rational new therapies for CF. We highlight the discovery of small molecules that rescue the cell surface expression and defective channel gating of CF mutants, termed CFTR correctors and CFTR potentiators, respectively. We draw attention to alternative approaches to restore epithelial ion transport to CF epithelia, including inhibitors of the epithelial Na(+) channel (ENaC) and activators of the Ca(2+)-activated Cl(-) channel TMEM16A. The expertise required to translate small molecules identified in the laboratory to drugs for CF patients depends on our ability to coordinate drug development at an international level and our ability to provide pertinent biological information using suitable disease models.
Comments [show]
None has been submitted yet.
No. Sentence Comment
50 An explanation for why mutations at R347 decrease Cl- flow through CFTR was provided by Tabcharani et al. [14], who demonstrated that the CF mutant R347H converts CFTR from a multi-ion pore to a single-ion pore.
X
ABCC7 p.Arg347His 21658632:50:148
status: NEW[hide] Molecular basis of cystic fibrosis in the Republic... Clin Genet. 1998 Sep;54(3):203-9. Petreska L, Koceva S, Plaseska D, Chernick M, Gordova-Muratovska A, Fustic S, Nestorov R, Efremov GD
Molecular basis of cystic fibrosis in the Republic of Macedonia.
Clin Genet. 1998 Sep;54(3):203-9., [PMID:9788722]
Abstract [show]
Eighty-three cystic fibrosis (CF) patients and their families, belonging to various ethnic groups living in the Republic of Macedonia were studied for molecular defects in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, and for the associated extragenic marker loci XV-2c and KM19. The DNA methodology used included characterization of CFTR mutations in 19 exons (and flanking sequences) of the gene and analysis of distribution of the XV-2c/KM19 haplotypes among normal (N) and CF chromosomes by polymerase chain reaction (PCR) amplification followed by dot blot hybridization, restriction digestion, single-strand conformational polymorphism, constant denaturing gel electrophoresis, denaturing gradient gel electrophoresis, and sequencing. We identified 58.4% (97/166) of the CF chromosomes. Nine different CFTR gene mutations, including three novel ones, were found. Eight known and one new CFTR intragene polymorphisms were also characterized. The haplotype analysis of the XV-2c/TaqI and KM19/PstI polymorphic loci have shown that haplotype C is the most frequently found haplotype among the non-deltaF508 CF chromosomes from Macedonia (36.5%). The results demonstrate the broad heterogeneity of CF origin in this part of the Balkan Peninsula.
Comments [show]
None has been submitted yet.
No. Sentence Comment
40 The screening procedures of 17 other known CF mutations included detection of mutations in the PCR products of positive controls and samples by: a) direct analysis on PAGE for A1507 and 1677delTA, simultaneously to AF508; b) hybridization with ASOs for mutation R117H (21), 1717-1GdA (22), G542X (22), N1303K (23), and W1316X (24), and c) restriction digestion `followed by agarose or polyacrylamide gel electrophoresis (exon 3 PCR product digested with HinfI for CUE, exon 4 with HinfI for 444delA, exon 5 with RsaI for 711 + 5G --*A,exon 7 with HhaI for R347H or with RsaI for Q359K/T360, exon 11 with HincII for both G551D and R553X, exon 19 with DdeI for R1162X or with HphI for 3849G+A, a 175 bp PCR fragment of exon 13 with HaeIII for 2556insAT) (4).
X
ABCC7 p.Arg347His 9788722:40:556
status: NEW[hide] Validation of double gradient denaturing gradient ... Clin Chem. 1999 Jan;45(1):35-40. Cremonesi L, Carrera P, Fumagalli A, Lucchiari S, Cardillo E, Ferrari M, Righetti SC, Zunino F, Righetti PG, Gelfi C
Validation of double gradient denaturing gradient gel electrophoresis through multigenic retrospective analysis.
Clin Chem. 1999 Jan;45(1):35-40., [PMID:9895335]
Abstract [show]
Among established techniques for the identification of either known or new mutations, denaturing gradient gel electrophoresis (DGGE) is one of the most effective. However, conventional DGGE is affected by major drawbacks that limit its routine application: the different denaturant gradient ranges and migration times required for different DNA fragments. We developed a modified version of DGGE for high-throughput mutational analysis, double gradient DGGE (DG-DGGE), by superimposing a porous gradient over the denaturant gradient, which maintains the zone-sharpening effect even during lengthy analyses. Because of this innovation, DG-DGGE achieves the double goals of retaining full effectiveness in the detection of mutations while allowing identical run time conditions for all fragments analyzed. Here we use retrospective analysis of a large number of well-characterized mutations and polymorphisms, spanning all predicted melting domains and the whole genomic sequence of three different genes--the cystic fibrosis transmembrane conductance regulator (CFTR), the beta-globin, and the p53 genes--to demonstrate that DG-DGGE may be applied to the rapid scanning of any sequence variation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
31 Mutations and polymorphisms analyzed in the CFTR gene. Position Denaturant gradient Mutation Exon 1 40-90% 125G/Ca,b M1V (A3G at 133) 175insT 182delT Exon 3 10-60% W57G (T3G at 301) 356G/Aa G85E (G3A at 386) Exon 4 20-70% R117H (G3A at 482) 541delC 621ϩ1G3T I148T (T3C at 575) Exon 5 20-70% E193K (G3A at 709) Intron 5 20-70% 711ϩ3A3G Exon 7 20-70% 1078delT R334W (C3T at 1132) T338I (C3T at 1145) R347P (G3C at 1172)b R347H (G3A at 1172) R352Q (G3A at 1187) Exon 10 20-70% M470V (1540A/G)a ⌬F508 (del 3 bp at 1652) Intron 10 10-60% 1717-1G3A Exon 11 10-60% G542X (G3T at 1756) 1784delG R553X (C3T at 1789) Exon 12 10-60% D579G (A3G at 1868) E585X (G3T at 1885) Intron 12 10-60% 1898ϩ3A3G Exon 13 30-80% 2183AA3G E730X (G3T at 2320) L732X (T3G at 2327) 2347delG Exon 14a 10-60% T854T (2694T/G)a V868V (2736G/A)a Intron 14b 30-80% 2789ϩ5G3A Exon 15 20-70% M952I (G3C at 2988)b Exon 17a 20-70% L997F (G3C at 3123)b Exon 17b 20-70% F1052V (T3G at 3286) R1066C (C3T at 3328) R1066H (G3A at 3329) A1067T (G3A at 3331) Exon 18 20-70% D1152H (G3C at 3586)b Exon 19 30-80% R1158X (C3T at 3604) Exon 20 20-70% S1251N (G3A at 3384) W1282X (G3A at 3978) Exon 21 20-70% N1303K (C3G at 4041)b Exon 22 30-80% G1349D (G3A at 4178) 4382delA Exon 24 30-80% Y1424Y (4404C/T)a a Polymorphism.
X
ABCC7 p.Arg347His 9895335:31:431
status: NEW[hide] Structure and function of the CFTR chloride channe... Physiol Rev. 1999 Jan;79(1 Suppl):S23-45. Sheppard DN, Welsh MJ
Structure and function of the CFTR chloride channel.
Physiol Rev. 1999 Jan;79(1 Suppl):S23-45., [PMID:9922375]
Abstract [show]
Structure and Function of the CFTR Chloride Channel. Physiol. Rev. 79, Suppl.: S23-S45, 1999. - The cystic fibrosis transmembrane conductance regulator (CFTR) is a unique member of the ABC transporter family that forms a novel Cl- channel. It is located predominantly in the apical membrane of epithelia where it mediates transepithelial salt and liquid movement. Dysfunction of CFTR causes the genetic disease cystic fibrosis. The CFTR is composed of five domains: two membrane-spanning domains (MSDs), two nucleotide-binding domains (NBDs), and a regulatory (R) domain. Here we review the structure and function of this unique channel, with a focus on how the various domains contribute to channel function. The MSDs form the channel pore, phosphorylation of the R domain determines channel activity, and ATP hydrolysis by the NBDs controls channel gating. Current knowledge of CFTR structure and function may help us understand better its mechanism of action, its role in electrolyte transport, its dysfunction in cystic fibrosis, and its relationship to other ABC transporters.
Comments [show]
None has been submitted yet.
No. Sentence Comment
128 However, because P99C did(128) could control the pore properties of the CF-associated mutant R347H simply by manipulating pH.
X
ABCC7 p.Arg347His 9922375:128:93
status: NEW129 At pH 5.5, not react with MTS reagents (1), P99 probably does not directly line the CFTR pore.when histidine is positively charged, R347H had normal pore properties (128).
X
ABCC7 p.Arg347His 9922375:129:132
status: NEW[hide] CFTR: mechanism of anion conduction. Physiol Rev. 1999 Jan;79(1 Suppl):S47-75. Dawson DC, Smith SS, Mansoura MK
CFTR: mechanism of anion conduction.
Physiol Rev. 1999 Jan;79(1 Suppl):S47-75., [PMID:9922376]
Abstract [show]
CFTR: Mechanism of Anion Conduction. Physiol. Rev. 79, Suppl.: S47-S75, 1999. - The purpose of this review is to collect together the results of recent investigations of anion conductance by the cystic fibrosis transmembrane conductance regulator along with some of the basic background that is a prerequisite for developing some physical picture of the conduction process. The review begins with an introduction to the concepts of permeability and conductance and the Nernst-Planck and rate theory models that are used to interpret these parameters. Some of the physical forces that impinge on anion conductance are considered in the context of permeability selectivity and anion binding to proteins. Probes of the conduction process are considered, particularly permeant anions that bind tightly within the pore and block anion flow. Finally, structure-function studies are reviewed in the context of some predictions for the origin of pore properties.
Comments [show]
None has been submitted yet.
No. Sentence Comment
357 R347D construct, and if a histidine was substituted for R347 (R347H), the blocking effect of SCN (XSCN Å 0.075)The magnitude of the voltage dependence was consistent with the ion experiencing from 30 to 60% of the transmem- was greatly enhanced at pH 5.5, suggesting that the presence of the positive charge is important for the high-affin-brane potential as it accessed the binding site.
X
ABCC7 p.Arg347His 9922376:357:62
status: NEW556 The more dramatic an R347H construct suggested that a positive charge at this locus was important for high-affinity SCN binding.
X
ABCC7 p.Arg347His 9922376:556:21
status: NEW[hide] Control of CFTR channel gating by phosphorylation ... Physiol Rev. 1999 Jan;79(1 Suppl):S77-S107. Gadsby DC, Nairn AC
Control of CFTR channel gating by phosphorylation and nucleotide hydrolysis.
Physiol Rev. 1999 Jan;79(1 Suppl):S77-S107., [PMID:9922377]
Abstract [show]
Control of CTFR Channel Gating by Phosphorylation and Nucleotide Hydrolysis. Physiol. Rev. 79, Suppl.: S77-S107, 1999. - The cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel is the protein product of the gene defective in cystic fibrosis, the most common lethal genetic disease among Caucasians. Unlike any other known ion channel, CFTR belongs to the ATP-binding cassette superfamily of transporters and, like all other family members, CFTR includes two cytoplasmic nucleotide-binding domains (NBDs), both of which bind and hydrolyze ATP. It appears that in a single open-close gating cycle, an individual CFTR channel hydrolyzes one ATP molecule at the NH2-terminal NBD to open the channel, and then binds and hydrolyzes a second ATP molecule at the COOH-terminal NBD to close the channel. This complex coordinated behavior of the two NBDs is orchestrated by multiple protein kinase A-dependent phosphorylation events, at least some of which occur within the third large cytoplasmic domain, called the regulatory domain. Two or more kinds of protein phosphatases selectively dephosphorylate distinct sites. Under appropriately controlled conditions of progressive phosphorylation or dephosphorylation, three functionally different phosphoforms of a single CFTR channel can be distinguished on the basis of channel opening and closing kinetics. Recording single CFTR channel currents affords an unprecedented opportunity to reproducibly examine, and manipulate, individual ATP hydrolysis cycles in a single molecule, in its natural environment, in real time.
Comments [show]
None has been submitted yet.
No. Sentence Comment
47 These biochemical resultsthe charge-neutralizing mutation R347H rendered single-channel conductance switchable between wild-type and provide a satisfying corollary to a substantial body of functional data that has established that opening and closingmutant values simply by changing cytoplasmic pH back and forth between 5.5 and 8.7 (195).
X
ABCC7 p.Arg347His 9922377:47:58
status: NEW[hide] A neutral variant involved in a complex CFTR allel... Hum Genet. 2005 May;116(6):454-60. Epub 2005 Mar 3. Clain J, Lehmann-Che J, Girodon E, Lipecka J, Edelman A, Goossens M, Fanen P
A neutral variant involved in a complex CFTR allele contributes to a severe cystic fibrosis phenotype.
Hum Genet. 2005 May;116(6):454-60. Epub 2005 Mar 3., [PMID:15744523]
Abstract [show]
In order to further elucidate the contribution of complex alleles to the wide phenotypic variability of cystic fibrosis (CF), we investigated the structure-function relationships of a severe CF-associated complex allele [p.S912L;p.G1244V]. To evaluate the contribution of each mutation to the phenotype, cystic fibrosis transmembrane conductance regulator (CFTR) mutants were expressed in HeLa cells and analysed for protein processing and Cl- channel activity. Both p.G1244V and [p.S912L;p.G1244V] mutants had normal protein processing but markedly decreased Cl- channel activity compared with wild-type. Notably, the double mutant displayed a dramatic decrease in Cl- channel activity compared with p.G1244V (P<0.001). p.S912L had normal protein processing and no detectable impact on CFTR function. In other respects, the p.S912L variation was identified in compound heterozygosity with p.R709X in a healthy fertile man. Together, these data strongly support the view that p.S912L in isolation should be considered as a neutral variant but one that might significantly impair CFTR function when inherited in cis with another CFTR mutation. Our data also further document the contribution of complex alleles to the wide phenotypic variability of CF. The results of functional studies of such complex alleles in other genetic diseases are discussed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
12 The combination of two missense mutations on the same chromo some has been described clinically to lessen ([p.R553Q;p.F508del], [p.R334W;p.R1158X]; Dork et al. 1991; Duarte et al. 1996) or worsen ([p.R74W;p.D1270N], [p.R347H;p.D979A]; Casals et al. 1995; Hojo et al. 1998) the phenotype of CF patients with regard to the commonest mutation alone (p.F508del, p.R1158X, p.D1270N, p.R347H).
X
ABCC7 p.Arg347His 15744523:12:219
status: NEWX
ABCC7 p.Arg347His 15744523:12:380
status: NEW[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]
Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4.
X
ABCC7 p.Arg347His 17331079:52:128
status: NEW[hide] Genetic, epidemiological, and clinical aspects of ... Am J Gastroenterol. 2010 Aug;105(8):1876-83. Epub 2010 May 25. Joergensen MT, Brusgaard K, Cruger DG, Gerdes AM, Schaffalitzky de Muckadell OB
Genetic, epidemiological, and clinical aspects of hereditary pancreatitis: a population-based cohort study in Denmark.
Am J Gastroenterol. 2010 Aug;105(8):1876-83. Epub 2010 May 25., [PMID:20502448]
Abstract [show]
OBJECTIVES: In a population-based, well-defined group of patients first regarded as having pancreatitis of unknown origin (PUO), we identified, described, and compared the clinical and genetic aspects of patients with hereditary pancreatitis (HP) and with cystic fibrosis transmembrane conductance regulator gene (CFTR) and serine protease inhibitor Kazal type 1 gene (SPINK1) mutations with patients who retained the diagnosis of true idiopathic pancreatitis (tIP) after genetic testing for HP, SPINK1, and CFTR mutations. METHODS: Patients with PUO were identified in the Danish National Registry of Patients or were referred by clinicians. DNA from blood was analyzed for cationic trypsinogen (PRSS1), SPINK1, and CFTR mutations. Considering the diagnosis of HP, a pedigree was drawn for each patient. RESULTS: A genetic mutation was found in 40% of 122 patients with PUO. After testing first-degree relatives of the 18 initially identified HP patients, 38 HP patients in total were identified, and 28 patients had SPINK1-CFTR mutations. Among HP patients, no p.N29I mutations were found and the p.A16V mutation was more frequent than previously reported, 45 and 32% had exocrine and endocrine insufficiency, respectively, and among tIP patients 9 and 12%, respectively. Pancreatic cancer was diagnosed in 5% of the HP families. CONCLUSIONS: The genotype of the Danish population with HP differs from that of previously described cohorts. The occurrence of exocrine and endocrine insufficiency is higher among patients with HP than in patients with SPINK1-CFTR mutations and tIP, and more HP families develop pancreatic cancer. Genetic testing thus helps to predict the prognosis of the pancreatitis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
57 The samples were also tested for 33 CFTR mutations, and all 6 classeswererepresented:394delTT,p.R553X,621+1G>T,p.R1162X, 1717-1G>A,3659delC,p.G542X,2183AA>G,p.W1282X,1078delT, 711+1G>T, F508del, p.S549N, I507del, p.S549R, 2184delA, p.G551D, p.G85E, p.N1303K, p.R560T, p.R117H, p.R347H, p.R347P, p.R334W, 2789+5G>A, 3849+10kbC>T, p.A445E, 3120+1G>A, p.V520F,1898+1G>A,3876delA,3905insT,andIVS8-5T.DNAwas amplified by multiplex PCR (Hybaid 4 A62, Middlesex, UK).
X
ABCC7 p.Arg347His 20502448:57:279
status: NEW[hide] Cystic fibrosis in Chilean patients: Analysis of 3... J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30. Lay-Son G, Puga A, Astudillo P, Repetto GM
Cystic fibrosis in Chilean patients: Analysis of 36 common CFTR gene mutations.
J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30., [PMID:21036675]
Abstract [show]
BACKGROUND: CFTR gene mutations have worldwide differences in prevalence and data on Chilean patients is scarce. METHODS: We studied 36 of the most common CFTR mutations in Chilean patients from the CF National Program [Programa Nacional de Fibrosis Quistica (PNFQ)] of the Ministry of Health of Chile. RESULTS: Two hundred and eighty-nine patients were studied. Fourteen different mutations were identified with an overall allele detection rate of 42.0%. Mutations with frequencies greater than 1% were p.F508del (30.3% of alleles), p.R334W (3.3%), p.G542X (2.4%), c.3849+10Kb C>T (1.7%), and p.R553X (1.2%). A north to south geographical gradient was observed in the overall rate of detection. CONCLUSIONS: Southern European CFTR mutations predominate in the Chilean population, but a high percentage of alleles remain unknown. Geographical heterogeneity could be explained in part by admixture. Complementary analyses are necessary to allow for effective genetic counselling and improve cost-effectiveness of screening and diagnostic tests.
Comments [show]
None has been submitted yet.
No. Sentence Comment
81 Mutation This study Rios et al. [4] Molina et al. [5] Repetto et al. [6] Perez et al. [13] CFGAC [2] (n=578) (%) (n=72) (%) (n=36) (%) (n=100) (%) (n=4102) (%) (n=43,849) (%) Chile Chile Chile Chile Latin-Americaa Worldwide Unknown 58.0 66.6 61.1 34.0 36.7 22.7 p.F508del 30.6 29.2 30.6 45.0 47.1 66.0 p.R334W 3.1 - - 2.0 0.8 0.1 p.G542X 2.4 0 8.3 7.0 5.0 2.4 c.3849+10Kb CNT 1.7 - - 3.0 0.3 0.2 p.R553X 1.2 4.2 0 1.0 0.4 0.7 p.R1162X 0.9 - - 2.0 1.0 0.3 p.1078delT 0.5 - - 0 b0.1 0.1 p.G85E 0.5 - - - 0.8 0.2 p.W1282X 0.2 - - 5.0 1.0 1.2 c.3120+1 GNA 0.2 - - - 0.3 - c.711+1 GNT 0.2 - - - 0.1 0.1 p.R117H 0.2 - - 0 b0.1 0.3 p.A455E 0.2 - - 0 0 0.1 p.I148T 0.2 - - - - - p.G551D 0 0 0 1.0 0.1 1.6 p.N1303K 0 0 0 0 1.8 1.3 c.621+1 GNT 0 - - 0 0.2 0.7 c.1717-1 GNA 0 - - 0 0.3 0.6 p.I507del 0 - - 0 0.2 0.2 p.R347P 0 - - 0 0 0.2 c.2789+5 GNA 0 - - - 0.2 0.1 c.1898+1 GNA 0 - - - 0.1 0.1 c.2184delA 0 - - - b0.1 0.1 p.S549N 0 - 0 - 0.1 0.1 c.3659delC 0 - - 0 0.1 0.1 p.R560T 0 - - - 0 0.1 c.1811+1.6Kb ANG 0 - - - 0.4 - c.2183AANG 0 - - 0 0.1 - p.S549R 0 - - - 0.1 - c.3272-26 ANG 0 - - - 0.1 - c.3199del6 0 - - - b0.1 - p.E60X 0 - - 0 0 - c.3905insT 0 - - - 0 - p.S1251N 0 - - 0 - - CFTRdele2,3 0 - - - - - p.R347H 0 - - - - - p.V520F 0 - - - - - p.Q552X 0 - - - - - c.394delTT 0 - - - - - c.711+1 GNA 0 - - - - - c.2143delT 0 - - - - - c.3876delA 0 - - - - - a Data from Chilean patients published in Rios et al., Molina et al., and Repetto et al. [4-6] included in this publication were excluded in this table to avoid repetition.
X
ABCC7 p.Arg347His 21036675:81:1207
status: NEW[hide] Mutations to amino acids located in predicted tran... Biochemistry. 1994 Nov 29;33(47):14049-57. Loo TW, Clarke DM
Mutations to amino acids located in predicted transmembrane segment 6 (TM6) modulate the activity and substrate specificity of human P-glycoprotein.
Biochemistry. 1994 Nov 29;33(47):14049-57., [PMID:7947814]
Abstract [show]
Site-directed mutagenesis was used to investigate whether amino acids located in the predicted transmembrane segment, TM6 (residues 330-351), of human P-glycoprotein play essential roles in drug transport. Mutant cDNAs were expressed in mouse NIH 3T3 cells and analyzed with respect to their ability to confer resistance to cytotoxic drugs. Four mutations were found to strongly alter the drug resistance profile conferred by P-glycoprotein. Mutation of Val338 to Ala resulted in a mutant P-glycoprotein which conferred enhanced resistance to colchicine and reduced relative resistance to vinblastine. By contrast, mutant Gly341 to Val conferred little resistance to colchicine or doxorubicin, while its ability to confer resistance to vinblastine or actinomycin D was retained. A reduction in the ability of P-glycoprotein to confer resistance to all four drugs was observed for mutant Ala342 to Leu. Mutation of Ser344 to Ala, Thr, Cys, or Tyr resulted in mutant P-glycoproteins which were unable to confer drug resistance. Photolabeling of P-glycoprotein with azidopine in the presence of varying amounts of vinblastine showed that mutation of Ser344 to Tyr required approximately 15-fold more vinblastine to inhibit photolabeling when compared to wild-type enzyme. All of the Ser344 mutants were found to have reduced drug-stimulated ATPase activity relative to wild-type enzyme. These results, together with our previous demonstration that changes to Phe335 affected dissociation of vinblastine, suggest that TM6 may play an important role in drug--protein interaction and coupling of drug binding to ATPase activity.
Comments [show]
None has been submitted yet.
No. Sentence Comment
280 Mutation of Arg347 to His resulted in the ability of CFTR to eliminate the multiple ion occupancy effects when the pH of the intracellular solution is changed (Tabcharani et al., 1993).
X
ABCC7 p.Arg347His 7947814:280:12
status: NEW[hide] CFTR mutation combinations producing frequent comp... Hum Mutat. 2012 Nov;33(11):1557-65. doi: 10.1002/humu.22129. Epub 2012 Jul 2. El-Seedy A, Girodon E, Norez C, Pajaud J, Pasquet MC, de Becdelievre A, Bienvenu T, des Georges M, Cabet F, Lalau G, Bieth E, Blayau M, Becq F, Kitzis A, Fanen P, Ladeveze V
CFTR mutation combinations producing frequent complex alleles with different clinical and functional outcomes.
Hum Mutat. 2012 Nov;33(11):1557-65. doi: 10.1002/humu.22129. Epub 2012 Jul 2., [PMID:22678879]
Abstract [show]
Genotype-phenotype correlations in cystic fibrosis (CF) may be difficult to establish because of phenotype variability, which is associated with certain CF transmembrane conductance regulator (CFTR) gene mutations and the existence of complex alleles. To elucidate the clinical significance of complex alleles involving p.Gly149Arg, p.Asp443Tyr, p.Gly576Ala, and p.Arg668Cys, we performed a collaborative genotype-phenotype correlation study, collected epidemiological data, and investigated structure-function relationships for single and natural complex mutants, p.[Gly576Ala;Arg668Cys], p.[Gly149Arg;Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala;Arg668Cys]. Among 153 patients carrying at least one of these mutations, only three had classical CF and all carried p.Gly149Arg in the triple mutant. Sixty-four had isolated infertility and seven were healthy individuals with a severe mutation in trans, but none had p.Gly149Arg. Functional studies performed on all single and natural complex mutants showed that (1) p.Gly149Arg results in a severe misprocessing defect; (2) p.Asp443Tyr moderately alters CFTR maturation; and (3) p.Gly576Ala, a known splicing mutant, and p.Arg668Cys mildly alter CFTR chloride conductance. Overall, the results consistently show the contribution of p.Gly149Arg to the CF phenotype, and suggest that p.[Arg668Cys], p.[Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala;Arg668Cys] are associated with CFTR-related disorders. The present study emphasizes the importance of comprehensive genotype-phenotype and functional studies in elucidating the impact of mutations on clinical phenotype. Hum Mutat 33:1557-1565, 2012. (c) 2012 Wiley Periodicals, Inc.
Comments [show]
None has been submitted yet.
No. Sentence Comment
105 [2002C>T;3718-2477C>T] p.Gln689X 2 CSD Nasal polyposis 14 y,16 y NA, 29 p.[Gly576Ala;Arg668Cys] NI 3 IP 35-39 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 IP Bronchitis 49 y NA p.[Gly576Ala;Arg668Cys] p.PheF508del 1 IP 42 y NA p.[Gly576Ala;Arg668Cys] p.Arg668Cys 1 IP NA NA p.[Gly576Ala;Arg668Cys] c.1210_34TG[12]T[5] 4 IP 19-69 y NA p.[Gly576Ala;Arg668Cys] NI 1 Cholestasis 60 y NA p.[Gly576Ala;Arg668Cys] c.1584G>A 33 CBAVD 27-50 y 9-82 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 2 CBAVD 30 y,36 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.2051_2052delAAinsG 1 CBAVD 34 y 72 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Trp1282X 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 CBAVD 35 y 65-66 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Ser549Asn 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.3605delA 1 CBAVD 30 y 41-69 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gln1411X 1 CBAVD 31 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg347His 3 CBAVD 29 y, 34 y, NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gly542X 1 CBAVD 35 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.946delT 1 CBAVD 26 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.4242_4242+1delGGinsT 1 CBAVD 41 y 31 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg117His 1 CBAVD 32 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr338Ile 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Glu379Lys 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Met1137Val 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr1246Ile 2 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 CBAVD 34 NA p.[Gly576Ala;Arg668Cys] p.Asn1303Lys 8 CBAVD 30-42 y NA p.[Gly576Ala;Arg668Cys] NI 1 CBAVD 27 y NA p.Arg668Cys p.Phe508del 1 CBAVD 30 y NA p.Arg668Cys NI 1 CUAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 1 CUAVD NA NA p.[Gly576Ala;Arg668Cys] NI 1 CUAVD Renal agenesis NA NA p.[Gly576Ala;Arg668Cys] NI 1 Hypofertility (not CBAVD) CF carrier`s partner NA NA p.[Gly576Ala;Arg668Cys] p.Asp1152His 1 FBA Mild CF considered possible, 2 older brothers with the same genotype, one with a very mild phenotype, the other being asymptomatic 22 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 FBA TOP for de novo chromosomal translocation; not CF 21 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg31Cys 1 FBA Not CF at birth 28 wg <30 p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Unknown outcome 23 wg NA p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Not CF at birth 21 wg <30 p.[Gly576Ala;Arg668Cys] p.Trp846X (Continued) Table 1.
X
ABCC7 p.Arg347His 22678879:105:922
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]
Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray.
X
ABCC7 p.Arg347His 22658665:855:1304
status: NEW[hide] Newborn screening for cystic fibrosis: Polish 4 ye... Eur J Hum Genet. 2012 Aug 15. doi: 10.1038/ejhg.2012.180. Sobczynska-Tomaszewska A, Oltarzewski M, Czerska K, Wertheim-Tysarowska K, Sands D, Walkowiak J, Bal J, Mazurczak T
Newborn screening for cystic fibrosis: Polish 4 years' experience with CFTR sequencing strategy.
Eur J Hum Genet. 2012 Aug 15. doi: 10.1038/ejhg.2012.180., [PMID:22892530]
Abstract [show]
Newborn screening for cystic fibrosis (NBS CF) in Poland was started in September 2006. Summary from 4 years' experience is presented in this study. The immunoreactive trypsin/DNA sequencing strategy was implemented. The group of 1 212 487 newborns were screened for cystic fibrosis during the programme. We identified a total of 221 CF cases during this period, including, 4 CF cases were reported to be omitted by NBS CF. Disease incidence in Poland based on the programme results was estimated as 1/4394 and carrier frequency as 1/33. The frequency of the F508del was similar (62%) to population data previously reported. This strategy allowed us to identify 29 affected infants with rare genotypes. The frequency of some mutations (eg, 2184insA, K710X) was assessed in Poland for the first time. Thus, sequencing assay seems to be accurate method for screening programme using blood spots in the Polish population.European Journal of Human Genetics advance online publication, 15 August 2012; doi:10.1038/ejhg.2012.180.
Comments [show]
None has been submitted yet.
No. Sentence Comment
57 Mutations D537N and P731L have not been Period of NBS CF Method The most frequent mutations in Polish population under analysis September 2006 - December 2007 Estonia Asper Biotech assay E60X, G85E, 394delTT, R117H, R117P, R117L, I148T, 621G>A, 711+1G>T, 711+5G>A, 1078delT, R334W, R347H, R347P, R347L, IVS8-T, A455E, I507del, F508del, 1717-1G>A, G542X, p.G551D, Q552X, R553X, R553G, R560T, R560K, 1898+1G>A, 1898+1G>T, 1898+1G>C, 2143delT, 2184delA, 2183AA>G, 2789+5G>A, 3120+1G>A, 3199del6, 3272-26A>G, R1162X, 3659delC, 3849+10kbC>T, 3905insT, S1235R, S1251N, W1282X, W1282C, N1303K, CFTRdele2,3 January 2007 - June 2009 Sanger sequencing of exons: 4, 7, 10, 11, 13, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R117H+IVS8-T*, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K July 2009 - currently Sanger sequencing of exons: 7, 10, 11, 13, 17b, 20, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K, 3272-26A>G**, W1282X** * removed from DNA analysis since July 2009 , **added into DNA analysis since July 2009 Figure 1 NBS CF in Poland.
X
ABCC7 p.Arg347His 22892530:57:282
status: NEW[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]
Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.
Comments [show]
None has been submitted yet.
No. Sentence Comment
81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations.
X
ABCC7 p.Arg347His 22581207:81:2803
status: NEWX
ABCC7 p.Arg347His 22581207:81:2814
status: NEW[hide] Mutations in the cystic fibrosis transmembrane con... J Cyst Fibros. 2012 Jul;11(4):316-23. doi: 10.1016/j.jcf.2012.01.005. Epub 2012 Apr 6. Li H, Wen Q, Li H, Zhao L, Zhang X, Wang J, Cheng L, Yang J, Chen S, Ma X, Wang B
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) in Chinese patients with congenital bilateral absence of vas deferens.
J Cyst Fibros. 2012 Jul;11(4):316-23. doi: 10.1016/j.jcf.2012.01.005. Epub 2012 Apr 6., [PMID:22483971]
Abstract [show]
BACKGROUND: Genetic testing of the cystic fibrosis transmembrane conductance (CFTR) gene is currently performed in patients with congenital bilateral absence of vas deferens (CBAVD). This study was conducted to investigate the role of mutations in the CFTR gene in CBAVD-dependent male infertility. METHODS: 73 Chinese patients diagnosed with CBAVD were studied. The entire coding regions and splice sites of 27 exons of the CFTR gene were sequenced in 146 chromosomes from the 73 CBAVD patients. Screening was carried out using PCR, gel electrophoresis and DNA sequencing to identify novel variants of the entire coding regions and boundaries of the 27 exons. RESULTS: Five novel nonsynonymous mutations, three novel splice site mutations and one deletion were identified by sequencing. Apart from the novel variants, we also found 19 previously reported mutations and polymorphism sites. Thirty-four patients (46.57%) had the 5T variant (6 homozygous and 28 heterozygous) and in two of them it was not associated with any detectable mutation of the CFTR gene. All potential pathogenic mutations are not contained in the 1000 Genome Project database. In total, the present study identified 30 potential pathogenic variations in the CFTR gene, 9 of which had not previously been described. CONCLUSIONS: Most patients with CBAVD have mutations in the CFTR gene. A mild genotype with one or two mild or variable mutations was observed in all the patients. These findings improve our understanding of the distribution of CFTR alleles in CBAVD patients and will facilitate the development of more sensitive CFTR mutation screening.
Comments [show]
None has been submitted yet.
No. Sentence Comment
77 Lastly, we have observed previously reported mutations and polymorphisms (p.E217G, p.R347H, p.V470M, p.R553X, p.I556V, p.T854T, p.G970D, p.P1290P, p.Q1352H, p.Q1643Q, 744-5delGATT, IVS8-T5) (Supplementary Table 1).
X
ABCC7 p.Arg347His 22483971:77:85
status: NEW119 △F508 R117H Mutation genotypes IVS8-Tn n (%) Two mutations detected Neg Neg I556V/I556V 7T/7T 1(1.3) Neg Neg I556V/1209+2 G-C 5T/7T 1(1.3) Neg Neg I556V/726delATT 5T/5T 1(1.3) Neg Neg I556V/- 5T/5T 1(1.3) Neg Neg I556V/- 5T/7T 1(1.3) Neg Neg G970D/- 5T/7T 1(1.3) Neg Neg C592F/- 5T/5T 1(1.3) Neg Neg 1209+1 G-C/- 5T/7T 1(1.3) Neg Neg R553X/- 5T/7T 1(1.3) Neg Neg Q1352H/- 5T/7T 1(1.3) Neg Neg S485C/- 5T/7T 1(1.3) Neg Neg A357T/- 5T/7T 1(1.3) Neg Neg E217G/- 5T/7T 1(1.3) Neg Neg R347H/- 5T/7T 1(1.3) Neg Neg G451K/- 5T/7T 1(1.3) Neg Neg L558S/- 5T/7T 1(1.3) Neg Neg 3635delT/Q1352H 7T/7T 1(1.3) Neg Neg A1136T/G970D 7T/7T 1(1.3) Neg Neg 870-1 G-C/- 5T/7T 1(1.3) Neg Neg 520-2 A-G/- 5T/7T 1(1.3) Neg Neg R419I/- 5T/7T 1(1.3) Neg Neg C491F/Q1643Q 7T/7T 1(1.3) Neg Neg Q1352H/- 5T/7T 1(1.3) Neg Neg R851X/- 5T/7T 1(1.3) Neg Neg P750L/G970D 7T/7T 1(1.3) One mutation detected Neg Neg -/- 5T/7T 2(2.7) Neg Neg -/- 5T/7T 3(4.1) Neg Neg -/- 5T/7T 5(6.8) Neg Neg -/- 5T/5T 2(2.7) Neg Neg -/- 5T/5T 1(1.3) Neg Neg G970D/- 7T/7T 2(2.7) Neg Neg D993Y/- 7T/7T 1(1.3) Neg Neg I556V/- 7T/7T 1(1.3) Neg Neg T388R/- 7T/7T 1(1.3) No mutation detected Neg Neg -/- 7T/7T 8(10.9) Neg Neg -/- 7T/7T 15(20.5) Neg Neg -/- 7T/9T 2(2.7) Neg Neg -/- 7T/7T 4(5.5) Neg: Negative.
X
ABCC7 p.Arg347His 22483971:119:487
status: NEW76 Lastly, we have observed previously reported mutations and polymorphisms (p.E217G, p.R347H, p.V470M, p.R553X, p.I556V, p.T854T, p.G970D, p.P1290P, p.Q1352H, p.Q1643Q, 744-5delGATT, IVS8-T5) (Supplementary Table 1).
X
ABCC7 p.Arg347His 22483971:76:85
status: NEW118 b3;F508 R117H Mutation genotypes IVS8-Tn n (%) Two mutations detected Neg Neg I556V/I556V 7T/7T 1(1.3) Neg Neg I556V/1209+2 G-C 5T/7T 1(1.3) Neg Neg I556V/726delATT 5T/5T 1(1.3) Neg Neg I556V/- 5T/5T 1(1.3) Neg Neg I556V/- 5T/7T 1(1.3) Neg Neg G970D/- 5T/7T 1(1.3) Neg Neg C592F/- 5T/5T 1(1.3) Neg Neg 1209+1 G-C/- 5T/7T 1(1.3) Neg Neg R553X/- 5T/7T 1(1.3) Neg Neg Q1352H/- 5T/7T 1(1.3) Neg Neg S485C/- 5T/7T 1(1.3) Neg Neg A357T/- 5T/7T 1(1.3) Neg Neg E217G/- 5T/7T 1(1.3) Neg Neg R347H/- 5T/7T 1(1.3) Neg Neg G451K/- 5T/7T 1(1.3) Neg Neg L558S/- 5T/7T 1(1.3) Neg Neg 3635delT/Q1352H 7T/7T 1(1.3) Neg Neg A1136T/G970D 7T/7T 1(1.3) Neg Neg 870-1 G-C/- 5T/7T 1(1.3) Neg Neg 520-2 A-G/- 5T/7T 1(1.3) Neg Neg R419I/- 5T/7T 1(1.3) Neg Neg C491F/Q1643Q 7T/7T 1(1.3) Neg Neg Q1352H/- 5T/7T 1(1.3) Neg Neg R851X/- 5T/7T 1(1.3) Neg Neg P750L/G970D 7T/7T 1(1.3) One mutation detected Neg Neg -/- 5T/7T 2(2.7) Neg Neg -/- 5T/7T 3(4.1) Neg Neg -/- 5T/7T 5(6.8) Neg Neg -/- 5T/5T 2(2.7) Neg Neg -/- 5T/5T 1(1.3) Neg Neg G970D/- 7T/7T 2(2.7) Neg Neg D993Y/- 7T/7T 1(1.3) Neg Neg I556V/- 7T/7T 1(1.3) Neg Neg T388R/- 7T/7T 1(1.3) No mutation detected Neg Neg -/- 7T/7T 8(10.9) Neg Neg -/- 7T/7T 15(20.5) Neg Neg -/- 7T/9T 2(2.7) Neg Neg -/- 7T/7T 4(5.5) Neg: Negative.
X
ABCC7 p.Arg347His 22483971:118:486
status: NEW[hide] Link between CFTR mutations and ABPA: a systematic... Mycoses. 2012 Jul;55(4):357-65. doi: 10.1111/j.1439-0507.2011.02130.x. Epub 2011 Oct 17. Agarwal R, Khan A, Aggarwal AN, Gupta D
Link between CFTR mutations and ABPA: a systematic review and meta-analysis.
Mycoses. 2012 Jul;55(4):357-65. doi: 10.1111/j.1439-0507.2011.02130.x. Epub 2011 Oct 17., [PMID:21999194]
Abstract [show]
Summary There is a biological plausibility on the link between cystic fibrosis transmembrane conductance regulator (CFTR) mutations and allergic bronchopulmonary aspergillosis (ABPA). The aim of the systematic review was to investigate this link by determining the frequency of CFTR mutations in ABPA. We searched the PubMed and EmBase databases for studies reporting CFTR mutations in ABPA. We pooled the odds ratio (OR) and 95% confidence intervals (CI) from individual studies using both fixed and random effects model. Statistical heterogeneity was evaluated using the I(2) test and the Cochran-Q statistic. Publication bias was assessed using both graphical and statistical methods. Our search yielded four studies (79 ABPA, 268 controls). The odds of encountering CFTR mutation was higher in ABPA compared with the control group (OR 10.39; 95% CI, 4.35-24.79) or the asthma population (OR 5.53; 95% CI 1.62-18.82). There was no evidence of statistical heterogeneity or publication bias. There is a possible pathogenetic link between CFTR mutations and ABPA. However, because of the small numbers of patients, further studies are required to confirm this finding. Future studies should adopt a uniform methodology and should screen for the entire genetic sequence of the CFTR gene.
Comments [show]
None has been submitted yet.
No. Sentence Comment
56 (1996)[30] 11ABPA53chronic bronchitis Asthma,pulmonaryinfiltrates,CB, immediateAfskintestpositivity,totalIgE >1000ngml)1 ,positiveAfprecipitins, elevatedAfIgG/IgE,bloodeosinophilia, sweatchloride<40mmoll)1 /(United States) BothgroupssixmutationsF508del, G542X,GS51D,R553X,W1282X andN1303K;ninemoremutations inABPA:R117H,R347P,R347H, R334W,A455E,G551S, 2789+5G>A,D1152H,and 3849+10kbC>T ReverseASOanalysis andDGGEwithDNA sequencing 1patientcarried2CF (F508del;R347H)and5 carried1CF(4F508del; 1R117H).Mutationsseenin 6/11ABPAvs.1/53 controls Aronetal.
X
ABCC7 p.Arg347His 21999194:56:326
status: NEW59 (2002)[33] 31ABPAHealthycontrols (n=34) Asthma(n=51) Asthma,positiveSPTtoAf,totalIgE >1000ngml)1 ,elevatedAf-IgE,positive precipitinstoAf,bloodeosinophilia >350ll)1 ,pulmonaryinfiltratesonCXR orCBonCT/(NewZealand) 16CFmutations-F508del,I507del, R117H,W1282X,621+1G>T, R334W,R347P,A455E, 1717-1G>A,G542X,5549N, G551D,R553X,R560T,N1303Kand 3849+10kbC>T ASOhybridisationand DGGEwithDNA sequencing 4/31(F508del[n=3], R117H[n=1])vs.2/51 asthma(F508del[n=1], R117H[n=1])vs.1/34 healthycontrols ABPA,allergicbronchopulmonaryaspergillosis;ARMS,amplificationrefractorymutationsystem;ASO,allele-specificoligonucleotide;CB,centralbronchiectasis;CFTR,cysticfibrosis transmembraneconductanceregulator;DGGE,denaturinggradientgelelectrophoresis;OR,oddsratio CFTRmutationclass(classI--1717-1G>A,R1162X,G542X;classII--F508del,N1303K;classIV--R347H,R117H).
X
ABCC7 p.Arg347His 21999194:59:825
status: NEW[hide] Ivacaftor potentiation of multiple CFTR channels w... J Cyst Fibros. 2012 May;11(3):237-45. doi: 10.1016/j.jcf.2011.12.005. Epub 2012 Jan 30. Yu H, Burton B, Huang CJ, Worley J, Cao D, Johnson JP Jr, Urrutia A, Joubran J, Seepersaud S, Sussky K, Hoffman BJ, Van Goor F
Ivacaftor potentiation of multiple CFTR channels with gating mutations.
J Cyst Fibros. 2012 May;11(3):237-45. doi: 10.1016/j.jcf.2011.12.005. Epub 2012 Jan 30., [PMID:22293084]
Abstract [show]
BACKGROUND: The investigational CFTR potentiator ivacaftor (VX-770) increased CFTR channel activity and improved lung function in subjects with CF who have the G551D CFTR gating mutation. The aim of this in vitro study was to determine whether ivacaftor potentiates mutant CFTR with gating defects caused by other CFTR gating mutations. METHODS: The effects of ivacaftor on CFTR channel open probability and chloride transport were tested in electrophysiological studies using Fischer rat thyroid (FRT) cells expressing different CFTR gating mutations. RESULTS: Ivacaftor potentiated multiple mutant CFTR forms with defects in CFTR channel gating. These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations. CONCLUSION: These in vitro data suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support investigation of the potential clinical benefit of ivacaftor in CF patients who have CFTR gating mutations beyond G551D.
Comments [show]
None has been submitted yet.
No. Sentence Comment
139 Other CFTR gene mutations associated with residual CFTR function include A445E, R347H, D1152H, and certain splice mutations (3849 +10kbC→T) [4,29-30].
X
ABCC7 p.Arg347His 22293084:139:80
status: NEW140 Other CFTR gene mutations associated with residual CFTR function include A445E, R347H, D1152H, and certain splice mutations (3849 +10kbCT) [4,29-30].
X
ABCC7 p.Arg347His 22293084:140:80
status: NEW[hide] CFTR, SPINK1, CTRC and PRSS1 variants in chronic p... Gut. 2012 Mar 17. Rosendahl J, Landt O, Bernadova J, Kovacs P, Teich N, Bodeker H, Keim V, Ruffert C, Mossner J, Kage A, Stumvoll M, Groneberg D, Kruger R, Luck W, Treiber M, Becker M, Witt H
CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated?
Gut. 2012 Mar 17., [PMID:22427236]
Abstract [show]
OBJECTIVE: In chronic pancreatitis (CP), alterations in several genes have so far been described, but only small cohorts have been extensively investigated for all predisposing genes. DESIGN: 660 patients with idiopathic or hereditary CP and up to 1758 controls were enrolled. PRSS1, SPINK1 and CTRC were analysed by DNA sequencing, and cystic fibrosis transmembrane conductance regulator (CFTR) by melting curve analysis. RESULTS: Frequencies of CFTR variants p.R75Q, p.I148T, 5T-allele and p.E528E were comparable in patients and controls. We identified 103 CFTR variants, which represents a 2.7-fold risk increase (p<0.0001). Severe cystic fibrosis (CF)-causing variants increased the risk of developing CP 2.9-fold, and mild CF-causing variants 4.5-fold (p<0.0001 for both). Combined CF-causing variants increased CP risk 3.4-fold (p<0.0001), while non-CF-causing variants displayed a 1.5-fold over-representation in patients (p=0.14). CFTR compound heterozygous status with variant classes CF-causing severe and mild represented an OR of 16.1 (p<0.0001). Notably, only 9/660 (1.4%) patients were compound heterozygotes in this category. Trans-heterozygosity increased CP risk, with an OR of 38.7, with 43/660 (6.5%) patients and 3/1667 (0.2%) controls being trans-heterozygous (p<0.0001). CONCLUSIONS: Accumulation of CFTR variants in CP is less pronounced than reported previously, with ORs between 2.7 and 4.5. Only CF-causing variants reached statistical significance. Compound and trans-heterozygosity is an overt risk factor for the development of CP, but the number of CFTR compound heterozygotes in particular is rather low. In summary, the study demonstrates the complexity of genetic interactions in CP and a minor influence of CFTR alterations in CP development.
Comments [show]
None has been submitted yet.
No. Sentence Comment
140 Variant distribution in patients aged >20 and <20 years In younger patients, overall PRSS1 variants were 2.9-fold more common (>20 years: 9/239, 3.8%; <20 years: 46/421, 10.9%; p¼0.001, OR 3.1, 95% CI 1.5 to 6.5), whereas overall SPINK1 variants were similarly distributed (56/239, 23.4%; 73/421, Table 2 CFTR variants detected by melting curve analysis Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing, severe) p.F508del 44/660 (6.7%) 48/1758 (2.7%) <0.0001 2.5 (1.7 to 3.9) p.R117H (5T/7T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.G542X 1/660 (0.2%) 1/1758 (0.06%) NS e c.1717-1G>A 3/660 (0.5%) 1/1758 (0.06%) NS e p.E585X 0/660 1/1758 (0.06%) NS e c.2183AA>G 0/660 1/1758 (0.06%) NS e p.R1158X 1/660 (0.2%) 0/1758 NS e p.R1162X 1/660 (0.3%) 0/1758 NS e p.N1303K 3/660 (0.5%) 0/1758 NS e Total 55/660 (8.3%) 53/1758 (3%) <0.0001 2.9 (2 to 4.3) CFTR (CF-causing mild) p.R117H (7T/7T) 13/660 (2%) 8/1758 (0.5%) 0.0009 4.4 (1.8 to 10.7) p.R117H (7T/9T) 3/660 (0.5%) 1/1758 (0.06%) NS e p.R347H 1/660 (0.2%) 0/1758 NS e p.R347P 1/660 (0.2%) 0/1758 NS e p.A455E 1/660 (0.2%) 0/1758 NS e c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.D1152H 3/660 (0.5%) 5/1758 (0.3%) NS e Total 23/660 (3.5%) 14/1758 (0.8%) <0.0001 4.5 (2.3 to 8.8) CFTR (non CF-causing) p.R74Q 2/660 (0.3%) 0/1758 NS e p.R75Q (het)* 29/660 (4.4%) 59/1758 (3.4%) NS e p.R75Q (hom)* 2/660 (0.3%) 1/1758 (0.06%) NS e p.Y84H 0/660 1/1758 (0.06%) NS e p.A120T 0/660 1/1758 (0.06%) NS e p.I148T* 4/660 (0.6%) 11/1758 (0.6%) NS e p.I507V 1/660 (0.2%) 2/1758 (0.1%) NS e p.F508C 1/660 (0.2%) 0/1758 NS e c.1716+12T>C 0/660 1/1758 (0.06%) NS e p.E528E (het)* 36/660 (5.5%) 82/1758 (4.7%) NS e p.E528E (hom)* 0/660 2/1758 (0.1%) NS e c.1898+8C>G 0/660 1/1758 (0.06%) NS e p.H667Y 1/660 (0.2%) 0/1758 NS e p.R668C 5/660 (0.8%) 3/1758 (0.2%) NS e p.G691R 0/660 1/1758 (0.06%) NS e p.L997F 5/660 (0.8%) 6/1758 (0.3%) NS e p.S1235R 10/660 (1.5%) 18/1758 (1.0%) NS e Total (excluded)* 25/660 (3.8%) 45/1758 (2.6%) NS e CFTR (CF-causing) Total (all) 78/660 (11.8%) 67/1758 (3.8%) <0.0001 3.4 (2.4 to 4.8) CFTR (all) Total (excluded)* 103/660 (15.6%) 112/1758 (6.4%) <0.0001 2.7 (2 to 3.6) The table is divided into three parts.
X
ABCC7 p.Arg347His 22427236:140:1005
status: NEW150 Table 4 Homozygous and compound heterozygous patients and controls with at least two CFTR, SPINK1 or CTRC variants Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing severe or CF-causing mild/CF-causing mild) p.F508del/p.R117H (7T/9T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.F508del/p.R347H 1/660 (0.2%) 0/1758 NS e p.F508del/p.D1152Hy 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.R1158X 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/c.1717-1G>A 1/660 (0.2%) 0/1758 NS e p.R117H (7T/9T)/p.N1303K 1/660 (0.2%) 0/1758 NS e p.D1152Hy/p.N1303K 1/660 (0.2%) 0/1758 NS e Total 9/660 (1.4%) 1/1758 (0.06%) 0.002 16.1 (1.9 to 134.2) CFTR (CF-causing severe or CF-causing mild or non-CF-causing/Non-CF-causing) p.F508del/p.R75Q* 0/660 1/1758 (0.06%) NS e p.F508del/5T* 2/660 (0.3%) 1/1758 (0.06%) NS e p.F508del/p.E528E* 2/660 (0.3%) 2/1758 (0.1%) NS e p.R75Q*/5T* 1/660 (0.2%) 1/1758 (0.06%) NS e p.R75Q*/p.E528E* 2/660 (0.3%) 2/1758 (0.1%) NS e p.R117H (7T/7T)/p.R75Q* 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.E528E* 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.S1235R 1/660 (0.2%) 0/1758 NS e p.I148T*/5T* 0/660 1/1758 (0.06%) NS e p.R347P/p.E528E* 1/660 (0.2%) 0/1758 NS e p.E528E*/5T* 1/660 (0.2%) 4/1758 (0.23%) NS e p.H667Y/5T* 1/660 (0.2%) 0/1758 NS e p.L997F/5T* 1/660 (0.2%) 0/1758 NS e p.L997F/p.E528E* 0/660 1/1758 (0.06%) NS e p.D1152Hy/5T* 1/660 (0.2%) 0/1758 NS e p.S1235R/5T* 2/660 (0.3%) 1/1758 (0.06%) NS e Total 17/660 (2.6%) 14/1758 (0.8%) 0.001 3.3 (1.6 to 6.7) CFTR Total (all, excluded)* 10/660 (1.5%) 1/1758 (0.06%) <0.0001 27 (3.5 to 211.7) SPINK1 p.N34S (hom) 17/660 (2.6%) 0/1758 <0.0001 95.6 (5.7 to 1594) p.N34S (het)/c.(1-215G>A;194+2T>C) 7/660 (1.1%) 0/1758 <0.0001 40.4 (2.3 to 708.2) Total 24/660 (3.6%) 0/1758 <0.0001 135.4 (8.2 to 2231) CTRC p.R254W (hom) 1/546 (0.2%) 0/1700 NS e p.R254W/p.V235I 1/546 (0.2%) 0/1700 NS e Total 2/546 (0.4%) 0/1700 NS e For CFTR compound heterozygous carriers, calculations were performed for patients and controls carrying a combination of one CF-causing severe or a CF-causing mild in addition with one CF-causing mild variant (upper section).
X
ABCC7 p.Arg347His 22427236:150:297
status: NEW135 Variant distribution in patients aged >20 and <20 years In younger patients, overall PRSS1 variants were 2.9-fold more common (>20 years: 9/239, 3.8%; <20 years: 46/421, 10.9%; p&#bc;0.001, OR 3.1, 95% CI 1.5 to 6.5), whereas overall SPINK1 variants were similarly distributed (56/239, 23.4%; 73/421, Table 2 CFTR variants detected by melting curve analysis Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing, severe) p.F508del 44/660 (6.7%) 48/1758 (2.7%) <0.0001 2.5 (1.7 to 3.9) p.R117H (5T/7T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.G542X 1/660 (0.2%) 1/1758 (0.06%) NS e c.1717-1G>A 3/660 (0.5%) 1/1758 (0.06%) NS e p.E585X 0/660 1/1758 (0.06%) NS e c.2183AA>G 0/660 1/1758 (0.06%) NS e p.R1158X 1/660 (0.2%) 0/1758 NS e p.R1162X 1/660 (0.3%) 0/1758 NS e p.N1303K 3/660 (0.5%) 0/1758 NS e Total 55/660 (8.3%) 53/1758 (3%) <0.0001 2.9 (2 to 4.3) CFTR (CF-causing mild) p.R117H (7T/7T) 13/660 (2%) 8/1758 (0.5%) 0.0009 4.4 (1.8 to 10.7) p.R117H (7T/9T) 3/660 (0.5%) 1/1758 (0.06%) NS e p.R347H 1/660 (0.2%) 0/1758 NS e p.R347P 1/660 (0.2%) 0/1758 NS e p.A455E 1/660 (0.2%) 0/1758 NS e c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.D1152H 3/660 (0.5%) 5/1758 (0.3%) NS e Total 23/660 (3.5%) 14/1758 (0.8%) <0.0001 4.5 (2.3 to 8.8) CFTR (non CF-causing) p.R74Q 2/660 (0.3%) 0/1758 NS e p.R75Q (het)* 29/660 (4.4%) 59/1758 (3.4%) NS e p.R75Q (hom)* 2/660 (0.3%) 1/1758 (0.06%) NS e p.Y84H 0/660 1/1758 (0.06%) NS e p.A120T 0/660 1/1758 (0.06%) NS e p.I148T* 4/660 (0.6%) 11/1758 (0.6%) NS e p.I507V 1/660 (0.2%) 2/1758 (0.1%) NS e p.F508C 1/660 (0.2%) 0/1758 NS e c.1716+12T>C 0/660 1/1758 (0.06%) NS e p.E528E (het)* 36/660 (5.5%) 82/1758 (4.7%) NS e p.E528E (hom)* 0/660 2/1758 (0.1%) NS e c.1898+8C>G 0/660 1/1758 (0.06%) NS e p.H667Y 1/660 (0.2%) 0/1758 NS e p.R668C 5/660 (0.8%) 3/1758 (0.2%) NS e p.G691R 0/660 1/1758 (0.06%) NS e p.L997F 5/660 (0.8%) 6/1758 (0.3%) NS e p.S1235R 10/660 (1.5%) 18/1758 (1.0%) NS e Total (excluded)* 25/660 (3.8%) 45/1758 (2.6%) NS e CFTR (CF-causing) Total (all) 78/660 (11.8%) 67/1758 (3.8%) <0.0001 3.4 (2.4 to 4.8) CFTR (all) Total (excluded)* 103/660 (15.6%) 112/1758 (6.4%) <0.0001 2.7 (2 to 3.6) The table is divided into three parts.
X
ABCC7 p.Arg347His 22427236:135:1004
status: NEW144 Table 4 Homozygous and compound heterozygous patients and controls with at least two CFTR, SPINK1 or CTRC variants Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing severe or CF-causing mild/CF-causing mild) p.F508del/p.R117H (7T/9T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.F508del/p.R347H 1/660 (0.2%) 0/1758 NS e p.F508del/p.D1152Hy 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.R1158X 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/c.1717-1G>A 1/660 (0.2%) 0/1758 NS e p.R117H (7T/9T)/p.N1303K 1/660 (0.2%) 0/1758 NS e p.D1152Hy/p.N1303K 1/660 (0.2%) 0/1758 NS e Total 9/660 (1.4%) 1/1758 (0.06%) 0.002 16.1 (1.9 to 134.2) CFTR (CF-causing severe or CF-causing mild or non-CF-causing/Non-CF-causing) p.F508del/p.R75Q* 0/660 1/1758 (0.06%) NS e p.F508del/5T* 2/660 (0.3%) 1/1758 (0.06%) NS e p.F508del/p.E528E* 2/660 (0.3%) 2/1758 (0.1%) NS e p.R75Q*/5T* 1/660 (0.2%) 1/1758 (0.06%) NS e p.R75Q*/p.E528E* 2/660 (0.3%) 2/1758 (0.1%) NS e p.R117H (7T/7T)/p.R75Q* 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.E528E* 1/660 (0.2%) 0/1758 NS e p.R117H (7T/7T)/p.S1235R 1/660 (0.2%) 0/1758 NS e p.I148T*/5T* 0/660 1/1758 (0.06%) NS e p.R347P/p.E528E* 1/660 (0.2%) 0/1758 NS e p.E528E*/5T* 1/660 (0.2%) 4/1758 (0.23%) NS e p.H667Y/5T* 1/660 (0.2%) 0/1758 NS e p.L997F/5T* 1/660 (0.2%) 0/1758 NS e p.L997F/p.E528E* 0/660 1/1758 (0.06%) NS e p.D1152Hy/5T* 1/660 (0.2%) 0/1758 NS e p.S1235R/5T* 2/660 (0.3%) 1/1758 (0.06%) NS e Total 17/660 (2.6%) 14/1758 (0.8%) 0.001 3.3 (1.6 to 6.7) CFTR Total (all, excluded)* 10/660 (1.5%) 1/1758 (0.06%) <0.0001 27 (3.5 to 211.7) SPINK1 p.N34S (hom) 17/660 (2.6%) 0/1758 <0.0001 95.6 (5.7 to 1594) p.N34S (het)/c.(1-215G>A;194+2T>C) 7/660 (1.1%) 0/1758 <0.0001 40.4 (2.3 to 708.2) Total 24/660 (3.6%) 0/1758 <0.0001 135.4 (8.2 to 2231) CTRC p.R254W (hom) 1/546 (0.2%) 0/1700 NS e p.R254W/p.V235I 1/546 (0.2%) 0/1700 NS e Total 2/546 (0.4%) 0/1700 NS e For CFTR compound heterozygous carriers, calculations were performed for patients and controls carrying a combination of one CF-causing severe or a CF-causing mild in addition with one CF-causing mild variant (upper section).
X
ABCC7 p.Arg347His 22427236:144:297
status: NEW[hide] Lessons learned from 20 years of newborn screening... Med J Aust. 2012 Jan 16;196(1):67-70. Massie RJ, Curnow L, Glazner J, Armstrong DS, Francis I
Lessons learned from 20 years of newborn screening for cystic fibrosis.
Med J Aust. 2012 Jan 16;196(1):67-70., [PMID:22256939]
Abstract [show]
OBJECTIVE: To compare three cystic fibrosis (CF) newborn screening strategies used in Victoria since 1989. DESIGN, SETTING AND PARTICIPANTS: Retrospective review of newborn screening and clinical records for people with CF born in Victoria between 1989 and 2008 to compare screening strategies: repeat immunoreactive trypsinogen (IRT) testing (IRT/IRT, 1989-1990), IRT and p.F508del mutation analysis (IRT/p.F508del, 1991-2006) and IRT with analysis of 12 CFTR mutations (IRT/12 mutations, 2007-2008). MAIN OUTCOME MEASURES: Total number of infants screened, people identified with CF (by screening or clinical diagnosis), number of CF-affected terminations of pregnancy, and number of carriers detected. RESULTS: There were 420 people born with CF (live-birth prevalence, 1/3139; 95% CI, 1/2853-1/3462) and 78 CF-affected pregnancy terminations (overall prevalence, 1/2647; 95% CI, 1/2425-1/2896). Of the babies born with CF, 283 (67.4%) were detected by newborn screening alone, 61 (14.5%) had meconium ileus, 33 (7.9%) had a family history of CF, nine (2.1%) were diagnosed antenatally, and 34 (8.1%) were missed by screening (17 missed because IRT level was < 99th percentile, two with repeat IRT level not elevated, 14 without a screened CFTR mutation, and one with missing data). The sensitivities of the protocols were 86.6% for IRT/IRT, 89.9% for IRT/p.F508del, and 95.8% for IRT/12 mutations. Including 12 mutations in the analysis detected one patient who would otherwise have been missed and, had this protocol been implemented from 1989, it would have detected four others. CONCLUSION: Most babies with CF without meconium ileus, a family history or antenatal diagnosis are detected by newborn screening. Despite improved sensitivity with the 12-mutation analysis, most infants detected would have been diagnosed using the IRT/p.F508del protocol.
Comments [show]
None has been submitted yet.
No. Sentence Comment
30 Where possible, all patients with a diagnosis of CF had further CFTR mutation analysis performed in an attempt to clarify the genotype (p.A455E, p.S549N, p.R347H, p.R1162X, p.R347P, p.R334W, p.R117H).
X
ABCC7 p.Arg347His 22256939:30:156
status: NEW[hide] Detecting Common CFTR Mutations by Reverse Dot Blo... Iran J Pediatr. 2011 Mar;21(1):51-7. Dooki MR, Akhavan-Niaki H, Juibary AG
Detecting Common CFTR Mutations by Reverse Dot Blot Hybridization Method in Cystic Fibrosis First Report from Northern Iran.
Iran J Pediatr. 2011 Mar;21(1):51-7., [PMID:23056764]
Abstract [show]
OBJECTIVE: Cystic fibrosis and its distribution vary widely in different countries and/or ethnic groups. Common cystic fibrosis transmembrane conductance regulator (CFTR) mutations were reported from Iran, but the northern population was not or underrepresented in those studies. The aim of this study was to determine the frequency of common CFTR mutations in children from northern Iran. METHODS: Thirty unrelated Iranian cystic fibrosis patients aged less than 11 years and living in Mazandaran province (in Iran) were screened for 5 common CFTR gene mutations. deltaF508, N1303K, G542X, R347H and W1282X using Reverse Dot Blot method. FINDINGS: Only one mutation, DeltaF508, was found in 7 patients accounting for 21.7% (13/60) of alleles. CONCLUSION: These findings can be used for planning future screening and appropriate genetic counseling programs in Iranian CF families.
Comments [show]
None has been submitted yet.
No. Sentence Comment
8 deltaF508, N1303K, G542X, R347H and W1282X using Reverse Dot Blot method.
X
ABCC7 p.Arg347His 23056764:8:26
status: NEW27 We selected five mutations, deltaF508, N1303K, G542X, R347H and W1282X based on previous reports in Iran and neighboring countries.
X
ABCC7 p.Arg347His 23056764:27:54
status: NEW67 Table 1: Human cystic fibrosis transconductance regulator probes CFTR probe sequenceLocation in the CFTR geneProbe name 5'-NH2-GAAACACCAAAGATGATA-3'Exon10∆F508-N 5'-NH2-GGAAACACCAATGATATT-3'Exon10∆F508-MUT 5'-NH2-TATAGTTCTTGGAGAAGGTG3'Exon11G542X-N 5'-NH2-TATAGTTCTTTGAGAAGGTG-3'Exon11G542X-MUT 5'-NH2-GCTTTCCTCCACTGTTG-3'Exon20W1282X-N 5'-NH2-CAACAGTGAAGGAAAGC-3'Exon20W1282X-MUT 5'-NH2-AGAAAAAACTTGGATCC-3'Exon21N1303K-N 5'-NH2-GGGATCCAACTTTTTTCT-3'Exon21N1303K-MUT 5'-NH2-AATTGTTCTGCGCATGG-3'Exon7R347H-N 5'-NH2-CATTGTTCTGCCCATGGC-3'Exon7R347H-MUT Table 2: Human cystic fibrosis transmembrane conductance regulator primers Cystic fibrosis primer sequence Exon amplified Cystic fibrosis primer name Cystic fibrosis mutation tested 5'-Biotin-AGACCATGCTCAGATCTTCCAT-3' 5'-Biotin-GCAAAGTTCATTAGAACTGATC-3' 7 CF7-F CF7-R R347P 5'-Biotin-GCAGAGTACCTGAAACAGGA-3' 5'-Biotin-CATTCACAGTAGCTTACCCA-3' 10 CF10-F CF10-R ∆F508 5'-Biotin-CAACTGTGGTTAAAGCAATAGTGT-3' 5'-Biotin-GCACAGATTCTGAGTAACCATAAT-3' 11 CF11-F CF11-R G542X 5'-Biotin-TGGGCCTCTTGGGAAGAACT-3' 5'-Biotin-CTCACCTGTGGTATCACTCC-3' 20 CF20-F CF20-R W1282X 5'-Biotin-GGTAAGTACATGGGTGTTTC-3' 5'-Biotin-CAAAAGTACCCTGTTGCTCCA-3' 21 CF21-F CF21-R N1303K Genotype Analysis: Mutation screening of the CFTR gene in 60 alleles by reverse dot blot hybridization for five common mutations showed that 13 (21.6%) alleles were ∆F508.
X
ABCC7 p.Arg347His 23056764:67:532
status: NEWX
ABCC7 p.Arg347His 23056764:67:575
status: NEW80 The other four mutations tested: N1303K, G542X, R347H and W1282X, were not found in these patients.
X
ABCC7 p.Arg347His 23056764:80:48
status: NEW98 Consequently, it is believed that the incidence of cystic fibrosis is also similarly high, and that the low incidence commonly believed to be associated cystic fibrosis is also similarly high, and that the Table 5: Comparison of the frequency of common CFTR mutations ∆F508, N1303K, G542X, R347H , W1282X in Europe and North Africa with Iran and some neighboring countries Region or Country Mutation Type Reference ∆F508 W1282X N1303K G542X R347H Europe and N Africa 66.8 1 1.6 2.6 0.8-3.6 6 Turkey 24.5-27 ND 2.9-3.7 2.6-4.9 3-3.6 6, 23, 25 Saudi Arabia 13 ND 2 ND ND 27, 28 India 19-27 ND ND ND ND 24, 26 Iran 16-17.8 0-4 4.3-5.5 1.6-3.6 1.6-3.6 7, 8, 9 Mazandaran 21.6 0 0 0 0 Present study ND: Not detected low incidence commonly believed to be associated with this non-European population is likely to be due to under-diagnosis.
X
ABCC7 p.Arg347His 23056764:98:298
status: NEWX
ABCC7 p.Arg347His 23056764:98:299
status: NEW139 Jalalirad M, Houshmand M, Mirfakhraie R, et al. First study of CF mutations in the CFTR gene of Iranian patients: detection of DeltaF508, G542X, W1282X, A120T, R117H, and R347H mutations.
X
ABCC7 p.Arg347His 23056764:139:173
status: NEW140 Jalalirad M, Houshmand M, Mirfakhraie R, et al. First study of CF mutations in the CFTR gene of Iranian patients: detection of DeltaF508, G542X, W1282X, A120T, R117H, and R347H mutations.
X
ABCC7 p.Arg347His 23056764:140:173
status: NEW[hide] The use of DHPLC (Denaturing High Performance Liqu... J Prenat Med. 2010 Jul;4(3):45-8. Mesoraca A, Di Natale M, Cima A, Di Giacomo G, Sarti M, Barone MA, Bizzoco D, Cignini P, Mobili L, D'emidio L, Giorlandino C
The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis.
J Prenat Med. 2010 Jul;4(3):45-8., [PMID:22439061]
Abstract [show]
OBJECTIVE: The aim of the study is to evaluate the role of Denaturing High Performance Liquid Chromatography (DHPLC) in the second level screening of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene. METHODS: A 9-month prospective study, between June 2008 and March 2009 at Artemisia Fetal Medical Centre, included 3829 samples of amniotic fluid collected from women undergoing mid-trimester amniocentesis.The genetic diagnosis of CF was based on research of the main mutations of the CFTR gene on fetal DNA extracted from the amniocytes, (first level screening) using different commercial diagnostic systems. A second level screening using DHPLC, on the amniotic fluid and on a blood sample from the couple, was offered in case of fetuses heterozygous at first level screening. RESULTS: Of 3829 fetuses, 134 were found to be positive, 129 heterozygous and 5 affected. Of the 129 couples, following appropriate genetic counselling, 53 requested a second level screening. Through the use of DHPLC, 44 couples were found to be negative, and in nine couples, nine rare mutations were identified. CONCLUSIONS: The first level screening can be useful to evidence up to 75% of the CF mutations. The second level screening can identify a further 10% of mutant alleles. DHPLC was found to be a reliable and specific method for the rapid identification of the rare CFTR mutations which were not revealed in initial first level screening.
Comments [show]
None has been submitted yet.
No. Sentence Comment
100 48 Journal of Prenatal Medicine 2010; 4 (3): 45-50 Table III Mutations found with II level screening through DHPLC Mutations of mutated alleles DF508 29 W1282X 3 N1303K 8 1717-1G®A 2 3659delC 1 G85E 1 2789 +5G®A 2 R553X 2 R1162X 1 R117H 1 G542X 3 Total 53Table I Mutations found through I level screeningMutations analysed with I level screening through OLA CFTR Mutations Position on the CFTR gene DF508 Exon 10 3849+10KbC®T Intron 19 R334W Exon 7 W1282X Exon 10 V520F Exon 10 3905insT Exon 20 N1303K Exon 21 3876delA Exon 20 1717-1G®A Exon 11 3659delC Exon 19 DI507 Exon 10 A455E Exon 9 G85E Exon 3 2789 +5G®A Exon 14 / Intron 14 2183AA®G Exon 13 1898+1G®A Exon 12 / Intron 12 R347P Exon 7 R347H Exon 7 R560T Exon 11 1078delT Exon 7 R553X Exon 11 711+1G®T Exon 5 / Intron 5 G551D Exon 11 R1162X Exon 19 S549R Exon 11 R117H Exon 4 S549N Exon 11 621+1G®T Exon 4 G542X Exon 11 394delTT Exon 3 3120+1G®ðA Exon 16/ Intron 16 2184delA Exon 13 Table II Mutations found through I level screening Mutations Positions on CFTR gene R1066C Exon 17 b L1065P Exon 17 b A1006E Exon 19 R75Q Exon 3 D537E Exon 11 W1134X Exon 18 W1145X Exon 18 L1077P Exon 17b C524X Exon 11 Total 9 The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis Journal of Prenatal Medicine 2010; 4 (3): 45-50 49 tion was to provide the couple with adequate counselling in order to better understand the genotype-phenotype correlation in the various associations of mutations.
X
ABCC7 p.Arg347His 22439061:100:721
status: NEWX
ABCC7 p.Arg347His 22439061:100:727
status: NEW[hide] Borderline sweat test: Utility and limits of genet... Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24. Seia M, Costantino L, Paracchini V, Porcaro L, Capasso P, Coviello D, Corbetta C, Torresani E, Magazzu D, Consalvo V, Monti A, Costantini D, Colombo C
Borderline sweat test: Utility and limits of genetic analysis for the diagnosis of cystic fibrosis.
Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24., [PMID:19318035]
Abstract [show]
OBJECTIVE: The sweat test remains the gold standard for the diagnosis of Cystic Fibrosis (CF) even despite the availability of molecular analysis of Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR). We investigated the relationship between CFTR mutation analysis and sweat chloride concentration in a cohort of subjects with borderline sweat test values, in order to identify misdiagnosis of CF. DESIGN AND METHODS: In the period between March 2006 and February 2008 we performed 773 sweat tests in individuals referred for suspect CF. Ninety-one subjects had chloride values in the border-line range. Clinicians required CFTR gene complete scanning on 66 of them. RESULTS: The mean value of sweat chloride in the DNA negative subjects was lower than in those with at least one CFTR mutation. Our data indicate that 39 mEq/l is the best sensitivity trade off for the sweat test with respect to genotype. CONCLUSIONS: To optimise diagnostic accuracy of reference intervals, it may be useful to modify from 30 to 39 mEq/l the threshold for sweat chloride electrolytes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
59 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported.
X
ABCC7 p.Arg347His 19318035:59:2462
status: NEW57 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported.
X
ABCC7 p.Arg347His 19318035:57:2462
status: NEW[hide] Improvement in clinical markers in CF patients usi... J Cyst Fibros. 2008 Sep;7(5):433-6. Epub 2008 May 21. Visca A, Bishop CT, Hilton SC, Hudson VM
Improvement in clinical markers in CF patients using a reduced glutathione regimen: an uncontrolled, observational study.
J Cyst Fibros. 2008 Sep;7(5):433-6. Epub 2008 May 21., [PMID:18499536]
Abstract [show]
CFTR mutation, which causes cystic fibrosis (CF), has also recently been identified as causing glutathione system dysfunction and systemic deficiency of reduced glutathione (GSH). Such dysfunction and deficiency regarding GSH may contribute to the pathophysiology of CF. We followed 13 patients (age range 1-27 years) with cystic fibrosis who were using a regimen of reduced glutathione (GSH), including oral glutathione and inhaled buffered glutathione in an uncontrolled, observational study. Dosage ranged from 66-148 mg/kg/day in divided doses, and the term examined was the initial 5.5 months of GSH use (45 days of incrementally adjusted dose, plus 4 months of use at full dosage). Baseline and post-measurements of FEV1 percent predicted, BMI percentile, and weight percentile were noted, in addition to bacterial status and pulmonary exacerbations. Significant improvement in the following clinical parameters was observed: average improvement in FEV1 percent predicted (N=10) was 5.8 percentage points (p<0.0001), average weight percentile (N=13) increased 8.6 points (p<0.001), BMI percentile (N=11) improved on average 1.22 points (p<0.001). All patients improved in FEV1 and BMI, if measured in their case; 12 of 13 patients improved in weight percentile. Positive sputum cultures of bacteria in 11 patients declined from 13 to 5 (p<0.03) with sputum cultures of Pseudomonas aeruginosa becoming negative in 4 of 5 patients previously culturing PA, including two of three patients chronically infected with PA as determined by antibody status. Use of a daily GSH regimen appears to be associated in CF patients with significant improvement in lung function and weight, and a significant decline in bacteria cultured in this uncontrolled study. These findings bear further clinical investigation in larger, randomized, controlled studies.
Comments [show]
None has been submitted yet.
No. Sentence Comment
45 24 25 29 57 57 60.5 7 7 15 AX AX AX 11, M, 15 DF508/R347H 42 44 51 50.5 50 54 30 24 32 PA SA,PA none 12, M, 1 NA NA NA NA 10 10 12 9 5 25 NA NA NA 13, F, 1 DF508/DF508 NA NA NA 7.5 8 9.5 0 0 3 NA NA NA NA - data not available. T3 - 3 months prior to baseline; T0 - baseline; T5.5 - 5.5 months after baseline.
X
ABCC7 p.Arg347His 18499536:45:52
status: NEW66 18.8 20.0 2 0 35 22 11, M, 15 DF508/R347H 17.5 18.7 1 1 10 18 12, M, 1 NA NA NA NA NA NA NA 13, F, 1 DF508/DF508 NA NA NA NA NA NA NA - data not available. T3 - 3 months prior to baseline; T0 - baseline; T5.5 - 5.5 months after baseline.
X
ABCC7 p.Arg347His 18499536:66:36
status: NEW[hide] Cystic fibrosis carrier frequency and estimated pr... J Cyst Fibros. 2008 Sep;7(5):440-3. Epub 2008 Feb 1. Ratbi I, Genin E, Legendre M, Le Floch A, Costa C, Cherkaoui-Deqqaqi S, Goossens M, Sefiani A, Girodon E
Cystic fibrosis carrier frequency and estimated prevalence of the disease in Morocco.
J Cyst Fibros. 2008 Sep;7(5):440-3. Epub 2008 Feb 1., [PMID:18243066]
Abstract [show]
BACKGROUND: The epidemiology of cystic fibrosis (CF) is poorly known in North African populations, in particular in Morocco and the CF carrier frequency in the general Moroccan population has never been evaluated. METHODS: To estimate the prevalence of CF mutations in Morocco, blood samples from 150 healthy Moroccans were tested for frequent CFTR mutations and the intron 8 polyT variant. RESULTS: Two subjects were heterozygous for F508del and eight others for the (T)5 variant. CONCLUSION: These findings indicate that the Moroccan population is at risk for CF and CFTR-related disorders. CF prevalence could be in the range of that found in European populations. Wider studies are necessary to identify the clinical pattern and accurately determine the prevalence and molecular basis of CF in Morocco.
Comments [show]
None has been submitted yet.
No. Sentence Comment
27 We screened for 32 CFTR gene mutations (G85E, 394delTT, R117H, 621+1GNT, 711+1GNT, R334W, R347P, R347H, 1078delT, A455E, I507del, F508del, V520F, 1717-1GNA, G542X, G551D, R553X, R560T, S549R(TNG), S549N, 1898+1GNA, 2183AANG, 2184delA, 2789+5GNA, 3120 + 1G NA, R1162X, 3659delC, 3849 + 10kbC NT, W1282X, 3905insT, 3876delA, N1303K) and the (T)5 splicing variant of intron 8, using a commercial kit (CF v3 Genotyping Assay, Abbott, Rungis, France).
X
ABCC7 p.Arg347His 18243066:27:97
status: NEW[hide] Consensus on the use and interpretation of cystic ... J Cyst Fibros. 2008 May;7(3):179-96. Castellani C, Cuppens H, Macek M Jr, Cassiman JJ, Kerem E, Durie P, Tullis E, Assael BM, Bombieri C, Brown A, Casals T, Claustres M, Cutting GR, Dequeker E, Dodge J, Doull I, Farrell P, Ferec C, Girodon E, Johannesson M, Kerem B, Knowles M, Munck A, Pignatti PF, Radojkovic D, Rizzotti P, Schwarz M, Stuhrmann M, Tzetis M, Zielenski J, Elborn JS
Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice.
J Cyst Fibros. 2008 May;7(3):179-96., [PMID:18456578]
Abstract [show]
It is often challenging for the clinician interested in cystic fibrosis (CF) to interpret molecular genetic results, and to integrate them in the diagnostic process. The limitations of genotyping technology, the choice of mutations to be tested, and the clinical context in which the test is administered can all influence how genetic information is interpreted. This paper describes the conclusions of a consensus conference to address the use and interpretation of CF mutation analysis in clinical settings. Although the diagnosis of CF is usually straightforward, care needs to be exercised in the use and interpretation of genetic tests: genotype information is not the final arbiter of a clinical diagnosis of CF or CF transmembrane conductance regulator (CFTR) protein related disorders. The diagnosis of these conditions is primarily based on the clinical presentation, and is supported by evaluation of CFTR function (sweat testing, nasal potential difference) and genetic analysis. None of these features are sufficient on their own to make a diagnosis of CF or CFTR-related disorders. Broad genotype/phenotype associations are useful in epidemiological studies, but CFTR genotype does not accurately predict individual outcome. The use of CFTR genotype for prediction of prognosis in people with CF at the time of their diagnosis is not recommended. The importance of communication between clinicians and medical genetic laboratories is emphasized. The results of testing and their implications should be reported in a manner understandable to the clinicians caring for CF patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1236 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations.
X
ABCC7 p.Arg347His 18456578:1236:1138
status: NEW1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations.
X
ABCC7 p.Arg347His 18456578:1239:1138
status: NEW[hide] Estimating the age of CFTR mutations predominantly... J Cyst Fibros. 2008 Mar;7(2):168-73. Epub 2007 Sep 6. Fichou Y, Genin E, Le Marechal C, Audrezet MP, Scotet V, Ferec C
Estimating the age of CFTR mutations predominantly found in Brittany (Western France).
J Cyst Fibros. 2008 Mar;7(2):168-73. Epub 2007 Sep 6., [PMID:17825628]
Abstract [show]
BACKGROUND: Disparities in the spectrum of mutations within the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene are commonly observed in populations from different ethnical and/or geographical origins. The occurrence of CF in Brittany (western France) is one of the highest in populations from Caucasian origin (<1/2000 in specific areas). The W846X(2), 1078delT and G551D mutations, as well as the I1027T polymorphism in cis with the DeltaF508 mutation (currently referred to as p.F508del) are particularly frequent in this area. We investigated the age of the respective variants in the region of interest. METHODS: Several polymorphic markers surrounding the CFTR gene were genotyped. Allele frequencies as well as mutation rates and other parameters were used to calculate the respective age of the most recent common ancestors in the region of interest by a previously employed, simple likelihood-based method. RESULTS: Following haplotype reconstruction and simulation, the ages were estimated to be approximately 600, 1000, 1200 and 600 years, respectively (with a 95% confidence interval). CONCLUSIONS: These datings thus provide historical insights in the context of understanding population migrations. They also underline the usefulness of this method for estimating the age of rare mutations with a limited number of carriers.
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 Primers amplifying the regions of interest were designed with PrimerQuestSM from Table 1 Genotypes of CF patients W846X2 1078delT G551D Mutation in trans Number Mutation in trans Number Mutation in trans Number ΔF508 6 ΔF508 21 ΔF508 18 R117C 1 1078delTa 2 E60K 1 ΔI507 1 4005+1GNA 2 W79X 1 Y563N 1 L610S 1 C225X 1 1078delTb 1 W846X2 b 1 F311L 1 621+1GNT 1 R1066H 1 R347H 1 2789+5GNA 1 1221delCT 1 G542X 1 3849+4ANG 1 1717-1GNA 1 G551D 1 3659delC 1 R553G 1 S942F 1 Y1092X 1 621+1GNT 1 2789+5GNA 1 4006-1GNA 1 Unidentified 1 Total 13 Total 31 Total 32 a One particular case: in this individual, the two chromosomes 7 are identical by descent.
X
ABCC7 p.Arg347His 17825628:51:386
status: NEW[hide] Molecular screening of CFTR gene in Brazilian men ... Hum Fertil (Camb). 2006 Mar;9(1):53-6. Bertuzzo CS, Pinto W
Molecular screening of CFTR gene in Brazilian men with bilateral agenesis of the vas deferens.
Hum Fertil (Camb). 2006 Mar;9(1):53-6., [PMID:16581722]
Abstract [show]
Infertility is a common symptom of cystic fibrosis, especially in men (95% become sterile). It is caused by blockage of the vas deferens and the epididymis, which result in degeneration of the tubules. The purpose of this study was to verify the frequency of CFTR gene mutation in patients with bilateral agenesis of the vas deferens using SSCP and sequencing. The study population consisted of 40 white individuals with agenesis of the vas deferens as well as their 12 siblings without agenesis of the vas deferens. CTFR gene mutation was found in 22 of the 40 patients (55%) and it was possible to detect both mutating alleles in these 22 patients. The most frequent genotype found was ?F508/IVS8-5T. There was no genotype concordance in siblings. Our results show the importance of the investigation of CFTR mutation in patients with vas deferens agenesis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
54 Patient CFTR mutation found 1 AG DF508/IVS8-5T 5 AG DF508/IVS8-5T 6 AG DF508 IVS8-5T 7 AG DF508/IVS8-5T 8 AG DF508/IVS8-5T 9 AG DF508/IVS8-5T 12 AG R117H/R117H 16 AG DF508/R1162X 18 AG N1303K/R1162X 21 AG DF508/IVS8-5T 23 AG R347H/R117H 24 AG N1303K/R117H 25 AG DF508/W1282X 27 AG N1303K/IVS8-5T 29 AG DF508/IVS8-5T 30 AG N1303K/W1282X 32 AG DF508/IVS8-5T 34 AG R347H/R117H 36 AG DF508/N1303K 38 AG IVS8-5T/IVS8-5T 39 AG DF508/R117H 40 AG DF508/N1303K Concerning the most prevalent mutation in our study, DF508, we found a higher proportion in our patients than that found in Argentine patients (Levy et al., 2004), 35% vs. 20.8%.
X
ABCC7 p.Arg347His 16581722:54:225
status: NEWX
ABCC7 p.Arg347His 16581722:54:362
status: NEW[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]
Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS.
X
ABCC7 p.Arg347His 16049310:51:1945
status: NEW[hide] Rapid screening for 31 mutations and polymorphisms... Methods Mol Med. 2005;114:147-71. Dunbar SA, Jacobson JW
Rapid screening for 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator gene by Lminex xMAP suspension array.
Methods Mol Med. 2005;114:147-71., [PMID:16156102]
Abstract [show]
A suspension array hybridization assay is described for the detection of 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator (CFTR) gene using Luminex xMAP technology. The Luminex xMAP system allows simultaneous detection of up to 100 different targets in a single multiplexed reaction. Included in the method are the procedures for design of oligonucleotide capture probes and PCR amplification primers, coupling oligonucleotide capture probes to carboxylated microspheres, hybridization of coupled microspheres to oligonucleotide targets, production of targets from DNA samples by multiplexed PCR amplification, and detection of PCR-amplified targets by direct hybridization to probe-coupled microspheres. Mutation screening with the system is rapid, requires relatively few sample manipulations, and provides adequate resolution to reliably genotype the 25 CFTR mutations and 6 CFTR polymorphisms contained in the ACMG/ACOG/NIH-recommended core mutation panel for general population CF carrier screening.
Comments [show]
None has been submitted yet.
No. Sentence Comment
119 Coriell Cell Repositories, NA12960 ΔI507/R347P Patient sample G551D/R347P Coriell Cell Repositories, NA12785 621+1G→T/711+1G→T Coriell Cell Repositories, NA11280 621+1G→T/G85E Coriell Cell Repositories, NA11282 3849+10kbC→T/3849+10kbC→T Coriell Cell Repositories, NA11860 A455E/normal Patient sample 621+1G→T/A455E Coriell Cell Repositories, NA11290 R1162X/normal Coriell Cell Repositories, NA12585 ΔF508/3659delC Coriell Cell Repositories, NA11275 2789+5G→A/2789+5G→A Coriell Cell Repositories, NA11859 2184delA/normal Patient sample 1898+1G→A/normal Patient sample 621+1G→T/3120+1G→A Coriell Cell Repositories, NA07441 3120+1G→A/3120+1G→A Patient sample F508C/normal Coriell Cell Repositories, NA13033 I506V/normal Coriell Cell Repositories, NA13032 R347H/normal Patient sample ΔF508/3120G→A Patient sample S549N/normal Patient sample S549R/normal Patient sample CFTR, cystic fibrosis transmembrane conductance regulator gene.
X
ABCC7 p.Arg347His 16156102:119:855
status: NEW[hide] Genotype and phenotype correlations in patients wi... Gastroenterology. 2002 Dec;123(6):1857-64. Durno C, Corey M, Zielenski J, Tullis E, Tsui LC, Durie P
Genotype and phenotype correlations in patients with cystic fibrosis and pancreatitis.
Gastroenterology. 2002 Dec;123(6):1857-64., [PMID:12454843]
Abstract [show]
BACKGROUND & AIMS: Pancreatitis is known to occur in some patients with cystic fibrosis (CF), but the prevalence, natural history, and genotypic basis are unclear. We examined a well-defined cohort of patients with CF to answer these questions. METHODS: Patients with CF were identified from a computerized database (1966-1996). Chart audit identified all patients with CF and pancreatitis. RESULTS: Among 1075 patients with CF, 937 (87%) were pancreatic insufficient at diagnosis, 28 (3%) were pancreatic sufficient but developed pancreatic insufficiency after diagnosis, and 110 (10%) have remained pancreatic sufficient. No patients with pancreatic insufficiency developed pancreatitis. Nineteen patients (17.3%) with pancreatic sufficiency experienced one or more attacks of pancreatitis. The mean age at diagnosis of pancreatitis was 22.7 +/- 10.3 years (range, 10-35 years), and pancreatitis was recognized before the diagnosis of CF in 6 patients (32%). The diagnosis of CF in pancreatic-sufficient patients, with and without pancreatitis, was established at a significantly older age than in those with pancreatic insufficiency (P < 0.0001). Genotyped patients with pancreatic insufficiency carried 2 severe mutant alleles. All genotyped patients with pancreatic sufficiency and pancreatitis carried at least one mild mutation. No specific genotype was predictive of pancreatitis. CONCLUSIONS: Patients with CF with pancreatic sufficiency carry at least one mild mutant allele and are at a significant risk of developing pancreatitis. Symptoms of pancreatitis may precede the diagnosis of CF. Pancreatitis is associated with an otherwise mild CF phenotype.
Comments [show]
None has been submitted yet.
No. Sentence Comment
105 CFTR Genotypes Among CF Patients With PS With and Without Pancreatitis Two mutations (n) ⌬F508/R117H (9) ⌬F508/(5T) (6) ⌬F508/3272-26A 3 G (4) ⌬F508/R347H (2) ⌬F508/P574H (2) ⌬F508/875 ϩ 1G Ͼ C (2) ⌬F508/3849 ϩ 10kb C 3 T (1) ⌬F508/A455E (1) ⌬F508/D614G (1) ⌬F508/G85E (1) ⌬F508/R347P (1) ⌬F508/S1251N (1) ⌬F508/⌬F508a (1) ⌬F508/3120G Ͼ A (1) ⌬F508/G551Da (1) G542X/R117H (1) R560T/L206W (1) R117H/R117H (1) R31L/P67L (1) 1461ins4 (AGAT)/G85E (1) G551D/(5T) (1) R1066C/3849 ϩ 10kb C Ͼ T (1) G551D/3849 ϩ 10kb C Ͼ T (1) R334W/R334W (1) R334W/681delC (1) W1282X/3489 ϩ 10kb C Ͼ T (1) One mutation (n) ⌬F508/- (18) L1077P/- (1) W1282X/- (1) M1137V/- (1) G551D/- (1) R347H/- (1) Q30X1/- (1) G1244E/- (1) R117H/- (1) 621 ϩ 2G621 ϩ 1G 3 T/- (1) NOTE.
X
ABCC7 p.Arg347His 12454843:105:177
status: NEWX
ABCC7 p.Arg347His 12454843:105:842
status: NEW124 of episodes of pancreatitis Genotype 1 0.3 12 21.7 2 ⌬F508/S1251N 2 0.3 34 30.0 1 ⌬F508/R347H 3 4.4 13 42.5 3 / 4 4.4 21 36.5 1 ⌬F508/ 5 7.3 26 40.8 10 ⌬F508/P67L 6 9.6 29 29.9 (D) 1 ⌬F508/ 7 12.0 18 39.9 1 ⌬F508/R347P 8 12.9 37 40.9 2 G542X/D1152H 9 13.0 30 50.3 1 ⌬F508/3849 ϩ 10Kbc Ͼ T 10 14.7 13 21.5 1 DF508/R117H 11 15.6 34 40.8 1 ⌬F508/2789ϩ5G Ͼ T 12 15.6 10 26.0 10 ⌬F508/R117H 13 16.0 10 22.0 14 ⌬F/508/3849 ϩ 10kbC Ͼ T 14 16.0 18 21.2 (D) 1 R1066C/3849 ϩ 10kbC Ͼ T 15 19.9 15 40.8 5 No DNA 16 23.2 19 23.2 15 ⌬F508/11234V 17 24.1 40 47.6 (D) 1 No DNA 18 26.9 25 43.3 12 No DNA 19 27.4 35 50.3 (D) 2 ⌬F508/A455E NOTE.
X
ABCC7 p.Arg347His 12454843:124:102
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... J Hepatol. 2002 Aug;37(2):192-7. Girodon E, Sternberg D, Chazouilleres O, Cazeneuve C, Huot D, Calmus Y, Poupon R, Goossens M, Housset C
Cystic fibrosis transmembrane conductance regulator (CFTR) gene defects in patients with primary sclerosing cholangitis.
J Hepatol. 2002 Aug;37(2):192-7., [PMID:12127423]
Abstract [show]
BACKGROUND/AIMS: Because biliary tract lesions that resemble those of primary sclerosing cholangitis (PSC) may occur in cystic fibrosis (CF), we examined the prevalence and influence of CF transmembrane conductance regulator (CFTR) gene mutations in PSC patients. METHODS: Genomic DNA was analyzed in 29 consecutive PSC patients and in 115 healthy control individuals. A scanning method followed by direct DNA sequencing was used to scan the CFTR coding regions. RESULTS: Four patients (13.8%) were heterozygous for a CFTR mutation, including a new putative severe CF-causing mutation (N782K), and three mild defects (L997F, D1270N, and S1235R). The comparison of PSC patients with healthy controls showed no significant difference in the frequency of CFTR mutations (P=0.415). In addition, two patients (6.9%) were heterozygous for the IVS8-5T allele, which is not significantly different from the 5-6%-prevalence in the general population. Unusual clinical features including a severe outcome in childhood, with a lethal outcome at age 22, and biliary aspergillosis were recorded in patients with a CFTR mutation. CONCLUSIONS: The proportion of CF carriers is not significantly higher in PSC patients than in the general population. The possibility that CFTR mutations may contribute to a severe clinical course in PSC patients is worth further examining.
Comments [show]
None has been submitted yet.
No. Sentence Comment
78 Four additional subjects (3.5%) carried one of the following mild defects: R117H, R347H, R74W-D1270N and R668C-G576A.
X
ABCC7 p.Arg347His 12127423:78:82
status: NEW[hide] Relation between the anatomical genital phenotype ... Fertil Steril. 2002 May;77(5):889-96. Robert F, Bey-Omar F, Rollet J, Lapray JF, Morel Y
Relation between the anatomical genital phenotype and cystic fibrosis transmembrane conductance regulator gene mutations in the absence of the vas deferens.
Fertil Steril. 2002 May;77(5):889-96., [PMID:12009340]
Abstract [show]
OBJECTIVE: To study the correlation between genital phenotype and cystic fibrosis genotype in men lacking at least one vas deferens. DESIGN: Prospective study. SETTING: Institut Rhonalpin pour la Reproduction Humaine, Lyon-Bron, France. PATIENT(S): Forty-seven infertile men lacking at least one vas deferens. INTERVENTION(S): All patients were screened for the 13 most common CFTR gene mutations and for the 5-thymidine variant of intron 8. Renal, scrotal, and transrectal ultrasonography were systematically performed. MAIN OUTCOME MEASURE(S): Epididymal and seminal vesicular abnormalities and testicular volume were compared among men with two, one, or no CFTR gene mutation, with or without the 5T allele. RESULTS: Seminal vesicles and the symmetry of epididymal and vesicular abnormalities did not differ between patients with and those without the CFTR gene mutation. Epididymal abnormalities were more frequent in men without the mutation. Testicular volumes were significantly lower in men without the mutation and those with the 5T allele only. CONCLUSION: Men with the CFTR mutation, the 5T allele only, and those without CFTR mutation have few differences in genital phenotype. Low testicular volume is observed in men without the CFTR mutation and those with the 5T allele only.
Comments [show]
None has been submitted yet.
No. Sentence Comment
81 Three patients had two CFTR gene mutations: two had the severe mutation ⌬F508 associated with the mild mutation R117H, and one had two mild mutations (R117H and R347H).
X
ABCC7 p.Arg347His 12009340:81:168
status: NEW108 Patient Mutations Intron 8 Phenotype Seminal vesicle Epididymis Testicular volume (right/left) (mL) Comments 1 ⌬F508/R117H 7T/9T BAVD A/D C/C 20/20 2 ⌬F508/R117H 7T/9T BAVD A/A E/C 15/12 3 R117H/R347H 7T/9T BAVD A/D E/E 15/15 Compound heterozygote 4 ⌬F508/o 5T/7T BAVD A/h C/C 10/13 Compound heterozygote 5 ⌬F508/o 5T/9T BAVD A/A E/E 16/17 Compound heterozygote 6 ⌬F508/o 5T/9T BAVD A/D E/E 15/15 7 ⌬F508/o 5T/9T BAVD A/A E/E 11/9 8 ⌬F508/o 5T/9T BAVD h/h E/E 20/20 9 ⌬F508/o 5T/9T BAVD A/A C/C 17/9 10 ⌬F508/o 5T/9T BAVD D/A E/E 15/12 11 ⌬F508/o 5T/9T BAVD A/D E/E 10/12 12 ⌬F508/o 7T/9T BAVD A/N C/E 20/20 13 ⌬F508/o 7T/7T BAVD A/A E/E 20/18 14 ⌬F508/o 7T/7T BAVD h/h E/E 10/9 15 ⌬F508/o 9T/9T BAVD A/D C/C 23/26 16 1612delTT/o 7T/9T BAVD A/D C/C 8/7 17 D1270N/o 7T/7T BAVD A/A E/E 12/13 18 R117H/o 7T/7T BAVD A/D E/E 20/18 19 2789ϩ5GBA/o 7T/7T BAVD A/A C/C 18/13 20 o/o 5T/5T BAVD D/A E/E 8/10 21 o/o 5T/9T BAVD A/A C/E 20/18 22 o/o 5T/7T BAVD A/A E/E 20/20 23 o/o 5T/9T BAVD A/A E/E 9/10 24 o/o 5T/7T BAVD A/D E/E 10/10 25 o/o 5T/7T BAVD A/A E/E 9/10 26 o/o 5T/9T BAVD A/D E/A 12/0 Left testicular atrophy 27 o/o 5T/7T BAVD A/A C/E 9/8 28 o/o 7T/7T BAVD A/A E/E 15/15 29 o/o 7T/7T BAVD A/h E/E 11/11 30 o/o 9T/9T BAVD h/h C/C 7/8 31 o/o 7T/7T BAVD h/A E/E 12/12 32 o/o 7T/7T BAVD A/A E/C 10/10 33 o/o 7T/9T BAVD A/A E/E 11/12 34 o/o 7T/7T BAVD h/A C/C 9/9 35 o/o 7T/7T BAVD A/D C/A 10/11 Bilateral dilatation of rete testis 36 o/o 7T/7T BAVD A/D C/C 12/12 37 o/o 7T/9T BAVD A/A C/E 15/15 38 o/o 7T/7T BAVD D/A C/C 12/15 39 o/o 7T/7T BAVDϩURA A/A C/C 12/12 40 o/o 7T/7T BAVDϩURA D/A A/C 0/20 Right testis absent 41 o/o 5T/9T UAVD D/A E/E 13/13 42 o/o 5T/7T UAVD D/A E/C 8/10 Right testicular hypotrophy 43 o/o 5T/7T UAVD h/N E/E 7/8 44 o/o 7T/7T UAVD A/D E/A 12/0 Left cryptorchidism 45 o/o 7T/7T UAVD D/A E/E 4/5 Bilateral testicular hypotrophy 46 o/o 7T/7T UAVD h/h E/E 8/8 47 o/o 7T/7T UAVDϩURA D/A E/E 15/15 Note: A ϭ absent; D ϭ dilated; C ϭ caput only; E ϭ whole; h ϭ hypotrophic; N ϭ normal; o ϭ no detected mutation; BAVD ϭ bilateral absence of the vas deferens; UAVD ϭ unilateral absence of the vas deferens; URA ϭ unilateral renal agenesis. Robert. Absence of the vas deferens.
X
ABCC7 p.Arg347His 12009340:108:209
status: NEW[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]
Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
102 Distribution of 310 CF Mutations in France With Respect to Relative Frequencies (Total Number of CF Chromosomes = 7,420) Group Mutations Number of alleles % Cum. % A F508del 4,985 67.18 G542X 212 2.86 N1303K 156 2.10 73.45 1717-1G>A 97 1.31 B G551D 73 0.98 2789+5G>A 72 0.97 W1282X 68 0.91 R553X 66 0.89 I507del 52 0.70 1078delT 49 0.66 7.47 2183AA>G 48 0.64 711+1G>T 33 0.44 R1162X 33 0.44 Y1092X 30 0.40 3849+10kbC>T 30 0.40 C 12 mutationsa 29 to 15 (239) 0.39-0.20 19 mutationsb 14 to 8 (190) 0.19-0.10 11 mutationsc 7 to 6 (71) 0.09-0.08 11 mutationsd 5 (55) 0.06 10.57 15 mutationse 4 (60) 0.05 23 mutationsf 3 (69) 0.04 50 mutationsg 2 (100) 0.02 D 154 mutationsh 1 (154) 0.01 2.07 6,942 93.56 a 3659delC, R347P, 3272-26A>G, R334W, W846X, 621+1G>T, G85E, R1066C, L206W, 394delTT, 4055+1G>A, R347H.
X
ABCC7 p.Arg347His 10923036:102:797
status: NEW153 Four mutations were detected on a 7T or a 9T background: L206W, R347H, D1152H, 3272-26A>G.
X
ABCC7 p.Arg347His 10923036:153:64
status: NEW171 CFTR Mutation Genotypes Identified Both in Cystic Fibrosis (CF) and in Congenital Bilateral Absence of the Vas Deferens (CBAVD) CF CBAVD F508del/5T 3 143 F508del/2789+5G>A 53 1 F508del/3272-26A>G 17 4 F508del/R117H* 10 39 F508del/R117C 2 2 F508del/L206W 12 4 F508del/R347H 10 5 F508del/R347L 1 1 F508del/D443Y 1 5 F508del/Y569C 1 1 F508del/P574H 3 1 F508del/G628R(G>A) 2 1 F508del/V920M 1 1 F508del/R1070W 2 3 F508del/D1152H 6 8 F508del/S1235R 3 1 F508del/T1246I 1 1 F508del/D1270N+R74W 2 3 F508delN1303I 1 1 3659delC/R347H 1 1 G542X/T338I 2 2 R347H/R1066H 1 1 *The only case with CF whose alleles at IVS8(T)n were reported had mutation R117H associated with a 5T allele.
X
ABCC7 p.Arg347His 10923036:171:267
status: NEWX
ABCC7 p.Arg347His 10923036:171:518
status: NEWX
ABCC7 p.Arg347His 10923036:171:544
status: NEW[hide] A comparison of fluorescent SSCP and denaturing HP... Hum Mutat. 2000;15(6):556-64. Ellis LA, Taylor CF, Taylor GR
A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning.
Hum Mutat. 2000;15(6):556-64., [PMID:10862085]
Abstract [show]
We examined 67 different mutations in 16 different amplicons in a comparison of mutation detection by fluorescent single strand conformation polymorphism (F-SSCP) and by denaturing HPLC (DHPLC). F-SSCP was used to analyze fluorescent amplicons with internal size standards and automated fragment analysis (GeneScan, PE Applied Biosystems, Foster City, CA). In DHPLC, unlabelled amplicons were analyzed by reverse phase HPLC with fragment detection by absorbance at 260nm. Both methods had high sensitivity (95-100%) and specificity (100%). Overall, F-SSCP with external temperature control was the more sensitive method, but DHPLC was particularly useful for the rapid analysis of novel fragments.
Comments [show]
None has been submitted yet.
No. Sentence Comment
97 Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE.
X
ABCC7 p.Arg347His 10862085:97:882
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... Biophys J. 1998 Mar;74(3):1320-32. Mansoura MK, Smith SS, Choi AD, Richards NW, Strong TV, Drumm ML, Collins FS, Dawson DC
Cystic fibrosis transmembrane conductance regulator (CFTR) anion binding as a probe of the pore.
Biophys J. 1998 Mar;74(3):1320-32., [PMID:9512029]
Abstract [show]
We compared the effects of mutations in transmembrane segments (TMs) TM1, TM5, and TM6 on the conduction and activation properties of the cystic fibrosis transmembrane conductance regulator (CFTR) to determine which functional property was most sensitive to mutations and, thereby, to develop a criterion for measuring the importance of a particular residue or TM for anion conduction or activation. Anion substitution studies provided strong evidence for the binding of permeant anions in the pore. Anion binding was highly sensitive to point mutations in TM5 and TM6. Permeability ratios, in contrast, were relatively unaffected by the same mutations, so that anion binding emerged as the conduction property most sensitive to structural changes in CFTR. The relative insensitivity of permeability ratios to CFTR mutations was in accord with the notion that anion-water interactions are important determinants of permeability selectivity. By the criterion of anion binding, TM5 and TM6 were judged to be likely to contribute to the structure of the anion-selective pore, whereas TM1 was judged to be less important. Mutations in TM5 and TM6 also dramatically reduced the sensitivity of CFTR to activation by 3-isobutyl 1-methyl xanthine (IBMX), as expected if these TMs are intimately involved in the physical process that opens and closes the channel.
Comments [show]
None has been submitted yet.
No. Sentence Comment
229 Hipper et al. (1995) reported that the mutations R334E, R334H, K335E, K335H, R347E, and R347H did not alter CFTR conduction properties, but careful inspection of the data presented revealed that the level of CFTR expression was very low so that altered properties of mutant CFTRs might have been easily obscured.
X
ABCC7 p.Arg347His 9512029:229:88
status: NEW[hide] Transmembrane domain of cystic fibrosis transmembr... Biochemistry. 1998 Jan 20;37(3):844-53. Wigley WC, Vijayakumar S, Jones JD, Slaughter C, Thomas PJ
Transmembrane domain of cystic fibrosis transmembrane conductance regulator: design, characterization, and secondary structure of synthetic peptides m1-m6.
Biochemistry. 1998 Jan 20;37(3):844-53., [PMID:9454574]
Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) give rise to cystic fibrosis (CF), the most common genetic disease in the Caucasian population. CFTR is organized into five putative domains, including two that are predicted to be transmembrane and consist of six membrane-spanning segments each. CFTR mediates regulated anion transport across the apical membrane of epithelial cells. The pore through which CFTR transports its solutes is thought to be formed by some combination of the amino-terminal membrane-spanning segments. Although these sequences are predicted to be alpha-helical in secondary structure, to date, no direct structural evidence has been presented testing this hypothesis. Here, we present the biophysical characterization of six peptides (m1-m6) representing the predicted amino-terminal membrane-spanning domain of CFTR. The peptides can be incorporated into liposomes and are soluble in SDS micelles and trifluoroethanol (TFE). FTIR and CD spectroscopy indicate all six peptides adopt a stable, predominantly alpha-helical secondary structure in these environments. In contrast, peptide m6 undergoes a shift from alpha-helix to beta-sheet when dissolved in 20% methanol. Additionally, the peptides show an increase in beta-sheet in TFE, a known inducer of alpha-helices, relative to that seen in the nativelike environments. These results have implications for the folding of this complex membrane protein and suggest that the possible functional role of m6 is manifested through a shift in secondary structure.
Comments [show]
None has been submitted yet.
No. Sentence Comment
287 For example, mutational data demonstrated that the substitution of glutamic acid for lysine 335 alters channel permeability of CFTR (4), and mutation of arginine 347 to histidine gives rise to pH-dependent ion selectivity of the channel (66).
X
ABCC7 p.Arg347His 9454574:287:153
status: NEW[hide] Genetic diseases of the seminal ducts. Biomed Pharmacother. 1998;52(5):197-203. Meschede D, Dworniczak B, Nieschlag E, Horst J
Genetic diseases of the seminal ducts.
Biomed Pharmacother. 1998;52(5):197-203., [PMID:9755815]
Abstract [show]
Azoospermia due to an obstruction of the genital tract is one of numerous possible pathophysiologic mechanisms underlying male infertility. The blockage of the seminal ducts may be acquired or congenital. Only recently has the strong association between mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and various subtypes of obstructive azoospermia been elucidated. Most patients with congenital bilateral absence of the vas deferens or bilateral ejaculatory duct obstruction are carriers of such mutations. The relationship between abnormal CFTR alleles and unilateral absence of the vas deferens, isolated seminal vesicle anomalies, and Young syndrome is less well characterized and awaits further investigation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
92 Another group recently reported a single case of BED0 with compound heterozygosity for the CFTR mutations R347H and N1303K [18].
X
ABCC7 p.Arg347His 9755815:92:109
status: NEW93 Another group recently reported a single case of BED0 with compound heterozygosity for the CFTR mutations R347H and N1303K [18].
X
ABCC7 p.Arg347His 9755815:93:109
status: NEW[hide] Severe cystic fibrosis associated with a deltaF508... Clin Genet. 1998 Jan;53(1):50-3. Hojo S, Fujita J, Miyawaki H, Obayashi Y, Takahara J, Bartholomew DW
Severe cystic fibrosis associated with a deltaF508/R347H + D979A compound heterozygous genotype.
Clin Genet. 1998 Jan;53(1):50-3., [PMID:9550362]
Abstract [show]
This report is concerned with twins with cystic fibrosis (CF). They are of mixed parentage: Japanese mother and German father. One case is presented with meconium ileus as a neonate. The other patient did relatively well until the age of 6 years when she was first hospitalized and diagnosed with pulmonary aspergillosis. They have been receiving standard therapies for CF including digestive enzymes, vitamins and periodic antibiotic therapy in the US. At 19 years of age, they were tested for common mutations and one AF508 cystic fibrosis transmembrane conductance regulator (CFTR) allele was found. Further testing of their CFTR gene as well as those of their Japanese mother and grandmother revealed missense mutations in exon 7 (R347H) and exon 16 (D979A). Although the D979A mutant is very rare, this mutation combination seemed to be responsible for severe CF phenotypes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
7 Further testing of their CFTR gene as well as those of their Japanese mother and grandmother revealed missense mutations in exon 7 (R347H) and exon 16 (D979A).
X
ABCC7 p.Arg347His 9550362:7:132
status: NEW14 - R347H and D979A Received 25 September 1997, revisedand accepted for publication28 October 1997 Following the identification of AF508 as the major mutation causing cystic fibrosis (CF), approximately 800 additional mutations, sequence variations and polymorphisms have been reported by members of the CF Genetic Analysis Consortium. ,The rare mutation R347H was first detected by Cremonesi et al. (1) in a patient with mild CF.
X
ABCC7 p.Arg347His 9550362:14:2
status: NEWX
ABCC7 p.Arg347His 9550362:14:353
status: NEW17 In addition, Mercier et al. (4) reported two R347H mutations when analysing 67 otherwise healthy men with congenital bilateral absence of vas deferens (CBAVD).
X
ABCC7 p.Arg347His 9550362:17:45
status: NEW18 These observations suggest that the R347H mutation might be associated more frequently with CBAVD than other CF mutations.
X
ABCC7 p.Arg347His 9550362:18:36
status: NEW19 Furthermore, in a very recent paper, Kosztolanyi et al. (5) reported a woman with unusually mild CF and normal sweat chloride levels who camed the AF508 deletion on one CF chromosome and 50 the rare mutation R347H on the other.
X
ABCC7 p.Arg347His 9550362:19:208
status: NEW20 In this study, we report on two women (twins) with the AF508 deletion on one CF chromosome and R347H and D979A on the other who show very severe C F phenotypes.
X
ABCC7 p.Arg347His 9550362:20:95
status: NEW52 Sequence analysis of the parental samples showed that the R347H +D979A mutation was present on the maternal C F chromosome, while the paternal chromosome carried the AF508 deletion.
X
ABCC7 p.Arg347His 9550362:52:58
status: NEW58 As her German father had AF508 and her Japanese mother had R347H +D979A, R347H +D979A seemed to be derived from her Japanese mother.
X
ABCC7 p.Arg347His 9550362:58:59
status: NEWX
ABCC7 p.Arg347His 9550362:58:73
status: NEW59 It has been reported that patients, who have a G to A transition at position 1172 in exon 7 which causes the substitution of a histidine for an arginine (R347H) as well as the AF508 mutation on the other chromosome, have mild pulmonary diseases and pancreatic sufficiency.
X
ABCC7 p.Arg347His 9550362:59:154
status: NEW60 Literature which shows the clinical features of mutation R347H are summarized in Table 1.
X
ABCC7 p.Arg347His 9550362:60:57
status: NEW61 Kosztolanyi et al. (5) reported that a patient with AF508/R347H genotype has pancreatic sufficiency and normal sweat chloride levels.
X
ABCC7 p.Arg347His 9550362:61:58
status: NEW63 Summary of literaturewhich showed clinical features with mutation R347H Authors Sex Mutations Respiratory symptoms Other symptoms Pancreaticfunction Hqo [present repoctl Kosztolanyi(5) Mills (9) Yilmaz (a) Yilmaz (a) Mercer (4) Mercier (4) Chillon (3) Culard (12) Osbome (2) Cremonesi (1) 2 women (twins) Woman NS NS NS Mall Mall 2 NS 2 men Mall NS AF5081R347Hf W79A AF508/R347H AF508/R347H R347H/R347H R347HIR347H R347H/R1066H R347H/unidentified R347H/unidentiRed AF5081R347H AF508/R347H AF508/R347H Severe Mild ABPAa Severe Mild Absent Absent NS Absent Some Mild lnsufficent NS Mildly insufficient - - Sufficient - Insufficient CEAVD Sufficient CEAVD Sufficient CEAVD Sufficient CEAVD Mildly insufficient - sufficient - - NSNS, not stated.
X
ABCC7 p.Arg347His 9550362:63:66
status: NEWX
ABCC7 p.Arg347His 9550362:63:373
status: NEWX
ABCC7 p.Arg347His 9550362:63:385
status: NEWX
ABCC7 p.Arg347His 9550362:63:391
status: NEWX
ABCC7 p.Arg347His 9550362:63:397
status: NEWX
ABCC7 p.Arg347His 9550362:63:415
status: NEWX
ABCC7 p.Arg347His 9550362:63:428
status: NEWX
ABCC7 p.Arg347His 9550362:63:447
status: NEWX
ABCC7 p.Arg347His 9550362:63:483
status: NEWX
ABCC7 p.Arg347His 9550362:63:495
status: NEW67 (3), who identified two chromosomes with mutation R347H when studying CF patients, also gave no data on sex, age or genotype/phenotype details.
X
ABCC7 p.Arg347His 9550362:67:50
status: NEW73 Kosztolanyi et al. (5) suggested that the unusually mild nature of CF in patient AF508/R347H genotype is associated with the fact that a missense mutation resulting in an exchange between similarly charged (basic) amino acids, histidine for arginine, produces even less significant change in ion flow through the chloride channel than the transition in R347P and R347L.
X
ABCC7 p.Arg347His 9550362:73:87
status: NEW79 These facts suggested that D979A mutants have a significant effect on CFTR function when combined with the R347H mutation.
X
ABCC7 p.Arg347His 9550362:79:107
status: NEW80 In conclusion, we reported twins who had AF508/R347H +D979A genotype.
X
ABCC7 p.Arg347His 9550362:80:47
status: NEW81 Although D979A mutant is very rare, the combination of AF508 on one chromosome and R347H +D979A on the other chromosome resulted in a severe phenotype.
X
ABCC7 p.Arg347His 9550362:81:83
status: NEW[hide] Genetic findings in congenital bilateral aplasia o... Hum Mutat. 1998;11(6):480. de Meeus A, Guittard C, Desgeorges M, Carles S, Demaille J, Claustres M
Genetic findings in congenital bilateral aplasia of vas deferens patients and identification of six novel mutatations. Mutations in brief no. 138. Online.
Hum Mutat. 1998;11(6):480., [PMID:10200050]
Abstract [show]
Congential bilateral aplasia of vas deferens (CBAVD), a form of male sterility, has been suggested to represent a "genital" form of cystic fibrosis (CF), as mutations in the CFTR gene have been identified in most patients with this condition. Interestingly, the 5T allele in intron 8 appeared to be the most frequent mutation associated with CBAVD. However, the molecular basis of CBAVD is not completely understood. We have analysed the complete coding and flanking CFTR sequences by PCR-DGGE in 64 men with CBAVD from southern France with the aim to list any sequence alteration. Fourty-two of the 64 patients (65.6%) had mutations on both copies of the CFTR gene, including one patient with two mutations in the same copy (DF508 + A1067T). The 5T allele was present in 21/64 cases (33%). Six of the 28 different mutations identified in this study had never been described previously, and appeared to be specific to CBAVD (P111L, M244K, A1364V, G544V, 2896insAG,-33G->A).
Comments [show]
None has been submitted yet.
No. Sentence Comment
56 However, some genotypes (DF508/L206W, DF508/R347H, DF508/D1152H, DF508/R117H, W1282X/D1152H and even DF508/5T) can induce both CF and CBAVD phenotypes.
X
ABCC7 p.Arg347His 10200050:56:44
status: NEW83 Phenotype CFTRamutations Intron 8, Poly(T) tract 1 3 crisis of acute pancreatitis F508 / L206W 9/7 2 F508 / L206W 9/9 3 frequent bronchitis F508 / R347H 9/9 4 F508 / R347H 9/9 5 F508 / M244K 9/7 6 F508 / A1364V 9/7 7 F508 / D1152H 9/7 8 chronic sinusitis and bronchitis F508 / D1152H 9/7 9 F508 / R117H 9/7 10 F508 / R117H 9/7 11 F508 / M952I 9/7 12 D443Y / G542X 7/9 13 D443Y / G542X 7/9 14 2184delA / D443Y 7/7 15 2184delA / D443Y 7/7 16 R347H / D443Y 9/7 17 seminal vesicles agenesia R117H / G1349D 7/7 18 R117H / G1244E 7/7 19 N1303K / P111L 9/7 20 chronic sinusitis, nasal polyps W1282X / D1152H 7/7 21 chronic sinusitis R347H / Y1092X 7/7 22 seminal vesicles agnesia 297-3C-GTT / 4279insA 7/7 23 G544V / F508C 7/7 24 D1152H / 2896insAG 7-9 25 F508 / - 9/5 26 F508 / - 9/5 27 F508 / - 9/5 28 F508 / - 9/5 29 F508 / - 9/5 30 chronic sinusitis, bronchitis F508 / - 9/5 31 sinusitis and allergy F508 / - 9/5 32 allergy F508 / - 9/5 33 F508 / - 9/5 34 F508 / - 9/5 35 F508 / - 9/5 36 F508 / - 9/5 37 bronchitis, asthma F508 / - 9/5 38 chronic sinusitis F508+A1067T / - 9/5 39 chronic sinusitis D1152H / - 7/5 40 2184delA / - 7/5 41 R764X / - 7/5 42 711+1G-GTT / - 7/5 43 F508 / - 9/7 44 F508 / - 9/7 45 F508 / - 9/7 46 F508 / - 9/9 47 R553X / - 7/7 48 -33G-GTA / - 7/7 49 K710X / - 7/7 50 - / - 5/5 51 - / - 5/7 52 - / - 5/7 53 - / - 7/7 54 - / - 7/7 55 - / - 7/7 56 - / - 7/7 57 - / - 7/7 58 - / - 7/7 59 - / - 7/7 60 - / - 7/7 61 - / - 7/9 62 - / - 7/9 63 NIDDb - / - 7/9 64 - / - 7/9 a : Cystic Fibrosis Transmembrane Regulator gene b : Non Insulino-Dependant Diabetis References Anguiano A, Oates RD, Amos JA, Dean M, Gerrard B, Stewart C, Maher TA, White MB, Milunsky A (1992) Congenital absence of the vas deferens: a primarily genital form of cystic fibrosis.
X
ABCC7 p.Arg347His 10200050:83:147
status: NEWX
ABCC7 p.Arg347His 10200050:83:166
status: NEWX
ABCC7 p.Arg347His 10200050:83:440
status: NEWX
ABCC7 p.Arg347His 10200050:83:627
status: NEW[hide] High heterogeneity for cystic fibrosis in Spanish ... Hum Genet. 1997 Dec;101(3):365-70. Casals T, Ramos MD, Gimenez J, Larriba S, Nunes V, Estivill X
High heterogeneity for cystic fibrosis in Spanish families: 75 mutations account for 90% of chromosomes.
Hum Genet. 1997 Dec;101(3):365-70., [PMID:9439669]
Abstract [show]
We have analyzed 640 Spanish cystic fibrosis (CF) families for mutations in the CFTR gene by direct mutation analysis, microsatellite haplotypes, denaturing gradient gel electrophoresis, single-strand conformation analysis and direct sequencing. Seventy-five mutations account for 90.2% of CF chromosomes. Among these we have detected seven novel CFTR mutations, including four missense (G85V, T582R, R851L and F1074L), two nonsense (E692X and Q1281X) and one splice site mutation (711+3A-->T). Three variants, two in intronic regions (406-112A/T and 3850-129T/C) and one in the coding region (741C/T) were also identified. Mutations G85V, T582R, R851L, E692X and Q1281X are severe, with lung and pancreatic involvement; 711+3A-->T could be responsible for a pancreatic sufficiency/insufficiency variable phenotype; and F1074L was associated with a mild phenotype. These data demonstrate the highest molecular heterogeneity reported so far in CF, indicating that a wide mutation screening is necessary to characterize 90% of the Spanish CF alleles.
Comments [show]
None has been submitted yet.
No. Sentence Comment
33 Eight mutations have frequencies 366 Table 1 Seventy-five CFTR mutations identified in 640 Spanish families with cystic fibrosis (CF) Mutation Exon/intron CF alleles % ∆F508 E.10 681 53.20 G542X E.11 108 8.43 N1303K E.21 34 2.65 1811+1.6kbA→Ga I.11 24 1.87 711+1G→T I.5 22 1.71 R1162Xa E.19 21 1.64 R334Wa E.7 21 1.64 R1066C E.17b 14 1.09 1609delCAa E.10 13 1.01 Q890X E.15 13 1.01 G85E E.3 12 0.94 712-1G→Ta I.5 11 0.86 2789+5G→A I.14b 11 0.86 ∆I507 E.10 10 0.78 W1282X E.20 10 0.78 2869insGa E.15 9 0.70 L206W E.6a 7 0.54 R709X E.13 7 0.54 621+1G→T I.4 6 0.47 3272-26A→G I.17a 6 0.47 R347H E.7 5 0.39 2183AA→G E.13 5 0.39 K710X E.13 5 0.39 2176insC E.13 5 0.39 3849+10kbC→T I.19 5 0.39 P205Sa E.6a 4 0.31 1078delT E.7 4 0.31 R553X E.11 4 0.31 G551D E.11 4 0.31 1812-1G→Aa I.11 4 0.31 CFdel#1a E.4-7/11-18 4 0.31 V232D E.6a 3 0.23 936delTAa E.6b 3 0.23 1717-8G→A I.10 3 0.23 1949del84 E.13 3 0.23 W1089X E.17b 3 0.23 R347P E.7 3 0.23 del E.3a E.3 2 0.16 R117H E.4 2 0.16 L558S E.11 2 0.16 A561E E.12 2 0.16 2603delT E.13 2 0.16 Y1092X E.17b 2 0.16 Q1100Pa E.17b 2 0.16 M1101K E.17b 2 0.16 delE.19a E.19 2 0.16 G1244E E.20 2 0.16 P5La E.1 1 0.08 Q30Xa E.2 1 0.08 G85Va E.3 1 0.08 E92Ka E.4 1 0.08 A120Ta E.4 1 0.08 I148T E.4 1 0.08 711+3A→Ta I.5 1 0.08 H199Y E.6a 1 0.08 875+1G→A I.6a 1 0.08 Table 1 (continued) Mutation Exon/intron CF alleles % 1717-1G→A I.10 1 0.08 L571S E.12 1 0.08 T582Ra E.12 1 0.08 E585X E.12 1 0.08 1898+3A→G I.12 1 0.08 G673X E.13 1 0.08 E692Xa E.13 1 0.08 R851X E.14a 1 0.08 R851La E.14a 1 0.08 A1006E E.17a 1 0.08 L1065Ra E.17b 1 0.08 F1074La E.17b 1 0.08 R1158X E.19 1 0.08 3667del4a E.19 1 0.08 3860ins31a E.20 1 0.08 3905insT E.20 1 0.08 4005+1G→A I.20 1 0.08 Q1281Xa E.20 1 0.08 Q1313X E.21 1 0.08 Known mutations (75) 1155 90.23 Unknown mutations 125 9.77 a Mutations discovered by the CF group of the Medical and Molecular Genetics Centre - IRO, Barcelona, Spain that range between 0.5% and 0.9%, representing 6.0% of the CF chromosomes.
X
ABCC7 p.Arg347His 9439669:33:642
status: NEW[hide] Novel and characteristic CFTR mutations in Saudi A... J Med Genet. 1997 Dec;34(12):996-9. el-Harith EA, Dork T, Stuhrmann M, Abu-Srair H, al-Shahri A, Keller KM, Lentze MJ, Schmidtke J
Novel and characteristic CFTR mutations in Saudi Arab children with severe cystic fibrosis.
J Med Genet. 1997 Dec;34(12):996-9., [PMID:9429141]
Abstract [show]
More than 600 different CFTR (cystic fibrosis transmembrane conductance regulator) gene mutations have been identified so far that are considered to cause the fatal genetic disorder cystic fibrosis (CF). We have investigated 15 Arab children from 12 families, who were diagnosed as having CF, for mutations in the coding region and in the flanking intron sequences of the CFTR gene. Six different CFTR mutations were identified including two novel mutations, 1548delG in exon 10 and 406-2A-->G in intron 3. Prominent mutations were the splice mutation 3120 + 1G-->A (intron 16) followed by N1303K (exon 21) and 1548delG (exon 10). Most CF children were homozygotes who presented with a severe form of the disease including failure to thrive, recurrent chest infections, particularly with Pseudomonas aeruginosa, and frequent hospital admissions. Identification of the CFTR mutations facilitates molecular investigation of the disease and better understanding of its pathophysiology in Arab children, among whom CF is probably an underdiagnosed disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
26 Deletions of two or more base pairs were screened for by electrophoresis using a native 12% polyacrylamide gel. The 20 common CFTR mutations that were screened for were AF508, AI507, 1677delTA, R347P, R347H, R553X, G551D, G542X, N1303K, 3849+1OKbC-8'T, R334W, I336K, 2789+5G-A, 1717-1G-A, 3272- 26A- G, Y1092X, 2143delT, W1282X, RI 17H, and the 5T allele.
X
ABCC7 p.Arg347His 9429141:26:201
status: NEW[hide] Cystic fibrosis phenotype associated with pancreat... J Biol Chem. 1997 Nov 28;272(48):30563-6. Fanen P, Labarthe R, Garnier F, Benharouga M, Goossens M, Edelman A
Cystic fibrosis phenotype associated with pancreatic insufficiency does not always reflect the cAMP-dependent chloride conductive pathway defect. Analysis of C225R-CFTR and R1066C-CFTR.
J Biol Chem. 1997 Nov 28;272(48):30563-6., [PMID:9374552]
Abstract [show]
We have previously screened the cystic fibrosis transmembrane conductance regulator (CFTR) gene and identified new disease-causing mutations. C225R and R1066C are both associated with pancreatic insufficiency, but the former mutation is associated with mild and unusual lung disease, whereas the latter is associated with severe lung disease. In the present study, we expressed these mutants heterologously in HeLa cells, and we analyzed protein synthesis by immunoprecipitation and chloride channel function by using a halide-sensitive fluorescent dye, 6-methoxy-N-ethylquinolinium. Immunoprecipitation and functional studies showed that cells transfected with C225R-CFTR exhibit cAMP-dependent chloride fluxes; C225R-CFTR protein is poorly expressed but fully glycosylated and can be compared with R117H-CFTR. R1066C-CFTR protein is not correctly processed and, unlike DeltaF508-CFTR, this defect cannot be corrected by reduced temperature or overexpression in butyrate-treated cells; defective processing may occur at a different step in the biosynthetic pathway. These results point to two different mechanisms underlying the same pancreatic status and suggest that it is unwise to use pancreatic sufficiency and insufficiency to define mild and severe cystic fibrosis (CF) disease, respectively. Finally, the experimental model described here may be helpful to predict the pulmonary status of CF patients bearing mutations located in putative membrane-spanning domains of the CFTR protein.
Comments [show]
None has been submitted yet.
No. Sentence Comment
101 Six CF-associated mutations (P99L, R117H, P205S, R334W, R347P, and R347H) located in putative membrane-spanning domains that have already been analyzed for their functional properties (2-5) were all associated with a mild phenotype (pancreatic sufficiency, PS).
X
ABCC7 p.Arg347His 9374552:101:67
status: NEW[hide] Cystic fibrosis: channel, catalytic, and folding p... J Bioenerg Biomembr. 1997 Oct;29(5):429-42. Seibert FS, Loo TW, Clarke DM, Riordan JR
Cystic fibrosis: channel, catalytic, and folding properties of the CFTR protein.
J Bioenerg Biomembr. 1997 Oct;29(5):429-42., [PMID:9511928]
Abstract [show]
The identification and characterization of the CFTR gene and protein have provided not only a major impetus to the dissection of the molecular pathophysiology of cystic fibrosis (CF) but also a new perspective on the structure and function of the large superfamily of membrane transport proteins to which it belongs. While the mechanism of the active vectorial translocation of many hydrophobic substrates by several of these transporters remains nearly as perplexing as it has for several decades, considerable insight has been gained into the control of the bidirectional permeation of chloride ions through a single CFTR channel by the phosphorylation of the R-domain and ATP interactions at the two nucleotide binding domains. However, details of these catalytic and allosteric mechanisms remain to be elucidated and await the replacement of two-dimensional conceptualizations with three dimensional structure information. Secondary and tertiary structure determination is required both for the understanding of the mechanism of action of the molecule and to enable a more complete appreciation of the misfolding and misprocessing of mutant CFTR molecules. This is the primary cause of the disease in the majority of the patients and hence understanding the details of the cotranslational interactions with multiple molecular chaperones, the ubiquitin-proteasome pathway and other components of the quality control machinery at the endoplasmic reticulum could provide a basis for the development of new therapeutic interventions.
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 If Arg 347 is mutated to His, the anomalous mole fraction behavior can be turned on and off, simply by changing the pH of the bath solutions (the imidazole group of histidineispositively charged at low pH and uncharged at high pH) (Tabcharani et al, 1993).
X
ABCC7 p.Arg347His 9511928:51:3
status: NEW[hide] Permeability of wild-type and mutant cystic fibros... J Gen Physiol. 1997 Oct;110(4):355-64. Linsdell P, Tabcharani JA, Rommens JM, Hou YX, Chang XB, Tsui LC, Riordan JR, Hanrahan JW
Permeability of wild-type and mutant cystic fibrosis transmembrane conductance regulator chloride channels to polyatomic anions.
J Gen Physiol. 1997 Oct;110(4):355-64., [PMID:9379168]
Abstract [show]
Permeability of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel to polyatomic anions of known dimensions was studied in stably transfected Chinese hamster ovary cells by using the patch clamp technique. Biionic reversal potentials measured with external polyatomic anions gave the permeability ratio (P/P) sequence NO > Cl > HCO > formate > acetate. The same selectivity sequence but somewhat higher permeability ratios were obtained when anions were tested from the cytoplasmic side. Pyruvate, propanoate, methane sulfonate, ethane sulfonate, and gluconate were not measurably permeant (P/P < 0.06) from either side of the membrane. The relationship between permeability ratios from the outside and ionic diameters suggests a minimum functional pore diameter of approximately 5.3 A. Permeability ratios also followed a lyotropic sequence, suggesting that permeability is dependent on ionic hydration energies. Site-directed mutagenesis of two adjacent threonines in TM6 to smaller, less polar alanines led to a significant (24%) increase in single channel conductance and elevated permeability to several large anions, suggesting that these residues do not strongly bind permeating anions, but may contribute to the narrowest part of the pore.
Comments [show]
None has been submitted yet.
No. Sentence Comment
13 Some of these low conductance mutations (R334W, R347P, and R347H) occur in cystic fibrosis patients and have been associated with relatively mild disease symptoms.
X
ABCC7 p.Arg347His 9379168:13:59
status: NEW17 Some of these low conductance mutations (R334W, R347P, and R347H) occur in cystic fibrosis patients and have been associated with relatively mild disease symptoms.
X
ABCC7 p.Arg347His 9379168:17:59
status: NEW[hide] Distinct spectrum of CFTR gene mutations in congen... Hum Genet. 1997 Sep;100(3-4):365-77. Dork T, Dworniczak B, Aulehla-Scholz C, Wieczorek D, Bohm I, Mayerova A, Seydewitz HH, Nieschlag E, Meschede D, Horst J, Pander HJ, Sperling H, Ratjen F, Passarge E, Schmidtke J, Stuhrmann M
Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens.
Hum Genet. 1997 Sep;100(3-4):365-77., [PMID:9272157]
Abstract [show]
Congenital absence of the vas deferens (CAVD) is a frequent cause for obstructive azoospermia and accounts for 1%-2% of male infertility. A high incidence of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has recently been reported in males with CAVD. We have investigated a cohort of 106 German patients with congenital bilateral or unilateral absence of the vas deferens for mutations in the coding region, flanking intron regions and promotor sequences of the CFTR gene. Of the CAVD patients, 75% carried CFTR mutations or disease-associated CFTR variants, such as the "5T" allele, on both chromosomes. The distribution of mutation genotypes clearly differed from that observed in cystic fibrosis. None of the CAVD patients was homozygous for delta F508 and none was compound heterozygous for delta F508 and a nonsense or frameshift mutation. Instead, homozygosity was found for a few mild missense or splicing mutations, and the majority of CAVD mutations were missense substitutions. Twenty-one German CAVD patients were compound heterozygous for delta F508 and R117H, which was the most frequent CAVD genotype in our study group. Haplotype analysis indicated a common origin for R117H in our population, whereas another frequent CAVD mutation, viz. the "5T allele" was a recurrent mutation on different intragenic haplotypes and multiple ethnic backgrounds. We identified a total of 46 different mutations and variants, of which 15 mutations have not previously been reported. Thirteen novel missense mutations and one unique amino-acid insertion may be confined to the CAVD phenotype. A few splice or missense variants, such as F508C or 1716 G-->A, are proposed here as possible candidate CAVD mutations with an apparently reduced penetrance. Clinical examination of patients with CFTR mutations on both chromosomes revealed elevated sweat chloride concentrations and discrete symptoms of respiratory disease in a subset of patients. Thus, our collaborative study shows that CAVD without renal malformation is a primary genital form of cystic fibrosis in the vast majority of German patients and links the particular expression of clinical symptoms in CAVD with a distinct subset of CFTR mutation genotypes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
43 This initial screening included the mutations ∆F508, G542X, R553X, G551D, N1303K, 1717-1 G→A, 3272-26 A→G, Y1092X, 2143delT, R347P, R347H, R334W, I336K, R117H, R117C, 2789+5 G→A, 3849+10kB C→T and the "5T" allele, the latter two splice variants being tested according to the instructions of Highsmith et al. (1994) and Chillón et al. (1995).
X
ABCC7 p.Arg347His 9272157:43:153
status: NEW69 Only four other common CF mutations were found in more than one family by this initial screening: 2789+5 G→A on 4 alleles, R347H on 3 alleles, G542X and 3272-26 A→G each on 2 alleles (Table 1).
X
ABCC7 p.Arg347His 9272157:69:130
status: NEW86 The V938G substitution was identified in two unrelated patients, one homozygote with unilateral ab- 368 Table 1A Frequency distribution and haplotypes of CFTR mutations in 106 CAVD patients Mutationa Nucleotide changesb Locationc Frequencyd Haplotypee Referencef 174delA deletion of A at 174 exon 1 1 D3 This study E56K G→A at 298 exon 3 1 B3 This study D58N G→A at 304 exon 3 1 C2 This study D110H G→A at 460 exon 4 2 C2 Dean et al. (1990) R117H G→A at 482 exon 4 24 B6 Dean et al. (1990) A120T G→A at 490 exon 4 1 n.p. Chillón et al. (1994) ̃L138 insertion of CTA after 546 exon 4 1 A2 This study L206W T→G at 749 exon 6a 1 B8 Claustres et al. (1993) M265R T→G at 926 exon 6b 1 A2 Schwarz et al. (pers. comm.) R297W C→T at 1021 exon 7 1 C2 This study 1078delT deletion of T at 1078 exon 7 1 C2 Claustres et al. (1992) R334W C→T at 1132 exon 7 1 B1 Gasparini et al. (1991) R334L G→T at 1133 exon 7 1 D3 This study I336K T→A at 1139 exon 7 1 A2 Cuppens et al. (1993) R347H G→A at 1172 exon 7 3 D1 Cremonesi et al. (1992) L375F A→C at 1257 exon 8 1 B3 Jézéquel et al. (1996) ∆F508 deletion of 3 bp between 1652-1655 exon 10 57 B1 Kerem et al. (1989) G542X G→T at 1756 exon 11 2 B1 Kerem et al. (1990) R553X C→T at 1789 exon 11 1 A4 Cutting et al. (1990) L568F G→T at 1836 exon 12 1 B3 This study 2184insA insertion of A at 2184 exon 13 1 D3 Dörk et al. (1994b) 2789+5 G→A G→A at 2789+5 intron 14b 4 D3 Highsmith et al. (1997) R933S A→T at 2931 exon 15 1 n.p.
X
ABCC7 p.Arg347His 9272157:86:1057
status: NEW137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level.
X
ABCC7 p.Arg347His 9272157:137:706
status: NEWX
ABCC7 p.Arg347His 9272157:137:2195
status: NEW144 Lung function tests indicated initial pulmonary deterioration in a few cases (FEV1 forced expiratory volume in 1 s, given as percent predicted) Subject Age Genotype Height Weight Sweat C1- Symptoms (years) (cm) (kg) (mM) 1 33 ∆F508/R117H 172 75 46 Dyspnoe 2 37 ∆F508/R117H 178 83 31 Nasal polyposis 3 31 ∆F508/R117H 181 91 n.d. Nasal polyposis 4 32 R117H/unknown 164 70 33 Recurrent infections 5 33 ∆F508/E56K 193 100 85 Sinusitis, recurrent bronchitis 6 31 ∆F508/M265R 192 112 59 Recurrent infections, pancreatitis 7 33 ∆F508/R334W 182 78 n.d. Recurrent infections, pneumonia 8 28 ∆F508/R347H n.d. n.d. n.d. Recurrent infections 9 32 ∆F508/F508C 192 98 32 Pneumonia 10 34 ∆F508/Y1032C n.d. n.d. n.d. Recurrent bronchitis 11 33 ∆F508/3272-26 A→G 172 82 125 Recurrent infections, maldigestion, FEVI 73% 12 28 ∆F508/unknown 185 95 n.d.
X
ABCC7 p.Arg347His 9272157:144:637
status: NEW145 Maldigestion 13 25 5T/D58N 184 99 55 - 14 34 5T/̃L138 177 80 53 - 15 33 5T/1078delT 187 87 56 Recurrent bronchitis 16 31 5T/G542X 181 85 79 - 17 31 5T/2184insA n.d. n.d. 60 Borderline pancreatic sufficiency 18 31 5T/D979A n.d. n.d. 55 Recurrent infections, FEVI 76% 19 29 5T/D1152H n.d. n.d. 57 - 20 32 5T/W1282X 180 76 n.d. Recurrent infections, nasal polyposis 21 37 5T/unknown 180 74 n.d. Nasal polyposis 22 28 D110H/D110H 175 80 n.d Asthma bronchiale, obstipation 23 33 R334L/I336K 170 65 n.d. Recurrent infections, nasal polyposis, maldigestion, salt depletion episodes 24 35 N1303K/R347H 167 77 93 - 25 30 V938G/174delA n.d. n.d. 42 - 26 29 V938G/V938G 197 115 n.d. Asthma bronchiale Fig.2 Spectrum of CFTR mutation genotypes in CF patients (left) and in patients with congenital absence of the vas deferens (right).
X
ABCC7 p.Arg347His 9272157:145:594
status: NEW153 A few other genotypes overlapped with those previously observed in some CF adults with mild or very mild disease, e.g. compound heterozygosity for ∆F508 and mutations R334W, R347H, 3272-26 A→G or D1152H.
X
ABCC7 p.Arg347His 9272157:153:181
status: NEW177 Two further CAVD missense mutations, viz. R117H and R347H, have been thoroughly studied in vitro and both were shown to result in a pH-sensitive decrease of chloride conductance (Sheppard et al. 1993; Tabcharani et al. 1993).
X
ABCC7 p.Arg347His 9272157:177:52
status: NEW[hide] Chromosomal findings in 150 couples referred for g... Hum Reprod. 1997 May;12(5):930-7. Mau UA, Backert IT, Kaiser P, Kiesel L
Chromosomal findings in 150 couples referred for genetic counselling prior to intracytoplasmic sperm injection.
Hum Reprod. 1997 May;12(5):930-7., [PMID:9194642]
Abstract [show]
A total of 150 infertile couples underwent chromosome analysis and genetic counselling before intracytoplasmic sperm injection (ICSI). Chromosomal abnormalities, including low-level sex chromosome mosaicism, were detected in 12% of the men and an unexpectedly high 6% of the women. Chromosomal abnormalities included gonosomal mosaicism in 13 cases, Robertsonian translocations in four males, autosomal reciprocal translocations in five cases, reciprocal translocation involving a sex chromosome in one case, inversions in three cases and a marker chromosome in one male. Chromosomal variants found in 11 women and 13 men were not included in the above percentages. Couples with a chromosomal aberration in one partner received a second counselling. The different aspects of genetic counselling in these couples are discussed. In conclusion, we recommend genetic counselling and chromosomal analysis of men and women prior to ICSI therapy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
22 In comparison, the rate of R334W, 3849ϩ10 kb C→T, R117H, R347H and poly-T allelic congenital chromosomal abnormalities in newborns is 0.5% variants in intron 8.
X
ABCC7 p.Arg347His 9194642:22:70
status: NEW62 Results and importance of molecular genetic examinations of cystic fibrosis transmembrane regulator (CFTR) mutations Mutation detection Female Male Clinical findings Remaining risk for Couple number Nationality rate (%)a mutations mutations in the male CF/CBAVD I German 82 -/- dF508/dF508 CBAVD & CF 1:280 II German 82 -/- dF508/R347H CBAVD 1:280 III German 82 dF508/- R117H/- CBAVD 1:4 IV Turkish 32 -/- R117H/- CBAVD 1:150 V Turkish 32 -/- -/- CBAVD 1:5400 VI Italian 63 -/- -/- CBAVD 1:34 300 aThe percentage indicates the frequency of the identified mutations in the reference population, based on the difference in the distribution of CFTR mutations in different populations (according to the frequencies published by the Cystic Fibrosis Genetic Analysis Consortium, 1994).
X
ABCC7 p.Arg347His 9194642:62:330
status: NEW[hide] Locating the anion-selectivity filter of the cysti... J Gen Physiol. 1997 Mar;109(3):289-99. Cheung M, Akabas MH
Locating the anion-selectivity filter of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel.
J Gen Physiol. 1997 Mar;109(3):289-99., [PMID:9089437]
Abstract [show]
The cystic fibrosis transmembrane conductance regulator forms an anion-selective channel; the site and mechanism of charge selectivity is unknown. We previously reported that cysteines substituted, one at a time, for Ile331, Leu333, Arg334, Lys335, Phe337, Ser341, Ile344, Arg347, Thr351, Arg352, and Gln353, in and flanking the sixth membrane-spanning segment (M6), reacted with charged, sulfhydryl-specific, methanethiosulfonate (MTS) reagents. We inferred that these residues are on the water-accessible surface of the protein and may line the ion channel. We have now measured the voltage-dependence of the reaction rates of the MTS reagents with the accessible, engineering cysteines. By comparing the reaction rates of negatively and positively charged MTS reagents with these cysteines, we measured the extent of anion selectivity from the extracellular end of the channel to eight of the accessible residues. We show that the major site determining anion vs. cation selectivity is near the cytoplasmic end of the channel; it favors anions by approximately 25-fold and may involve the residues Arg347 and Arg 352. From the voltage dependence of the reaction rates, we calculated the electrical distance to the accessible residues. For the residues from Leu333 to Ser341 the electrical distance is not significantly different than zero; it is significantly different than zero for the residues Thr351 to Gln353. The maximum electrical distance measured was 0.6 suggesting that the channel extends more cytoplasmically and may include residues flanking the cytoplasmic end of the M6 segment. Furthermore, the electrical distance calculations indicate that R352C is closer to the extracellular end of the channel than either of the adjacent residues. We speculate that the cytoplasmic end of the M6 segment may loop back into the channel narrowing the lumen and thereby forming both the major resistance to current flow and the anion-selectivity filter.
Comments [show]
None has been submitted yet.
No. Sentence Comment
19 Mutation of Arg347 to His resulted in pH-dependent anomalous mole-fraction effects, indicating that the positive charge at this position was important and that Arg347 was at or near one of the anion-binding sites (Tabcharani et al., 1993).
X
ABCC7 p.Arg347His 9089437:19:12
status: NEW[hide] Rapid characterization of the variable length poly... Hum Mutat. 1997;10(2):108-15. Friedman KJ, Heim RA, Knowles MR, Silverman LM
Rapid characterization of the variable length polythymidine tract in the cystic fibrosis (CFTR) gene: association of the 5T allele with selected CFTR mutations and its incidence in atypical sinopulmonary disease.
Hum Mutat. 1997;10(2):108-15., [PMID:9259194]
Abstract [show]
The CFTR intron 8 variable length polythymidine tract modulates the cystic fibrosis (CF) phenotype associated with the mutation R117H. To explore whether other mutations reside on multiple intron 8 backgrounds with discernible impacts on phenotype, we developed an allele-specific PCR assay to characterize this locus. Our approach types samples rapidly without the use or radioisotopes. Polythymidine alleles were identified for mutations either associated with a wide range of clinical phenotypes (R117H, R347P, G85E, D1152H, R334W, 2789 + 5 G > A, 3849 + 10kb C > T), and/or located at hypermutable CpG loci (R117H, 3845 + 10kb C > T, R553X, R334W, S945L and R75Q). R117H was detected in cis with each of three alleles (5T, 7T, 9T) at the intron 8 locus. The novel R117H-9T association was detected in a 10-month African-American male with borderline-to-mildly elevated sweat chloride values (approximately 50-66 mEq/L). All other mutations studied were associated with 7T except 3849 + 10kb C > T, which was detected on both 7T and 9T backgrounds, but not 5T. Three individuals with a delta F508/3849 + 10kb C > T genotype were 9T,9T and had pancreatic sufficiency and normal sweat chloride values, whereas 15 others who carried 3849 + 10kb C > T on a 7T background had variable pancreatic function (sufficient, n = 12, insufficient, n = 3), and variable sweat chloride values (normal, n = 12, elevated, n = 3). Surprisingly, when not associated with known CFTR mutations, 5T was detected with elevated frequency among individuals with sinopulmonary disease of ill-defined etiology, but with some characteristics of variant CF. In summary, the 5T allele was not found in cis with CF-causing mutations besides R117H, but an elevated 5T allele frequency in variant CF patients suggests 5T may be associated with disease in some situations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
29 The mutations R117H, R347H, ∆F508, and 384910kb C>T exist in association with more than one intron 8 allele (Dörk et al., 1994; Chillón et al., 1995), but small numbers of any particular mutation-intron 8 combination make phenotypic conclusions difficult to establish.
X
ABCC7 p.Arg347His 9259194:29:21
status: NEW[hide] cAMP- and Ca2+-independent activation of cystic fi... J Biol Chem. 1996 Jul 5;271(27):16171-9. Becq F, Verrier B, Chang XB, Riordan JR, Hanrahan JW
cAMP- and Ca2+-independent activation of cystic fibrosis transmembrane conductance regulator channels by phenylimidazothiazole drugs.
J Biol Chem. 1996 Jul 5;271(27):16171-9., [PMID:8663098]
Abstract [show]
Patch-clamp, iodide efflux, and biochemical techniques were used to evaluate the ability of phenylimidazothiazoles to open normal and mutated cystic fibrosis transmembrane conductance regulator (CFTR) chloride channels and to investigate the mechanism of activation. As reported previously for bromotetramisole, levamisole activated wild-type CFTR channels stably expressed in Chinese hamster ovary cells in the absence of other secretagogues and without elevating intracellular cAMP or calcium. The protein kinase A (PKA) inhibitor N - (2-(p-bromocinnamylamino)ethyl)-5-isoquinolinesul-fonamid e abolished activation by forskolin but only partially inhibited stimulation by levamisole, suggesting the involvement of other kinases. CFTR channels bearing mutations at multiple phosphorylation sites, in the membrane domains, and in the first nucleotide binding domain (including the disease-causing mutations G551D and DeltaF508) all responded to phenylimidazothiazoles. Moreover, levamisole and bromotetramisole increased the activity of wild-type and mutant channels already exposed to PKA + MgATP, consistent with the inhibition of a constitutive, membrane-associated phosphatase activity. We conclude that phenylimidazothiazole drugs can open normal and mutated CFTR channels by stabilization of phosphoforms of CFTR that are produced by basal activity of PKA and alternative protein kinases. If similar stimulation is observed in humans in vivo, phenylimidazothiazoles may be useful in the development of pharmacological therapies for cystic fibrosis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
153 We also examined a CFTR mutation (R347D) that is at a residue where disease-causing mutations have been identified (R347P and R347H).
X
ABCC7 p.Arg347His 8663098:153:126
status: NEW152 We also examined a CFTR mutation (R347D) that is at a residue where disease-causing mutations have been identified (R347P and R347H).
X
ABCC7 p.Arg347His 8663098:152:126
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... Am J Hum Genet. 1996 Jul;59(1):45-51. Miller PW, Hamosh A, Macek M Jr, Greenberger PA, MacLean J, Walden SM, Slavin RG, Cutting GR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in allergic bronchopulmonary aspergillosis.
Am J Hum Genet. 1996 Jul;59(1):45-51., [PMID:8659542]
Abstract [show]
The etiology of allergic bronchopulmonary aspergillosis (ABPA) is not well understood. A clinical phenotype resembling the pulmonary disease seen in cystic fibrosis (CF) patients can occur in some individuals with ABPA. Reports of familial occurrence of ABPA and increased incidence in CF patients suggest a possible genetic basis for the disease. To test this possibility, the entire coding region of the cystic fibrosis transmembrane regulator (CFTR) gene was analyzed in 11 individuals who met strict criteria for the diagnosis of ABPA and had normal sweat electrolytes (< or = 40 mmol/liter). One patient carried two CF mutations (deltaF508/R347H), and five were found to carry one CF mutation (four deltaF508; one R117H). The frequency of the deltaF508 mutation in patients with ABPA was significantly higher than in 53 Caucasian patients with chronic bronchitis (P < .0003) and the general population (P < .003). These results suggest that CFTR plays an etiologic role in a subset of ABPA patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
7 One patient carried two CF mutations (AF508/R347H), and five were found to carry one CF mutation (four AF508; one R117H).
X
ABCC7 p.Arg347His 8659542:7:44
status: NEW63 DNA samples from ABPA patients were screened for nine additional mutations associated with pancreatic sufficient and atypical CF: R117H (ASO), R347P (NcoI digest) and R347H (HhaI digest), R334W (MspI digest), A455E (ASO and BamHI digest), G551S (ASO) (Strong et al. 1991), 2789+5G-*A (ASO), D1152H (ASO) (Tsui 1992), and 3849+10kbC-*T (ASO and HphI digest) (Highsmith et al. 1994).
X
ABCC7 p.Arg347His 8659542:63:167
status: NEW95 The ABPA patient with a mildly elevated serum IRT (1) was found to be a compound heterozygote for CF mutations, AF508 and R347H.
X
ABCC7 p.Arg347His 8659542:95:122
status: NEW103 Her baseline NPD was -45 mV, which de- 59:45-S1, 1996 Table 2 Demographics and Genotype of ABPA Patients CFTR I.D. Race CF Mutations Polymorphismsa 1 Caucasianb AFS08/R347H 2 Caucasianb -/- M470V, 129G/C 3 Caucasianb AFS08/- ... 4 African-American -/- 5 Caucasian -5-ST, M470V 6 Caucasian &FS08/- R75Q, M470V 7 Caucasian -/- M470V 8 Caucasian R117H-7T/- R75Q 9 Caucasian AFS08/- M470V 10 Caucasian AFS08/- M470V 11 Caucasian -/- ST a The 5 thymidine variant (ST) does not cause CF (Chu et al. 1992) but has been associated with the CBAVD phenotype (Chill6n et al. 1995).
X
ABCC7 p.Arg347His 8659542:103:170
status: NEW[hide] Disease-associated mutations in the fourth cytopla... J Biol Chem. 1996 Jun 21;271(25):15139-45. Seibert FS, Linsdell P, Loo TW, Hanrahan JW, Clarke DM, Riordan JR
Disease-associated mutations in the fourth cytoplasmic loop of cystic fibrosis transmembrane conductance regulator compromise biosynthetic processing and chloride channel activity.
J Biol Chem. 1996 Jun 21;271(25):15139-45., [PMID:8662892]
Abstract [show]
A cluster of 18 point mutations in exon 17b of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has been detected in patients with cystic fibrosis. These mutations cause single amino acid substitutions in the most C-terminal cytoplasmic loop (CL4, residues 1035-1102) of the CFTR chloride channel. Heterologous expression of the mutants showed that 12 produced only core-glycosylated CFTR, which was retained in the endoplasmic reticulum; the other six mutants matured and reached the cell surface. In some cases substitution of one member of pairs of adjacent residues resulted in misprocessing, whereas the other did not. Thus, the secondary structure of CL4 may contribute crucially to the proper folding of the entire CFTR molecule. Cyclic AMP-stimulated iodide efflux was not detected from cells expressing the misprocessed variants but was from the other six, indicating that their mutations cause relatively subtle channel defects. Consistent with this, these latter mutations generally are present in patients who are pancreatic-sufficient, while the processing mutants are mostly from patients who are pancreatic-insufficient. Single-channel patch-clamp analysis demonstrated that the processed mutants had the same ohmic conductance as wild-type CFTR, but a lower open probability, generally due to an increase in channel mean closed time and a reduction in mean open time. This suggests that mutations in CL4 do not affect pore properties of CFTR, but disrupt the mechanism of channel gating.
Comments [show]
None has been submitted yet.
No. Sentence Comment
88 Other disease-causing CFTR mutants, which are appropriately processed and trafficked to the plasma membrane, show defective ion conduction properties (e.g. R334W, R347H, and R347P; Sheppard et al., 1993; Tabcharani et al., 1993) or defective regulation of channel activity (e.g. G551S, G1244E, S1255P, and G1349D; Anderson and Welsh, 1992).
X
ABCC7 p.Arg347His 8662892:88:163
status: NEW95 Other disease-causing CFTR mutants, which are appropriately processed and trafficked to the plasma membrane, show defective ion conduction properties (e.g. R334W, R347H, and R347P; Sheppard et al., 1993; Tabcharani et al., 1993) or defective regulation of channel activity (e.g. G551S, G1244E, S1255P, and G1349D; Anderson and Welsh, 1992).
X
ABCC7 p.Arg347His 8662892:95:163
status: NEW[hide] Identification of cystic fibrosis transmembrane co... Biophys J. 1996 Jun;70(6):2688-95. Cheung M, Akabas MH
Identification of cystic fibrosis transmembrane conductance regulator channel-lining residues in and flanking the M6 membrane-spanning segment.
Biophys J. 1996 Jun;70(6):2688-95., [PMID:8744306]
Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) forms a chloride channel that is regulated by phosphorylation and ATP binding. Work by others suggested that some residues in the sixth transmembrane segment (M6) might be exposed in the channel and play a role in ion conduction and selectivity. To identify the residues in M6 that are exposed in the channel and the secondary structure of M6, we used the substituted cysteine accessibility method. We mutated to cysteine, one at a time, 24 consecutive residues in and flanking the M6 segment and expressed these mutants in Xenopus oocytes. We determined the accessibility of the engineered cysteines to charged, lipophobic, sulfhydryl-specific methanethiosulfonate (MTS) reagents applied extracellularly. The cysteines substituted for Ile331, Leu333, Arg334, Lys335, Phe337, Ser341, Ile344, Arg347, Thr351, Arg352, and Gln353 reacted with the MTS reagents, and we infer that they are exposed on the water-accessible surface of the protein. From the pattern of the exposed residues we infer that the secondary structure of the M6 segment includes both alpha-helical and extended regions. The diameter of the channel from the extracellular end to the level of Gln353 must be at least 6 A to allow the MTS reagents to reach these residues.
Comments [show]
None has been submitted yet.
No. Sentence Comment
26 In the mutant R347H, multiple ion occupancy was dependent on the pH of the intracellular solution, and presumably titration of the histidine altered a nearby anion-binding site (Tabcharani et al., 1993).
X
ABCC7 p.Arg347His 8744306:26:14
status: NEW27 The ability to titrate the histidine in the R347H mutant also suggests that Arg347 is on the water-exposed surface of the channel lining.
X
ABCC7 p.Arg347His 8744306:27:44
status: NEW190 The multiple ion occupancy effects were eliminated by mutation of Arg347 to Asp or His, and the single-channel conductance was reduced (Tabcharani et al., 1993).
X
ABCC7 p.Arg347His 8744306:190:66
status: NEW188 The multiple ion occupancy effects were eliminated by mutation of Arg347 to Asp or His, and the single-channel conductance was reduced (Tabcharani et al., 1993).
X
ABCC7 p.Arg347His 8744306:188:66
status: NEW[hide] Survey of cystic fibrosis transmembrane conductanc... Dig Dis Sci. 1996 Mar;41(3):540-2. McGill JM, Williams DM, Hunt CM
Survey of cystic fibrosis transmembrane conductance regulator genotypes in primary sclerosing cholangitis.
Dig Dis Sci. 1996 Mar;41(3):540-2., [PMID:8617131]
Abstract [show]
A variety of cholestatic liver diseases appear to primarily affect the biliary epithelium, including cystic fibrosis (CF). CF results from a defect in the chloride channel protein, cystic fibrosis transmembrane conductance regulator (CFTR). Although the majority of CF patients have a genomic deletion in deltaF508, other mutations of CFTR may result in less severe clinical presentations and outcomes. Recently, CFTR has been shown to be involved in secretin-stimulated choleresis in intrahepatic bile duct epithelial cells. Cholestasis in cystic fibrosis appears to result from defective chloride transport across the biliary epithelium and is the only cholestatic disease of bile ducts for which a cellular defect has been identified. Primary sclerosing cholangitis (PSC) is a cholestatic disease with histological and cholangiographic features similar to CF. The purpose of this pilot study was to explore whether there is an increased prevalence of CFTR mutations. Two patients exhibited mutations in one allele, yielding a carrier rate of 10.6%, not statistically different from the general U.S. population carrier rate of 4%.
Comments [show]
None has been submitted yet.
No. Sentence Comment
33 In total, 32 mutations were evaluated, which represent 90% of the most common mutations (t4): AF508 G542X G551D W1282X 3905insT NI303K 3849+ 10kbC--~T R553X 621+ IG--*T 1717- IG--,A lt)78delT 2789+5G---~A 3849+4A--~G 711+ IG---oT R1162X 1898+IG----~A R117H 3659delC G85E 2184delA A1507 R347P Y1092X R560T A455E R334W Y122X S549R(T---~G) Q493X V520F $549N R347H Patient Selection.
X
ABCC7 p.Arg347His 8617131:33:355
status: NEW[hide] Haplotype analysis of 94 cystic fibrosis mutations... Hum Mutat. 1996;8(2):149-59. Morral N, Dork T, Llevadot R, Dziadek V, Mercier B, Ferec C, Costes B, Girodon E, Zielenski J, Tsui LC, Tummler B, Estivill X
Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers.
Hum Mutat. 1996;8(2):149-59., [PMID:8844213]
Abstract [show]
We have analyzed 416 normal and 467 chromosomes carrying 94 different cystic fibrosis (CF) mutations with polymorphic genetic markers J44, IVS6aGATT, IVS8CA, T854, IVS17BTA, IVS17BCA, and TUB20. The number of mutations found with each haplotype is proportional to its frequency among normal chromosomes, suggesting that there is no preferential haplotype in which mutations arise and thus excluding possible selection for specific haplotypes. While many common mutations in the worldwide CF population showed absence of haplotype variation, indicating their recent origins, some mutations were associated with more than one haplotype. The most common CF mutations, delta F508, G542X, and N1303K, showed the highest number of slippage events at microsatellites, suggesting that they are the most ancient CF mutations. Recurrence was probably the case for 9 CF mutations (R117H, H199Y, R347YH, R347P, L558S, 2184insA, 3272-26A-->G, R1162X, and 3849 + 10kbC-->T). This analysis of 94 CF mutations should facilitate mutation screening and provides useful data for studies on population genetics of CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
91 Other mutations appeared in varioushaplotypes that were different at both microsatelliteand diallelic markers: R117H, H199Y, R347H, R347P, L558S, 2184insA, 3272-26A+G, R1162X, and 3849+10kbC-T (Table 4).
X
ABCC7 p.Arg347His 8844213:91:125
status: NEW105 CFTR Haplotypes for Diallelic and Multiallelic DNA Markers for 94 CF Mutations" J44-GATT- 8CA-17BTA- No. of T854-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 2-7-1-2 17-47-13 (55.4%) 17-46-13 17-45-13 17-34-13 17-32-13 17-31-14 17-31-13 17-29-14 17-28-13 16-48-13 16-46-14 16-46-13 16-45-13 16-44-13 16-35-13 16-33-13 16-32-13 16-31-14 16-31-13 16-30-13 16-29-13 16-26-13 16-25-13 16-24-13 14-31-13 1-7-2-1 17-7-17 (16.8%) R334W R334W 3860ins31 G1244E R1162X R1162X R1162X G91R MllOlK R347P R334W R117C E92K 3849+lOkbC+T 3293delA 1811+1.6kb A-tG 1811+1.6kb A-tG 2184insA P205S 3659delC G673X 11005R I336K W58S R347P W846X 405+1-A G178R 3905insT R1162X R347H 3100insA E60X 1078delT 4005+1-A K710X 1677delTA H199Y 3601-2AjG 3850-3T+G 3272-26A-tG 3850-1-A 1812-1-A R117H L1059X S492F Y1092X Y569H 3732delA C866Y 711+1G+T 711+1-T G85E 1949del84 2789+5-A H1085R W1282X R1066C 2043delG V456F 2 1 1 1 2 1 6 2 2 1 2 1 1 2 1 1 4 1 1 1 3 2 1 1 1 1 1 1 2 7 1 1 1 1 2 1 1 3 19 3 3 1 1 2 1 1 5 1 1 1 1 3 6 3 5 1 13 2 1 1 - 0.48 0.48 - - - 0.24 - - - 2.65 2.40 1.93 2.65 1.68 2.65 0.72 13.94 13.46 1.93 - 0.72 0.24 3.37 - b b fP fP fP t b,fb.fP h fb t h t h h fP fP b.h b h h b h h h h h fb fb,fP.t fP fP fP9t fP b t fPh b h fb b.fb,h fb*fP b,fP h h t h fb fb,fp,h.t fP fP fb t b.fP,t b,fb,h,t b f b h h fb b,fb.fP,h fP h h Gasparini et al. (1991b) Chilldn et al. (1993a) Devoto et al. (1991) Gasparini et al. (1991b) Dork et al. (1993a) Guillermit et al. (1993) Zielenski et al. (1993) Dean et al. (1990) Dork et al. (1994a) Nunes et al. (1993) Highsmith et al. (1994) Ghanem et al. (1994) Chilldn et al. (1995) Dork et al. (1994a) Dork et al. (1993a) Chilldn et al. (1993b) Kerem et al. (1990) Dork et al. (1994a) Dork et al. (1994a) Cuppenset al. (1993) Fanen et al. (1992) Maggio et al. (personal communication) Audrezet et al. (1993) Vidaud et al. (1990) Dork et al. (1993b) Zielenski et al. (1991a) Chilldn et al. (1994b) Malik et al. (personal communication) Cremonesi et at.
X
ABCC7 p.Arg347His 8844213:105:670
status: NEW106 (1992) Dork et al. (1994a) Malone et al. (personal communication) Claustreset al. (1992) Ferec et al. (1992) Fanen et al. (1992) lvaschenko et al. (1991) T. Dork (personal communication) Dean et al. (1990) Dork et al. (1994a) Ferec et al. (1992) Bozon et al. (1994) Costes et al. (personal communication) Fanen et al. (1992) Audrezet et al. (personal communication) Zielenski et al. (1991a) Zielenski et al. (1991a) Granell et al. (1992) Highsmith et al. (1990) Mercier et al. (1993b) Vidaud et al. (1990) Fanen et al. (1992) Fanen et al. (1992) Dork et al. (1994b) (continued) HAPLOTYPESFOR 94 CF MUTATIONS TABLE2. CFTR HaplotvpesforDiallelic and Multiallelic DNA Markers for 94 CF Mutations"(Continued) ~~ ~ J44-GAIT- 8CA-17BTA- No. of TSU-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 1-6-1-2 (9.1%) 1-6-2-2 (8.9%) 1-7-1-2 (3.4%) 1-7-2-2 (2.6%) 2-7-1-1 (1.2%) 2-7-2-2 (0.7%) 17-7-16 16-7-18 16-7-17 15-7-17 24-31-13 23-52-13 23-34-13 23-33-14 23-33-13 23-32-13 23-31-13 23-30-13 23-21-19 23-18-13 22-35-13 22-31-13 22-30-13 21-31-13 19-33-13 18-45-13 18-37-13 18-35-13 17-57-11 17-55-13 17-55-11 17-54-11 17-53-11 17-52-11 17-51-11 17-33-13 16-46-13 16-45-13 16-44-13 16-42-13 16-35-13 16-30-13 16-30-13 16-7-17 16-21-19 L107% L1077P 24ldelAT L719X A1507 3849+10kbC-T 2184insA 2991de132 G551D 1154insTC V520F R560T 4114ATA+lT 3667de14 435insA Q414X C225R Q39X N1303K R1162X H199Y G542X G542X w1204x R347H G542X AF50gb N1303K 2143delT 3849f 10kbC-T N1303K 681delC R347H A455E N1303K A120T 621+1 h T 574delA 1221delCT F311L R560K R553X R533X R553X Q552X R553X Q552X R116W R553X 1898+5 h T 3272-26A-G 1717-1hA 1342-2A-C A1507 2869insG 2869insG E92X 4374+1 h T 2183AA-G R117H 1609delCA I336K W1063X 1 1 1 1 6 1 3 1 1 22 17 1 1 1 1 1 1 1 1 1 1 1 1 1 17 1 1 4 157 7 1 2 2 1 1 2 2 1 9 1 1 1 1 1 1 6 1 1 1 2 1 3 2 1 3 1 1 1 4 2 4 1 1 - - 10.33 1.45 - - 0.48 1.45 - 0.24 1.45 0.24 - - - - 0.24 0.48 - - - - - - 0.49 0.48 - 0.24 0.24 0.24 - - - - - 0.72 0.24 0.72 - t h fP h b.fb,fP h b,fp.t t h b.fb.fp,h,t b.fb.fp,h,t t t t h b h h fP h fP fb b fP b.fb,fP,h.t fP fb b,fP,t b.fb,fp,h,t b.fb,h h h h,t t fb t b b b.fb.t fP fb fb tb h fP h h t t b h t h b b h h b,fb,h fP.h b h fP fP Bozon et al. (1994) Fanen et al. (1992) Dork et al. (1994a) Kerem et al. (1990) Dork et al. (1994~) Cutting et al. (1990) Kerem et al. (1990) lannuui et d.
X
ABCC7 p.Arg347His 8844213:106:1421
status: NEWX
ABCC7 p.Arg347His 8844213:106:1485
status: NEW136 Other mutations with relative frequency of less than 0.7% are associated with more than one haplotype that should be the result of slippage at one or several microsatellite repeats (R553X, R334W, 1811+1.6kbA-+G, 711 + lG+T, Q552X, 2869insG, L1077P, R347H, and R1162X).
X
ABCC7 p.Arg347His 8844213:136:249
status: NEW138 Nine mutations (R117H, H199Y, R347H, R347P, L558S, 2184insA, 3272-26A+G, R1162X, and 3849+10kbC+T) have been found associated with more than one haplotype for both diallelic and microsatellite markers.
X
ABCC7 p.Arg347His 8844213:138:30
status: NEW141 In addition, fiveof them (R177H, R347H, R347P, R1162X, and 3849+1OkbC-T) have occurredat CpG dinucleotides.Although it is difficult to prove recurrence for these mutations, this has already been postulated for severalCFmu- tations (Reisset al., 1991;Kiesewetteret al., 1993; Dork et al., 1994a; Morral et al., 1994b).
X
ABCC7 p.Arg347His 8844213:141:33
status: NEW[hide] Cystic fibrosis mutation detection by hybridizatio... Hum Mutat. 1996;7(3):244-55. Cronin MT, Fucini RV, Kim SM, Masino RS, Wespi RM, Miyada CG
Cystic fibrosis mutation detection by hybridization to light-generated DNA probe arrays.
Hum Mutat. 1996;7(3):244-55., [PMID:8829658]
Abstract [show]
We have combined photochemistry and photolithography with solid-phase DNA synthesis chemistry to form a new technology that makes high density oligonucleotide probe array synthesis possible. Hybridization to these two-dimensional arrays containing hundreds or thousands of oligonucleotide probes provides a powerful DNA sequence analysis tool. Two types of light-generated DNA probe arrays have been used to test for a variety of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. One array, made up of 428 probes, was designed to scan through the length of CFTR exon 11 and identify differences from the wild type reference sequence. The second type of array contained 1480 probes chosen to detect known deletions, insertions, or base substitution mutations. The validity of the probe arrays was established by hybridizing them with fluorescently labeled control oligonucleotide targets. Characterized mutant CFTR genomic DNA samples were then used to further test probe array hybridization specificity. Finally, ten unknown patient samples were genotyped using the CFTR probe array assay. The genotype assignments were identical to those obtained by PCR product restriction fragment analysis. Our results show that light-generated DNA probe arrays are highly effective in analyzing complex mutation and polymorphism patterns in a relatively large gene such as CFTR.
Comments [show]
None has been submitted yet.
No. Sentence Comment
238 Cystic Fibrosis Mutation-Specific DNA Probe Array" Mutation Exon and column Tested Subarrayhow G85E R117H I148T 621 -+ l(G+T) 711 + 1(G+T) R334W R347H R347P 1078 delT A455E G480C Q493X A1507 F508C AF508 V520F G542X S549R(T-+ G) G551D Q552X R553X A559T R560T 1898 + l(G-,A) 2184 del A 2789 + 5(G+ A) R1066C L1077P Y1092X R1162X 3659 del C 1717-1(& A) 3272 - 26(A+ G) 3 4 4 in 4 in 5 7 7 7 7 9 10 10 10 10 10 10 in 10 11 11 11 11 11 11 11 in 12 13 in 14b in 17a 17b 17b 17b 19 19 * * * * * * * * * * * * * * * * * * * * * * * * * * * * 3849 + lOkb C-, T in 19 9,3 W1282X 20 994 3905insT 20 10.1 * N1303K 21 10,2 * * * "Row and column locations for each of the mutation specific,40 probe sets included in the specialized probe array design.
X
ABCC7 p.Arg347His 8829658:238:145
status: NEW[hide] Mutations in the putative pore-forming domain of C... FEBS Lett. 1995 Nov 6;374(3):312-6. Hipper A, Mall M, Greger R, Kunzelmann K
Mutations in the putative pore-forming domain of CFTR do not change anion selectivity of the cAMP activated Cl- conductance.
FEBS Lett. 1995 Nov 6;374(3):312-6., [PMID:7589561]
Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) apparently forms Cl- channels in apical membranes of secretory epithelial cells. A detailed model describes molecular structure and biophysical properties of CFTR and the impact of various mutations as they occur in cystic fibrosis. In the present report mutations were introduced into the putative 6th alpha-helical transmembrane pore forming domain of CFTR. The mutants were subsequently expressed in Xenopus oocytes by injection of the respective cRNAs. Whole cell (wc) conductances could be reversibly activated by IBMX (1 nmol/l) only in oocytes injected with wild-type (wt) or mutant CFTR but not in oocytes injected with water or antisense CFTR. The activated conductance was partially inhibited by (each 100 mumol/l) DIDS (27%) and glibenclamide (77%), but not by 10 mumol/l NPPB. The following mutations were examined: K335E, R347E, R334E, K335H, R347H, R334H. They did not measurably change the wt-CFTR anion permeability (P) and we conductance (G) sequence of: PCl- > PBr- > P1- and GCl- > GBr- > G1-, respectively. Moreover, anomalous mole fraction behavior for the cAMP activated current could not be detected: neither in wt-CFTR nor in R347E-CFTR. Various mutants for which positively charged amino acids were replaced by histidines (K335H, R347H, R334H) did not show pH sensitivity of the IBMX activated wc conductance. We, therefore, cannot confirm previous results. CFTR might have a different molecular structure than previously suggested or it might act as a regulator of ion conductances.
Comments [show]
None has been submitted yet.
No. Sentence Comment
6 The following mutations were examined: K335E, R347E, R334E, K335H, R347H, R334H.
X
ABCC7 p.Arg347His 7589561:6:67
status: NEW9 Various mutants for which positively charged amino acids were replaced by histidines (K335H, R347H, R334H) did not show pH sensitivity of the IBMX activated wc conductance.
X
ABCC7 p.Arg347His 7589561:9:93
status: NEW32 Synthesis of mutated CFTR-cDNA was induced by annealing of ampicillin repair oligonucleotide and oligonucleotide primers carrying the respective mutation changing positively charged to negatively charged amino acids (R334E, R347E, K335E) or replacing R and K at these positions by histidines (R334H, R347H, K335H).
X
ABCC7 p.Arg347His 7589561:32:300
status: NEW76 I R334EIIR334HI K335E...... I K335H I R347EII R347H l (n=16) n=10) (n=10) (n=24) (n=9) "° ,11 ml I'lnt;"i' ii Illll 111 0.8 X T °., I ~ 0.4 0.2 I o.o ~ ~ ~ 6!~ 6 ~ 8 ~ ,I I ~ ...... ] J I I L ...... ,j I I t 1 I * *J t........ ~,_J L * * I * *I _ J I .......... I I , * * * , (n=18) (n=lO) (n=22) (n=7) 1.o - T T (n=8) (n=14) T / T T T o.eT T T o 1 "~ 0.4-O 0.2- oo_ L__J , i I i t - - I 1 I I I ~ t J L ' t * J I__~ * I [ * * I l * * j l.
X
ABCC7 p.Arg347His 7589561:76:46
status: NEW80 Next, positively charged amino acids R334, R347, K335 located in the putative 6th pore forming transmembrane a-helical domain of CFTR, were exchanged by histidines (R334H, R347H, K335H) or by the negatively charged glutamate (R334E, R347E, K335E).
X
ABCC7 p.Arg347His 7589561:80:172
status: NEW81 Wc conductances were activated significantly by IBMX in all 6 mutants but to variable degrees (AG in/.tS): 3.2 + 0.6 (R334E, n = 20), 2.7 + 0.6 (R334H, n = 13), 7.1 + 0.9 (K335E, n-- 20), 2.8 + 0.7 (K335H, n = 10), 3.2 + 0.04 (R347E, n = 32) and 1.8 + 0.3 (R347H, n = 10).
X
ABCC7 p.Arg347His 7589561:81:257
status: NEW91 Following previous experiments [7] wc C1- conductances were examined in mutants bearing a histidine mutation (K335H, R347H, R334H) at different extracellular pH values.
X
ABCC7 p.Arg347His 7589561:91:117
status: NEW92 However, unlike in the previous study in R347H [7] no significant changes of G could be detected when extracellular pH was G wtCFTR R347E 10 - (n=17) 0.8- _T_ T 0~- ~ ~, ~, 0.4- ~ ~ o.2- ~ 0.0-I # 10 0.8 0.60.40.20.0- (n=14) T .__T_ i:I I L J Fig. 4. Summary of the conductance ratios obtained in wt and R347E-CFTR transfected oocytes stimulated by IBMX when 101 mmol/1 extracellular CI- was replaced by (mmol/1) 94 C1- and 7 SCN- (94/7) and 5 C1- and 96 SCN- (5/96), respectively.
X
ABCC7 p.Arg347His 7589561:92:41
status: NEW94 aL IFEBS Letters 374 (1995) 312-316 - ~ - K335H (n=7) .... ~ .... R347H (n=8) 8 - • R334H (n=5) ...6- I~ ...L 25.5/6 7.5 8/8.5 opH Fig. 5. Summary of the conductances obtained from IBMX stimulated oocytes at different extracellular pH values.
X
ABCC7 p.Arg347His 7589561:94:67
status: NEW95 Experiments were performed with oocytes overexpressing three different CFTR mutants: K335H, R347H, R334H.
X
ABCC7 p.Arg347His 7589561:95:92
status: NEW108 In the present study we repeated some of the published (K335E, R347E, R347H) and performed additional mutations (R334E, R334H, K335H) which are all located in the putative sixth transmembrane domain and overexpressed the respective CFTRs in oocytes.
X
ABCC7 p.Arg347His 7589561:108:70
status: NEW117 Additional mutations were constructed in which positively charged lysine and two arginines in the sixth transmembrane domain were replaced by pH-sensitive histidines (R334H, K335H, R347H).
X
ABCC7 p.Arg347His 7589561:117:181
status: NEW120 In the present study, unlike in the previous one ([7], R347H), we did not find significant differences for the cAMP activated wc conductances at different pH values in all three mutants.
X
ABCC7 p.Arg347His 7589561:120:55
status: NEW[hide] Neonatal screening for cystic fibrosis: result of ... Hum Genet. 1995 Nov;96(5):542-8. Ferec C, Verlingue C, Parent P, Morin JF, Codet JP, Rault G, Dagorne M, Lemoigne A, Journel H, Roussey M, et al.
Neonatal screening for cystic fibrosis: result of a pilot study using both immunoreactive trypsinogen and cystic fibrosis gene mutation analyses.
Hum Genet. 1995 Nov;96(5):542-8., [PMID:8530001]
Abstract [show]
We have evaluated a two-tier neonatal cystic fibrosis (CF) screening of immunoreactive trypsinogen (IRT) followed by CFTR gene mutation analysis using a systematic scanning of exons 7, 10, and 11, and, if necessary, by direct DNA sequencing. Over an 18-month period we screened 32,300 neonates born in the western part of Britanny. The first tier, involving IRT screening at 3 days of age, utilizes a low elevation of the trypsinogen level (600 ng/ml), which is highly sensitive. The second tier, which corresponds to the exhaustive screening for mutations in three exons of the gene, is highly specific for this population (Britanny). The false positive rate is very low, and no false negatives have been reported to date. This strategy has allowed the identification of five novel alleles (V322A, V317A, 1806 del A, R553G, G544S).
Comments [show]
None has been submitted yet.
No. Sentence Comment
80 Identification of novel mutations The systematic screening of exons 7, 10, and I I performed on each positive Guthrie card during this period has led us to identify five new mutations in the CFTR 30 545 % of non AF508 mutations 20 9 1717-1G->A 10 & & i i Esox G91R I 621+1G->T R117H 6b[ 7 905delG 1078 del T R347H 1221 det CT F311L R347L i10 i11i12 13 14a~l !
X
ABCC7 p.Arg347His 8530001:80:309
status: NEW82 {17bi DI507 [ Y569X W846X 2789+5G->A ,' $492F i ] i I G551D 2622+1 G->A Y1092X 1717-1 G->A E827X A1067T G542X 2183 AA->G R1066H R560K 2184 ins A 3320,ins 5 R553G R1070W 1806 del A & 4005+1G->A W1282X ] i "- Exons Fig.2 Distribution of the different mutations (except AF508) of the CFTR gene in Brittany Table 1 Mutations and genotypes in newborns Genotypes of newborns Number Sweat test AF508/AF508 7 + > 90 AF508/1806 del A 1 + > 90 R553G/G551D 1 Borderline (60) AF508/G551D 1 + > 90 AF508/R1070W 1 40 AF508/G542X 1 + > 90 AF508/G149R 1 45 Total 13 Mutations found in heterozygote newborns AF508 31 R560K 1 1078 del T 1 G544S l G542X 1 V317A 1 R347H 1 V322A 1 Total 38 gene.
X
ABCC7 p.Arg347His 8530001:82:645
status: NEW[hide] Correlation of sweat chloride concentration with c... J Pediatr. 1995 Nov;127(5):705-10. Wilschanski M, Zielenski J, Markiewicz D, Tsui LC, Corey M, Levison H, Durie PR
Correlation of sweat chloride concentration with classes of the cystic fibrosis transmembrane conductance regulator gene mutations.
J Pediatr. 1995 Nov;127(5):705-10., [PMID:7472820]
Abstract [show]
OBJECTIVE: To compare differences in epithelial chloride conductance according to class of mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. METHODS: We evaluated the relationship between the functional classes of CFTR mutations and chloride conductance using the first diagnostic sweat chloride concentration in a large cystic fibrosis (CF) population. RESULTS: There was no difference in sweat chloride value value between classes of CFTR mutations that produce no protein (class I), fail to reach the apical membrane because of defective processing (class II), or produce protein that fails to respond to cyclic adenosine monophosphate (class III). Those mutations that produce a cyclic adenosine monophosphate-responsive channel with reduced conductance (class IV) were associated with a significantly lower, intermediate sweat chloride value. However, patients with the mutations that cause reduced synthesis or partially defective processing of normal CFTR (class V) had sweat chloride concentrations similar to those in classes I to III. CONCLUSION: Studies of differences in chloride conductance between functional classes of CFTR mutations provide insight into phenotypic expression of the disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
43 Defined mutations (each mutation cited in references 8, 23, and 24; numerals in parentheses indicate number of patients): Nonsense mutations-----class I: Frameshift mutations---class I: Splice site mutations-class I: Missense mutations---class HI: Missense mutations---class IV: Partially defective processing---class V: Alternative spficing-----classV: R1162X (3), Y1092X (3), G542X (21), Q552X (2), Q493X (2), w1282x (2), E1104X (1), R553X (6), E585X (l), (all PI) 3659delC (5), 2184delA (4), 4010de14 (1), 556delA (1), 3002delG (1) 3905insT (1), 4016insT (3), 1154insTC (l), 441delA (1), 2184insA (2), 1078delT (1), 4326delTC (3) (all PI) I717-1G--~A (4), 621+lG--*T (10), 711+IG--~T (3), 875+1G-+C (2), 3120+IG-~A (1) (18 PI, 2 PS) G551D (25), N1303K (7), R560T (8), I148T (1), G85E (3), A559T (1), L1077P (2), T1234V (1), (47 PI, 1 PS) R117H (10), R347H (3), R347P (1), D614G (1), S1251N (2), (all PS) P574H (2), A455E (2), (all PS) 3272-26A-+G (4), 3849+10KbC---~T (2), 3120G-+A (1), (all PS) analysis, we further grouped the patients according to the molecular consequences conferred by the CFTR alleles.
X
ABCC7 p.Arg347His 7472820:43:853
status: NEW[hide] Screening Young syndrome patients for CFTR mutatio... Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7. Friedman KJ, Teichtahl H, De Kretser DM, Temple-Smith P, Southwick GJ, Silverman LM, Highsmith WE Jr, Boucher RC, Knowles MR
Screening Young syndrome patients for CFTR mutations.
Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7., [PMID:7551394]
Abstract [show]
Young syndrome is characterized by obstructive azoospermia associated with chronic sinobronchial disease of an infectious nature, but normal sweat-gland and pancreatic function as well as normal nasal potential differences. Congenital bilateral absence of the vas deferens (CBAVD) in some patients arises from mutations within the cystic fibrosis (CF) transmembrane regulator (CFTR) gene. Because of some similarities between Young syndrome, CF, and CBAVD, we evaluated 13 patients with Young syndrome, including screening for more than 30 different mutations within the CFTR gene. The mean age of the patients was 43 yr (range, 32 to 50 yr), and all were of northern European extraction. The sweat chloride concentration was normal in all patients (mean = 29 mEq/L; range, 8 to 43 mEq/L). Most had intermittent bronchial and sinus infections, but none was chronically colonized with Staphylococcus aureus or Pseudomonas aeruginosa. The FEV1 was normal or only mildly reduced in most patients (mean = 74%; range, 48 to 100% predicted). Of 26 Young syndrome chromosomes, we identified one with the recognized CF mutation delta F508. The incidence of CFTR mutations (1 in 26) did not differ significantly from the expected carrier frequency in this population. In summary, it is unlikely that the typical Young syndrome patient has a clinical disease associated with CFTR mutation on both alleles.
Comments [show]
None has been submitted yet.
No. Sentence Comment
78 Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No.
X
ABCC7 p.Arg347His 7551394:78:325
status: NEW[hide] Mutations in the cystic fibrosis gene in patients ... N Engl J Med. 1995 Jun 1;332(22):1475-80. Chillon M, Casals T, Mercier B, Bassas L, Lissens W, Silber S, Romey MC, Ruiz-Romero J, Verlingue C, Claustres M, et al.
Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens.
N Engl J Med. 1995 Jun 1;332(22):1475-80., [PMID:7739684]
Abstract [show]
BACKGROUND: Congenital bilateral absence of the vas deferens (CBAVD) is a form of male infertility in which mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene have been identified. The molecular basis of CBAVD is not completely understood. Although patients with cystic fibrosis have mutations in both copies of the CFTR gene, most patients with CBAVD have mutations in only one copy of the gene. METHODS: To investigate CBAVD at the molecular level, we have characterized the mutations in the CFTR gene in 102 patients with this condition. None had clinical manifestations of cystic fibrosis. We also analyzed a DNA variant (the 5T allele) in a noncoding region of CFTR that causes reduced levels of the normal CFTR protein. Parents of patients with cystic fibrosis, patients with types of infertility other than CBAVD, and normal subjects were studied as controls. RESULTS: Nineteen of the 102 patients with CBAVD had mutations in both copies of the CFTR gene, and none of them had the 5T allele. Fifty-four patients had a mutation in one copy of CFTR, and 34 of them (63 percent) had the 5T allele in the other CFTR gene. In 29 patients no CFTR mutations were found, but 7 of them (24 percent) had the 5T allele. In contrast, the frequency of this allele in the general population was about 5 percent. CONCLUSIONS: Most patients with CBAVD have mutations in the CFTR gene. The combination of the 5T allele in one copy of the CFTR gene with a cystic fibrosis mutation in the other copy is the most common cause of CBAVD: The 5T allele mutation has a wide range of clinical presentations, occurring in patients with CBAVD or moderate forms of cystic fibrosis and in fertile men.
Comments [show]
None has been submitted yet.
No. Sentence Comment
74 OF PATIENTS POLYT GENOTYPE† ⌬F508/R668C ⌬F508/D1152H ⌬F508/D1270N ⌬F508/R75L ⌬F508/R117H ⌬;F508/L206W #2c;F508/R258G ⌬F508/S1235R ⌬F508/R347H ⌬F508/R347H R117H/G1349D R117H/712-1G→T G149R/R668C R347H/R1066H R553X/R668C R1070W/2869insG ⌬F508/- G542X/- W1282X/- R334W/- K1060T/- R1162X/- N1303K/- A800G/- ⌬F508/- ⌬F508/- ⌬F508/- ⌬E115/- R117H/- R347H/- G542X/- R553X/- 1677delTA/- 2184delA/- 2789ϩ5G→Α/- S1235R/- W1282X/- -/- -/- -/- -/- 2 2 2 1 1 1 1 1 1 1 1 1 1 1 1 1 22 4 3 1 1 1 1 1 7 1 1 1 1 2 1 1 1 1 1 1 1 3 3 1 19 9T/7T 9T/7T 9T/7T 9T/7T 9T/7T 9T/9T 9T/7T 9T/7T 9T/7T 9T/9T 7T/7T 7T/9T 9T/7T 9T/7T 7T/7T 7T/7T 9T/5T 9T/5T 7T/5T 7T/5T 7T/5T 7T/5T 9T/5T 5T/5T 9T/7T 9T/9T 7T/7T 7T/7T 7T/7T 9T/7T 9T/7T 7T/7T 7T/7T 7T/7T 7T/7T 7T/9T 7T/7T 9T/5T 7T/5T 5T/5T 7T/7T -/- 3 7T/9T *Data were obtained from the Spanish population analyzed in this study.
X
ABCC7 p.Arg347His 7739684:74:138
status: NEWX
ABCC7 p.Arg347His 7739684:74:150
status: NEWX
ABCC7 p.Arg347His 7739684:74:202
status: NEWX
ABCC7 p.Arg347His 7739684:74:221
status: NEWX
ABCC7 p.Arg347His 7739684:74:274
status: NEWX
ABCC7 p.Arg347His 7739684:74:351
status: NEWX
ABCC7 p.Arg347His 7739684:74:458
status: NEW[hide] Is congenital bilateral absence of vas deferens a ... Am J Hum Genet. 1995 Jan;56(1):272-7. Mercier B, Verlingue C, Lissens W, Silber SJ, Novelli G, Bonduelle M, Audrezet MP, Ferec C
Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients.
Am J Hum Genet. 1995 Jan;56(1):272-7., [PMID:7529962]
Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) is an important cause of sterility in men. Although the genetic basis of this condition is still unclear, it has been shown recently that some of these patients carry mutations in their cystic fibrosis transmembrane conductance regulator (CFTR) genes. To extend this observation, we have analyzed the entire coding sequence of the CFTR gene in a cohort of 67 men with CBAVD, who are otherwise healthy. We have identified four novel missense mutations (A800G, G149R, R258G, and E193K). We have shown that 42% of subjects were carriers of one CFTR allele and that 24% are compound heterozygous for CFTR alleles. Thus, we have been unable to identify 76% of these patients as carrying two CFTR mutations. Furthermore, we have described the segregation of CFTR haplotypes in the family of one CBAVD male; in this family are two male siblings, with identical CFTR loci but displaying different phenotypes, one of them being fertile and the other sterile. The data presented in this family, indicating a discordance between the CBAVD phenotype and a marked carrier (delta F508) chromosome, support the involvement of another gene(s), in the etiology of CBAVD.
Comments [show]
None has been submitted yet.
No. Sentence Comment
65 In addition, we identified the following missense mutations: four R668C, one A800G, one (G628R + S1235R, borne on the same chromosome), one (R74W + D1270N, borne on the same chromosome), six R117H, one F1052V, one R117C, one S1235R, one G149R, one R258G, two R347H, one R1066H, one R75L, and one E193K.
X
ABCC7 p.Arg347His 7529962:65:259
status: NEW77 of Patients Genotypea 1 AF508 + (G628R + S1235R) 1 AF508 + (R74W + D1270N) 2 AF508 + R668C 4 AF508 + R117H 1 AF508 + R258G 1 AF508 + R75L 1 E193K + N1303K 1 R347H + R1066H 1 R117C + W1282X 1 R553X + R668C 1 G149R + R668C 1 R117H+R117H 18 AF508/unidentified 4 W1282X/unidentified 1 G542X/unidentified 1 N1303K/unidentified 1 S1235R/unidentified 1 R347H/unidentified 1 A800G/unidentified 1 F1052V/unidentified 23 unidentified/unidentified a In parentheses are the two mutations located on the same haplotype.
X
ABCC7 p.Arg347His 7529962:77:157
status: NEWX
ABCC7 p.Arg347His 7529962:77:346
status: NEW[hide] The CFTR chloride channel of mammalian heart. Annu Rev Physiol. 1995;57:387-416. Gadsby DC, Nagel G, Hwang TC
The CFTR chloride channel of mammalian heart.
Annu Rev Physiol. 1995;57:387-416., [PMID:7539989]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
20 The conclusion that certain residues in M l and M6 line the anion-selective pore is corroborated by three new pieces of evidence: (a) Tabcharani et al (130) found that the charge-switching mutation R347D lowered channel conductance and abolished the anomalous mole-fraction effect seen with mixtures of CI- and SCN- ions, and that channel conductance and anomalous mole-fraction behavior became pH sensitive in the mutant R347H.
X
ABCC7 p.Arg347His 7539989:20:422
status: NEW[hide] Independent origins of cystic fibrosis mutations R... Am J Hum Genet. 1994 Nov;55(5):890-8. Morral N, Llevadot R, Casals T, Gasparini P, Macek M Jr, Dork T, Estivill X
Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene.
Am J Hum Genet. 1994 Nov;55(5):890-8., [PMID:7526685]
Abstract [show]
Microsatellite analysis of chromosomes carrying particular cystic fibrosis mutations has shown different haplotypes in four cases: R334W, R347P, R1162X, and 3849 + 10kbC-->T. To investigate the possibility of recurrence of these mutations, analysis of intra- and extragenic markers flanking these mutations has been performed. Recurrence is the most plausible explanation, as it becomes necessary to postulate either double recombinations or single recombinations in conjunction with slippage at one or more microsatellite loci, to explain the combination of mutations and microsatellites if the mutations arose only once. Also in support of recurrence, mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T involve CpG dinucleotides, which are known to have an increased mutation rate. Although only 15.7% of point mutations in the coding sequence of CFTR have occurred at CpG dinucleotides, approximately half of these CpG sites have mutated at least once. Specific nucleotide positions of the coding region of CFTR, distinct from CpG sequences, also seem to have a higher mutation rate, and so it is possible that the mutations observed are recurrent. G-->A transitions are the most common change found in those positions involved in more than one mutational event in CFTR.
Comments [show]
None has been submitted yet.
No. Sentence Comment
107 1990 G--*-T R117L G. Novelli, personal communication 1171 ......... CT R347C C. Ferec, personal communication 1172 ......... G--A R347H Cremonesi et al. 1992 G I.
X
ABCC7 p.Arg347His 7526685:107:130
status: NEW124 Two other mutations (R347H and R347L) (Cremonesi et al. 1992; Audrezet et al. 1993) have occurred at nucleotide 1172 (G--A and G--T), and another one (R347C) has occurred at nucleotide 1171, which consists of a C-*T transition (C. Ferec, personal communication).
X
ABCC7 p.Arg347His 7526685:124:21
status: NEW144 A collaborative study involving the analysis of 94 mutations in the CFTR gene has shown that mutations R117H, H199Y, R347H, R347P, L558S, 2184insA, R1162X, 3272-26A--G, and 3849+10kbC-)T have arisen more than once in different genetic backgrounds (authors' unpublished data).
X
ABCC7 p.Arg347His 7526685:144:117
status: NEW145 A collaborative study involving the analysis of 94 mutations in the CFTR gene has shown that mutations R117H, H199Y, R347H, R347P, L558S, 2184insA, R1162X, 3272-26A--G, and 3849+10kbC-)T have arisen more than once in different genetic backgrounds (authors' unpublished data).
X
ABCC7 p.Arg347His 7526685:145:117
status: NEW[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]
Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).
Comments [show]
None has been submitted yet.
No. Sentence Comment
82 Four new mutations of the CFTR gene (541delC, R347H, R352Q, E585X) detected by DGGE analysis in Italian CF patients, associated with different clinical phenotypes.
X
ABCC7 p.Arg347His 7525963:82:46
status: NEW[hide] Amino acid residues lining the chloride channel of... J Biol Chem. 1994 May 27;269(21):14865-8. Akabas MH, Kaufmann C, Cook TA, Archdeacon P
Amino acid residues lining the chloride channel of the cystic fibrosis transmembrane conductance regulator.
J Biol Chem. 1994 May 27;269(21):14865-8., [PMID:7515047]
Abstract [show]
The cystic fibrosis transmembrane conductance regulator forms a chloride channel that is regulated by phosphorylation and intracellular ATP levels. The structure of the channel-forming domains is undetermined. To identify the residues lining this channel we substituted cysteine, one at a time, for 9 consecutive residues (91-99) in the M1 membrane-spanning segment. The cysteine substitution mutants were expressed in Xenopus oocytes. We determined the accessibility of the engineered cysteine to charged, sulfhydryl-specific methanethiosulfonate reagents added extracellularly. We assume that, among residues in membrane-spanning segments, only those lining the channel will be accessible to react with these hydrophilic reagents and that such a reaction would irreversibly alter conduction through the channel. Only the cysteines substituted for Gly-91, Lys-95, and Gln-98 were accessible to the reagents. We conclude that these residues are in the channel lining. The periodicity of these residues is consistent with an alpha-helical secondary structure.
Comments [show]
None has been submitted yet.
No. Sentence Comment
18 Mutation of Arg-347 to His resulted in theability to eliminate themultiple ion occupancy effects by changing the pH of the intracellular solution, presumablyby titrating the stateof protonation of the histidine.
X
ABCC7 p.Arg347His 7515047:18:12
status: NEW[hide] Analysis of the whole CFTR coding regions and spli... Hum Genet. 1994 Apr;93(4):467-70. Culard JF, Desgeorges M, Costa P, Laussel M, Razakatzara G, Navratil H, Demaille J, Claustres M
Analysis of the whole CFTR coding regions and splice junctions in azoospermic men with congenital bilateral aplasia of epididymis or vas deferens.
Hum Genet. 1994 Apr;93(4):467-70., [PMID:7513294]
Abstract [show]
Several recent studies have demonstrated the presence of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene in healthy males with infertility caused by congenital absence of the vas deferens (CBAVD), previously recognized as an idiopathic genetic condition distinct from CF. In order to document further the genetic commonality of these two disorders, we undertook a double screening of the entire coding and flanking sequences of the CFTR gene, by using single-strand conformational polymorphism analysis and denaturing gradient gel electrophoresis in 12 unrelated infertile men with abnormalities of the vas deferens and/or epididymis. This strategy allowed us to identify 11 DNA sequence alterations considered as CF-causing mutations and several variations. Despite this double analysis, only two patients out of eight with CBAVD could be demonstrated as compound heterozygotes for CF mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
30 Two CBAVD patients were found to be compound heterozygous for AF508 and the missense mutation R347H (Cremonesi et al. 1992), whereas another was heterozygous for the frameshift mutation 2184delA+A---~G'at 2183 (Bozon et al. CF Consortium).
X
ABCC7 p.Arg347His 7513294:30:94
status: NEW33 CFTR mutations identified in 12 patients lacking an epididymis or vas deferens Patient Age Mutations Exon XV2c/KM19 (years) haplotypesa CBAVD 1 43 Unknown B Unknown A CBAVD 6 33 p AF508/A1067T 10/17b B m Unknown A CBAVD 8 32 p Unknown A m AF508 10 B CBAVD 9 27 p R347H 7 C m AF508 10 B CBAVD 11 31 m Unknown D p 2184delA+A---~G at 2183 13 B CBAVD 12 30 Unknown B Unknown B CBAVD 13 32 p AF508 10 B m Unknown A CBAVD 14 AF508 10 B R347H 7 C CUAVD 4 35 m G542X 11 B p Unknown D CBAE 2 28 Unknown C Unknown D CBAE 7 34 p Unknown B m S1235R 19 A CBAE 10 30 Unknown B Unknown C CBAVD, Congenital bilateral aplasia of the vas deferens; CUAVD, congenital unilateral aplasia of the vas deferens; CBAE, congenital bilateral aplasia of the epididymis; p, paternal chromosome; m, maternal chromosome The four haplotypes defined by the CFTR-linked polymorphic restriction sites XV-2c and KM-19 are as follows: A, 1-1; B, -2; C, 2-1; D, 2-2 (the absence of the restriction site for each polymorphism is defined as allele "1", and the presence of the site as allele "2") Table .
X
ABCC7 p.Arg347His 7513294:33:263
status: NEWX
ABCC7 p.Arg347His 7513294:33:430
status: NEW[hide] Analysis of the CFTR gene confirms the high geneti... Hum Genet. 1994 Apr;93(4):447-51. Chillon M, Casals T, Gimenez J, Ramos MD, Palacio A, Morral N, Estivill X, Nunes V
Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes.
Hum Genet. 1994 Apr;93(4):447-51., [PMID:7513293]
Abstract [show]
We have analysed 972 unrelated Spanish cystic fibrosis patients for 70 known mutations. Analysis was performed on exons 1, 2, 3, 4, 5, 6a, 6b, 7, 10, 11, 12, 13, 14a, 14b, 15, 16, 17b, 18, 19, 20 and 21 of the cystic fibrosis transmembrane regulator gene using single strand conformation polymorphism analysis and denaturing gradient gel electrophoresis. The major mutation delta F508 accounts for 50.6% of CF chromosomes, whereas another 42 mutations account for 27.6% of CF chromosomes, with 21.8% of Spanish CF chromosomes remaining uncharacterized. At present, we have identified 36 mutations that have frequency of less than 1% and that are spread over 15 different exons. This indicates that, in the Spanish population, with the exception of delta F508 (50.6%) and G542X (8%), the mutations are not concentrated in a few exons of the gene nor are there any predominating mutations. This high degree of genetic heterogeneity is mainly a result of the different ethnic groups that have populated Spain and of the maintenance of separated population sets (Basques, Arab-Andalusian, Mediterranean, Canarian and Gallician). The high proportion of CF chromosomes still unidentified (21.8%) together with association analysis with intragenic markers suggest that at least 100 different mutations causing CF are present in our population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
41 A Exon 13 4 0.41 621-1 G--~T Intron 4 3 0.31 P205S Exon 6a 3 0.31 936 del TA Exon 6b 3 0.31 1949 del 84 Exon 13 3 0.31 K710X Exon 13 3 0.31 CF del #1 Exon 4-7/11-18 3 0.31 L206W Exon 6a 2 0.20 R347H Exon 7 2 0.20 Y1092X Exon 17b 2 0.20 Q1100P Exon 17b 2 0.20 Q30X Exon 2 1 0.10 E92K Exon 4 1 0.10 A120T Exon 4 1 0.10 I148T Exon 4 1 0.10 H199Y Exon 6a 1 0.10 1078 del T Exon 7 1 0.10 1717-1 G--+A Intron 10 1 0.10 T582R Exon 12 1 0.10 E585X Exon 12 1 0.10 1898+3 A~---G Intron 12 1 0.10 W1098X Exon 17b 1 0.10 R1158X Exon 19 1 0.10 3667 del 4 Exon 19 1 0.10 3860 ins 31 Exon 20 1 0.10 3905 ins T Exon 20 1 0.10 Unknown 212 21.81 The Basque subset The Basques have a different genetic background with respect to other ethnic groups (Pancorbo et al. 1989) as they are the only pre-Indoeuropean group in Spain.
X
ABCC7 p.Arg347His 7513293:41:193
status: NEW[hide] A novel splice site mutation in the first exon of ... Hum Mol Genet. 1994 Feb;3(2):369-70. Culard JF, Desgeorges M, Romey MC, Malzac P, Demaille J, Claustres M
A novel splice site mutation in the first exon of the cystic fibrosis transmembrane regulator (CFTR) gene identified in a CBAVD patient.
Hum Mol Genet. 1994 Feb;3(2):369-70., [PMID:7516233]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
3 Some of these are compound heterozygotes for AF508 and missense mutations such as R117H or R347H (2-4), which are known to be associated with mild forms of CF.
X
ABCC7 p.Arg347His 7516233:3:91
status: NEW[hide] Exon 9 of the CFTR gene: splice site haplotypes an... Hum Genet. 1994 Jan;93(1):67-73. Dork T, Fislage R, Neumann T, Wulf B, Tummler B
Exon 9 of the CFTR gene: splice site haplotypes and cystic fibrosis mutations.
Hum Genet. 1994 Jan;93(1):67-73., [PMID:7505767]
Abstract [show]
The alternatively spliced exon 9 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene codes for the initial part of the amino-terminal nucleotide-binding fold of CFTR. A unique feature of the acceptor splice site preceding this exon is a variable length polymorphism within the polypyrimidine tract influencing the extent of exon 9 skipping in CFTR mRNA. We investigated this repeat for its relationship to CFTR mutations and intragenic markers on 200 chromosomes from German patients with cystic fibrosis (CF). Four frequent length variations were strongly associated with the four predominant haplotypes previously defined by intragenic marker dimorphisms. One of these alleles displayed absolute linkage disequilibrium to the major CF mutation delta F508. Other frequent CFTR mutations were linked to one particular splice site haplotype indicating that differential exon 9 skipping contributes little to the clinical heterogeneity among CF patients with an identical mutation. We also identified a novel missense mutation (V456F) and a novel nonsense mutation (Q414X) within the coding region of exon 9. The missense mutation V456F adjacent to Walker motif A was present in a pancreas-sufficient CF patient. In contrast, the pancreas-insufficient Q414X/delta F508 compound heterozygote suffered from a severe form of the disease, indicating that alternative splicing of exon 9 does not overcome the deleterious effect of a stop codon with this exon.
Comments [show]
None has been submitted yet.
No. Sentence Comment
146 Nature Genet 3:151-156 Cremonesi L, Ferrari M, Belloni E, Magnani C, Seia M, Ronchetto P, Rady M, Russo MP, Romeo G, Devoto M (1992) Four new mutations of the CFTR gene (541delC, R347H, R352Q, E585X) detected by DGGE analysis in Italian patients, associated with different clinical phenotypes.
X
ABCC7 p.Arg347His 7505767:146:179
status: NEW[hide] Nasal epithelial ion transport and genetic analysi... Hum Mol Genet. 1993 Oct;2(10):1605-9. Osborne LR, Lynch M, Middleton PG, Alton EW, Geddes DM, Pryor JP, Hodson ME, Santis GK
Nasal epithelial ion transport and genetic analysis of infertile men with congenital bilateral absence of the vas deferens.
Hum Mol Genet. 1993 Oct;2(10):1605-9., [PMID:7505692]
Abstract [show]
It has been suggested that congenital bilateral absence of the vas deferens (CBAVD), an important cause of male infertility, is a variant of cystic fibrosis (CF). This study describes a defect in chloride conductance across the nasal epithelium of subjects with CBAVD which is dissimilar to that found in patients with CF. It also demonstrates normal sodium transport across the nasal epithelium in these men, in contrast to patients with CF who exhibit increased sodium absorption. The increased frequency of CFTR mutations in these men implicates the CFTR gene in the pathogenesis of this disorder. Genetic analysis of men with CBAVD who were heterozygous for a known CFTR mutation failed to identify a second mutation within any of the exons or introns of the CFTR gene. These results demonstrate that most men presenting with CBAVD are not compound heterozygotes for mutations within the CFTR gene and can be distinguished from individuals with atypical or asymptomatic CF on the basis of the bioelectric properties of their nasal epithelium. We postulate that mutations in the promoter region or at other regulatory sites of the CFTR gene may be responsible for the CBAVD phenotype in a proportion of cases.
Comments [show]
None has been submitted yet.
No. Sentence Comment
22 Only one subject (genotype AF508/R347H) had a history of upper and lower respiratory symptoms from childhood.
X
ABCC7 p.Arg347His 7505692:22:33
status: NEW25 Nasal potential difference, sweat sodium concentration and CF genotype in subjects with CBAVD, CF patients and controls CF genotype Control cohort CBAVD cohort CF cohort N/N« AF5O8/R347H SM9N/R1070Q AF508/Other R553X/N*> Unknown/Unknowtf AF 5«/AF5O8 AFjQj/Other AF508/R347P AF50e/G542X AFjQg/RllTH AF5O8/G85E AF5Q8/R553X AFJO8/G551D AF5O8A^520F AFJO8/S549N AF^/DIjQ, N1303K/Other G542X/R117H AFJ08/R334W Other/Other Subjects 50 1 1 1 6 1 16 25 18 3 2 1 1 1 2 1 1 1 3 1 1 3 Mean (range) sweat Na+ concentration (mmol/1) 50 (27-78) 88 N/A 94 57 (47-70) 36 49 (32-76) 126(80-162) 99 (80-128) 108 (99-115) 128 (118-137) 95 107 130 122 (116-128) 90 80 118 96 (92-99) 84 123 108(83-130) Mean (range) nasal potential difference (-mV) 21 (8-30) 31 N/A 34 23 (13-29) -15 20 (-13-28) 45 (32-58) 41 (33-61) 50 (36-77) 43 (33-52) 51 42 39 60 (50-71) 32 37 41 38 (36-40) 32 34 44(31-57) N = non-CF chromosome Other = uncharacterised CF chromosome N/A not available • with CF carrier frequency of 1/20-1/25, it is likely that 2 or 3 of these individuals will be carriers.
X
ABCC7 p.Arg347His 7505692:25:186
status: NEW34 One of these was a British Caucasian whose genotype was AFJ08/R347H and the second, a Pakistani Asian, was heterozygous for the S549N and R1070Q mutations (Table 1).
X
ABCC7 p.Arg347His 7505692:34:62
status: NEW58 The 2 subjects with elevated sweat sodium (AF5Og/R347H and AF^/Other) also had elevated nasal PD (Table 1).
X
ABCC7 p.Arg347His 7505692:58:49
status: NEW63 As expected, the two subjects with elevated sweat sodium concentrations and elevated basal nasal PD (AF508/R347H and AF^/Other) had nasal PD responses to amiloride and low chloride solutions that were comparable to those found in patients with CF.
X
ABCC7 p.Arg347His 7505692:63:107
status: NEW[hide] Analysis of the 27 exons and flanking regions of t... Hum Mol Genet. 1993 Aug;2(8):1209-13. Claustres M, Laussel M, Desgeorges M, Giansily M, Culard JF, Razakatsara G, Demaille J
Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France.
Hum Mol Genet. 1993 Aug;2(8):1209-13., [PMID:7691344]
Abstract [show]
In order to characterize the non-delta F508 mutations that account for 36% of cystic fibrosis (CF) chromosomes in Southern France in a sample of 137 patients, we have systematically screened the entire coding region and adjacent sequences of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by the single strand conformation polymorphism (SSCP) technique followed by direct sequencing of the mutant DNAs. We identified 13 novel mutations (9 reported in this paper) and 4 novel rare nucleotide sequence variations. Forty different mutations including delta F508, located in 15 exons, account for only 91.2% of mutants in a population originating from Southern France, in contrast with a recent report on the Celtic population of Brittany demonstrating that 90% of mutations can be detected with only three mutations. We present a very large spectrum of different CF mutations identified in a small geographical area.
Comments [show]
None has been submitted yet.
No. Sentence Comment
26 Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation?
X
ABCC7 p.Arg347His 7691344:26:169
status: NEW[hide] Identification of 12 novel mutations in the CFTR g... Hum Mol Genet. 1993 Jan;2(1):51-4. Audrezet MP, Mercier B, Guillermit H, Quere I, Verlingue C, Rault G, Ferec C
Identification of 12 novel mutations in the CFTR gene.
Hum Mol Genet. 1993 Jan;2(1):51-4., [PMID:7683952]
Abstract [show]
Over 200 mutations, besides the deletion delta F508, have been identified in the CFTR gene and are known to cause CF. In order to characterize the molecular defects of non delta F508 CF chromosomes of various French origin, we have combined the techniques of denaturing gradient gel electrophoresis (DGGE) and direct sequencing to screen for mutations in the whole coding sequence of the CFTR gene corresponding to the 27 exons and their exon-intron boundaries. This approach enabled us to identify 12 novel mutations which are described here. We have systematically tested a large number of other nucleotide changes distributed in the 27 exons, each of them was clearly detected. These data support the notion that the DGGE conditions we have defined for screening coding sequence of the CFTR gene allows the identification of most of, if not all, the CFTR gene mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
40 It appears that codon 347 could be a hot spot for mutations since two other nucleotide changes have been reported at nucleotide 1172 leading to R347P (12) or R347H which is associated with pancreatic sufficiency (Devoto, personal comm.).
X
ABCC7 p.Arg347His 7683952:40:158
status: NEW[hide] Analysis of 31 CFTR mutations in 55 families from ... Early Hum Dev. 2001 Nov;65 Suppl:S161-4. Gomez-Llorente MA, Suarez A, Gomez-Llorente C, Munoz A, Arauzo M, Antunez A, Navarro M, Gil A, Gomez-Capilla JA
Analysis of 31 CFTR mutations in 55 families from the South of Spain.
Early Hum Dev. 2001 Nov;65 Suppl:S161-4., [PMID:11755047]
Abstract [show]
We carried out a molecular analysis of 350 chromosomes from 55 families originating from the South of Spain (Andalucia) who were diagnosed with cystic fibrosis (CF). We used polymerase chain reaction, followed by an oligonucleotide ligation assay (OLA) and sequence-coded separation using capillary electrophoresis. A frequency of 43.5% for DeltaF508 was found, making it the most common CF mutation in our sample. Seven more mutations (G542X, R334W, R1162X, 2789+5G-->A, R117H, DeltaI507 and W1282X) were detected and accounted for 24.7% of the total. The remaining mutations (31.8%) were undetectable with the methodology used in this study.
Comments [show]
None has been submitted yet.
No. Sentence Comment
30 T I.5 R553X E.11 1078delT E.7 R560T E.11 R347P E.7 S549R E.11 R347H E.7 S549N E.11 R334W E.7 3849 + 10kbC !
X
ABCC7 p.Arg347His 11755047:30:62
status: NEW[hide] CFTR gene: molecular analysis in patients from Sou... Mol Genet Metab. 2003 Apr;78(4):259-64. Streit C, Burlamaque-Neto AC, de Abreu e Silva F, Giugliani R, Saraiva Pereira ML
CFTR gene: molecular analysis in patients from South Brazil.
Mol Genet Metab. 2003 Apr;78(4):259-64., [PMID:12706377]
Abstract [show]
Cystic fibrosis (CF) is the most common genetic disease among Caucasians. The CF gene, named cystic fibrosis transmembrane conductance regulator (CFTR), codifies a protein that acts as a channel through the epithelial membrane. The present work aimed (1) to detect sequence alterations in the nucleotide binding regions and at the membrane spanning domain of the CFTR gene and (2) to detect the following frequent mutations R347P, R347H, R334W, and Q359K (located in exon 7), DeltaF508 (located in exon 10), G542X, G551D, R553X, and S549N (located in exon 11), W1282X (located in exon 20), and N1303K (located in exon 21). Seventy-seven unrelated CF patients were analyzed, who were previously diagnosed and currently under treatment at the Pneumology Service of our hospital. Regions of interest were amplified by PCR using specific primers. Each sample was analyzed by a non-radioactive single-stranded conformational polymorphism (SSCP) analysis technique and restriction enzyme digestion. The DeltaF508 mutation was found in 48.7% of the alleles. Frequencies of G542X, R334W, R553X, and W1282X mutations in our population were 3.25, 1.3, 0.65, and 0.65%, respectively. No alleles were found to carry mutations G551D, R334W, R347P, R347H, Q359K, S549N, and N1303K, which were included in the screening protocol. This study allowed the characterization of 84 out of 154 CF mutant alleles (54.5%). The incidence of main CF mutations analyzed was similar to that of the south European population. Mutation data presented here will be useful for designing new DNA testing strategies for CF in South Brazil.
Comments [show]
None has been submitted yet.
No. Sentence Comment
2 The present work aimed (1) to detect sequence alterations in the nucleotide binding regions and at the membrane spanning domain of the CFTR gene and (2) to detect the following frequent mutations R347P, R347H, R334W, and Q359K (located in exon 7), DF508 (located in exon 10), G542X, G551D, R553X, and S549N (located in exon 11), W1282X (located in exon 20), and N1303K (located in exon 21).
X
ABCC7 p.Arg347His 12706377:2:203
status: NEW8 No alleles were found to carry mutations G551D, R334W, R347P, R347H, Q359K, S549N, and N1303K, which were included in the screening protocol.
X
ABCC7 p.Arg347His 12706377:8:62
status: NEW34 The main aims of the present work were (1) to establish the frequency of the DF508 mutation this studied population, (2) to identify alterations in the nucleotide sequence of the exons 3, 5, and 7 which are located in the first membrane spanning domain (MSD1); of exons 9, 10, 11, and 12 which are located in the first nucleotide binding domain (NBD1); of exons 19, 20, 21, and 22 which are located in the second nucleotide binding domain (NBD2) of the CFTR gene, and finally (3) to identify some specific frequent mutations (R347P, R347H, R334W, Q359K, G542X, G551D, R553X, S54 9N, W1282X, and N1303K) in these patients.
X
ABCC7 p.Arg347His 12706377:34:533
status: NEW59 Restriction fragment length polymorphism Mutations R347P, R347H, R334W, Q359K (located in exon 7), G542X, S549N, G551D, R553X mutations (exon 11), W1282X (exon 20), and N1303K (exon 21) were identified by restriction fragment length polymorphism (RFLP) protocol, using specific restriction endonucleases.
X
ABCC7 p.Arg347His 12706377:59:58
status: NEW76 Screening of four additional mutations (G542X, R553X, R334W, and W1282X) together with DF508 Table 2 Mutations detected in 77 CF patients from south region of Brazil Mutation Location Number of alleles Frequency (%) R334W Exon 7 2 1.3 R347P Exon 7 0 0 R347H Exon 7 0 0 Q359K Exon 7 0 0 DF508 Exon 10 75 48.7 S549N Exon 11 0 0 G542X Exon 11 5 3.2 G551D Exon 11 0 0 R553X Exon 11 1 0.7 W1282X Exon 20 1 0.7 N1303K Exon 21 0 0 ?
X
ABCC7 p.Arg347His 12706377:76:252
status: NEW[hide] Diagnosis of cystic fibrosis in adults with diffus... J Cyst Fibros. 2004 Mar;3(1):15-22. Hubert D, Fajac I, Bienvenu T, Desmazes-Dufeu N, Ellaffi M, Dall'ava-Santucci J, Dusser D
Diagnosis of cystic fibrosis in adults with diffuse bronchiectasis.
J Cyst Fibros. 2004 Mar;3(1):15-22., [PMID:15463882]
Abstract [show]
We assessed the contribution of the sweat test, genotyping and nasal potential difference (NPD) in the diagnosis of cystic fibrosis (CF) in adults with diffuse bronchiectasis (DB). Among 601 adults referred for DB from 1992 to 2001, 46 were diagnosed with CF. The sweat test was positive in 37 patients and normal or intermediate in nine patients. Two CF mutations were identified in 18 patients (39%) by screening for 31 mutations and in 36 patients (78%) after complete genetic analysis. NPD was suggestive of CF in 71% of the patients. The combination of the sweat test and genetic analysis led to the diagnosis of CF in 45 patients. In the nine patients with normal or intermediate sweat test, the diagnosis was confirmed by screening for 31 mutations in five, by complete genetic screening in three, and by NPD in the remaining patient. Searching for CF should start with sweat test. If the sweat test is normal or intermediate, screening for 31 mutations may help to diagnose CF. A complete genetic analysis is indicated when only one mutation is detected and/or when other clinical features, such as obstructive azoospermia or pancreatic insufficiency, are suggestive of CF. NPD measurement is indicated in controversial cases.
Comments [show]
None has been submitted yet.
No. Sentence Comment
47 We used an oligonucleotide ligation assay using a commercially available kit (Cystic Fibrosis Assay, Applied Biosystems, Foster City, CA, USA) to seek 31 mutations in the CFTR gene (F508del, I507del, Q943X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA) which allowed to detect 82% of the CF alleles in France.
X
ABCC7 p.Arg347His 15463882:47:410
status: NEW129 * 31 mutations: F508del, I507del, Q493X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q ** 4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA. that the laboratory criteria for the diagnosis of CF should be expanded to include identification of CFTR mutations and abnormal bioelectrical properties of the nasal epithelium, in addition to the sweat test w7x.
X
ABCC7 p.Arg347His 15463882:129:248
status: NEW[hide] A 96-well formatted method for exon and exon/intro... Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5. Lucarelli M, Narzi L, Piergentili R, Ferraguti G, Grandoni F, Quattrucci S, Strom R
A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene.
Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5., [PMID:16635477]
Abstract [show]
Full genotypic characterization of subjects affected by cystic fibrosis (CF) is essential for the definition of the genotype-phenotype correlation as well as for the enhancement of the diagnostic and prognostic value of the genetic investigation. High-sensitivity diagnostic methods, capable of full scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, are needed to enhance the significance of these genetic assays. A method for extensive sequencing of the CFTR gene was optimized. This method was applied to subjects clinically positive for CF and to controls from the general population of central Italy as well as to a single subject heterozygous for a mild mutation and with an uncertain diagnosis. Some points that are crucial for the optimization of the method emerged: a 96-well format, primer project and purification, and amplicon purification. The optimized method displayed a high degree of diagnostic sensitivity; we identified a subset of 13 CFTR mutations that greatly enhanced the diagnostic sensitivity of common methods of mutational analysis. A novel G1244R disease causing mutation, leading to a CF phenotype with pancreatic sufficiency but early onset of pulmonary involvement, was detected in the subject with an uncertain diagnosis. Some discrepancies between our results and previously published CFTR sequence were found.
Comments [show]
None has been submitted yet.
No. Sentence Comment
26 None of these subjects showed any clinical manifestations of CF, nor were any positive for CFTR mutations when analyzed by means of the PCR/OLA/SCS method (Celera Diagnostics) [21], which searches for the most common worldwide 31 CFTR mutations (G85E, R117H, Y122X, 621+1G->T, 711+1G->T, 1078delT, R347P, R347H, R334W, A455E, DF508, DI507, Q493X, V520F, 1717-1G->A, G542X, G551D, R553X, R560T, S549R(T->G), S549N, 1898+1G->A, 2183AA->G, 2789+5G->A, R1162X, 3659delC, 3849+10kbC->T, 3849+4A->G, W1282X, 3905insT, N1303K), including the 12 most common in Italy [1,22].
X
ABCC7 p.Arg347His 16635477:26:305
status: NEW[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]
Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.
Comments [show]
None has been submitted yet.
No. Sentence Comment
78 At least another 38 mutations have been searched for, but none of them were found in the CF patients from Latin America: p.E60X, p.Y122X, p.G178R, p.G330X, p.R347H, p.R352Q, p.S364P, p.A455E, p.Q493X, p.V520F, p.C524X, p.R560T, p.Y563D, p.P574H, p.K710X, p.Q890X, p. R1158X, p.S1196X, p.S1255X, p.D1270N, p.W1310X, p. W1316X, c.405+1G-A, c.444delA, c.556delA, c.574delA, c.1677delTA, c.2043delG, c.2307insA, c.2909delT, c.3120G-A, c.3358delAC, c.3662delA, c.3750delAG, c.3791delC, c.3821delT, c.3849+4A-G, c.3905insT.
X
ABCC7 p.Arg347His 16963320:78:158
status: NEW[hide] Newborn screening for cystic fibrosis in Alberta: ... Paediatr Child Health. 2010 Nov;15(9):590-4. Lilley M, Christian S, Hume S, Scott P, Montgomery M, Semple L, Zuberbuhler P, Tabak J, Bamforth F, Somerville MJ
Newborn screening for cystic fibrosis in Alberta: Two years of experience.
Paediatr Child Health. 2010 Nov;15(9):590-4., [PMID:22043142]
Abstract [show]
On April 1, 2007, Alberta became the first province in Canada to introduce cystic fibrosis (CF) to its newborn screening program. The Alberta protocol involves a two-tier algorithm involving an immunoreactive trypsinogen measurement followed by molecular analysis using a CF panel for 39 mutations. Positive screens are followed up with sweat chloride testing and an assessment by a CF specialist. Of the 99,408 newborns screened in Alberta during the first two years of the program, 221 had a positive CF newborn screen. The program subsequently identified and initiated treatment in 31 newborns with CF. A relatively high frequency of the R117H mutation and the M1101K mutation was noted. The M1101K mutation is common in the Hutterite population. The presence of the R117H mutation has created both counselling and management dilemmas. The ability to offer CF transmembrane regulator full sequencing may help resolve diagnostic dilemmas. Counselling and management challenges are created when mutations are mild or of unknown clinical significance.
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 These include the following mutations: delF508, I507del, G542X, G85E, R117H, 621+1GT, 711+1GT, G551D, R334W, R347P, A455E, 1717-1GA, R560T, R553X, N1303K, 1898+1GA, 2184delA, 2789+5GA, 3120+1GA, R1162X, 3659delC, 3849+10kbCT, W1282X, 1078delT, 394delTT, Y122X, R347H, V520F, A559T, S549N, S549R, 1898+5GT, 2183AAG, 2307insA, Y1092X, M1101K, S1255X, 3876delA and 3905insT.
X
ABCC7 p.Arg347His 22043142:46:310
status: NEW84 TAbLe 1 Mutation frequency Mutation name Number of times detected (247 total mutations) Frequency, % expected, % (reference) delF508* 156 63.2 68.6 (1) R117H* 36 14.6 0.7 (1) G551D* 11 4.5 2.1 (1) 3849+10kbCT* 6 2.4 0.7 (1) M1101K 5 2.0 Undetermined (1) G542X* 4 1.6 2.4 (1) 1717-1GA* 4 1.6 0.7 (1) 621+1GT* 3 1.2 0.9 (1) 3120+1GA* 3 1.2 1.5 (1) G85E* 2 0.8 0.3 (1) A455E* 2 0.8 0.2 (1) R553X* 2 0.8 0.9 (1) 2789+5GA* 2 0.8 0.3 (1) ƊI507* 1 0.4 0.3 (1) 711+1GT* 1 0.4 0.1 (1) R334W* 1 0.4 0.2 (1) N1303K* 1 0.4 1.3 (1) 1898+1GA* 1 0.4 Undetermined (1) 2184delA* 1 0.4 0.1 (1) 394delTT 1 0.4 Undetermined (1) R347H 1 0.4 0.2 (4) V520F 1 0.4 0.2 (4) S549N 1 0.4 0.1 (1) 2307insA 1 0.4 0.2 (1) R347P* 0 0 0.2 (1) R560T* 0 0 0.2 (1) R1162X* 0 0 0.2 (1) 3659delC* 0 0 0.2 (1) W1282X* 0 0 1.4 (1) 1078delT 0 0 0.03 (2) Y122X 0 0 Undetermined (3) A559T 0 0 0.2 (1) S549R 0 0 Undetermined (1) 1898+5GT 0 0 Undetermined (1) 2183AAG 0 0 0.1 (1) Y1092X 0 0 Undetermined (1) S1255X 0 0 0.2 (1) 3876delA 0 0 Undetermined (4) 3905insT 0 0 0.12 (1) *American College of Medical Genetics-recommended mutations TAbLe 2 Positive cystic fibrosis newborn screen summary Screen result Unaffected Affected Further follow-up required Lost to follow-up Total Probable screen 0 23 0 0 23 Inconclusive screen One mutation 179 8 2 2 191 Markedly elevated IRT 2 0 0 0 2 R117H/F508del 0 0 5 0 5 Total 181 31 7 2 221 Data presented as n. IRT Immunoreactive trypsinogen TAbLe 3 F508del/R117H cases ID number Mutation status Sweat test result(s), &#b5;mol/L Other clinical information 24827 F508del/R117H 28 None 23726 F508del/R117H 36/insufficient/20 Fecal elastase normal 22578 F508del/R117H 10 None 24500 F508del/R117H 34/insufficient None 18527 F508del/R117H 29 None 23317 F508del/R117H+5T 47/62 Affected sibling 5T 5 thymine There were 23 newborns with probable screens.
X
ABCC7 p.Arg347His 22043142:84:662
status: NEW[hide] [Emergencies in adult mucoviscidosis patients]. Internist (Berl). 2012 May;53(5):575-84. doi: 10.1007/s00108-012-3019-4. Smaczny C, Born T, Wagner TO
[Emergencies in adult mucoviscidosis patients].
Internist (Berl). 2012 May;53(5):575-84. doi: 10.1007/s00108-012-3019-4., [PMID:22527665]
Abstract [show]
Cystic fibrosis is an inherited autosomal recessive metabolic disease caused by mutations on the CFTR gene. This leads to defective chloride channels on epithelial cell membranes and causes various disorders of the respiratory, gastrointestinal, and urogenital tracts.As a result, all exocrine glands produce a viscous secretion, leading to pulmonary symptoms such as chronic cough, secretion retention, recurring infections as well as bronchiectasis and obstructive lung emphysema. Gastrointestinal effects include exocrine and often also endocrine pancreatic insufficiency with chronic diarrhea and maldigestion syndrome as well as pancreoprivic diabetes mellitus; biliary cirrhosis occurs in 10% of cases. Additional effects include reduced fertility in women and infertility in men.Life-threatening complications include bleeding from the bronchial arteries, pneumothorax, and distal intestinal obstruction syndrome (DIOS), previously known as meconium ileus equivalent. Treatment requires rapid diagnosis and should be carried out in experienced centres, since the mortality rate can otherwise be up to 50%.
Comments [show]
None has been submitted yet.
No. Sentence Comment
19 Bei Neugeborenen kommt es typischerweise zu einem Tab. 1ߓ Typische Mutationen bei der Mukoviszidose Mutationsklasse Defektbeschreibung Beispiele (alte Nomenklatur) I Vollst&#e4;ndigerVerlust der CFTR-Protein- synthese R553X, G542X, N1303K, Êf; 1717-1 G &#e1;ߙ A II St&#f6;rung der Reifung und des intrazellul&#e4;- renTransports des CFTR-Proteins DF508 III Regulationsst&#f6;rung des Ionenkanals G551D IV St&#f6;rung der Ionenleitf&#e4;higkeit des CFTR-Kanals R347H, R117H V Verminderte CFTR-Konzentration in der Zelle 3849+10kBÊf;C &#e1;ߙ T VI Beschleunigter CFTR-Abbau ߕ CFTRÉe;Cystic fibrosis transmembrane conductance regulator".
X
ABCC7 p.Arg347His 22527665:19:476
status: NEW[hide] Two salt bridges differentially contribute to the ... J Biol Chem. 2013 Jul 12;288(28):20758-67. doi: 10.1074/jbc.M113.476226. Epub 2013 May 24. Cui G, Freeman CS, Knotts T, Prince CZ, Kuang C, McCarty NA
Two salt bridges differentially contribute to the maintenance of cystic fibrosis transmembrane conductance regulator (CFTR) channel function.
J Biol Chem. 2013 Jul 12;288(28):20758-67. doi: 10.1074/jbc.M113.476226. Epub 2013 May 24., [PMID:23709221]
Abstract [show]
Previous studies have identified two salt bridges in human CFTR chloride ion channels, Arg(352)-Asp(993) and Arg(347)-Asp(924), that are required for normal channel function. In the present study, we determined how the two salt bridges cooperate to maintain the open pore architecture of CFTR. Our data suggest that Arg(347) not only interacts with Asp(924) but also interacts with Asp(993). The tripartite interaction Arg(347)-Asp(924)-Asp(993) mainly contributes to maintaining a stable s2 open subconductance state. The Arg(352)-Asp(993) salt bridge, in contrast, is involved in stabilizing both the s2 and full (f) open conductance states, with the main contribution being to the f state. The s1 subconductance state does not require either salt bridge. In confirmation of the role of Arg(352) and Asp(993), channels bearing cysteines at these sites could be latched into a full open state using the bifunctional cross-linker 1,2-ethanediyl bismethanethiosulfonate, but only when applied in the open state. Channels remained latched open even after washout of ATP. The results suggest that these interacting residues contribute differently to stabilizing the open pore in different phases of the gating cycle.
Comments [show]
None has been submitted yet.
No. Sentence Comment
21 However, subconductance states are dominant events with short burst durations in CFTR channels bearing known salt bridge mutations, such as R352A, R347H, D993R, and D924R (13, 14).
X
ABCC7 p.Arg347His 23709221:21:147
status: NEW[hide] Newborn screening for cystic fibrosis in Switzerla... J Cyst Fibros. 2013 Dec;12(6):667-74. doi: 10.1016/j.jcf.2013.04.008. Epub 2013 May 24. Torresani T, Fingerhut R, Rueegg CS, Gallati S, Kuehni CE, Baumgartner MR, Barben J
Newborn screening for cystic fibrosis in Switzerland--consequences after analysis of a 4 months pilot study.
J Cyst Fibros. 2013 Dec;12(6):667-74. doi: 10.1016/j.jcf.2013.04.008. Epub 2013 May 24., [PMID:23712087]
Abstract [show]
BACKGROUND: Switzerland introduced newborn screening (NBS) for CF in 2011, using an IRT/DNA/IRT protocol. This paper describes the results of the first year and compares two versions of the protocol with different IRT cut-offs, particularly effects on recall rate, sensitivity and specificity. METHODS: IRT cut-offs were >45 ng/ml (99.0th percentile) in period 1 (months 1-4) and >50 ng/ml (99.2nd percentile) in period 2 (months 5-12). In period 2 we abstained from recalls when none of the 7 most common CF mutations were detected and IRT was <60 ng/ml. RESULTS: In periods 1 and 2, 26,535 and 56,663 tests were performed. Recall rates were 0.94% and 0.48%, respectively (p<0.001), PPV increased from 23% to 47% (p=0.024) and sensitivity was 90% and 100%. CONCLUSIONS: Raising initial IRT cut-off from the 99.0th to the 99.2nd percentile and abstaining from recalls for children with an IRT<60 ng/ml and carrying no major CFTR mutation significantly reduced the recall rate without affecting sensitivity.
Comments [show]
None has been submitted yet.
No. Sentence Comment
105 Case no GA (weeks) Weight at birth (g) 1st IRT (4th day of life) (ng/ml) 2nd IRT (repeat heel prick) (ng/ml) a CFTR mutation screening SWISS PANEL in NBS laboratory b CFTR mutation screening LUMINEX in NBS laboratory b CFTR mutation diagnosis in genetic reference laboratory c Sweat chloride macroduct method (mmol/l) d Sweat conductivity nanoduct method (mmol/l) d Pancreas function faecal elastase (ng) e Diagnosis 1 39 2980 183.0 F508del/- F508del/- F508del/420del9 97 113 45 CF 4 39 3290 150.2 F508del/F508del F508del/F508del F508del/F508del - 129 23 CF 11 37 3400 270.0 F508del/- F508del/- F508del/2347delG 105 98 b15 CF 14 40 3655 114.4 F508del/F508del F508del/F508del F508del/F508del - 116 37 CF 21 37 3280 119.5 F508del/F508del F508del/F508del F508del/F508del ND ND b15 CF with MI 23 f 38 2900 76.9 F508del/F508del F508del/F508del F508del/F508del ND ND b15 CF 35 37 2930 134.8 F508del/- F508del/621+1GNT F508del/621+1GNT 110 139 b15 CF 40 37 2980 39.5 41.8 F508del/F508del F508del/F508del F508del/F508del - 97 b15 CF with MI 12 41 3810 65.9 -/- R347P/- R347P/4006-46del5 h 38 37 ND i Equivocal CF 20 g 38 2720 63.0 122.9 -/- -/- T5/T1086A h 35 - 382 Equivocal CF 2 41 3250 50.1 F508del/- F508del/- - 39 No CF 10 38 2590 51.3 F508del/- F508del/- 14 47 No CF 13 39 3330 68.8 F508del/- F508del/- 11 36 No CF 17 39 2670 64.1 1717-1GNA/- 1717-1GNA/- 20 15 No CF 18 40 3360 58.9 3905insT/- 3905insT/- 13 36 No CF 22 38 2970 51.3 F508del/- F508del/- - 27 No CF 24 36 2790 49.1 F508del/- F508del/- 10 48 No CF 27 40 3420 60.7 F508del/- F508del/- 6 23 No CF 31 40 4400 55.5 F508del/- F508del/- 14 29 No CF 32 41 4460 89.5 F508del/- F508del/- 14 33 No CF 33 40 3700 130.6 F508del/- F508del/- ND 36 No CF 34 40 3005 65.4 N1303K/- N1303K/- 24 37 No CF 36 39 2780 61.5 F508del/- F508del/- F508del/- d ND - No CF 15 40 3310 49.3 -/- R347H/- 10 39 No CF 16 37 3240 56.0 -/- R347H/- 18 54 No CF 29 34 1870 126.5 -/- 2184delA/- 2184delA/- - - No CF 3 41 3860 46.2 72.6 -/- -/- 13 44 No CF 5 37 2840 60.1 61.0 -/- -/- - 51/34 No CF 6 40 3030 56.6 56.2 -/- -/- 16 34 No CF 7 37 3130 49.0 43.6 -/- -/- 6 18 No CF 8 39 4320 48.7 94.9 -/- -/- 13 27 No CF 9 37 2050 127.9 52.3 -/- -/- 28 28 No CF 19 38 3570 68.1 54.5 -/- -/- 6 45 No CF 25 35 2300 61.5 50.2 -/- -/- 12 37 No CF 26 40 2780 58.2 59.8 -/- -/- 10 48 No CF 28 40 3430 56.5 53.4 -/- -/- 13 31 No CF 30 37 2930 54.2 65.6 -/- -/- - 32 No CF 37 40 3615 65.9 191.4 -/- -/- ND 51 No CF 38 41 4350 56.2 65.1 -/- -/- ND 41 No CF 39 42 2900 51.6 68.5 -/- -/- 20 - No CF nine, CF diagnosis was confirmed either by a positive sweat test and/or two CFTR mutations (PPV = 23.1%; Table 1).
X
ABCC7 p.Arg347His 23712087:105:1827
status: NEWX
ABCC7 p.Arg347His 23712087:105:1867
status: NEW[hide] Clinical and genetic features in patients with cys... Iran J Pediatr. 2013 Apr;23(2):212-5. Farjadian S, Moghtaderi M, Kashef S, Alyasin S, Najib K, Saki F
Clinical and genetic features in patients with cystic fibrosis in southwestern iran.
Iran J Pediatr. 2013 Apr;23(2):212-5., [PMID:23724185]
Abstract [show]
OBJECTIVE: Cystic fibrosis (CF) is a common autosomal recessive genetic disease caused by a mutation in the CF transmembrane conductance regulatory (CFTR) gene. This study attempted to identify the most common CFTR mutations and any correlations between certain mutations and the clinical presentation of the disease in CF patients in southwestern Iran. METHODS: Twenty nine common CFTR gene mutations were examined in 45 CF patients. FINDINGS: Chronic cough, intestinal obstruction, dehydration, heat exhaustion and steatorrhea were the most common early clinical symptoms among our patients. The most common mutation was DeltaF508, with an allele frequency of 21%. The homozygous DeltaF508 mutation was observed in eight patients (18%), and three patients (7%) were DeltaF508 carriers. The 2183AA > G mutation was observed in four patients, one of whom was also a DeltaF508 carrier. The R1162X mutation was detected in two patients. The G542X, R334W and N1303K mutations were detected each in one patient, the first of whom was also a DeltaF508 carrier. CONCLUSION: Out of 45 patients, 27 (60%) had none of the CFTR gene mutations we tested for. The most frequent mutations in southwestern Iranian patients with CF should be identified by sequencing the entire CFTR gene in order to optimize the design of a diagnostic kit for common regional mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
82 Jalalirad M, Houshmand M, Mirfakhraie R, et al. First study of CF mutations in the CFTR gene of Iranian patients: detection of DeltaF508, G542X, W1282X, A120T, R117H, and R347H mutations.
X
ABCC7 p.Arg347His 23724185:82:171
status: NEW[hide] A comprehensive assay for CFTR mutational analysis... Clin Chem. 2013 Oct;59(10):1481-8. doi: 10.1373/clinchem.2013.206466. Epub 2013 Jun 17. Abou Tayoun AN, Tunkey CD, Pugh TJ, Ross T, Shah M, Lee CC, Harkins TT, Wells WA, Tafe LJ, Amos CI, Tsongalis GJ
A comprehensive assay for CFTR mutational analysis using next-generation sequencing.
Clin Chem. 2013 Oct;59(10):1481-8. doi: 10.1373/clinchem.2013.206466. Epub 2013 Jun 17., [PMID:23775370]
Abstract [show]
BACKGROUND: Cystic fibrosis is a life-threatening genetic disorder that has been associated with mutations in the CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] gene. Hundreds of CFTR mutations have been detected to date. Current CFTR genotyping assays target a subset of these mutations, particularly a mutation panel recommended by the American College of Medical Genetics for carrier screening of the general population. Fast sequencing of the entire coding sequence in a scalable manner could expand the detection of CFTR mutations and facilitate management of costs and turnaround times in the clinical laboratory. METHODS: We describe a proof-of-concept CFTR assay that uses PCR target enrichment and next-generation sequencing on the Ion Torrent Personal Genome Machine (PGM) platform. RESULTS: The scalability of the assay was demonstrated, with an average mean depth of coverage ranging from 500x to 3500x, depending on the number of multiplexed patient samples and the Ion Torrent chip used. In a blinded study of 79 previously genotyped patient DNA samples and cell lines, our assay detected most of the mutations, including single-nucleotide variants, small insertions and deletions, and large copy-number variants. The reproducibility was 100% for detecting mutations in independent runs. Our assay demonstrated high specificity, with only 2 false-positive calls (at 2184delA) found in 2 samples caused by a sequencing error in a homopolymer stretch of sequence. The detection rate for variants of unknown significance was very low in the targeted region. CONCLUSIONS: With continued optimization and system refinements, PGM sequencing promises to be a powerful, rapid, and scalable means of clinical diagnostic sequencing.
Comments [show]
None has been submitted yet.
No. Sentence Comment
53 of cases af9;/af9; c.1521_1523delCTT; c.1521_1523delCTT èc;F508; èc;F508 CF Yes 97 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.350Gb0e;A èc;F508; R117H CF Yes 53; 50 Dartmouth 1 af9;/af9; c.350Gb0e;A; c.1477Cb0e;T R117H; Q493*b CF Yes 52; 49 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.1000Cb0e;T èc;F508; R334W CF Yes 49; 54 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.489af9;1Gb0e;T èc;F508; 621af9;1Gb0e;T CF Yes 48; 47 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.1364Cb0e;A èc;F508; A455E CF Yes 51; 46 Dartmouth 1 af9;/af9; c.489af9;1Gb0e;T; c.2988af9;1Gb0e;A 621af9;1Gb0e;T; 3120af9;1Gb0e;A CF Yes 48; 49 Coriell 1 af9;/af9; c.1521_1523delCTT; c.1657Cb0e;T èc;F508; R553* CF Yes 44; 49c Coriell 2 af9;/af9; c.1521_1523delCTT; c.3528delC èc;F508; 3659delC CF Yes 46; 46 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.579af9;1Gb0e;T 621af9;1Gb0e;T; 711af9;1Gb0e;T CF Yes 50; 51 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.254Gb0e;A 621af9;1Gb0e;T; G85E CF Yes 50; 45 Coriell 1 af9;/af9; c.1521_1523delCTT; c.1679Gb0e;C èc;F508; R560T CF Yes 44; 52 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.1364Cb0e;A 621af9;1Gb0e;T; A455E CF Yes 50; 49 Coriell 1 af9;/af9; c.3909Cb0e;G; c.4046Gb0e;A N1303K; G1349D CF Yes 47; 52 Coriell 1 af9;/af9; c.2657af9;5Gb0e;A; c.2657af9;5Gb0e;A 2789af9;5Gb0e;A; 2789af9;5Gb0e;A CF Yes 100 Coriell 1 af9;/af9; c.1040Gb0e;C; c.1652Gb0e;A R347P; G551D CF Yes 51; 49 Coriell 1 af9;/af9; c.1000Cb0e;T; c.3368-2Ab0e;T R334W; 3500-2Ab0e;G CF Yes 53; 45 Coriell 1 af9;/af9; c.254Gb0e;A; c.3454Gb0e;C G85E; D1152H CF Yes 44; 47 Coriell 1 af9;/af9; c.1521_1523delCTT; c.350Gb0e;A èc;F508; R117H CF Yes 49; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.54-5940_273af9;10250del21kb èc;F508; CFTRdel2,3 CF Yes 47; N/Ad Coriell 1 af9;/af9; c.1521_1523delCTT; c.1766af9;1Gb0e;A èc;F508; 1898af9;1Gb0e;A CF Yes 47; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.2051_2052delAAinsG èc;F508; K684Sfs CF Yes 47; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.2052del èc;F508; K684Nfs*38 CF Yes 51; 55 Coriell 1 af9;/afa; c.1521_1523delCTT èc;F508 Carrier Yes 50c Dartmouth 16 af9;/afa; c.1652Gb0e;A G551D Carrier Yes 50c Dartmouth 5 af9;/afa; c.1519_1521delATC èc;I507 Carrier Yes 46 Dartmouth 1 af9;/afa; c.3454Gb0e;C D1152H Carrier Yes 50 Dartmouth 1 af9;/afa; c.1657Cb0e;T R553* Carrier Yes 51 Dartmouth 1 af9;/afa; c.178Gb0e;T E60* Carrier Yes 51 Dartmouth 1 af9;/afa; c.3846Gb0e;A W1282* Carrier Yes 45c Dartmouth 3 af9;/afa; c.1000Cb0e;T R334W Carrier Yes 51 Dartmouth 1 af9;/afa; c.1624Gb0e;T G542* Carrier Yes 47c Dartmouth 4 af9;/afa; c.3484Cb0e;T R1162* Carrier Yes 43 Dartmouth 1 af9;/afa; c.1766af9;1Gb0e;A 1898af9;1Gb0e;A Carrier Yes 57 Dartmouth 1 af9;/afa; c.3773_3774insT 3905insT (L1258Ffs*7) Carrier Yes 37 Dartmouth 1 af9;/afa; c.350Gb0e;A R117H Carrier Yes 50c Dartmouth 3 af9;/afa; c.1645Ab0e;C S549R Ab0e;C Carrier No N/A Dartmouth 1 af9;/afa; c.1040Gb0e;A R347H Carrier Yes 47 Dartmouth 1 af9;/afa; c.3909Cb0e;G N1303K Carrier Yes 46 Dartmouth 1 af9;/afa; c.3718-2477Cb0e;T 3849af9;10kbCb0e;T Carrier Yes 51 Coriell 1 af9;/afa; c.2988af9;1Gb0e;A 3120af9;1Gb0e;A Carrier Yes 49 Coriell 1 af9;/afa; c.489af9;1Gb0e;T 621af9;1Gb0e;T Carrier Yes 50 Coriell 1 af9;/afa; c.1585-1Gb0e;A 1717-1Gb0e;A Carrier Yes 51 Coriell 1 afa;/afa;e N/Af N/A Normal N/A N/A Dartmouth 9 a af9;/af9;, 2 pathogenic mutations; af9;/afa;, carrier of a single pathogenic mutation; afa;/afa;, absence of any pathogenic mutations.
X
ABCC7 p.Arg347His 23775370:53:3384
status: NEW[hide] Genetic testing of sperm donors for cystic fibrosi... Eur J Obstet Gynecol Reprod Biol. 2013 Sep;170(1):183-7. doi: 10.1016/j.ejogrb.2013.06.022. Epub 2013 Jul 15. Landaburu I, Gonzalvo MC, Clavero A, Ramirez JP, Yoldi A, Mozas J, Zamora S, Martinez L, Castilla JA
Genetic testing of sperm donors for cystic fibrosis and spinal muscular atrophy: evaluation of clinical utility.
Eur J Obstet Gynecol Reprod Biol. 2013 Sep;170(1):183-7. doi: 10.1016/j.ejogrb.2013.06.022. Epub 2013 Jul 15., [PMID:23866907]
Abstract [show]
OBJECTIVE: To evaluate the clinical utility of genetic testing for cystic fibrosis (CF) and spinal muscular atrophy (SMA) in sperm donors. STUDY DESIGN: We studied the results of the genetic tests for CF and SMA applied to 372 sperm donor candidates. The CF carrier screening test analysed 32 mutations on the CFTR gene. Regarding SMA, the carrier test studied possible deletions of SMN1/2 by Multiplex Ligation-dependent Probe Amplification (MLPA) methodology. RESULTS: The carrier frequency obtained was greater for SMA than for CF. After adjusting the results obtained for the sensitivity of the tests, and taking into account the prevalence of female carriers in our population, the probability of transmission of the disease to the child from a donor with a negative genetic test was about five times lower in the case of SMA than in CF, although this difference was not statistically significant. The number of donors needed to screen (NNS) to avoid the occurrence of a child being affected by CF and SMA in our population was similar in both cases (1591 vs. 1536). CONCLUSIONS: This study demonstrates the need to include SMA among the diseases for which genetic screening is performed in the process of sperm donor selection. We believe that testing donors for SMA is as important and as useful as doing so for CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 The panel of mutations studied was: S549N, S549R, R553X, G551D, V520F, I507del, F508del, 3876delA, 1717-1G->A, G542X, R560T, 3120+1G->A, A455E, R117H, 394delTT, 2183AA- >G, 2184delA, 2789+5G->A, 1898+1G->A, 621+1G->T, 711+1G- >T, G85E, R347P, R347H, W1282X, R334W, 1078delT, 3849+10kbC->T, R1162X, N1303K, 3659delC, 3905insT.
X
ABCC7 p.Arg347His 23866907:51:243
status: NEW[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]
Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.
Comments [show]
None has been submitted yet.
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1.
X
ABCC7 p.Arg347His 23891399:44:99
status: NEW64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations.
X
ABCC7 p.Arg347His 23891399:64:1929
status: NEW74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2.
X
ABCC7 p.Arg347His 23891399:74:410
status: NEWX
ABCC7 p.Arg347His 23891399:74:903
status: NEW82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org).
X
ABCC7 p.Arg347His 23891399:82:2346
status: NEW87 Similarly, the baseline chloride transport and ivacaftor response were higher for mutant CFTR forms with mild defects in channel conductance (30-84% of normal; D110H-, R347H, and R352Q-CFTR) [17-19], compared with those with severe defects in CFTR channel conductance (undetectable R334W- and T338I-CFTR) [9,20].
X
ABCC7 p.Arg347His 23891399:87:168
status: NEW91 This suggests that the R117H mutation may be associated with defective channel gating, as well as conductance defects, and may explain why the ivacaftor response was larger than for CFTR mutations that result in defects in conductance alone (e.g., R347H, R352Q).
X
ABCC7 p.Arg347His 23891399:91:248
status: NEW92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3.
X
ABCC7 p.Arg347His 23891399:92:955
status: NEW[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]
Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
44 RESULTS The 32-mutation panel is composed of the 23 variants from the ACMG/ACOG screening panel combined with 9 additional mutations, namely, 3876delA, R347H, S549N, 3905insT, 1078delT, V520F, 394delTT, S549R, and 2183AA>G.
X
ABCC7 p.Arg347His 24357848:44:152
status: NEW63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population.
X
ABCC7 p.Arg347His 24357848:63:829
status: NEWX
ABCC7 p.Arg347His 24357848:63:2607
status: NEW[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]
Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B).
X
ABCC7 p.Arg347His 24517344:81:429
status: NEW[hide] Understanding how cystic fibrosis mutations disrup... Int J Biochem Cell Biol. 2014 Jul;52:47-57. doi: 10.1016/j.biocel.2014.04.001. Epub 2014 Apr 13. Wang Y, Wrennall JA, Cai Z, Li H, Sheppard DN
Understanding how cystic fibrosis mutations disrupt CFTR function: from single molecules to animal models.
Int J Biochem Cell Biol. 2014 Jul;52:47-57. doi: 10.1016/j.biocel.2014.04.001. Epub 2014 Apr 13., [PMID:24727426]
Abstract [show]
Defective epithelial ion transport is the hallmark of the life-limiting genetic disease cystic fibrosis (CF). This abnormality is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), the ATP-binding cassette transporter that functions as a ligand-gated anion channel. Since the identification of the CFTR gene, almost 2000 disease-causing mutations associated with a spectrum of clinical phenotypes have been reported, but the majority remain poorly characterised. Studies of a small number of mutations including the most common, F508del-CFTR, have identified six general mechanisms of CFTR dysfunction. Here, we review selectively progress to understand how CF mutations disrupt CFTR processing, stability and function. We explore CFTR structure and function to explain the molecular mechanisms of CFTR dysfunction and highlight new knowledge of disease pathophysiology emerging from large animal models of CF. Understanding CFTR dysfunction is crucial to the development of transformational therapies for CF patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
2005 By contrast, the CF mutation R347H reduced single-channel conductance, converting CFTR to a single-ion pore.
X
ABCC7 p.Arg347His 24727426:2005:29
status: NEW[hide] Molecular genetic testing for cystic fibrosis: lab... Genet Med. 2015 Mar;17(3):219-25. doi: 10.1038/gim.2014.93. Epub 2014 Jul 31. Lyon E, Schrijver I, Weck KE, Ferreira-Gonzalez A, Richards CS, Palomaki GE
Molecular genetic testing for cystic fibrosis: laboratory performance on the College of American Pathologists external proficiency surveys.
Genet Med. 2015 Mar;17(3):219-25. doi: 10.1038/gim.2014.93. Epub 2014 Jul 31., [PMID:25077647]
Abstract [show]
BACKGROUND: Molecular testing for cystic fibrosis mutations is widespread and routine in reproductive decision making and diagnosis. Our objective was to assess the level of performance of laboratories for this test. METHODS: The College of American Pathologists administers external proficiency testing with multiple DNA samples distributed biannually. RESULTS are analyzed, reviewed, and graded by the joint College of American Pathologists/American College of Medical Genetics and Genomics Biochemical and Molecular Genetics Committee. Assessment is based on genotype and associated clinical interpretation. RESULTS: Overall, 357 clinical laboratories participated in the proficiency testing survey between 2003 and 2013 (322 in the United States and 35 international). In 2013, US participants reported performing nearly 120,000 tests monthly. Analytical sensitivity and specificity of US laboratories were 98.8% (95% confidence interval: 98.4-99.1%) and 99.6% (95% confidence interval: 99.4-99.7%), respectively. Analytical sensitivity improved between 2003 and 2008 (from 97.9 to 99.3%; P = 0.007) and remained steady thereafter. Clinical interpretation matched the intended response for 98.8, 86.0, and 91.0% of challenges with no, one, or two mutations, respectively. International laboratories performed similarly. DISCUSSION: Laboratory testing for cystic fibrosis in the United States has improved since 2003, and these data demonstrate a high level of quality. Neither the number of samples tested nor test methodology affected performance.
Comments [show]
None has been submitted yet.
No. Sentence Comment
40 Two other surveys included samples with non-ACMG mutations: MGL2-2011B contained a sample with E60X (in combination with F508del), and MGL5- 2011B included a sample with R347H.
X
ABCC7 p.Arg347His 25077647:40:170
status: NEW111 Given the previously discussed issues with the potential problems with missing data and the known problems with some methods for distinguishing the Table 1ߒ Results from external proficiency testing for CFTR mutations: common types of genotyping errors Sample switch ߓ Two genotypes and associated clinical interpretations are correct, but results are reversed from the original challenge ߓ ߓ Samples actually reversed before testing ߓ ߓ Testing correct but genotypes reversed during reporting False-positive genotypes ߓ Genotype reported as homozygous instead of heterozygous ߓ ߓ Data entry error ߓ ߓ Methodology cannot distinguish zygosity and reported incorrectly ߓ Wrong mutation (examples) ߓ ߓ R347H reported when R347P was challenged ߓ ߓ R553X homozygosity reported instead of compound heterozygosity ߓ ߓ I507del reported for a F508del challenge ߓ ߓ I507del/F508del for I507del False-negative genotype ߓ Reported a homozygous genotype as heterozygous Table 2ߒ Results from external proficiency testing for CFTR mutations: analytic sensitivity and specificity for US and international clinical laboratories Time period (survey) Total alleles True positive False negative Analytical sensitivity (95% CI) True negative False positive Analytical specificity (95% CI) 2003-2013 (All) 10,952 3,941 49 98.8 (98.4-99.1) 6,932 30 99.6 (99.4-99.7) 2008-2013 (All) 5,521 2,525 19 99.3 (98.8-99.5) 2,965 12 99.6 (99.3-99.8) 2008-2013 (MGL2) 2,444 737 8 98.9 (97.8-99.5) 1,696 3 99.8 (99.4-99.9) 2008-2013 (MGL5) 3,077 1,788 11 99.4 (98.9-99.7) 1,269 9 99.3 (98.6-99.7) 2008-2013 (international) 770 288 12 96.0 (92.9-97.8) 470 0 100 (99.9-100) CI, confidence interval.
X
ABCC7 p.Arg347His 25077647:111:785
status: NEW[hide] Comprehensive CFTR gene analysis of the French cys... Genet Med. 2015 Feb;17(2):108-16. doi: 10.1038/gim.2014.113. Epub 2014 Aug 14. Audrezet MP, Munck A, Scotet V, Claustres M, Roussey M, Delmas D, Ferec C, Desgeorges M
Comprehensive CFTR gene analysis of the French cystic fibrosis screened newborn cohort: implications for diagnosis, genetic counseling, and mutation-specific therapy.
Genet Med. 2015 Feb;17(2):108-16. doi: 10.1038/gim.2014.113. Epub 2014 Aug 14., [PMID:25122143]
Abstract [show]
PURPOSE: Newborn screening (NBS) for cystic fibrosis (CF) was implemented throughout France in 2002. It involves a four-tiered procedure: immunoreactive trypsin (IRT)/DNA/IRT/sweat test [corrected] was implemented throughout France in 2002. The aim of this study was to assess the performance of molecular CFTR gene analysis from the French NBS cohort, to evaluate CF incidence, mutation detection rate, and allelic heterogeneity. METHODS: During the 8-year period, 5,947,148 newborns were screened for cystic fibrosis. The data were collected by the Association Francaise pour le Depistage et la Prevention des Handicaps de l'Enfant. The mutations identified were classified into four groups based on their potential for causing disease, and a diagnostic algorithm was proposed. RESULTS: Combining the genetic and sweat test results, 1,160 neonates were diagnosed as having cystic fibrosis. The corresponding incidence, including both the meconium ileus (MI) and false-negative cases, was calculated at 1 in 4,726 live births. The CF30 kit, completed with a comprehensive CFTR gene analysis, provides an excellent detection rate of 99.77% for the mutated alleles, enabling the identification of a complete genotype in 99.55% of affected neonates. With more than 200 different mutations characterized, we confirmed the French allelic heterogeneity. CONCLUSION: The very good sensitivity, specificity, and positive predictive value obtained suggest that the four-tiered IRT/DNA/IRT/sweat test procedure may provide an effective strategy for newborn screening for cystic fibrosis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
81 Some molecular defects that could belong to either the CF-causing group or the CFTR-related disorders group (group A/B) were reported in patients presenting a broad spectrum of phenotypes from classic CF to mild monosymptomatic presentations.16 These are four missense mutations (p.Leu206Trp (L206W), p.Arg347His (R347H), p.Asp1152His (D1152H), and p.Ser945Leu (S945L)) and three splice mutations (c.2657+5G>A (2789+5G>A), c.3718-2477C>T (3849+10kbC>T), and c.1210-34TG(13);1210-12T(5) (TG13T5)).
X
ABCC7 p.Arg347His 25122143:81:303
status: NEWX
ABCC7 p.Arg347His 25122143:81:314
status: NEW[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]
Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
346 First, almost all CF-causing mutations involving residues located in the MSD transmembrane segments are encountered in MSD1 and generally concern positions lining the pore (G85E, E92K, D110H, P205S, R334W, I336K, T338I, S341P, R347H/R347P, and R352Q) (Fig. 7a).
X
ABCC7 p.Arg347His 25287046:346:227
status: NEW[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]
Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%.
X
ABCC7 p.Arg347His 25304080:79:445
status: NEW[hide] Clinical expression of patients with the D1152H CF... J Cyst Fibros. 2015 Jul;14(4):447-52. doi: 10.1016/j.jcf.2014.12.012. Epub 2015 Jan 10. Terlizzi V, Carnovale V, Castaldo G, Castellani C, Cirilli N, Colombo C, Corti F, Cresta F, D'Adda A, Lucarelli M, Lucidi V, Macchiaroli A, Madarena E, Padoan R, Quattrucci S, Salvatore D, Zarrilli F, Raia V
Clinical expression of patients with the D1152H CFTR mutation.
J Cyst Fibros. 2015 Jul;14(4):447-52. doi: 10.1016/j.jcf.2014.12.012. Epub 2015 Jan 10., [PMID:25583415]
Abstract [show]
BACKGROUND: Discordant results were reported on the clinical expression of subjects bearing the D1152H CFTR mutation, and also for the small number of cases reported so far. METHODS: A retrospective review of clinical, genetic and biochemical data was performed from individuals homozygous or compound heterozygous for the D1152H mutation followed in 12 Italian cystic fibrosis (CF) centers. RESULTS: 89 subjects carrying at least D1152H on one allele were identified. 7 homozygous patients had very mild clinical expression. Over half of the 74 subjects compound heterozygous for D1152H and a I-II-III class mutation had borderline or pathological sweat test and respiratory or gastrointestinal symptoms; one third had pulmonary bacteria colonization and 10/74 cases had complications (i.e. diabetes, allergic bronchopulmonary aspergillosis, and hemoptysis). However, their clinical expression was less severe as compared to a group of CF patients homozygous for the F508del mutation. Finally, 8 subjects compound heterozygous for D1152H and a IV-V class mutation showed very mild disease. CONCLUSIONS: The natural history of subjects bearing the D1152H mutation is widely heterogeneous and is influenced by the mutation in trans.
Comments [show]
None has been submitted yet.
No. Sentence Comment
85 Legacy name Protein name CDNA name Patients Homozygous for the D1152Ha D1152H p.Asp1152His c.3454GNC 7 Compound heterozygous for class I-II-III mutationsa : 74 F508del p.Phe508del c.1521_1523delCTT 43 G542X p.Gly542X c.1624GNT 7 N1303K p.Asn1303Lys c.3909CNG 4 1717-1GNA No protein name c.1585-1GNA 4 R1158X p.Arg1158X c.3472CNT 4 2183AANG p.Lys684SerfsX38 c.2051_2052delAAinsG 2 W1282X p.Trp1282X c.3846GNA 2 711 + 1GNT No protein name c.579 + 1GNT 1 Y849X p.Tyr849X c.2547CNA 1 L1065P p.Leu1065Pro c.3194 TNC 1 4016insT p.Ser1297PhefsX5 c.3884_3885insT 1 R1066H p.Arg1066His c.3197GNA 2 R1066C p.Arg1066Cys c.3196CNT 1 4382delA p.Glu1418ArgfsX14 c.4251delA 1 Compound heterozygous for class IV-V mutationsa : 8 (TG)12T5 No protein name Not available 2 2789 + 5GNA No protein name c.2657 + 5GNA 1 D579G p.Asp579Gly c.1736ANG 1 [R74W;V201M; D1270N] No protein name Not available 1 3849 + 10KbCNT No protein name c.3717 + 12191CNT 1 R347H p.Arg347His c.1040GNA 1 R347P p.Arg347Pro c.1040GNC 1 a Protein name and cDNA name from the CFTR2 database (http://www.http. com//www.cftr2) and http://www.genet.sickkids.on.ca/Home.html.
X
ABCC7 p.Arg347His 25583415:85:932
status: NEWX
ABCC7 p.Arg347His 25583415:85:940
status: NEW[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]
Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.
Comments [show]
None has been submitted yet.
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve.
X
ABCC7 p.Arg347His 25674778:15:2692
status: NEW74 However, the sensitivity of the IRT/NGS algorithm would have decreased as much as 50% for classic CF cases when a positive screen is defined as two CF-causing mutations because of uncommon mutations found in five patients Table 2ߒ Cases with a second mutation detected from the next-generation sequencing panel Case no. IRT (ng/ml) Second-tier DNA Additional mutation Sweat chloride (mmol/l) Clinical assessmenta Test 1 Test 2 1 64 F508del D110H 71.4 67.1 CF 2 327 F508del Q1313X N/A N/A CF 3 297 F508del Q1313X N/A N/A CF 4 71 R117H (7T) R347H 45.2 41.5 CRMSb 5 148 F508del R117C 40 38 CRMSb 6 66 F508del 5Tc 36.9 30.8 CRMSb 7 147 F508del D1152Hc 27.9 24.6 CRMSb 8 121 F508del D1152Hc 11 QNS Carrier 9 176 F508del D1152Hc 24 26 Carrier CF, cystic fibrosis; CRMS, CFTR-related metabolic syndrome; IRT, immunoreactive trypsinogen; QNS, quantity not sufficient.
X
ABCC7 p.Arg347His 25674778:74:545
status: NEW[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]
Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.
Comments [show]
None has been submitted yet.
No. Sentence Comment
370 991del5 c.859_863delAACTT CF-PI nd p.Asn287LysfsX19 L320V c.958T>G uncertain: CF-PI and/or CF-PS and/or CFTR-RD nd p.Leu320Val R334W c.1000C>T CF-PI,CF-PS CF-causing p.Arg334Trp R334L c.1001G>T CF-PS nd p.Arg334Leu T338I c.1013C>T CF-PS,CFTR-RD,CBAVD CF-causing p.Thr338Ile R347P c.1040G>C CF-PI,CF-PS CF-causing p.Arg347Pro R347H c.1040G>A CF-PS CF-causing p.Arg347His [M348K;S912X] c.
X
ABCC7 p.Arg347His 25910067:370:325
status: NEWX
ABCC7 p.Arg347His 25910067:370:360
status: NEW[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]
Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.
Comments [show]
None has been submitted yet.
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance.
X
ABCC7 p.Arg347His 26014425:79:982
status: NEWX
ABCC7 p.Arg347His 26014425:79:1000
status: NEW92 Well known examples include missense variants D110H, R117C, L206W, R347P, R347H, R1066H, or splice variants that produce both aberrant and full-length transcript such as 3849+10kbC4T, 2789+5G4A, 3272-26 A4G, 711+3 A4G.
X
ABCC7 p.Arg347His 26014425:92:74
status: NEW[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]
Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.
Comments [show]
None has been submitted yet.
No. Sentence Comment
63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented.
X
ABCC7 p.Arg347His 26087176:63:2776
status: NEW109 While non-CFTR modifier genes as well as environmental factors largely influence the development and progression of lung disease and nutritional decline,33-36 we demonstrate that the severity of the underlying CFTR genotype Table 2ߒ Meconium ileus prevalence scores and CFTR function CFTR mutation MIP score CFTR function (%wt) High MIP score ߓ V520F 0.38 0.2 ߓ N1303K 0.25 0.5 ߓ F508del 0.27 0.4 ߓ R560T 0.27 0.1 ߓ A559T 0.24 0 ߓ G551D 0.15 1 ߓ G85E 0.14 0.8 ߓ R1066C 0.13 0 Low MIP score ߓ R347P 0.1 0 ߓ R117C 0.1 2.9 ߓ R117H 0.07 33 ߓ R347H 0.06 5 ߓ R334W 0.05 1.3 ߓ A455E 0.05 6 ߓ L206W 0.04 5 ߓ M1101K 0.04 0 ߓ P67L 0.0 8 The table compares meconium ileus prevalence (MIP) scores and measured cystic fibrosis transmembrane conductance regulator (CFTR) function in Fisher rat thyroid determined by VanGoor et al.24 for the major and missense cystic fibrosis-causing variants for which patient group size was ࣙ10 in at least the US group.
X
ABCC7 p.Arg347His 26087176:109:616
status: NEW[hide] Murine and human CFTR exhibit different sensitivit... Am J Physiol Lung Cell Mol Physiol. 2015 Oct 1;309(7):L687-99. doi: 10.1152/ajplung.00181.2015. Epub 2015 Jul 24. Cui G, McCarty NA
Murine and human CFTR exhibit different sensitivities to CFTR potentiators.
Am J Physiol Lung Cell Mol Physiol. 2015 Oct 1;309(7):L687-99. doi: 10.1152/ajplung.00181.2015. Epub 2015 Jul 24., [PMID:26209275]
Abstract [show]
Development of therapeutic molecules with clinical efficacy as modulators of defective CFTR includes efforts to identify potentiators that can overcome or repair the gating defect in mutant CFTR channels. This has taken a great leap forward with the identification of the potentiator VX-770, now available to patients as "Kalydeco." Other small molecules with different chemical structure also are capable of potentiating the activity of either wild-type or mutant CFTR, suggesting that there are features of the protein that may be targeted to achieve stimulation of channel activity by structurally diverse compounds. However, neither the mechanisms by which these compounds potentiate mutant CFTR nor the site(s) where these compounds bind have been identified. This knowledge gap partly reflects the lack of appropriate experimental models to provide clues toward the identification of binding sites. Here, we have compared the channel behavior and response to novel and known potentiators of human CFTR (hCFTR) and murine (mCFTR) expressed in Xenopus oocytes. Both hCFTR and mCFTR were blocked by GlyH-101 from the extracellular side, but mCFTR activity was increased with GlyH-101 applied directly to the cytoplasmic side. Similarly, glibenclamide only exhibited a blocking effect on hCFTR but both blocked and potentiated mCFTR in excised membrane patches and in intact oocytes. The clinically used CFTR potentiator VX-770 transiently increased hCFTR by approximately 13% but potentiated mCFTR significantly more strongly. Our results suggest that mCFTR pharmacological sensitivities differ from hCFTR, which will provide a useful tool for identifying the binding sites and mechanism for these potentiators.
Comments [show]
None has been submitted yet.
No. Sentence Comment
306 However, recent data indicating that VX-770 potentiates channels bearing multiple disease-causing mutations, spread across CFTR, and that VX-770 potentiates one mutant but not another one in the same domain (for example, VX-770 potentiated TM mutants T338I- and R347H- but not S341P- and E92K-CFTR and potentiated cytoplasmic loop mutants E193K- and K1060T- but not R1066M- and L1065P-CFTR) do not support this conclusion (30, 38).
X
ABCC7 p.Arg347His 26209275:306:262
status: NEW[hide] [Male infertility caused by bilateral agenesis of ... Rev Med Interne. 1997;18(2):114-8. Durieu I, Bey-Omar F, Rollet J, Boggio D, Bellon G, Morel Y, Vital Durand D
[Male infertility caused by bilateral agenesis of the vas deferens: a new clinical form of cystic fibrosis?].
Rev Med Interne. 1997;18(2):114-8., [PMID:9092029]
Abstract [show]
Congenital bilateral absence of vas deferens causes male excretory infertility and represents 1 to 2% of male infertility. Because of a genotypic similarity with cystic fibrosis, the possible in vitro fertilization with epididymal sperm requires careful genetic counselling. We studied genotype, sweat chloride concentration, respiratory function tests, sinus abnormalities, pancreatic and hepatic functions in 22 subjects with congenital bilateral absence of vas deferens. Among them, four were compound heterozygotus, all of them with the R117H mutation. Ten had a positive sweat test, one of them also being compound heterozygotus. Congenital bilateral absence of vas deferens and double mutation or positive sweat test led to high probable cystic fibrosis diagnosis in 13 subjects. Six subjects were heterozygotus for one cystic fibrosis mutation, criterium which is not sufficient for cystic fibrosis diagnosis; five of them had sinus abnormalities, present in 11 of the 22 subjects. Only three patients had no mutation nor sweat chloride abnormalities. This work confirms the high frequency of cystic fibrosis mutations in males with congenital bilateral absence of vas deferens, with a higher frequency of positive sweat test than in other publications, and a high frequency of sinus abnormalities. This monosymptomatic phenotype of cystic fibrosis suggests new hypotheses for a relationship between genotype and phenotype.
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 Vingt-deux mutations du gene CFTR ont Cte recher- chtes : les cinq plus frequentes (AF508, G542X, N1303K, 1717-G--A, G85E) et les 17 suivantes : R117H, 556delA, R334W, R347H, R347P, S549N, S5491, S549R, G551D, R553X,R560T,G1244E3,S1255X,W1282X,R1283K,3898 ins C, D1270N.
X
ABCC7 p.Arg347His 9092029:46:168
status: NEW
admin on 2016-08-19 15:16:22