ABCMdb

ABCC7 p.Arg117Cys

Admin's notes:	Class II-III (maturation defect, gating defect) Veit et al.
ClinVar:	c.350G>C , p.Arg117Pro ? , not provided c.349C>G , p.Arg117Gly ? , not provided c.350G>T , p.Arg117Leu ? , not provided c.349C>T , p.Arg117Cys D , Pathogenic c.350G>A , p.Arg117His D , Pathogenic
CF databases:	c.350G>A , p.Arg117His ? , Varying clinical consequence ; CFTR1: c.349C>T , p.Arg117Cys D , CF-causing ; CFTR1: The haplotype is 2-1-1-2 (XV2c-KM19-D9-J44) with seven GATT repeats. The mutation creates a new Bsml site. c.349C>G , p.Arg117Gly (CFTR1) ? , Was reported previously in one study of CBAVD. R117G/UND 7T/9T (Daudin et al., Fertility and Sterility, 74:1164-1174, 2000). c.350G>C , p.Arg117Pro (CFTR1) ? , A new missense mutation was found in exon 4 : R 117 P. The mutation was detected by DGGE analysis and identified by remplacement of an arginine residue by a proline at codon 117. The mutation creates new MnlI and NlaIV sites. The mutation was identified in one french CF chromosome. The patient has a mild lung disease and is sufficient pancreatic. c.350G>T , p.Arg117Leu (CFTR1) ? , This mutation was identified by DGGE and direct sequencing and was identified on one CF chromosome of Italian origin.
Predicted by SNAP2:	A: D (91%), C: D (63%), D: D (95%), E: D (95%), F: D (91%), G: D (95%), H: N (53%), I: D (85%), K: D (95%), L: D (63%), M: D (85%), N: D (95%), P: D (66%), Q: D (95%), S: D (95%), T: D (95%), V: D (91%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: N, C: D, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, S: N, T: N, V: N, W: N, Y: N,

[switch to compact view]
Comments [show]

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Congenital bilateral absence of the vas deferens, ... Hum Reprod. 2000 Feb;15(2):431-5. Phillipson GT, Petrucco OM, Matthews CD
Congenital bilateral absence of the vas deferens, cystic fibrosis mutation analysis and intracytoplasmic sperm injection.
Hum Reprod. 2000 Feb;15(2):431-5., [PMID:10655317]

Abstract [show]
The aim of this study was to assess the outcome of intracytoplasmic sperm injection (ICSI) with fresh and frozen-thawed surgically retrieved spermatozoa from men diagnosed with congenital bilateral absence of the vas deferens (CBAVD). Twenty-seven azoospermic men with their partners were treated [25 with CBAVD and two with clinical cystic fibrosis (CF)]. CF gene mutation analysis and genetic counselling was provided. Spermatozoa were aspirated by microsurgical epididymal sperm aspiration (MESA), percutaneous epididymal sperm aspiration (PESA) or open testis biopsy. Of the men with CBAVD, 60% carried a single mutation, 20% were compound heterozygotes, and 20% had no CF mutation identified. Of the 28 sperm aspiration procedures, 86% had supplementary spermatozoa for cryopreservation with 83% of those samples assessed as satisfactory when thawed. Of 29 cycles with fresh spermatozoa a fertilization rate of 76% of oocytes injected and 17% embryo implantation rate occurred. Twenty-four cycles in which cryopreserved spermatozoa were used resulted in an oocyte fertilization rate of 69% and embryo implantation rate of 20%. Eighteen clinical pregnancies occurred with 14 live births without congenital anomaly. Two pregnancies were achieved following pre-implantation genetic diagnosis. It is concluded that the presence of CF mutations in the male partner does not compromise in-vitro fertilization treatment outcomes or the opportunity for healthy live births.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 PESA was offered as an alternative for those men R117C only 9T:9T 1 ∆F508 only 9T:9T 2preferring a less invasive procedure. Login to comment
135 However the total number of live of either the R117H or R117C CF mutation, pregnancy did births reported remains small and continued study will be not occur despite the transfer of 25 embryos over nine cycles. Login to comment

[hide] A novel mutation in the CFTR gene correlates with ... J Med Genet. 2000 Mar;37(3):215-8. Wang J, Bowman MC, Hsu E, Wertz K, Wong LJ
A novel mutation in the CFTR gene correlates with severe clinical phenotype in seven Hispanic patients.
J Med Genet. 2000 Mar;37(3):215-8., [PMID:10777364]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
570 SYLVAIN R RIVARD* CHRISTIAN ALLARD† JEAN-PIERRE LEBLANC† MARCEL MILOT† GERVAIS AUBIN† FERNAND SIMARD† CLAUDE FÉREC‡ MARC DE BRAEKELEER†§¶ *Département des Sciences Fondamentales, Université du Québec à Chicoutimi, Canada Table 1 Distribution of cystic fibrosis patients diagnosed before the age of 5 by age groups in Saguenay-Lac-Saint-Jean, (A) by genotype, (B) by mutation 0-10 years 10.1-20 years Over 20 years All ages No % No % No % No % (A) Genotype F508/ F508 15 (1) 40.5 21 (2) 36.2 18 (3) 42.9 54 (6) 39.4 F508/621+1G→T 12 (1) 32.4 16 (1) 27.6 10 (1*) 23.8 38 (3*) 27.7 F508/A455E 1 2.7 6 10.3 5 11.9 12 8.8 F508/I148T 1 2.7 1 1.7 2 1.5 F508/Y1092X 3 (1) 5.2 1 2.4 4 (1) 2.9 F508/Q890X 1 2.4 1 0.7 F508/R1158X 1 2.4 1 0.7 621+1G→T/621+1G→T 2 (1) 5.4 4 6.9 1 2.4 7 (1) 5.1 621+1G→T/A455E 1 2.7 4 6.9 3 7.1 8 5.8 621+1G→T/711+1G→T 2 (1) 5.4 2 (1) 3.4 4 (2) 2.9 621+1G→T/Y1092X 1 2.7 1 0.7 621+1G→T/S489X 1 2.7 1 0.7 621+1G→T/G85E 1 (1) 1.7 1 (1) 2.4 2 (2) 1.5 A455E/R117C 1 2.7 1 0.7 N1303K/I148T 1 2.4 1 0.7 Total 37 58 42 137 Death (4) 10.8 (6) 10.3 (5*) 11.9 (15*) 10.9 (B) Mutation F508 16 (1) 43.2 25 (3) 43.1 21 (3) 51.2 62 (7) 45.6 621+1G→T 18 (3) 48.6 23 (3) 39.7 12 (2*) 29.3 53 (8*) 39.0 A455E 3 8.1 10 17.2 8 19.5 21 15.4 Total 37 58 41 136 Death (4) 10.8 (6) 10.3 (5*) (12.2) (15*) (11.0) ( ): Number of deaths. Login to comment

[hide] Histological and genetic analysis and risk assessm... Hum Reprod. 2000 Jul;15(7):1613-8. Viville S, Warter S, Meyer JM, Wittemer C, Loriot M, Mollard R, Jacqmin D
Histological and genetic analysis and risk assessment for chromosomal aberration after ICSI for patients presenting with CBAVD.
Hum Reprod. 2000 Jul;15(7):1613-8., [PMID:10875876]

Abstract [show]
Intracytoplasmic sperm injection (ICSI) has opened a new field in the treatment of male infertility, leading to a debate concerning its genetic safety. In this study we present an analysis of 11 patients presenting congenital bilateral absence of the vas deferens (CBAVD). In all 11 cases, genetic counselling, histological analysis of testicular biopsies, cystic fibrosis transmembrane conductance regulator (CFTR) mutation screenings of both partners and spermatozoa three-colour fluorescent in-situ hybridization (FISH) analysis were performed. A total of 31 CFTR mutations were screened and mutations were found in eight out of 11 cases, with DeltaF508 being the most common mutation found. Histological analyses showed that seven out of 11 patients had normal tubule/membrane/interstitium (TMI) and Johnsen scores, while the remaining four patients had mild impairment of testicular parenchyma. The average aneuploidy rate was 6.8 +/- 3.9% compared with two control subjects with 4.4 and 5.4% aneuploidy rates respectively, using FISH analysis. After ICSI, the fertilization and pregnancy rates were 66.2 and 22.7% respectively. Thus, in our case of CBAVD, the risk of chromosomal aberration following ICSI, in the absence of a CFTR mutation in the male patient and/or in his partner, was not higher than in normal fertile men. Furthermore, the pregnancy success rate following ICSI of these CBAVD patients was comparable to the general ICSI population, even when histological analysis showed limited spermatogenesis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
49 These samples were at least one mutation, three patients (27%) presented only washed once in phosphate-buffered saline (PBS) and placed in an the ∆F508 mutation and five (45%) presented compound area previously delimited with a diamond pen on superfrosted slides heterozygosity for ∆F508/R347H, ∆F508/R117C, ∆F508/5T, (CML, France). Login to comment
60 TMI score Johnsen score CF mutation screening Sweat test Karyotype Family history 1 1 12 NF ND ND No 2 1 12 ∆F508/NF ND Normal No 3 3 11 R117H-7T/5T ND Normal No 4 3 11 NF ND Normal Yes 5 1 11 ∆F508/NF ND Normal No 6 2 11 ∆F508/R347H ND ND Yes 7 4 10 ∆F508/5T ND ND No 8 3 10 ∆F508/NF Neg ND No 9 1 11 NF Pos ND No 10 2 11 ∆F508/R117C Pos ND Yes 11 2 11 ∆F508/D443Y Pos ND No TMI ϭ tubule/membrane/interstitium; CF ϭ cystic fibrosis; ND ϭ not determined; Neg ϭ negative; Pos ϭ positive; NF ϭ not found in 31 screened mutations, including ∆F508, R117H and the variant IVS5T. Login to comment

[hide] Distribution of CFTR gene mutations in cystic fibr... J Med Genet. 2000 Aug;37(8):E16. Teder M, Klaassen T, Oitmaa E, Kaasik K, Metspalu A
Distribution of CFTR gene mutations in cystic fibrosis patients from Estonia.
J Med Genet. 2000 Aug;37(8):E16., [PMID:10922396]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
19 To scan for several known mutations simultaneously, a multiple allele specific primer extension (MASPE) method was developed.23 Thirty eight mutations were chosen: 30 of the most common mutations world wide24 and eight mutations of regional interest (394delTT, 3821delT, 2143delT, 2184insA, 3732delA/K1200E, R117C, and I1005R), previously detected in Scandinavia,2 Russia,25 or Germany.19 Fifteen target exons were amplified to get the templates for primer extension.26 Owing to the dense location of the mutation sites in seven exons, both DNA strands were used as templates to avoid overlapping of the extension primers. Login to comment
62 It diVers from the one found in Germany by one repeat in the IVS8 locus and could have been derived from it by slippage mechanism.31 The mutations R117C and R1066H are obviously recurrent and therefore neither diallelic markers nor microsatellites matched to the corresponding haplotypes from the other populations. Login to comment

[hide] Genotype analysis and phenotypic manifestations of... Chest. 2000 Dec;118(6):1591-7. Desmarquest P, Feldmann D, Tamalat A, Boule M, Fauroux B, Tournier G, Clement A
Genotype analysis and phenotypic manifestations of children with intermediate sweat chloride test results.
Chest. 2000 Dec;118(6):1591-7., [PMID:11115444]

Abstract [show]
STUDY OBJECTIVES: Cystic fibrosis (CF) is one of the most common inherited diseases among whites. Since the cloning of the CF transmembrane conductance regulator (CFTR) gene, a number of studies have focused on associations between the genotype and phenotype in CF. This had led to the progressive identification of new groups of patients, including those who have mild lung disease and those who have normal sweat chloride values (< 60 mEq/L). The aim of the present work was to provide information on the genotype and the phenotypic characteristics of children with intermediate-range sweat chloride test results. PATIENTS AND RESULTS: We focused on children referred to the pulmonary department for various types of pulmonary disease and who had several sweat chloride test results with median values in the range of 40 to 60 mEq/L. Twenty-four patients over a 10-year period were enrolled (mean age, 4.8 years). Respiratory manifestations at initial evaluation included recurrent bronchitis, wheezing, chronic cough, and pneumonia. The duration of the follow-up ranged from 0.5 to 10.5 years. Sputum cultures revealed the presence of Haemophilus influenzae (10 children), Staphylococcus aureus (4 children), and Pseudomonas aeruginosa (3 children). Pancreatic insufficiency was found in two patients. Analysis of the entire coding sequence allowed identification of 16 known mutations in CFTR gene. Fifteen chromosomes (31.2%) carried a mutation in CFTR gene and one allele carried two mutations. Three patients were homozygous or double heterozygous (DeltaF508/DeltaF508, DeltaF508/3849 + 10 kb C-->T, S1235R/G551D). The 5-thymidine allele was identified in four children. CONCLUSION: These results indicate an higher frequency of CFTR gene mutations in patients with borderline sweat chloride test results, compared to data reported in the general population. They lead to the recommendations for complete pulmonary and GI investigations in this group of patients, as well as assiduous care and medical follow-up.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 Genotype Poly T 1 -/- 7T/7T 2 R117C/- 7T/7T 3 R75X-D1270H/- 7T/7T 4 -/- 7T/7T 5 G91R/- 7T/5T 6 ⌬F508/- 7T/9T 7 -/- 7T/7T 8 -/- 7T/7T 9 S1235R/G551D 5T/7T 10 ⌬F508/- 9T/9T 11 7T/7T 12 ⌬F508/⌬F508 9T/9T 13 ⌬F508/- 7T/9T 14 -/- 7T/7T 15 ⌬F508/- 7T/9T 16 -/- 7T/5T 17 -/- 7T/7T 18 -/- 7T/7T 19 -/- 7T/9T 20 ⌬F508/- 7T/9T 21 -/- 7T/7T 22 W1282X/- 7T/5T 23 -/- 7T/7T 24 ⌬F508/3849 ϩ 10 kb C 3 T 7T/7T 1594 Clinical Investigations reported in the general population (frequency of the 5T allele in the general population, 5.2%).26 Based on the results of DNA analysis and according to the consensus statement on the diagnosis of CF, three patients (patients 9, 12, and 24) met the criteria of both respiratory manifestations and identification of two CF mutations.21 For patient 6, there was a diagnostic dilemma. Login to comment

[hide] Disease-associated mutations in the extracytoplasm... J Biol Chem. 2001 May 4;276(18):14848-54. Epub 2001 Feb 6. Hammerle MM, Aleksandrov AA, Riordan JR
Disease-associated mutations in the extracytoplasmic loops of cystic fibrosis transmembrane conductance regulator do not impede biosynthetic processing but impair chloride channel stability.
J Biol Chem. 2001 May 4;276(18):14848-54. Epub 2001 Feb 6., 2001-05-04 [PMID:11278813]

Abstract [show]
Consistent with its function as a chloride channel regulated entirely from the cytoplasmic side of the plasma membrane, the cystic fibrosis transmembrane conductance regulator (CFTR) glycoprotein exposes little of its mass on the exterior surface of cells. The first and fourth extracytoplasmic loops (ELs) contain approximately 15 and 30 residues, respectively; the other four ELs are extremely short. To examine the influence of missense mutants in ELs detected in patients with cystic fibrosis, we have expressed them in mammalian (baby hamster kidney (BHK21)) cells and assessed their biosynthetic processing and chloride channel activity. In contrast to previous findings that 18 of 30 disease-associated missense mutations in cytoplasmic loops caused retention of the nascent polypeptides in the endoplasmic reticulum, all the EL mutants studied matured and were transported to the cell surface. This pronounced asymmetry is consistent with the notion that endoplasmic reticulum quality control of nascent CFTR is exerted primarily on the cytoplasmic side of the membrane. Although this set of EL mutations has little effect on CFTR maturation, most of them seriously compromise its chloride channel activity. Substitutions at six different positions in EL1 and single positions in EL2 and EL4 all destabilized the open state, some of them severely, indicating that the ELs contribute to the stability of the CFTR ion pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 TABLE I Oligonucleotide primers used to generate mutations Mutation Primer S108F GGAAGAATCATAGCTTtCTATGACCCGGATAAC Y109C AGAATCATAGCTTCCTgTGACCCGGATAACAAG D110H ATCATAGCTTCCTATcACCCGGATAACAAGGAG P111A ATAGCTTCCTATGACgCGGATAACAAGGAGGAA P111L ATAGCTTCCTATGACCtGGATAACAAGGAGGAA E116K CCGGATAACAAGGAGaAACGCTCTATCGCGATT R117C GATAACAAGGAGGAAtGCTCTATCGCGATTTAT R117H GATAACAAGGAGGAACaCTCTATCGCGATTTAT R117L GATAACAAGGAGGAACtCTCTATCGCGATTTAT R117P GATAACAAGGAGGAACcCTCTATCGCGATTTAT E217G ATGGGGCTAATCTGGGgGTTGTTACAGGCGTCT T908N TATGCAGTGATTATCAaCAGCACCAGTTCGTAT P1013L GTCGCAGTTTTACAACtCTACATCTTTGTTGCA FIG. 2. Login to comment
119 C, squares, R117C; circles, R117H; triangles, R117L; diamonds, R117P. Login to comment
142 Both R117C and R117L had very unstable open states like S108F and E116K with the cysteine substitution able to maintain openings FIG. 4. Login to comment
171 For example a nucleotide binding domain mutation, G551D, precludes virtually all TABLE II Relative charge transport capacity of mutants Mutants S108F Y109C D110H P111L P111A E116K R117H R117C R117L R117P E217G T908N P1013L Imutant/Iwt 100% 11 15 27 173 105 12 80 27 5 11 10 48 170 FIG. 5. Login to comment

[hide] Intron-8 polythymidine sequence in Australasian in... Eur Respir J. 2001 Jun;17(6):1195-200. Massie RJ, Poplawski N, Wilcken B, Goldblatt J, Byrnes C, Robertson C
Intron-8 polythymidine sequence in Australasian individuals with CF mutations R117H and R117C.
Eur Respir J. 2001 Jun;17(6):1195-200., [PMID:11491164]

Abstract [show]
Compound heterozygotes for a severe cystic fibrosis transmembrane conductance regulator (CFTR) mutation and the R117H or R117C mutation (R117H/C) have clinical presentations that vary from classic cystic fibrosis (CF) to an incidental genetic finding. The aim of this study was to assess the influence of the intron-8 polythvmidine sequence (IVS8) on the relationship between genotype and phenotype of individuals with R117H/C. All individuals with R117H/C known to CF clinics in Australia and New Zealand were retrospectively studied by collecting information on genotype, age, pancreatic status, sweat electrolytes, sputum microbiology and pulmonary function. Forty-one individuals (39 with R117H and two with R117C), 16 on an IVS8-5T background and 25 on an IVS8-7T background were identified. Twelve individuals presented clinically, four were siblings of known R117H/C compound heterozygotes and 25 were detected by newborn screening. Eleven of 14 of the IVS8-5T group (78%) with sweat chloride results available had sweat CI > 60 mmol x L(-1) compared to 5 (20%) of the R117H/7T group (Chi-squared=10.4, p=0.001). Two were pancreatic insufficient, both IVS8-5T. Two IVS8-5T individuals have recently died (aged 43 and 19) and of the 14 surviving IVS8-5T group, 11 (79%) are symptomatic compared to eight (32%) of the IVS8-7T individuals (Chi-squared=6.1, p=0.01). In conclusion, most individuals with R117H/C on a IVS8-5T background have an elevated sweat chloride and clinical cystic fibrosis, which in some cases is severe. Most individuals with R117H/C on an IVS8-7T background do not have clinical cystic fibrosis but should be followed for the development of clinical disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 ABSTRACT: Compound heterozygotes for a severe cystic fibrosis transmembrane conductance regulator (CFTR) mutation and the R117H or R117C mutation (R117H/ C) have clinical presentations that vary from classic cystic fibrosis (CF) to an incidental genetic finding. Login to comment
6 Forty-one individuals (39 with R117H and two with R117C), 16 on an IVS8-5T background and 25 on an IVS8-7T background were identified. Login to comment
16 In general, individuals who are compound heterozygotes for a severe cystic fibrosis transmembrane conductance regulator (CFTR) mutation and R117H or R117C (R117H/C) have milder disease. Login to comment
32 Information was requested regarding all individuals, alive or deceased, who had been seen in their clinic and who were known to have the R117H or R117C mutation. Login to comment
33 R117H and R117C have been considered to be functionally equivalent [11] and have been combined in the analysis, referring to R117H and R117C collectively as R117H/C. Login to comment
45 R117H was detected by ARMS (Western Australia, New South Wales, Victoria, Tasmania, New Zealand) or ASO (South Australia) and R117C was detected using a restriction enzyme digest (Western Australia, New South Wales, Victoria, Tasmania), ASO (South Australia) or ARMS (New Zealand). Login to comment
54 Results Genotype Forty-one individuals with R117H/C (39 R117H and two R117C) being followed at one of the CF clinics in Australia and New Zealand were identified. Login to comment

[hide] Spectrum of mutations in the CFTR gene of patients... Genet Test. 2001 Fall;5(3):235-42. Strandvik B, Bjorck E, Fallstrom M, Gronowitz E, Thountzouris J, Lindblad A, Markiewicz D, Wahlstrom J, Tsui LC, Zielenski J
Spectrum of mutations in the CFTR gene of patients with classical and atypical forms of cystic fibrosis from southwestern Sweden: identification of 12 novel mutations.
Genet Test. 2001 Fall;5(3):235-42., [PMID:11788090]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CFTR gene. The spectrum of CFTR mutations varies between populations and depends on different factors, such as ethnic background and geographical location. The extensive CFTR mutation screening of 129 patients with classical or atypical CF from the south-western region of Sweden revealed the presence of 37 CFTR mutations, including 12 novel alleles. The overall mutation detection rate in this study population was 92%, the highest among all tested regions in Sweden. Eight mutations with a frequency above 1% (DeltaF508, 394delTT, R117C, 3659delC, E60X, 1112delT, R764X, and 621 + 1G --> T) accounted for 78% of CF chromosomes and have been recommended for inclusion in the CFTR mutation screening panel for molecular diagnosis of CF in this region. The multiple occurrence of specific CFTR alleles less common than the predominant DeltaF508 mutation (394delTT, R117C, 3659delC) allowed for genotype-phenotype comparisons and revealed consistent relationships between these mutations and disease severity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Eight mutations with a frequency above 1% (DF508, 394delTT, R117C, 3659delC, E60X, 1112delT, R764X, and 621 1 1G R T) accounted for 78% of CF chromosomes and have been recommended for inclusion in the CFTR mutation screening panel for molecular diagnosis of CF in this region. Login to comment
6 The multiple occurrence of specific CFTR alleles less common than the predominant DF508 mutation (394delTT, R117C, 3659delC) allowed for genotype-phenotype comparisons and revealed consistent relationships between these mutations and disease severity. Login to comment
27 MUTATIONS IDENTIFIED IN 258 CHROMOSOMES IN THE CF POPULATION ATTENDING THE SOUTH-WESTERN SWEDISH CF CENTRE Location in the Frequency of Mutation gene, exon Number of mutations mutation (%) Homozygotes Heterozygotes DF508 10 161 62.4 56 49 394delTT 3 13 5.0 3 7 R117C 4 7 2.7 7 3659delC 19 5 1.9 5 E60X 3 4 1.6 4 1112delT 7 4 1.6 1 2 R764X 13 4 1.6 1 2 621 1 1G ® T 4 3 1.2 3 G551D 11 2 0.8 2 I506L 10 2 0.8 2 N1088D (R75Q) 17b 2 0.8 2 Q1238X 19 2 0.8 2 R117H (IVS8-5T) 4 2 0.8 2 V603F (IVS8-5T) 13 2 0.8 2 1716G ® A 10 2 0.8 2 R75Q 3 2 0.8 2 R533X 11 1 0.4 1 2329A ® G Promoter 1 0.4 1 297-3 C ® A 2 1 0.4 1 Y161D 4 1 0.4 1 994del9 Exon/intron 6b 1 0.4 1 1154insTC 7 1 0.4 1 W361R 7 1 0.4 1 T338I 7 1 0.4 1 1249-5A ® G Intron 7 1 0.4 1 1717-2A ® G Intron 10 1 0.4 1 R560T 11 1 0.4 1 E1401X 23 1 0.4 1 3126del4 17a 1 0.4 1 S945L 15 1 0.4 1 R668C 13 1 0.4 1 2622 1 2del6 Intron 13 1 0.4 1 R1162Q Exon 19 1 0.4 1 3849 1 10kbC ® T Intron 19 1 0.4 1 R74W Exon 3 1 0.4 1 2363C ® T Promoter 1 0.4 1 IVS8-5Ta Intron 8 1 0.4 1 Unidentified 20 7.8 Total 258 100 61 116 The new mutations are displayed in bold. Login to comment
40 Two other mutations with frequencies exceeding 2% were R117C and 3659delC. Login to comment
46 Among the most common non-D508 alleles, three (394del TT, R117C, and 3659delC) were detected in the context of full CFTR genotypes in 22 CF patients (Table 2). Login to comment
49 In contrast, patients (n 5 7) with the R117C allele (all paired with the DF508 deletion) tended to present with a mild form of CF [pancreatic sufficiency(PS), good pulmonary status]. Login to comment
53 CLINICAL PROFILES OF THE PATIENTS WITH MOST COMMON CFTR MUTATIONS (DF508 NOT INCLUDED) Patient clinical data Cl2 AD/yr (mmol/liter) Mutation/ median Lung median genotype n (range) PI/PS involvement MI (range) Other 394delTT 10 1.5 (0.1-12.2) 13/0a 10/10 1/10 109 (90-140)0 394delTT/DF508 7 1.5 (0.1-12.2) 7/0a 1/70 110 (90-140)0 4 with liver disease of whom 1 died (B. cepacia syndrome) 394delTT/394delTT 3 1.5 (0.8-4.2) 3/0a 0/3 102 (100-118) R117C 7 5.5 (2.5-18) 0/7a 1/7 0/7 85 (71-100) R117C/DF508 7 5.5 (2.5-18) 0/7a - 85 (71-100) 3659delC 5 0.8 (0.3-29) 4/1a 5/5 0/5 106 (80-116)0 3659delC/DF508 4 0.6 (0.3-8.0) 4/0a 0/4 107 (100-116) 2 double lung transplanted (34, 28 years), of whom 1 had diabetes mellitus 3659delC/I506L 1 29 0/1* 0/1 80000000. Login to comment
138 As with the southern region of Sweden (Lund), the second most common mutation (3659delC) in the eastern part of the country (Uppsala 13.3%, Stockholm 10.5%), was much less represented in our patients (1.9%) and it was surpassed by another mutation, R117C (2.7%) (Table 4). Login to comment
145 The relatively high frequency of the 394delTT (3 homozygotes) R117C and 3659delC alleles made it possible to draw genotype-phenotype correlations for patients carrying these mutations (Table 2). Login to comment
152 In the group carrying the mild R117C allele all patients were PS and diagnosed at older ages. Login to comment
166 The "Nm" column represents the number of different CFTR mutant alleles identified among CF chromosomes not carrying most common mutations (DF508, 394delTT, 3659delC, and R117C). Login to comment
168 Patient chromosomes DF508 394delTT 3659delC R117C Othere by the nonsensemutation may produce a relativelyunstable but fully functional CFTR channel that may partially account for the milder presentation (Haardt et al., 1999). Login to comment
180 Near-complete screening of a local CF population provides important information for establishing the most optimal strategies for routine screeningof CF patients in this population.Our results indicate that an adjustment should be made to the panel of most common mutations used in the screening of the southwestern Swedish CF population:the addition of the R117C mutation (2.7% of CF chromosomes; Table 1). Login to comment

[hide] Mutations of the cystic fibrosis gene and intermed... Am J Respir Crit Care Med. 2002 Mar 15;165(6):757-61. Lebecque P, Leal T, De Boeck C, Jaspers M, Cuppens H, Cassiman JJ
Mutations of the cystic fibrosis gene and intermediate sweat chloride levels in children.
Am J Respir Crit Care Med. 2002 Mar 15;165(6):757-61., 2002-03-15 [PMID:11897640]

Abstract [show]
The incidence of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in children with intermediate sweat chloride levels is unknown. The results of 2,349 sweat tests performed at two Belgian university hospitals were reviewed. Intermediate chloride concentrations were observed in 98 subjects (4.2%), 68 being younger than 18 years of age. Forty-three children could be traced and their parents agreed to take part in the study. Exhaustive analysis of the CFTR gene disclosed a total of 24 putative mutations (27.9%). Three subjects were found to carry only one CFTR mutation, whereas 10 harbored one mutation on both CFTR genes. These 10 children were investigated in detail. At the time of writing, the mean age (+/-SD) of this group is 8.9 years (+/-4.2 years). Nine children are pancreatic sufficient. Three have been asymptomatic for more than two years, whereas the others display, to different degrees, clinical features suggestive of CF. The sweat chloride concentration is slightly higher in this group (39.4 +/- 5.4 mM) than in subjects without CFTR mutation (35.2 +/- 4.4 mM, p < 0.05). The nasal potential difference was abnormal in five of the nine subjects tested. In this study, 23% of children displaying intermediate sweat chloride levels were found to carry a putative mutation on both CFTR genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 Age at First Sweat Test (yr) Clin Sweat (mM) Nasal Potential (mV) Bacteriology (Throat Swab or Sputum Culture) GenotypePDmax ⌬Iso ϩ Cl-free 1 2.5 34 -15 -7* Staphylococcus aureus ⌬F508/D1152H 2 2.8 36 -21 -10 - ⌬F508/R117H, 7T 3 0.3 33 ND ND - ⌬F508/R117H, 7T 4 0.7 43 -51* -7* S. aureus S977F, 5T/2789 ϩ 5G→A 5 0.1 39 -16 -4* Haemophilus influenzae, S. aureus ⌬F508/R117C 6 0.1 37 -48* -9* H. influenzae, S. aureus ⌬F508/R117C 7 0.7 48 -15 -12 Pseudomonas aeruginosa, S. aureus R553X/R117H, 7T 8 6 34 -30 -10 H. influenzae 5T/5T 9 7 45 -24 -15 S. aureus ⌬F508/S1235R 10 9.5 45 -47* -11 P. aeruginosa ⌬F508/D1152H Definition of abbreviations: PDmax ϭ maximum basal nasal potential difference; ⌬Iso ϩ Cl-free ϭ cumulative change in PD after perfusion with chloride-free solution plus isoproterenol in the presence of amiloride. Login to comment
77 C→T (6-9), R347H (12), G551S (13), D1152H (14), R117H (15, 16), and R117C (17) mutations. Login to comment
86 Data on the R117C mutation (Subjects 5 and 6 are twin sisters) and the S977F mutations (Subject 4) are limited but suggest that a mild form of the disease is associated with the former (27). Login to comment

[hide] DHPLC screening of cystic fibrosis gene mutations. Hum Mutat. 2002 Apr;19(4):374-83. Ravnik-Glavac M, Atkinson A, Glavac D, Dean M
DHPLC screening of cystic fibrosis gene mutations.
Hum Mutat. 2002 Apr;19(4):374-83., [PMID:11933191]

Abstract [show]
Denaturing high performance liquid chromatography (DHPLC) using ion-pairing reverse phase chromatography (IPRPC) columns is a technique for the screening of gene mutations. In order to evaluate the potential utility of this assay method in a clinical laboratory setting, we subjected the PCR products of 73 CF patients known to bear CFTR mutations to this analytic technique. We used thermal denaturation profile parameters specified by the MELT program tool, made available by Stanford University. Using this strategy, we determined an initial analytic sensitivity of 90.4% for any of 73 known CFTR mutations. Most of the mutations not detected by DHPLC under these conditions are alpha-substitutions. This information may eventually help to improve the MELT algorithm. Increasing column denaturation temperatures for one or two degrees above those recommended by the MELT program allowed 100% detection of CFTR mutations tested. By comparing DHPLC methodology used in this study with the recently reported study based on Wavemaker 3.4.4 software (Transgenomic, Omaha, NE) [Le Marechal et al., 2001) and with previous SSCP analysis of CFTR mutations [Ravnik-Glavac et al., 1994] we emphasized differences and similarities in order to refine the DHPLC system and discuss the relationship to the alternative approaches. We conclude that the DHPLC method, under optimized conditions, is highly accurate, rapid, and efficient in detecting mutations in the CFTR gene and may find high utility in screening individuals for CFTR mutations. Hum Mutat 19:374-383, 2002. Published 2002 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X. Login to comment

[hide] Predictors of deterioration of lung function in cy... Pediatr Pulmonol. 2002 Jun;33(6):483-91. Schaedel C, de Monestrol I, Hjelte L, Johannesson M, Kornfalt R, Lindblad A, Strandvik B, Wahlgren L, Holmberg L
Predictors of deterioration of lung function in cystic fibrosis.
Pediatr Pulmonol. 2002 Jun;33(6):483-91., [PMID:12001283]

Abstract [show]
The severity of lung disease in cystic fibrosis (CF) may be related to the type of mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, and to environmental and immunological factors. Since pulmonary disease is the main determinant of morbidity and mortality in CF, it is important to identify factors that can explain and predict this variation. The aim of this longitudinal study of the whole Swedish CF population over age 7 years was to correlate genetic and clinical data with the rate of decline in pulmonary function. The statistical analysis was performed using the mixed model regression method, supplemented with calculation of relative risks for severe lung disease in age cohorts.The severity of pulmonary disease was to some extent predicted by CFTR genotype. Furthermore, the present investigation is the first long-term study showing a significantly more rapid deterioration of lung function in patients with concomitant diabetes mellitus. Besides diabetes mellitus, pancreatic insufficiency and chronic Pseudomonas colonization were found to be negative predictors of pulmonary function. In contrast to several other reports, we found no significant differences in lung function between genders. Patients with pancreatic sufficiency have no or only a slight decline of lung function with age once treatment is started, but an early diagnosis in this group is desirable.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 Furthermore, the inferred values for FEV1 and VC at age 5 years (the intercepts) were significantly lower TABLE 1- Allele Frequencies of 10 Most Common CFTR Mutations in Swedish CF Population Mutation Allele frequency (%) DF508 67.9 394delTT 7.1 3659delC 6.4 S945L 1.2 R117C 1.0 R117H 0.55 T338I 0.55 G551D 0.55 R553X 0.55 I506L 0.41 compared with those in the other CF patients (63.4% and 68.2% vs. 89% and 93.3%). Login to comment
121 TABLE 3CFTR Mutations Associated With Pancreatic Sufficiency in Swedish CF Population Y109C S549I/S549I Y109N S945L R117C N1088D À R75Q R117H G1244E L206W 711 þ 3A !G T338I 1249 À 5A !G A455E 2789 þ 5G ! Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment
112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL. Login to comment

[hide] Variant cystic fibrosis phenotypes in the absence ... N Engl J Med. 2002 Aug 8;347(6):401-7. Groman JD, Meyer ME, Wilmott RW, Zeitlin PL, Cutting GR
Variant cystic fibrosis phenotypes in the absence of CFTR mutations.
N Engl J Med. 2002 Aug 8;347(6):401-7., 2002-08-08 [PMID:12167682]

Abstract [show]
BACKGROUND: Cystic fibrosis is a life-limiting autosomal recessive disorder with a highly variable clinical presentation. The classic form involves characteristic findings in the respiratory tract, gastrointestinal tract, male reproductive tract, and sweat glands and is caused by loss-of-function mutations in the cystic fibrosis transmembrane conductance regulator (CFTR ) gene. Nonclassic forms of cystic fibrosis have been associated with mutations that reduce but do not eliminate the function of the CFTR protein. We assessed whether alteration in CFTR function is responsible for the entire spectrum of variant cystic fibrosis phenotypes. METHODS: Extensive genetic analysis of the CFTR gene was performed in 74 patients with nonclassic cystic fibrosis who had been referred by 34 medical centers. We evaluated two families that each included a proband without identified mutations and a sibling with nonclassic cystic fibrosis to determine whether there was linkage to the CFTR locus and to measure the extent of CFTR function in the sweat gland and nasal epithelium. RESULTS: Of the 74 patients studied, 29 had two mutations in the CFTR gene, 15 had one mutation, and 30 had no mutations. A final genotype of two mutations was more common among patients who had been referred after screening for common cystic fibrosis-causing mutations identified one mutation than among those who had been referred after screening had identified no such mutations (26 of 34 patients vs. 3 of 40 patients, P<0.001). Comparison of clinical features and sweat chloride concentrations revealed no significant differences among patients with two, one, or no CFTR mutations. Haplotype analysis in the two families revealed no linkage to CFTR. Although each of the affected siblings had elevated sweat chloride concentrations, measurements of cyclic AMP-mediated ion and fluid transport in the sweat gland and nasal epithelium demonstrated the presence of functional CFTR. CONCLUSIONS: Factors other than mutations in the CFTR gene can produce phenotypes clinically indistinguishable from nonclassic cystic fibrosis caused by CFTR dysfunction.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 MUTATION IDENTIFIED BY SCREENING FOR COMMON MUTATIONS MUTATION IDENTIFIED BY DNA SEQUENCING NO. OF PATIENTS ∆F508 5T* 3 ∆F508 D1152H 2 ∆F508 2789+2insA 2 ∆F508 R117C 2 ∆F508 D110H 1 ∆F508 2789+5G→A 1 ∆F508 P205S 1 ∆F508 L967S 1 ∆F508 I1027T 1 ∆F508 L206W 1 ∆F508 T1053I and 5T 1 ∆F508 V920M and 5T 1 ∆F508 R1070W 1 ∆F508 D579G 1 ∆F508 P67L 1 ∆F508 2811G→T†‡ 1 G85E F191V† 1 R117H G103X and 5T 1 I148T I556V 1 G542X R1162L 1 W1282X D1152H 1 None L138ins and 3272-26 A→G 1 None G463D† and 5T 1 None F693L and 5T 1 ∆F508 None 6 G551D None 1 W1282X None 1 None 5T 4 None 2307insA 1 None L997F 1 None V520I 1 None None 30 in Subject II-2 in Family 1. Login to comment

[hide] Association between serum oncofetal antigens CA 19... Acta Paediatr. 2003 Nov;92(11):1267-71. Gronowitz E, Pitkanen S, Kjellmer I, Heikinheimo M, Strandvik B
Association between serum oncofetal antigens CA 19-9 and CA 125 and clinical status in patients with cystic fibrosis.
Acta Paediatr. 2003 Nov;92(11):1267-71., [PMID:14696845]

Abstract [show]
In cystic fibrosis (CF), mucus plugging in the airways and in the gastrointestinal tract leads to severe morbidity and mortality. The mucin-associated antigens CA 19-9 and CA 125 are markers of gastrointestinal malignancy, and CA 19-9 has also been reported in association with pulmonary function in CF. AIM: To test whether these antigens might serve as markers for the severity of pulmonary and gastrointestinal disease in CF. METHODS: In 99 patients, aged 1 to 48 y, serum levels of CA 19-9 and CA 125 were measured by RIA and ELISA and related to clinical data. RESULTS: Patients with severe mutations had significantly increased serum levels of CA 125, indicating an association with a more severe CF phenotype. This was further supported by the association with lung function, chronic pulmonary colonization of Pseudomonas aeruginosa and pancreatic insufficiency. CA 19-9 was also shown to be associated with lung function and Ps. aeruginosa colonization. No gastrointestinal malignancy was found in our patients despite very high values of CA 19-9 in some patients. During a 5-y follow-up, the very high serum levels of CA 19-9 decreased along with improved general condition of the patients. CONCLUSION: Increased serum levels of CA 125 in CF patients were associated with severe cystic fibrosis transmembrane conductance regulator mutations and a severe phenotype. Both antigens were associated with pseudomonas colonization and lung function and CA 125 also with pancreatic insufficiency. The estimates of CA 19-9 are hampered by the influence of the Lewis histo-blood group system on the synthesis of CA 19-9.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 The remaining 23 patients had at least one mild (I506L, R117C, S945L, T338I, W301R, 3849 10KBC → T, 1249-5 → G, R117H, R75Q), moderate (G551D, R560T, V603F) or unknown mutation. Login to comment

[hide] Population-based newborn screening for genetic dis... Pediatrics. 2004 Jun;113(6):1573-81. Comeau AM, Parad RB, Dorkin HL, Dovey M, Gerstle R, Haver K, Lapey A, O'Sullivan BP, Waltz DA, Zwerdling RG, Eaton RB
Population-based newborn screening for genetic disorders when multiple mutation DNA testing is incorporated: a cystic fibrosis newborn screening model demonstrating increased sensitivity but more carrier detections.
Pediatrics. 2004 Jun;113(6):1573-81., [PMID:15173476]

Abstract [show]
OBJECTIVES: Newborn screening for cystic fibrosis (CF) provides a model to investigate the implications of applying multiple-mutation DNA testing in screening for any disorder in a pediatric population-based setting, where detection of affected infants is desired and identification of unaffected carriers is not. Widely applied 2-tiered CF newborn screening strategies first test for elevated immunoreactive trypsinogen (IRT) with subsequent analysis for a single CFTR mutation (DeltaF508), systematically missing CF-affected infants with any of the >1000 less common or population-specific mutations. Comparison of CF newborn screening algorithms that incorporate single- and multiple-mutation testing may offer insights into strategies that maximize the public health value of screening for CF and other genetic disorders. The objective of this study was to evaluate technical feasibility and practical implications of 2-tiered CF newborn screening that uses testing for multiple mutations (multiple-CFTR-mutation testing). METHODS: We implemented statewide CF newborn screening using a 2-tiered algorithm: all specimens were assayed for IRT; those with elevated IRT then had multiple-CFTR-mutation testing. Infants who screened positive by detection of 1 or 2 mutations or extremely elevated IRT (>99.8%; failsafe protocol) were then referred for definitive diagnosis by sweat testing. We compared the number of sweat-test referrals using single- with multiple-CFTR-mutation testing. Initial physician assessments and diagnostic outcomes of these screened-positive infants and any affected infants missed by the screen were analyzed. We evaluated compliance with our screening and follow-up protocols. All Massachusetts delivery units, the Newborn Screening Program, pediatric health care providers who evaluate and refer screened-positive infants, and the 5 Massachusetts CF Centers and their affiliated genetic services participated. A 4-year cohort of 323 506 infants who were born in Massachusetts between February 1, 1999, and February 1, 2003, and screened for CF at approximately 2 days of age was studied. RESULTS: A total of 110 of 112 CF-affected infants screened (negative predictive value: 99.99%) were detected with IRT/multiple-CFTR-mutation screening; 2 false-negative screens did not show elevated IRT. A total of 107 (97%) of the 110 had 1 or 2 mutations detected by the multiple- CFTR-mutation screen, and 3 had positive screens on the basis of the failsafe protocol. In contrast, had we used single-mutation testing, only 96 (87%) of the 110 would have had 1 or 2 mutations detectable by single-mutation screen, 8 would have had positive screens on the basis of the failsafe protocol, and an additional 6 infants would have had false-negative screens. Among 110 CF-affected screened-positive infants, a likely "genetic diagnosis" was made by the multiple-CFTR-mutation screen in 82 (75%) versus 55 (50%) with DeltaF508 alone. Increased sensitivity from multiple-CFTR-mutation testing yielded 274 (26%) more referrals for sweat testing and carrier identifications than testing with DeltaF508 alone. CONCLUSIONS: Use of multiple-CFTR-mutation testing improved sensitivity and postscreening prediction of CF at the cost of increased referrals and carrier identification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
142 This infant also carries a mutation (R117C) that is not present on either panel or on the population-screening panel recommended by the American College of Medical Genetics.26 The other 2 CF-affected infants presumably have CFTR mutations not yet identified. Login to comment
150 112 CF-Affected MA Infants Who Were Screened: Details of CF Newborn Screening Results and Diagnostic Follow-up Sweat Test Result (mEq Cl-/L) CF-Screen Positive CF-Screen Negative Total 2 Mutations 1 Mutation 0 Mutations Positive (Ն60) 62 19 3 2 86 Borderline (Ն30 and Ͻ60) Within expectations for specific CF genotype* 5 3 8¶ Monozygotic twin sweat test positive† 1 1 Negative (Ͻ30) Within expectations for specific CF genotype‡ 4 1 5 Incomplete (not done or QNS) 2 CFTR mutations identified and clinical symptoms§ 6 1 7 2 CFTR mutations identified without clinical symptoms࿣ 5 5 Total 82 25 3 2 112 * ⌬F508/R117H;7T (3), ⌬F508/3849 ϩ 10kb (2), ⌬F508/L206W (1), G551D/R117C (1), and G85E/R117C (1). Login to comment
159 Genotypes and Frequencies Observed in 112 CF-Affected Infants First Mutation Second Mutation N ⌬F508 ⌬F508 55 ⌬F508 R117H 7* ⌬F508 G551D 4 ⌬F508 N1303K 3 ⌬F508 W1282X 3 ⌬F508 G542X 2 ⌬F508 1898 ϩ 1 G Ͼ A 2 G85E R117C 2 ⌬F508 1717-GϾA 1 ⌬F508 3849 ϩ 10kbC Ͼ T 1 ⌬F508 R1066C 1 ⌬F508 Y1092X 1 ⌬F508 L206W 1 ⌬F508 R560T 1 ⌬F508 1152H 1 ⌬F508 621 ϩ 1G Ͼ T 1 R117H G551D 1 R117H G85E 1 G551D 2789 ϩ 5GϾA 1 G551D R117C 1 G85E 711 ϩ 1GϾT 1 W1282X 3849 ϩ 10kbCϾT 1 R553X 2183AAϾG 1 A455E S549R 1 ⌬F508 Unknown† 13 N1303K Unknown 2 G542X Unknown 1 Unknown Unknown 2 * Includes 1 of the false-negative screens. Login to comment
171 ࿣ Presumed second CFTR mutation: 2183AAϾG, R117C (2), S549R, and "not present in additional mutation analysis and yet to be identified" (2). Login to comment
173 # One infant`s genotype: G85E/R117C screening done with 16-mutation panel before inclusion of G85E in the 27-mutation panel; other 2 infant`s genotypes: "not present in additional mutation analysis and yet to be identified" for the 2 alleles. Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment

[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]

Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment
78 b 5T reflex testing is performed for R117H- and R117C-positive individuals. Login to comment

[hide] Late diagnosis defines a unique population of long... Am J Respir Crit Care Med. 2005 Mar 15;171(6):621-6. Epub 2004 Dec 10. Rodman DM, Polis JM, Heltshe SL, Sontag MK, Chacon C, Rodman RV, Brayshaw SJ, Huitt GA, Iseman MD, Saavedra MT, Taussig LM, Wagener JS, Accurso FJ, Nick JA
Late diagnosis defines a unique population of long-term survivors of cystic fibrosis.
Am J Respir Crit Care Med. 2005 Mar 15;171(6):621-6. Epub 2004 Dec 10., 2005-03-15 [PMID:15591474]

Abstract [show]
Although the median survival for patients with cystic fibrosis (CF) is 32.9 years, a small group of patients live much longer. We analyzed the genotype and phenotype of CF patients 40 years and older seen between 1992 and 2004 at the National Jewish Medical and Research Center (n = 55). These patients were divided into two groups according to age at diagnosis: an early diagnosis (ED) group, median age at diagnosis 2.0 years (range 0.1-15 years, n = 28), and a late diagnosis (LD) group, median age of diagnosis 48.8 years (range 24-72.8 years, n = 27). Consistent with the hypothesis that the CFTR genotype affects the age at diagnosis, CFTR DeltaF508 homozygous individuals were more common in the ED group. Although patients in the ED group were predominantly male, the majority of LD patients were female. Patients with CF diagnosed late had a significantly lower prevalence of pancreatic insufficiency and CF-related diabetes, and better lung function. Fewer patients in the LD groups were infected with Pseudomonas aeruginosa, whereas a greater percentage had cultures positive for nontuberculous mycobacteria. This is the largest cohort of older patients with CF described to date, and our findings indicate that patients diagnosed as adults differ distinctly from survivors of long-term CF diagnosed as children.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 GENOTYPE DISTRIBUTION Early Diagnosis Late Diagnosis ⌬F508/⌬F508 10 1 ⌬F508/⌬I507 1 ⌬F508/G551D 1 ⌬F508/M1101K 1 ⌬F508/P67L/11027T 1 ⌬F508/3120G-A 1 ⌬F508/2789ϩ5G-A 1 2 ⌬F508/W1282X 1 ⌬F508/621ϩ1G-T 1 ⌬F508/R347P 1 ⌬F508/3849ϩ10kbC-T 1 1 ⌬F508/A455E 2 ⌬F508/R347H 2 ⌬F508/D1152H 1 ⌬508/I148T 1 ⌬F508/R117H 1 ⌬F508/Y109N 1 ⌬F508/IVS8-5T 1 ⌬F508/unknown 3 5 S1251N/D1152H 1 G542X/R117C 1 R117H/G551D 1 W1282X/D1152H 1 Unknown 4 4 Values represent number of individuals in each diagnostic group with each genotype. Login to comment

[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]

Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]

Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 This test involved nine subjects from the infertile group, revealing the occurrence of the following rare mutations: E217G, T1054A, W356X, D443Y and 3667insTC in males and L997F and R297Q in females and 29 subjects from the control, in which we found: A1009T, D110Y, E826K, G1069R, G1130A, G194V, I556V, L320F, M348K, M82V, P1290T, R117C, R352W, R74W, S42F, S660T, S911R, S912L, T1086A, T582S, V920L and Y89C. Login to comment

[hide] Extensive sequencing of the CFTR gene: lessons lea... Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28. McGinniss MJ, Chen C, Redman JB, Buller A, Quan F, Peng M, Giusti R, Hantash FM, Huang D, Sun W, Strom CM
Extensive sequencing of the CFTR gene: lessons learned from the first 157 patient samples.
Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28., [PMID:16189704]

Abstract [show]
Cystic fibrosis (CF) is one of the most common monogenic diseases affecting Caucasians and has an incidence of approximately 1:3,300 births. Currently recommended screening panels for mutations in the responsible gene (CF transmembrane regulator gene, CFTR) do not detect all disease-associated mutations. Our laboratory offers extensive sequencing of the CFTR (ABCC7) gene (including the promoter, all exons and splice junction sites, and regions of selected introns) as a clinical test to detect mutations which are not found with conventional screening. The objective of this report is to summarize the findings of extensive CFTR sequencing from our first 157 consecutive patient samples. In most patients with classic CF symptoms (18/24, 75%), extensive CFTR sequencing confirmed the diagnosis by finding two disease-associated mutations. In contrast, only 5 of 75 (7%) patients with atypical CF had been identified with two CFTR mutations. A diagnosis of CF was confirmed in 10 of 17 (58%) newborns with either positive sweat chloride readings or positive immunoreactive trypsinogen (IRT) screen results. We ascertained ten novel sequence variants that are potentially disease-associated: two deletions (c.1641AG>T, c.2949_2853delTACTC), seven missense mutations (p.S158T, p.G451V, p.K481E, p.C491S, p.H949L, p.T1036N, p.F1099L), and one complex allele ([p.356_A357del; p.358I]). We ascertained three other apparently novel complex alleles. Finally, several patients were found to carry partial CFTR gene deletions. In summary, extensive CFTR gene sequencing can detect rare mutations which are not found with other screening and diagnostic tests, and can thus establish a definitive diagnosis in symptomatic patients with previously negative results. This enables carrier detection and prenatal diagnosis in additional family members.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 DF508/c.546insCTA CF; lung symptoms; PS; 2 sibs with CF NG Pos p.R1066C/c.3272-26 A>G Mild CF 40 115 [p.V562I;p.A1006E]b /p.R1158X CF, FTT 6 Not done DF508/c.1716G>A Classic CF 21 Not done p.R785X/c.2732insA Classic CF, PI 4 Not done DF508/p.R117C Classic CF 2 Not done DF508/p.R75X CF 19 Pos DF508/p.G451Va Mild CF 23 Pos DF508/p.L206W Classic CF 9 150s DF508/p.G542Xc Classic CF 15 Pos p.T1036N/p.T1036Na CF, PS 9 Pos DF508/c.3272-26 A>G Classic CF 33 Not done DF508/p.R117Hc Classic CF 35 Not done DF508/p.A455Ec CF 3 Pos p.G551D/p.Y275X a Novel CFTR variant b Complex CFTR allele c Both mutations are on the ACMG/ACOG panel Table 5 Diagnosis of CF in infants/newborns with abnormal newborn screening results Patient number Genotype Age at sequencing Sex Newborn screen result Sweat chloride concentration (mmol/l)a Phenotype 1 DF508/c.2789+2insA 3 months F Positive sweat test 88,96,89,84 Dx of CF, being treated prophylactically 2 DF508/c.2949del5b 3 months F IRT positive 105 Dx of CF 3 p.G551D/c.1259insA 14 months M Positive sweat test ?

In reference to DF508 and 1716G>A. Does this mean these two mutation have resulted in "classic CF"? Does this mean 1716G>A is disease causing?
Gibson75 on 2013-08-12 07:00:25

Login to comment

[hide] Diagnostic dilemmas resulting from the immunoreact... J Pediatr. 2005 Sep;147(3 Suppl):S78-82. Parad RB, Comeau AM
Diagnostic dilemmas resulting from the immunoreactive trypsinogen/DNA cystic fibrosis newborn screening algorithm.
J Pediatr. 2005 Sep;147(3 Suppl):S78-82., [PMID:16202789]

Abstract [show]
OBJECTIVE: To quantitate the proportion of infants identified through cystic fibrosis (CF) newborn screening (NBS) by an immunoreactive trypsinogen (IRT)/DNA screening algorithm who have an unclear diagnosis as defined by the findings of an elevated IRT level and either 1) 2 CF gene (CFTR) mutations detected and sweat chloride level <60 mEq/L; or 2) 0 or 1 CFTR mutations and a "borderline" sweat chloride level >or=30 and <60 mEq/L. STUDY DESIGN: Using the 4-year cohort of CF-affected infants recently described by the Massachusetts CF NBS program, we identified and described the number of infants with the diagnostic characteristics (diagnostic dilemmas) aforementioned. RESULTS: Of infants with positive results on CF NBS who had 1 CFTR mutation detected and a borderline sweat chloride concentration, nearly 20% displayed a second CFTR mutation on further evaluation. Of all infants with positive CF NBS results considered affected with CF, 11% had a diagnosis that fell into 1 of the diagnostic dilemma categories aforementioned. CONCLUSIONS: Four problematic diagnostic categories generated by CF NBS are defined. In the absence of data on the natural history of such infants, careful follow-up is recommended for infants in whom a definitive diagnosis is elusive.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 Two infants with DF508/5T and borderline sweat chloride values were not included in the count of the true positive cohort, however follow-up continues Group IRT (mg/ml) IRT % CFTR Allele 1 CFTR Allele 2 [Cl2 ] mEq/L Sex I 64 97 DF508 R117H-7T 34 F 179 100 DF508 R117H-7T 33 F 79 99 DF508 R117H-7T 49 M 97 99 W1282X 3849110kb 54 M II 176 99.8 DF508 R117H-7T 24 F 129 99.7 G85E R117H 21 F 84 99 G551D R117H-7T 27 M III 94 99.1 DF508 unknown 58 M* 142 100 G85E R117C 33 F 72 98 G551D R117C 46 F 100 99.2 DF508 L206W 35 M IV 141 100 G85Ey R117C 41 M *Identified twin sibling has [Cl2 ] > 60 mEq/L. Login to comment

[hide] Two-tiered immunoreactive trypsinogen-based newbor... J Pediatr. 2005 Sep;147(3 Suppl):S83-8. Sontag MK, Hammond KB, Zielenski J, Wagener JS, Accurso FJ
Two-tiered immunoreactive trypsinogen-based newborn screening for cystic fibrosis in Colorado: screening efficacy and diagnostic outcomes.
J Pediatr. 2005 Sep;147(3 Suppl):S83-8., [PMID:16202790]

Abstract [show]
OBJECTIVE: To examine immunoreactive trypsinogen (IRT)-based screening for cystic fibrosis (CF) for recall rate, genotype distribution, and "borderline" sweat test results. STUDY DESIGN: CF newborn screening in Colorado began in 1982, and >1,153,000 infants were screened through 2002 with an IRT-based screen (IRT/IRT). RESULTS: We have identified 313 infants with CF, giving an overall incidence of 1 in 3684 and a Hispanic incidence of 1 in 6495. Fifty-five infants with meconium ileus (17.6%) were excluded from analysis. Fourteen infants with false-negative results were identified (5.4%). The average recall rate was 0.6%, with a positive predictive value of 4.7%. Ninety-three percent of the infants had at least 1 DeltaF508 mutation, and 98% of the infants had at least 1 mutation from the American College of Medical Genetics recommended panel. Six infants had hypertrypsinogenemia and borderline results on sweat tests (30-60 mmol/L). Increased variability in sweat chloride levels were seen in these infants compared with infants with homozygous DeltaF508. Three children with initial borderline results on sweat tests had CF diagnosed. CONCLUSIONS: The recall and false-negative rates of our IRT/IRT CF screening program are reported. Additionally, genotypes of the patients identified mirror the CF population genotypes, reflecting similar disease severity in the screened population. Finally, infants with persistent hypertrypsinogenemia and borderline sweat test results need long-term follow-up.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 The pancreatic sufficient mutations identified were 18981 5G>T, 278915G>A, A455E, G551S, G85E, I336K, P67L, R117C, R117H, R334W, R347P. Login to comment
129 Initial and repeat sweat chloride values and CFTR mutations in infants with borderline sweat test results Sweat Cl2 (mmol/L) Infant <6 months >6 months Genotype A 55 65 DF508/A455E B 50 - DF508/R117H C 45 77 DF508/R117C (7T/9T) D 33 26 DF508/- E 43 76 R117H/F575Y (7T,7T) F 43 25 312011G-A/- Figure 4. Login to comment

[hide] The relevance of sweat testing for the diagnosis o... Clin Biochem Rev. 2005 Nov;26(4):135-53. Mishra A, Greaves R, Massie J
The relevance of sweat testing for the diagnosis of cystic fibrosis in the genomic era.
Clin Biochem Rev. 2005 Nov;26(4):135-53., [PMID:16648884]

Abstract [show]
Cystic fibrosis (CF) is the most common inherited disorder of childhood. The diagnosis of CF has traditionally been based on clinical features with confirmatory evidence by sweat electrolyte analysis. Since 1989 it has been possible to also use gene mutation analysis to aid the diagnosis. Cloning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has advanced our understanding of CF, in particular the molecular basis of an expanded CF phenotype. However, because there are over 1000 mutations and 200 polymorphisms, many without recognised effects on CFTR, the molecular diagnosis can be troublesome. This has necessitated measurement of CFTR function with renewed interest in the sweat test. This review provides an overview of the clinical features of CF, the diagnosis and complex genetics. We provide a detailed discussion of the structure and function of CFTR and the classification of CFTR mutations. Sweat electrolyte analysis is discussed, from the physiology of sweating to the rigours of a properly performed sweat test and its interpretation. With this information it is possible to understand the relevance of the sweat test in the genomic era.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
446 Nat Genet 1993;5:274-8. 77. Massie RJ, Poplawski N, Wilcken B, Goldblatt J, Byrnes C, Robertson C. Intron-8 polythymidine sequence in Australasian individuals with CF mutations R117H and R117C. Login to comment

[hide] Mutations in the cystic fibrosis transmembrane reg... Am J Respir Crit Care Med. 2006 Oct 1;174(7):787-94. Epub 2006 Jul 13. Wilschanski M, Dupuis A, Ellis L, Jarvi K, Zielenski J, Tullis E, Martin S, Corey M, Tsui LC, Durie P
Mutations in the cystic fibrosis transmembrane regulator gene and in vivo transepithelial potentials.
Am J Respir Crit Care Med. 2006 Oct 1;174(7):787-94. Epub 2006 Jul 13., 2006-10-01 [PMID:16840743]

Abstract [show]
AIM: To examine the relationship between cystic fibrosis transmembrane regulator gene mutations (CFTR) and in vivo transepithelial potentials. METHODS: We prospectively evaluated 162 men including 31 healthy subjects, 21 obligate heterozygotes, 60 with congenital bilateral absence of the vas deferens (CBAVD) and 50 with CF by extensive CFTR genotyping, sweat chloride and nasal potential difference testing. RESULTS: Six (10%) men with CBAVD carried no CFTR mutations, 18 (30%) carried one mutation, including the 5T variant, and 36 (60%) carried mutations on both alleles, for a significantly higher rate carrying one or more mutations than healthy controls (90% versus 19%, p < 0.001). There was an overlapping spectrum of ion channel measurements among the men with CBAVD, ranging from values in the control and obligate heterozygote range at one extreme, to values in the CF range at the other. All pancreatic-sufficient patients with CF and 34 of 36 patients with CBAVD with mutations on both alleles carried at least one mild mutation. However, the distribution of mild mutations in the two groups differed greatly. Genotyping, sweat chloride and nasal potential difference (alone or in combination) excluded CF in all CBAVD men with no mutations. CF was confirmed in 56% and 67% of CBAVD men carrying 1 and 2 CFTR mutations, respectively. CONCLUSION: Abnormalities of CFTR transepithelial function correlate with the number and severity of CFTR gene mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 CFTR GENE MUTATIONS IN THE PATIENT GROUPS Control Subjects (n ϭ 31) Heterozygotes (n ϭ 21) CBAVD-1 (n ϭ 18) CBAVD-2 (n ϭ 36) CF-PS (n ϭ 24) CF-PI (n ϭ 26) G542X*/R75Q ⌬F508*/- (n ϭ 16) ⌬F508* (n ϭ 6) ⌬F508*/2789ϩ5G→A* ⌬F508*/R117H [5T]* (n ϭ 4) ⌬F508*/⌬F508* (n ϭ 11) ⌬F508* ⌬F508*/5T W1282X*/5T (n ϭ 8) R334W*/R334W* ⌬F508*/A455E* (n ϭ 2) ⌬F508*/G542X* (n ϭ 2) G542X* W1282X*/- (n ϭ 2) D1152H† ⌬F508*/R117H [7T] (n ϭ 10) ⌬F508*/3849ϩ10kbC→T* (n ϭ 2) ⌬F508*/G551D* (n ϭ 2) R117H[7T] G85E† /R75Q L206W† ⌬F508*/R117C [7T] G551D*/3849ϩ10kbC→T* ⌬F508*/621ϩ1G→T* (n ϭ 2) S431G R75Q/- A198P G551D*/R117H [7T] ⌬F508*/3272-26A→G† (n ϭ 2) ⌬F508*/2789ϩ5 G→A* 5T ⌬F508*/5T (n ϭ 8) ⌬F508*/P574H† (n ϭ 2) ⌬F508*/W1282X* G542X*/5T ⌬F508*/I1234V† ⌬F508*/G85E* W1282X*/5T ⌬F508*/P67L† ⌬F508*/L1077P† (n ϭ 2) ⌬F508*/P67L† ⌬F508*/R347H† G551D*/G480C† ⌬F508*/L206W† ⌬F508*/5T ⌬F508*/- (n ϭ 2) ⌬F508*/M952T† ⌬F508*/875ϩ1G→C† -/- ⌬F508*/S549R† G551D*/R75Q A455E*/L206W† ⌬F508*/- (n ϭ 2) 621ϩG→T*/R117C [7T] A455E*/- R117H [7T]/5T ⌬I507*/- R117L[7T]/5T -/- R117H/R117H [7T/7T] D979A/5T 5T/-741T→G 4016insT† /D110H Definition of abbreviations: CBAVD ϭ congenital bilateral absence of the vas deferens; CF-PI ϭ pancreatic-insufficient cystic fibrosis; CF-PS ϭ pancreatic-sufficient cystic fibrosis. Login to comment

[hide] Airway nitric oxide in patients with cystic fibros... Chest. 2007 Jun;131(6):1857-64. Epub 2007 Mar 30. Keen C, Olin AC, Edentoft A, Gronowitz E, Strandvik B
Airway nitric oxide in patients with cystic fibrosis is associated with pancreatic function, Pseudomonas infection, and polyunsaturated fatty acids.
Chest. 2007 Jun;131(6):1857-64. Epub 2007 Mar 30., [PMID:17400678]

Abstract [show]
BACKGROUND: Airway nitric oxide (NO) is low or normal in cystic fibrosis (CF) patients. This may affect bacterial status since NO has antimicrobial properties. Arachidonic acid (AA), which is increased in the serum and airways of CF patients, has been shown to reduce NO levels. The aim of this study was to investigate whether airway NO level correlates with genotype and pancreatic function, and whether low airway NO level is associated with bacterial infection and increased serum AA level in CF patients. METHOD: Nasal NO (nNO) and exhaled NO (eNO) were measured according to the European Respiratory Society/American Thoracic Society standard in 59 CF patients aged 7 to 55 years, 80% of whom were pancreatic insufficient (PI) and 51% were chronically infected with Pseudomonas aeruginosa. RESULTS: PI CF patients had significantly lower nNO levels than pancreatic-sufficient (PS) patients. Airway NO level did not correlate with lung function or inflammatory parameters. PI patients chronically infected with P aeruginosa had significantly lower nNO levels than noninfected PI patients. nNO level correlated inversely with the AA/docosahexaenoic acid ratio, and eNO with the essential fatty acid (FA) deficiency index, which is the ratio between mead acid and AA. CONCLUSIONS: CF patients with PI, which is associated with more severe genotypes, had lower airway NO levels than patients with PS. Low NO level was correlated to chronic P aeruginosa infection, and an association was found between airway NO level and the abnormal serum phospholipid FA pattern.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Patients in group 3 were heterozygous for mutations dF508 and V603F, R560T, or 621 ϩ 1G-T; group 4 patients were heterozygous for mutations dF508, 3659del C, or 394delTT and a mutation linked to a "mild" phenotype (eg, N1088D, R117C, R117H, R75Q, R658X, S945L, 1154insTC, or T338I). Login to comment

[hide] Distribution of CFTR mutations in Saguenay- Lac-Sa... Genet Med. 2008 Mar;10(3):201-6. Madore AM, Prevost C, Dorfman R, Taylor C, Durie P, Zielenski J, Laprise C
Distribution of CFTR mutations in Saguenay- Lac-Saint-Jean: proposal of a panel of mutations for population screening.
Genet Med. 2008 Mar;10(3):201-6., [PMID:18344710]

Abstract [show]
PURPOSE: Saguenay-Lac-Saint-Jean is a region located in the northeastern part of the Province of Quebec, Canada, and is characterized by a founder effect. In this region, it has been documented that the incidence of cystic fibrosis reached 1/902 live births between 1975 and 1988, three times higher than the average incidence of 1/2500 live births reported in other Caucasian populations. This corresponds to a carrier rate of 1/15. METHODS: Using genotyping data from the Canadian Consortium for Cystic Fibrosis Genetic Studies, this article describes the cystic fibrosis transmembrane conductance regulator profile of the cystic fibrosis population living in the Saguenay-Lac-Saint-Jean region and compares it with cystic fibrosis populations living in three other regions of the Province of Quebec. RESULTS: Significant differences in allelic frequencies of common mutations (as DeltaF508, 621 + 1G>T and A455E), and in percentage of covered allele with three or six mutations, were found in Saguenay-Lac-Saint-Jean compared to other regions. Based on this result, two mutation panels exceeding 90% sensitivity threshold are now proposed for cystic fibrosis carrier screening in this region. CONCLUSION: The implementation of the proposed carrier screening program could diminish the incidence of this disease in this region and allow future parents to make informed decisions about family planning.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Altogether, the six mutations represent 95.89% of the CFTR allele of CF patients in the SLSJ population, whereas the proportions are 86.85, 85.27, and Table 2 Cystic fibrosis mutations present in the four populations studied Mutationa Allelic frequency (number of alleles [%]) Populationb 1 2 3 4 „F508 106 (62.35) 55 (72.37) 398 (72.36) 67 (57.78) 621 ؉ 1G>T 42 (24.71) 6 (7.89) 30 (5.45) 1 (0.85) A455E 12 (7.06) 2 (2.63) 14 (2.55) 1 (0.85) 3199del6 1 (0.59) 1 (1.32) 7 (1.27) 1 (0.85) 711 ؉ 1G>T 1 (0.59) 1 (1.32) 15 (2.73) 1 (0.85) Y1092X 1 (0.59) 1 (1.32) 5 (0.91) 0 R117C 2 (1.18) 0 0 0 ‚I507 1 (0.59) 2 (2.63) 10 (1.82) 0 L206W 1 (0.59) 1 (1.32) 9 (1.64) 0 R1158X 1 (0.59) 0 0 0 S489X 1 (0.59) 0 1 (0.18) 0 R553X 0 2 (2.63) 2 (0.36) 0 R334W 0 1 (1.32) 2 (0.36) 0 G542X 0 0 10 (1.82) 0 G85E 0 0 6 (1.09) 5 (4.24) N1303K 0 0 5 (0.91) 1 (0.85) IVS8-5T 0 0 4 (0.73) 0 W1282X 0 0 3 (0.55) 7 (5.93) R347P 0 0 1 (0.18) 2 (1.69) V520F 0 0 1 (0.18) 0 I1027T 0 0 1 (0.18) 0 R1066C/IVS 0 0 1 (0.18) 0 Q1313X 0 0 1 (0.18) 0 1898ϩ3GϾA 0 0 1 (0.18) 0 2183AAϾG 0 0 1 (0.18) 0 2951insA 0 0 1 (0.18) 0 G551D 0 0 0 2 (1.69) 1525-iG-A 0 0 0 2 (1.69) Y109C 0 0 0 1 (0.85) S549N 0 0 0 1 (0.85) 3154del1G 0 0 0 1 (0.85) UNKNOWN 1 (0.59) 4 (5.26) 20 (3.82) 25 (21.19) Number of alleles genotypedc 170 (100) 76 (100) 550 (100) 118 (100) a The six mutations included in the panels proposed are in bold. Login to comment

[hide] Identification of positive charges situated at the... Pflugers Arch. 2008 Nov;457(2):351-60. Epub 2008 May 1. Zhou JJ, Fatehi M, Linsdell P
Identification of positive charges situated at the outer mouth of the CFTR chloride channel pore.
Pflugers Arch. 2008 Nov;457(2):351-60. Epub 2008 May 1., [PMID:18449561]

Abstract [show]
We have used site-directed mutagenesis and functional analysis to identify positively charged amino acid residues in the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel that interact with extracellular anions. Mutation of two positively charged arginine residues in the first extracellular loop (ECL) of CFTR, R104, and R117, as well as lysine residue K335 in the sixth transmembrane region, leads to inward rectification of the current-voltage relationship and decreased single channel conductance. These effects are dependent on the charge of the substituted side chain and on the Cl(-) concentration, suggesting that these positive charges normally act to concentrate extracellular Cl(-) ions near the outer mouth of the pore. Side chain charge-dependent effects are mimicked by manipulating charge in situ by mutating these amino acids to cysteine followed by covalent modification with charged cysteine-reactive reagents, confirming the location of these side chains within the pore outer vestibule. State-independent modification of R104C and R117C suggests that these residues are located at the outermost part of the pore. We suggest that ECL1 contributes to the CFTR pore external vestibule and that positively charged amino acid side chains in this region act to attract Cl(-) ions into the pore. In contrast, we find no evidence that fixed positive charges in other ECLs contribute to the permeation properties of the pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 State-independent modification of R104C and R117C suggests that these residues are located at the outermost part of the pore. Login to comment
89 The expected side chain charge at R104C and R117C following modification by these reagents mirrored the effects of mutation to Fig. 3 Charge and chloride dependence of current rectification in mutant forms of CFTR. Login to comment
95 Mean of data from four to six patches in both a and b side chains bearing different charges (Fig. 5b), with the possible exception that R117C modified by MTSES did not show the same degree of inward rectification seen in R117E. Login to comment
100 However, using the same MTS pretreatment protocols as in our previous study [2] (see "Materials and methods"), we found that both R104C and R117C could be modified by both MTSET and MTSES prior to channel activation, effectively mimicking the effects of inclusion of these substances in the pipette solution on rectification of the I-V relationship (Fig. 6). Login to comment
101 This suggests that both positively and negatively charged MTS reagents can modify both R104C and R117C independently of the state of channel activation, a situation that contrasts with R334C, K335C, and other TM6 mutants. Login to comment
103 As shown in Fig. 7, external application of pCMBS also increased the inward rectification seen in R104C and R117C, consistent with deposition of a negative charge on the cysteine present at these positions. Login to comment
128 Our present study, together with previous work on R334 [6,8,22,26], has surveyed the effects of removing all permanent positive charges (contributed by arginine and lysine side chains) in the outer TMs and ECLs on the permeation properties of Fig. 6 Modification of R104C and R117C by MTSES is independent of channel activation. Login to comment
131 b Mean rectification ratios for R104C (left) and R117C (right) under control conditions (open bars) and following modification by MTSET or MTSES using a pretreatment protocol (black bars) or by inclusion in the pipette (gray bars; see Fig. 5). Login to comment
134 a Example relative current-voltage (IREL-V) relationships for R104C (left) and R117C (right) under control conditions and with MTSET or MTSES present in the pipette solution. Login to comment
150 Mean of data from four to six patches in both b and c Fig. 7 Modification of R104C and R117C by pCMBS. Login to comment
152 b Mean rectification ratios for R104C (left) and R117C (right) under control conditions (open bars) and following modification by pCMBS using a pretreatment protocol (black bars) or by inclusion in the pipette (gray bars). Login to comment

[hide] Sweat gland bioelectrics differ in cystic fibrosis... Thorax. 2009 Nov;64(11):932-8. Epub 2009 Sep 3. Gonska T, Ip W, Turner D, Han WS, Rose J, Durie P, Quinton P
Sweat gland bioelectrics differ in cystic fibrosis: a new concept for potential diagnosis and assessment of CFTR function in cystic fibrosis.
Thorax. 2009 Nov;64(11):932-8. Epub 2009 Sep 3., [PMID:19734129]

Abstract [show]
BACKGROUND: For nearly 50 years the diagnosis of cystic fibrosis (CF) has depended on measurements of sweat chloride concentration. While the validity of this test is universally accepted, increasing diagnostic challenges and the search for adequate biomarker assays to support curative-orientated clinical drug trials have created a new demand for accurate, reliable and more practical CF tests. A novel concept is proposed that may provide a more efficient real-time method for assessing CFTR function in vivo. METHODS: Cholinergic and beta-adrenergic agonists were iontophoresed to stimulate sweating. The bioelectric potential from stimulated sweat glands (SPD) was measured in vivo using a standard ECG electrode applied to the skin surface. SPD and sweat chloride concentrations were compared in cohorts predicted to express a range of CFTR function as presented by healthy controls (HC), heterozygotes (Hz), pancreatic sufficient (CFPS) and pancreatic insufficient patients with CF (CFPI). RESULTS: The median SPD was hyperpolarized in patients with CF compared with control subjects (-47.4 mV vs -14.5 mV, p<0.001). In distinguishing between control and CF subjects, SPD (area under receiver operator curve (AUC) = 0.997) was similar to sweat chloride concentration (AUC = 0.986). Sequential cholinergic/beta-adrenergic sweat stimulation dramatically depolarised the SPD in patients with CF (p<0.001) but had no effect in control subjects (p = 0.6) or on the sweat chloride concentration in either group (p>0.5). Furthermore, the positive SPD response was larger in CFPI than in CFPS subjects (p = 0.04). CONCLUSION: These results support the concept that skin surface voltages arising from stimulated sweat glands can be exploited to assess expressed CFTR function in vivo and may prove to be a useful diagnostic tool.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Table 1 Summary of study subjects ID Category Sex Age Genotype ID Category Sex Age Genotype 1 HC F 49 +/+ 21 CFPS M 46 deltaF508/P67L 2 HC F 39 +/+ 22 CFPS F 41 deltaF508/R117C 3 HC M 32 +/+ 23 CFPS F 57 G542X/D1152H 4 HC M 23 +/+ 24 CFPS M 34 deltaF508/M1101K 5 HC F 28 +/+ 25 CFPS F 29 deltaF508/L1335P 6 HC M 26 +/+ 26 CFPS F 48 deltaF508/+ 7 HC M 26 R75Q/+ 27 CFPS M 26 deltaF508/R117H 8 HC M 30 +/+ 28 CFPS M 44 deltaF508/3272_26A.G 9 HC M 22 +/+ 29 CFPS M 46 deltaF508/R117H 5T 10 HC M 22 +/+ 30 CFPS M 48 R347P/2753-2A.G 11 Hz F 26 deltaF508/+ 31 CFPI M 29 deltaF508/deltaF508 12 Hz F 54 deltaF508/+ 32 CFPI M 29 deltaF508/2194inA 13 Hz F 24 deltaF508/+ 33 CFPI F 40 G551D/621+1 G.T 14 Hz F 33 deltaF508/+ 34 CFPI M 33 deltaF508/deltaF508 15 Hz M 25 deltaF508/+ 35 CFPI M 27 deltaF508/deltaF508 16 Hz F 37 deltaF508/+ 36 CFPI M 25 deltaF508/deltaF508 17 Hz F 49 deltaF508/+ 37 CFPI M 27 deltaF508/deltaF508 18 Hz M 49 deltaF508/+ 38 CFPI M 29 deltaF508/deltaF508 19 Hz F 55 deltaF508/+ 20 Hz M 61 deltaF508/+ CFPI, pancreatic-insufficient CF patients; CFPS, pancreatic-sufficient CF patients; HC, healthy controls; Hz, heterozygotes. Login to comment

[hide] Clinical phenotype of cystic fibrosis patients wit... QJM. 2009 Nov;102(11):793-8. Epub 2009 Sep 4. Comer DM, Ennis M, McDowell C, Beattie D, Rendall J, Hall V, Elborn JS
Clinical phenotype of cystic fibrosis patients with the G551D mutation.
QJM. 2009 Nov;102(11):793-8. Epub 2009 Sep 4., [PMID:19734299]

Abstract [show]
BACKGROUND: Data on whether the phenotype of cystic fibrosis (CF) patients with compound heterozygocity for G551D (Gly551Asp) differs from patients with F508del (Phe508del) homozygous mutations is divergent. AIM: We hypothesized that CF patients with the G551D mutation would have less severe disease than F508del homozygotes. DESIGN: We compared the clinical phenotype of adult patients with a G551D mutation with adult patients homozygous for F508del and those with the missense mutation R117H (Arg117His). Compound heterozygotes for the G551D and R117H were analysed separately. METHODS: Data were collected for 101 adult CF patients. Group 1-4 represents in order F508del homozygote patients (n = 61), those with the G551D mutation and a more severe mutation (n = 13), those with R117H mutation and a more severe mutation (n = 23) and also those compound for both the R117H and G551D mutations (n = 4). RESULTS: Our findings have shown that adult patients with the G551D mutation and a second severe mutation have a milder clinical phenotype than F508del homozygous adult patients. Higher FEV(1) and body mass index and less impaired glucose tolerance was demonstrated in the patients with G551D and R117H compared to F508del homozygotes. There was a reduced yearly rate of decline of FEV(1) (P < 0.05), infection with Pseudomonas aeruginosa along with reduced burden of care. Compound heterozygosity for G551D and R117H mutations was associated with normal spirometry, body mass index, no chronic infection and no symptoms. CONCLUSION: Mutations on different chromosomes are not independent of each other for the overall impact on the amount of functional CFTR. This study suggests that patients with the G551D mutation and a second severe mutation have a milder clinical phenotype than F508del homozygous patients, but the phenotype is not as mild as patients with the R117H mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 In contrast to the number of T repeats, high numbers of TG repeats will result in a reduced amount of functional CFTR.16 The incidence of R117H on an IVS8-5T background was much higher in our cohort in comparison to a multicentre study of patients with the R117H/C mutation (39 with the R117H and 2 with the R117C mutation). Login to comment

[hide] Cystic fibrosis newborn screening: using experienc... J Inherit Metab Dis. 2010 Oct;33(Suppl 2):S255-61. Epub 2010 Jun 3. Hale JE, Parad RB, Dorkin HL, Gerstle R, Lapey A, O'Sullivan BP, Spencer T, Yee W, Comeau AM
Cystic fibrosis newborn screening: using experience to optimize the screening algorithm.
J Inherit Metab Dis. 2010 Oct;33(Suppl 2):S255-61. Epub 2010 Jun 3., [PMID:20521170]

Abstract [show]
Newborn screening (NBS) for cystic fibrosis (CF) offers the opportunity for early diagnosis and improved outcomes in patients with CF and has been universally available in the state of Massachusetts since 1999 using an immunoreactive trypsinogen (IRT)-DNA algorithm. Ideally, CF NBS is incorporated as part of an integrated NBS system that allows for comprehensive and coordinated education, laboratory screening, clinical follow-up, and evaluation so that evidence-based data can be used to maximize quality improvements and optimize the screening algorithm. The New England Newborn Screening Program (NENSP) retrospectively analyzed Massachusetts's CF newborn screening data that yielded decisions to eliminate a screen-positive category, maintain the IRT cutoff value that prompts the second tier DNA testing, and communicate CF relative risk to primary care providers (PCPs) based on categorization of positive CF NBS results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 Discussion In addition to providing the laboratory services necessary for implementation of CF NBS, effective newborn screen- Table 4 Summary of positive screens identified by Massachusetts failsafe cystic fibrosis (CF) newborn screening (NBS) protocol Top 0.2% [IRT] Top 0.1% [IRT] Total Monitored by CF center 3 1 4 Borderline sweat testa 1 1 2 Negative sweat test 364 136 485 Not sweat testedb 91 62 153 IRT Immunoreactive trypsinogen a Infants do not have CF and are not monitored by a CF center b The 153 infants who did not have a documented sweat test either expired prior to a sweat test (36%), had a QNS sweat test and did not return for repeat sweat test (8%), had parents who refused sweat test (2%), or are lost to follow up (54%) Table 5 Infants followed at a cystic fibrosis (CF) center identified by Massachusetts failsafe CF newobrn screening (NBS) protocol Infant [IRT] (ng/ml) Mutations on NBS panel (n) Sweat [Cl- ] MEq/L Extended genotype results Comments A 141 16 41, 83 G85E/R117C Would be identified by current mutation panel B 503 16 103 Negative for 86 CFTR mutations C 274 16 92 Negative for 86 CFTR mutations D 159 39 38 P67L trans to 5t Does not meet 2008 CFF consensus guidelines for CF but is positive for CRMS CFF Cystic Fibrosis Foundation, CRMS cystic fibrosis transmembrane conductance regulator-related metabolic syndrome (Borowitz 2009) ing programs should collect and monitor outcomes for quality assurance purposes. Login to comment

[hide] Measurement of nasal potential difference in young... Thorax. 2010 Jun;65(6):539-44. Sermet-Gaudelus I, Girodon E, Roussel D, Deneuville E, Bui S, Huet F, Guillot M, Aboutaam R, Renouil M, Munck A, des Georges M, Iron A, Thauvin-Robinet C, Fajac I, Lenoir G, Roussey M, Edelman A
Measurement of nasal potential difference in young children with an equivocal sweat test following newborn screening for cystic fibrosis.
Thorax. 2010 Jun;65(6):539-44., [PMID:20522854]

Abstract [show]
BACKGROUND: A challenging problem arising from cystic fibrosis (CF) newborn screening is the significant number of infants with hypertrypsinaemia (HIRT) with sweat chloride levels in the intermediate range and only one or no identified CF-causing mutations. OBJECTIVES: To investigate the diagnostic value for CF of assessing CF transmembrane conductance regulator (CFTR) protein function by measuring nasal potential difference in children with HIRT. METHODS: A specially designed protocol was used to assess nasal potential difference (NPD) in 23 young children with HIRT (3 months-4 years) with inconclusive neonatal screening. Results were analysed with a composite score including CFTR-dependent sodium and chloride secretion. Results were correlated with genotype after extensive genetic screening and with clinical phenotype at follow-up 3 years later. RESULTS: NPD was interpretable for 21 children with HIRT: 13 had NPD composite scores in the CF range. All 13 were finally found to carry two CFTR mutations. At follow-up, nine had developed a chronic pulmonary disease consistent with a CF diagnosis. The sweat test could be repeated in nine children, and six had sweat chloride values >or=60 mmol/l. Of the eight children with normal NPD scores, only two had two CFTR mutations, both wide-spectrum mutations. None had developed a CF-like lung disease at follow-up. The sweat test could be reassessed in five of these eight children and all had sweat chloride values <60 mmol/l. CF diagnosis was ruled out in six of these eight children. CONCLUSION: Evaluation of CFTR function in the nasal epithelium of young children with inconclusive results at CF newborn screening is a useful diagnostic tool for CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
130 Table 3 Genotypes of the children with HIRT according to the diagnostic score cut-off in the 21 patients with reliable NPD tests; results after extensive genetic analysis CFTR genotypes Diagnosis score >0.27 (8 patients) £0.27 (13 patients) A/A 0 F508del/621+3A/G F508del/Q1291R A/AB F508del/R347H F508del/R117H;T7 W846X/R117C n¼2 F508del/R1070W 2183AA/G/L206W F508del/3272-26A/G F508del/R117H;T7; n¼4 A/D 0 F508del/R933G G551D/R352Q B/D G622D/3849+45G/A 0 A/0 F508del/0 n¼2 0 0/0 3 0 0, no identified mutation; A, CF-causing mutation; B, mutation associated with cystic CFTR-related disorders; C, mutation with no clinical consequence ; D, mutation of unknown or uncertain clinical relevance; AB, mutation that is associated with a wide phenotypic spectrum that might belong to either group A or B. CFTR, cystic fibrosis transmembrane conductance regulator; HIRT, hypertrypsinaemia; NPD, nasal potential difference. Login to comment

[hide] A new complex allele of the CFTR gene partially ex... Genet Med. 2010 Sep;12(9):548-55. Lucarelli M, Narzi L, Pierandrei S, Bruno SM, Stamato A, d'Avanzo M, Strom R, Quattrucci S
A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation.
Genet Med. 2010 Sep;12(9):548-55., [PMID:20706124]

Abstract [show]
PURPOSE: To evaluate the role of complex alleles, with two or more mutations in cis position, of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in the definition of the genotype-phenotype relationship in cystic fibrosis (CF), and to evaluate the functional significance of the highly controversial L997F CFTR mutation. METHODS: We evaluated the diagnosis of CF or CFTR-related disorders in 12 unrelated subjects with highly variable phenotypes. According to a first CFTR mutational analysis, subjects appeared to be compound heterozygotes for a classic mutation and the L997F mutation. A further CFTR mutational analysis was conducted by means of a protocol of extended sequencing, particularly suited to the detection of complex alleles. RESULTS: We detected a new [R117L; L997F] CFTR complex allele in the four subjects with the highest sweat test values and CF. The eight subjects without the complex allele showed the most varied biochemical and clinical outcome and were diagnosed as having mild CF, CFTR-related disorders, or even no disease. CONCLUSIONS: The new complex allele partially explains the variable phenotype in CF subjects with the L997F mutation. CFTR complex alleles are likely to have a role in the definition of the genotype-phenotype relationship in CF. Whenever apparently identical CFTR-mutated genotypes are found in subjects with divergent phenotypes, an extensive mutational search is mandatory.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 In vivo findings and, in some cases, in vitro functional characterizations have been reported for [F508C; S1251N],38 [R347H; D979A],39,40 [R74W; D1270N],41 [G628R; S1235R],42,43 [M470V; S1235R],42 [S912L; G1244V],44 [R117H; (TG)mTn],45-47 [R117C; (TG)mTn],46 [S1235R; (TG)mT5],48 [G576A; R668C],10,49 [V562I; A1006E],49 [R352W; P750L],49 [1198_1203del TGGGCT; 1204GϾA],49 [V754M; CFTRdele3_10,14b_16],50 and [F508del; I1027T].51 These complex alleles have been found in patients with either CF or CFTR-RD, although more often in the former. Login to comment
108 Five different CFTR mutations of the 117 CFTR amino acid are known: R117C, R117G, R117H, R117L, and R117P.37 All these mutations have previously been reported to be more likely to cause CFTR-RD than CF.13,37,46,56 However, R117H and R117C have been shown to yield high sweat test values and CF, even severe, if cis-acting with the T5 variant tract in CFTR intron 8.45,46 If we bear in mind that the pH range of airway surface fluid is pH 6.7-7.0,57,58 these mutations of the R117 CFTR residue represent both conservative and nonconservative substitutions. Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Association between genotype and pulmonary phenoty... J Cyst Fibros. 2011 May;10(3):187-92. doi: 10.1016/j.jcf.2011.01.005. Epub 2011 Feb 26. Geborek A, Hjelte L
Association between genotype and pulmonary phenotype in cystic fibrosis patients with severe mutations.
J Cyst Fibros. 2011 May;10(3):187-92. doi: 10.1016/j.jcf.2011.01.005. Epub 2011 Feb 26., [PMID:21354377]

Abstract [show]
BACKGROUND: Despite numerous studies a clear relationship between genotype and pulmonary phenotype has not been established within the group pancreatic insufficient cystic fibrosis (CF) patients. We studied the relationship between class I and class II mutations and pulmonary function in Swedish patients with known CFTR functional classification. METHODS: 170 CF patients with two class II mutations, 18 with two class I mutations and 78 with a combination of class I and II mutations were included in the study. Spirometry was performed when patients were in an optimal clinical condition. RESULTS: Patients with two class I mutations had lower lung function (FEV(1) and FVC) compared to the group with either a combination of class I and II mutations or two class II mutations. CONCLUSION: CF patients carrying two class I mutations risk developing more severe lung disease compared to patients with at least one class II mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 Class I Class II Class III Class IV Class V 1717-1 G-NA F508del G551D 297 C-NA 2789+5 G-NA 3659delC S945L R560T R117C 3849+10 kb CNT 394delTT R347P A455E R553X T 3381 3849+10 kb C-T 621+1 G-NT E60X G542X W79R W1282X decline of pulmonary function was more rapid in patients with pancreatic insufficiency, mainly class II mutations, compared to CF patients with normal pancreatic function [4]. Login to comment

[hide] Cystic fibrosis carrier testing in an ethnically d... Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7. Rohlfs EM, Zhou Z, Heim RA, Nagan N, Rosenblum LS, Flynn K, Scholl T, Akmaev VR, Sirko-Osadsa DA, Allitto BA, Sugarman EA
Cystic fibrosis carrier testing in an ethnically diverse US population.
Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7., [PMID:21474639]

Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) and the frequency of specific disease-causing mutations vary among populations. Affected individuals experience a range of serious clinical consequences, notably lung and pancreatic disease, which are only partially dependent on genotype. METHODS: An allele-specific primer-extension reaction, liquid-phase hybridization to a bead array, and subsequent fluorescence detection were used in testing for carriers of 98 CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations among 364 890 referred individuals with no family history of CF. RESULTS: One in 38 individuals carried one of the 98 CFTR mutations included in this panel. Of the 87 different mutations detected, 18 were limited to a single ethnic group. African American, Hispanic, and Asian individuals accounted for 33% of the individuals tested. The mutation frequency distribution of Caucasians was significantly different from that of each of these ethnic groups (P < 1 x 10(1)). CONCLUSIONS: Carrier testing using a broad mutation panel detects differences in the distribution of mutations among ethnic groups in the US.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
123 CFTR mutationsa Individuals, n p.F508del/p.R117H 16 5T/9T 1 7T/9T 15 p.F508del/p.D1152H 3 p.R117H/p.R117H, 7T/7T 2 p.D1152H/p.D1152H 2 p.W1282X/p.D1152H 2 p.D1152H/p.G551D 1 c.3717ϩ12191CϾT/p.R352Q 1 c.3717ϩ12191CϾT/c.3717ϩ12191CϾT 1 p.F508del/c.3717ϩ12191CϾT 1 p.F508del/p.L206W 1 p.F508del/p.R117C 1 p.F508del/p.R347H 1 p.F508del/p.R347P 1 p.R117H/p.W1282X, 7T/7T 1 p.R117H/p.G551D, 7T/7T 1 p.R117H/p.G542X, 7T/9T 1 a Human Genome Variation Society nomenclature [Ogino et al. (23)]. Login to comment

[hide] A recurrent deep-intronic splicing CF mutation emp... J Cyst Fibros. 2011 Jul 21. Costa C, Pruliere-Escabasse V, de Becdelievre A, Gameiro C, Golmard L, Guittard C, Bassinet L, Bienvenu T, Georges MD, Epaud R, Bieth E, Giurgea I, Aissat A, Hinzpeter A, Costes B, Fanen P, Goossens M, Claustres M, Coste A, Girodon E
A recurrent deep-intronic splicing CF mutation emphasizes the importance of mRNA studies in clinical practice.
J Cyst Fibros. 2011 Jul 21., 2011-07-21 [PMID:21783433]

Abstract [show]
BACKGROUND: The identification by CFTR mRNA studies of a new deep-intronic splicing mutation, c.870-1113_1110delGAAT, in one patient of our series with mild CF symptoms and in three CF patients of an Italian study, led us to evaluate the mutation frequency and phenotype/genotype correlations. METHODS: 266 patients with CF and related disorders and having at least one undetected mutation, were tested at the gDNA level in three French reference laboratories. RESULTS: In total, the mutation was found in 13 unrelated patients (5% of those already carrying a mutation) plus 4 siblings, including one homozygote and 12 heterozygotes having a severe CF mutation. The sweat test was positive in 10/14 documented cases, the diagnosis was delayed after 20years in 9/15 and pancreatic insufficiency was present in 5/16. CONCLUSION: c.870-1113_1110delGAAT should be considered as CF-causing with phenotype variability and overall delayed diagnosis. Its frequency highlights the potential of mRNA studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 kansaii and M. avium, FEV1 77% PS No 70-83 CF p.Phe508del France 15 F 14 19 None declared PS Na Chronic pancreatitis 60, 105 CF p.Arg117Cys France 16 M 35 43 None declared Nd CBAVD Nd C F T R - RD Undetected Nd 17 F Nd 28 DB PS Nd b40 C F T R - RD Undetected France CBAVD: congenital bilateral absence of vas deferens; CSD: chronic sinus disease; DB: disseminated bronchiectasis; FEV1: forced expiratory volume in one second; Hi: Haemophilus influenza; M: Mycobacterium; Na: not applicable; NBS: newborn screening; Nd: not documented; NP: nasal polyposis; Pa: Pseudomonas aeruginosa; PI: pancreatic insufficiency; PS: pancreatic sufficiency; Sa: Staphylococcus aureus. Login to comment

[hide] Mild cystic fibrosis mutations in Southern Sweden ... Clin Genet. 1998 May;53(5):383-6. Schaedel C, Andersson AM, Kristoffersson AC, Kornfalt R, Lannefors L, Holmberg L
Mild cystic fibrosis mutations in Southern Sweden with special reference to S549I and T338I.
Clin Genet. 1998 May;53(5):383-6., [PMID:9660057]

Abstract [show]
In this study of cystic fibrosis (CF) gene mutations in Southern Sweden we found missense mutations in 12 out of 110 patients. These patients, as a group, differed from deltaF508 homozygotes by a higher frequency of pancreatic sufficiency and an older age at diagnosis as has been indicated in previous studies. In addition, lung function (vital capacity (VC) and forced expiratory volume in 1 s (FEV1)) tended to be better although the difference did not reach statistical significance (p = 0.13 for FEV1). For two mutations, S549I and T338I, our results differed from earlier reports. In our experience, S549I confers a milder phenotype and T338I a more severe one than previously reported. We conclude that each mutation should be treated separately when trying to correlate genotype with phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 The most frequent ones were T338I (5), R117C (3) and R117H (2), accounting for 2.2, 1.4and 0.9% of the C F alleles, respectively. Login to comment
55 Five patients had the relatively common R117H and R117C mutations with clinical pictures of mild or no lung symptoms, pancreatic sufficiency and male infertility as reported in several publications. Login to comment
56 Four of the patients with the R117C or R117H mutations were heterozygous 7T/9T for the IVS8 polymorphism and one patient with R117H/unknown mutation was homozygous for the 7T allele. Login to comment

[hide] Development and validation of a screening test for... Eur Respir J. 1998 Aug;12(2):477-82. Robertson NH, Weston SL, Kelly SJ, Duxbury NJ, Pearce SR, Elsmore P, Webb MB, Newton CR, Little S
Development and validation of a screening test for 12 common mutations of the cystic fibrosis CFTR gene.
Eur Respir J. 1998 Aug;12(2):477-82., [PMID:9727805]

Abstract [show]
The results obtained using deoxyribonucleic acid (DNA) amplification-based tests must be accurate and reproducible. One such test that simultaneously detects any of 12 of the most common mutations of the cystic fibrosis transmembrane conductance regulator gene is presented in this report. An investigation was conducted into how changes of primer, DNA template and Taq DNA polymerase concentrations and of polymerase chain reaction annealing temperatures affect the test. A total of 383 DNA samples obtained from different laboratories was then examined. The preliminary studies defined the conditions under which accurate results are obtained even if the test is performed under suboptimal conditions. Subsequently, 377 (98.4%) of the DNA samples analysed were in full agreement with DNA typing results derived by other methods. The remaining 1.6% of samples were not mistyped, rather they were not scored owing to failure to detect control DNA sequences. These were also archival DNA preparations rather than freshly prepared samples from venous blood. Careful primer design and optimization of reaction conditions are important in the development of multiplex deoxyribonucleic acid amplification-based diagnostic tests. Providing the recommended protocols are followed, the test described here is simple to carry out, gives accurate results and works well if performed within defined operational windows for each reaction variable.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 There was no mistyping when ∆I507, 1717-2A>G, R1283M, R117C, 3617G/T, 621+2T>C or F508C alleles were present. Login to comment

[hide] Structure and function of the CFTR chloride channe... Physiol Rev. 1999 Jan;79(1 Suppl):S23-45. Sheppard DN, Welsh MJ
Structure and function of the CFTR chloride channel.
Physiol Rev. 1999 Jan;79(1 Suppl):S23-45., [PMID:9922375]

Abstract [show]
Structure and Function of the CFTR Chloride Channel. Physiol. Rev. 79, Suppl.: S23-S45, 1999. - The cystic fibrosis transmembrane conductance regulator (CFTR) is a unique member of the ABC transporter family that forms a novel Cl- channel. It is located predominantly in the apical membrane of epithelia where it mediates transepithelial salt and liquid movement. Dysfunction of CFTR causes the genetic disease cystic fibrosis. The CFTR is composed of five domains: two membrane-spanning domains (MSDs), two nucleotide-binding domains (NBDs), and a regulatory (R) domain. Here we review the structure and function of this unique channel, with a focus on how the various domains contribute to channel function. The MSDs form the channel pore, phosphorylation of the R domain determines channel activity, and ATP hydrolysis by the NBDs controls channel gating. Current knowledge of CFTR structure and function may help us understand better its mechanism of action, its role in electrolyte transport, its dysfunction in cystic fibrosis, and its relationship to other ABC transporters.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
156 First, incorporation of glycosylation sequences into ICL1, ICL3, and ICL4 disrupted protein associated mutations (R117C/H/L/P) (142). Login to comment

[hide] beta-Adrenergic Sweat Secretion as a Diagnostic Te... Am J Respir Crit Care Med. 2012 Oct 15;186(8):732-9. doi: 10.1164/rccm.201205-0922OC. Epub 2012 Aug 2. Quinton P, Molyneux L, Ip W, Dupuis A, Avolio J, Tullis E, Conrad D, Shamsuddin AK, Durie P, Gonska T
beta-Adrenergic Sweat Secretion as a Diagnostic Test for Cystic Fibrosis.
Am J Respir Crit Care Med. 2012 Oct 15;186(8):732-9. doi: 10.1164/rccm.201205-0922OC. Epub 2012 Aug 2., [PMID:22859523]

Abstract [show]
Rationale: beta-Adrenergically induced sweat secretion offers an expedient method to assess native cystic fibrosis transmembrane conductance regulator (CFTR) secretory function in vivo. Objectives: To evaluate the sensitivity, specificity, and reliability of a test based on the activity and secretory function of CFTR in the sweat gland. Methods: Primary and validation trials with prospectively ascertained healthy control subjects, obligate heterozygotes, and patients with a CFTR-related disorder and CF (pancreatic sufficient and insufficient). Measurements and Main Results: Diagnostic accuracy and reliability of beta-adrenergic sweat secretory rates using an evaporimeter was assessed and compared with sweat chloride concentrations. The cholinergically stimulated mean sweat rate did not differ among groups. The mean maximal beta-adrenergically stimulated sweat rate in heterozygotes was about half the rate of healthy control subjects, and completely absent in pancreatic-insufficient patients with CF and pancreatic-sufficient patients with CF (P < 0.0001). Subjects with a CFTR-related disorder showed reduced or absent beta-adrenergic sweat secretion. The beta-adrenergic secretory response demonstrated high diagnostic accuracy (area under a characteristic receiver-operator curve = 0.99; 95% confidence interval, 0.97-1.00) and reliability (intraclass correlation, 0.90; 95% confidence interval, 0.81-0.95). The diagnostic cutoff level for CF, derived from the primary trial, correctly identified all control subjects, heterozygotes, and patients with CF in the validation cohort, whereas concurrent sweat chloride measurements misclassified one heterozygote and five subjects with CF. The cholinergic and beta-adrenergic sweat secretion rates were lower in women compared with men (P < 0.001). Conclusions: beta-Adrenergic sweat secretion rate determined by evaporimetry is an accurate and reliable technique to assess different levels of CFTR function and to identify patients with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 DIAGNOSTIC CHARACTERISTICS OF PARTICIPANTS IN THE VALIDATION COHORT Group Age (yr) Sex Genotype Sweat Cl2 (mmol/L) Cholinergic b-Adrenergic Ratio b/Chol Healthy 38 M 2/2 15 64.45 72.79 1.13 Healthy 39 M 2/2 18 81.61 86.08 1.05 Healthy 54 F 2/2 29 48.90 47.30 0.97 Healthy 64 F 2/2 28 50.64 57.54 1.14 Healthy 54 F 2/2 11 68.63 52.30 0.76 Hetero. 64 M F508del/2 16 68.21 36.78 0.54 Hetero. 56 M F508del/2 53 82.44 59.57 0.72 Hetero. 27 F F508del/2 11 78.30 46.30 0.59 Hetero. 29 F F508del/2 16 65.63 26.13 0.40 Hetero. 51 F G551D/2 62 39.13 16.50 0.42 CFTR-RD CBAVD 41 M W1282X/5T 55 84.61 20.69 20.01 CFTR-RD CBAVD 52 M F508del/R117H (7T) 57 70.39 20.61 20.01 CFTR-RD CBAVD 41 M F508del/5T 40 68.00 22.29 20.03 CFTR-RD CBAVD 47 M G551D/R117H (7T) 57 65.93 10.08 0.15 CFTR-RD CBAVD 40 M L206W/W216C 42 67.80 17.00 0.25 CFTR-RD CBAVD 26 M 36599delC15T/7T 55 91.55 0.18 0.00 CFTR-RD Sinopulm 65 F F508del/c.876-9_876-6delGATT 51 74.30 32.20 0.43 CFTR-RD Sinopulm 39 F R764X/2 12 24.64 3.49 0.14 CFTR-RD Sinopulm 17 F 5T/2 50 52.95 14.24 0.27 CFPS 21 M F508del/2 97 46.19 0.56 0.01 CFPS 33 M F508del/3849110kbC.T 50 76.22 22.94 20.04 CFPS 58 M 71111G.T/A455E 72 70.19 23.06 20.04 CFPS 41 M G551D/3849110kbC.T 88 87.37 0.08 0.00 CFPS 54 F F508del/R117C 59 36.74 1.06 0.03 CFPS 23 F F508del/A455E 82 64.85 3.46 0.05 CFPS 30 F D1152H/D1152H 31 41.52 23.54 20.09 CFPS 55 F G551D/2 99 67.62 21.78 20.03 CFPS 42 F F508del/1002-2A.G 94 27.64 2.63 0.10 CFPS 46 F 3849110kbC.T/3849110kbC.T 53 24.43 21.16 20.05 CFPS 14 F R1162X/3849110kbC.T 46 50.19 20.49 20.01 CFPI 32 M F508del/F508del 108 73.93 1.41 0.02 CFPI 28 M F508del/F508del 84 95.13 3.45 0.04 CFPI 24 F F508del/F508del 109 60.48 4.06 0.07 CFPI 34 F F508del/F508del 115 79.24 0.99 0.01 CFPI 35 F F508del/F508del 87 79.79 23.02 20.04 CFPI 44 F F508del/F508del 112 80.60 1.23 0.02 CFPI 23 F F508del/G551D 90 45.80 0.80 0.02 Definition of abbreviations: CBAVD ¼ congenital bilateral absence of vas deference; CF ¼ cystic fibrosis; CFPI ¼ pancreatic-insufficient patients with CF; CFPS ¼ pancreatic-sufficient patients with CF; CFTR ¼ CF transmembrane regulator; CFTR-RD ¼ CFTR-related disorder; hetero ¼ heterozygotes; sinopulm ¼ chronic sinopulmonary disease. Login to comment
92 Of note, four of these patients with CFPS carrying 3849110kbC.T or D1152H on one or two alleles had sweat chloride results between 31 and 52 mmol/L, whereas one subject with CFPS carried F508del/R117C with sweat [Cl2 ] 59 mmol/L. Login to comment
43 DIAGNOSTIC CHARACTERISTICS OF PARTICIPANTS IN THE VALIDATION COHORT Group Age (yr) Sex Genotype Sweat Cl2 (mmol/L) Cholinergic b-Adrenergic Ratio b/Chol Healthy 38 M 2/2 15 64.45 72.79 1.13 Healthy 39 M 2/2 18 81.61 86.08 1.05 Healthy 54 F 2/2 29 48.90 47.30 0.97 Healthy 64 F 2/2 28 50.64 57.54 1.14 Healthy 54 F 2/2 11 68.63 52.30 0.76 Hetero. 64 M F508del/2 16 68.21 36.78 0.54 Hetero. 56 M F508del/2 53 82.44 59.57 0.72 Hetero. 27 F F508del/2 11 78.30 46.30 0.59 Hetero. 29 F F508del/2 16 65.63 26.13 0.40 Hetero. 51 F G551D/2 62 39.13 16.50 0.42 CFTR-RD CBAVD 41 M W1282X/5T 55 84.61 20.69 20.01 CFTR-RD CBAVD 52 M F508del/R117H (7T) 57 70.39 20.61 20.01 CFTR-RD CBAVD 41 M F508del/5T 40 68.00 22.29 20.03 CFTR-RD CBAVD 47 M G551D/R117H (7T) 57 65.93 10.08 0.15 CFTR-RD CBAVD 40 M L206W/W216C 42 67.80 17.00 0.25 CFTR-RD CBAVD 26 M 36599delC15T/7T 55 91.55 0.18 0.00 CFTR-RD Sinopulm 65 F F508del/c.876-9_876-6delGATT 51 74.30 32.20 0.43 CFTR-RD Sinopulm 39 F R764X/2 12 24.64 3.49 0.14 CFTR-RD Sinopulm 17 F 5T/2 50 52.95 14.24 0.27 CFPS 21 M F508del/2 97 46.19 0.56 0.01 CFPS 33 M F508del/3849110kbC.T 50 76.22 22.94 20.04 CFPS 58 M 71111G.T/A455E 72 70.19 23.06 20.04 CFPS 41 M G551D/3849110kbC.T 88 87.37 0.08 0.00 CFPS 54 F F508del/R117C 59 36.74 1.06 0.03 CFPS 23 F F508del/A455E 82 64.85 3.46 0.05 CFPS 30 F D1152H/D1152H 31 41.52 23.54 20.09 CFPS 55 F G551D/2 99 67.62 21.78 20.03 CFPS 42 F F508del/1002-2A.G 94 27.64 2.63 0.10 CFPS 46 F 3849110kbC.T/3849110kbC.T 53 24.43 21.16 20.05 CFPS 14 F R1162X/3849110kbC.T 46 50.19 20.49 20.01 CFPI 32 M F508del/F508del 108 73.93 1.41 0.02 CFPI 28 M F508del/F508del 84 95.13 3.45 0.04 CFPI 24 F F508del/F508del 109 60.48 4.06 0.07 CFPI 34 F F508del/F508del 115 79.24 0.99 0.01 CFPI 35 F F508del/F508del 87 79.79 23.02 20.04 CFPI 44 F F508del/F508del 112 80.60 1.23 0.02 CFPI 23 F F508del/G551D 90 45.80 0.80 0.02 Definition of abbreviations: CBAVD &#bc; congenital bilateral absence of vas deference; CF &#bc; cystic fibrosis; CFPI &#bc; pancreatic-insufficient patients with CF; CFPS &#bc; pancreatic-sufficient patients with CF; CFTR &#bc; CF transmembrane regulator; CFTR-RD &#bc; CFTR-related disorder; hetero &#bc; heterozygotes; sinopulm &#bc; chronic sinopulmonary disease. Login to comment
93 Of note, four of these patients with CFPS carrying 3849110kbC.T or D1152H on one or two alleles had sweat chloride results between 31 and 52 mmol/L, whereas one subject with CFPS carried F508del/R117C with sweat [Cl2 ] 59 mmol/L. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]

Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]

Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

[hide] Lessons learned from 20 years of newborn screening... Med J Aust. 2012 Jan 16;196(1):67-70. Massie RJ, Curnow L, Glazner J, Armstrong DS, Francis I
Lessons learned from 20 years of newborn screening for cystic fibrosis.
Med J Aust. 2012 Jan 16;196(1):67-70., [PMID:22256939]

Abstract [show]
OBJECTIVE: To compare three cystic fibrosis (CF) newborn screening strategies used in Victoria since 1989. DESIGN, SETTING AND PARTICIPANTS: Retrospective review of newborn screening and clinical records for people with CF born in Victoria between 1989 and 2008 to compare screening strategies: repeat immunoreactive trypsinogen (IRT) testing (IRT/IRT, 1989-1990), IRT and p.F508del mutation analysis (IRT/p.F508del, 1991-2006) and IRT with analysis of 12 CFTR mutations (IRT/12 mutations, 2007-2008). MAIN OUTCOME MEASURES: Total number of infants screened, people identified with CF (by screening or clinical diagnosis), number of CF-affected terminations of pregnancy, and number of carriers detected. RESULTS: There were 420 people born with CF (live-birth prevalence, 1/3139; 95% CI, 1/2853-1/3462) and 78 CF-affected pregnancy terminations (overall prevalence, 1/2647; 95% CI, 1/2425-1/2896). Of the babies born with CF, 283 (67.4%) were detected by newborn screening alone, 61 (14.5%) had meconium ileus, 33 (7.9%) had a family history of CF, nine (2.1%) were diagnosed antenatally, and 34 (8.1%) were missed by screening (17 missed because IRT level was < 99th percentile, two with repeat IRT level not elevated, 14 without a screened CFTR mutation, and one with missing data). The sensitivities of the protocols were 86.6% for IRT/IRT, 89.9% for IRT/p.F508del, and 95.8% for IRT/12 mutations. Including 12 mutations in the analysis detected one patient who would otherwise have been missed and, had this protocol been implemented from 1989, it would have detected four others. CONCLUSION: Most babies with CF without meconium ileus, a family history or antenatal diagnosis are detected by newborn screening. Despite improved sensitivity with the 12-mutation analysis, most infants detected would have been diagnosed using the IRT/p.F508del protocol.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 19 Massie RJ, Poplawski N, Wilcken B, et al. Intron-8 polythymidine sequence in Australasian individuals with CF mutations R117H and R117C. Login to comment
142 19 Massie RJ, Poplawski N, Wilcken B, et al. Intron-8 polythymidine sequence in Australasian individuals with CF mutations R117H and R117C. Login to comment

[hide] First study of the F508del mutation in Malaysian c... J Paediatr Child Health. 2011 Aug;47(8):573-5. doi: 10.1111/j.1440-1754.2011.02149.x. Nathan AM, Thong MK, deBruyne J, Ariffin H
First study of the F508del mutation in Malaysian children diagnosed with cystic fibrosis.
J Paediatr Child Health. 2011 Aug;47(8):573-5. doi: 10.1111/j.1440-1754.2011.02149.x., [PMID:21843195]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Letters to the Editor Journal of Paediatrics and Child Health 47 (2011) 572-575 (c) 2011 The Authors Journal of Paediatrics and Child Health (c) 2011 Paediatrics and Child Health Division (Royal Australasian College of Physicians) Table1Summaryoftheclinicalcharacteristics,sweattestresultsandcysticfibrosistransmembraneconductanceregulatormutationstudiesofthepatientsdiagnosedwithcysticfibrosisinUniversity MalayaMedicalCenterfrom2000to2009 PatientAgeat presentation PresentingsymptomsOtherfindingsConsanguinityRaceSweatconductivity (mmol/l) KS score Mutations Rin3monthsRecurrentpneumoniaandFTTPseudo-Bartter`ssyndromeYesIndian13440†Nonedetected Nes8yearsSeverepersistentasthmaFTTNoIndian12450F508del/unknown Abd4monthsSeverepneumoniaandventilator dependent FTTYesYemeni11730F508del/F508del Ben7yearsCirrhosisoftheliverwithportal hypertension FTTUnknown(adopted)Unknown14080†Nonedetected(7T polymorphism) Sak3monthsRecurrentpneumoniaandFTTNDYesIndian11350F508del/F508del Ngan3yearsPseudo-Bartter`ssyndromeNDNoChinese13790Notdone(parentsrefused) LJH5monthsPseudo-Bartter`ssyndromeRecurrentpneumoniaNoChinese/Indonesian9465F508delnegative Josh5monthsPseudo-Bartter`ssyndromeandFTTNDNoIndian8585†Nonedetected Nur3monthsChronicdiarrhoeaandFTTPseudo-Bartter`ssyndromeNoMalay/Chinese13085‡†R553X/nonedetected Vin4monthsRecurrentpneumoniaandFTTNDNoChinese12260F508delnegative Muh5yearsPoorlycontrolledasthmaNDNoMalay10765F508delnegative Naz3monthsFTTandsteatorrhoeaRecurrentlunginfectionsand pseudo-Bartter`s NoMalay14675F508delnegative Additionalmutationsscreenedinthefourpatients:†F508del,I506/7del,G551D,G542X,R553X,R117C,R117H,621+1G>T,V520F,A455E,N1303K,3849+10kbC>T.‡R334W,R347P,A455E,S549N,R560T, 3659delC,W1282X.FTT,failuretothrive;KS,Schwachman-Kulczycki(KS)score;ND,nodata. Login to comment

[hide] Borderline sweat test: Utility and limits of genet... Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24. Seia M, Costantino L, Paracchini V, Porcaro L, Capasso P, Coviello D, Corbetta C, Torresani E, Magazzu D, Consalvo V, Monti A, Costantini D, Colombo C
Borderline sweat test: Utility and limits of genetic analysis for the diagnosis of cystic fibrosis.
Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24., [PMID:19318035]

Abstract [show]
OBJECTIVE: The sweat test remains the gold standard for the diagnosis of Cystic Fibrosis (CF) even despite the availability of molecular analysis of Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR). We investigated the relationship between CFTR mutation analysis and sweat chloride concentration in a cohort of subjects with borderline sweat test values, in order to identify misdiagnosis of CF. DESIGN AND METHODS: In the period between March 2006 and February 2008 we performed 773 sweat tests in individuals referred for suspect CF. Ninety-one subjects had chloride values in the border-line range. Clinicians required CFTR gene complete scanning on 66 of them. RESULTS: The mean value of sweat chloride in the DNA negative subjects was lower than in those with at least one CFTR mutation. Our data indicate that 39 mEq/l is the best sensitivity trade off for the sweat test with respect to genotype. CONCLUSIONS: To optimise diagnostic accuracy of reference intervals, it may be useful to modify from 30 to 39 mEq/l the threshold for sweat chloride electrolytes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported. Login to comment
92 It is known that some mutations as D1152H and R117H-7T/R117C-7Tare associated with negative or borderline sweat chloride value. Login to comment
57 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported. Login to comment
90 It is known that some mutations as D1152H and R117H-7T/R117C-7Tare associated with negative or borderline sweat chloride value. Login to comment

[hide] Consensus on the use and interpretation of cystic ... J Cyst Fibros. 2008 May;7(3):179-96. Castellani C, Cuppens H, Macek M Jr, Cassiman JJ, Kerem E, Durie P, Tullis E, Assael BM, Bombieri C, Brown A, Casals T, Claustres M, Cutting GR, Dequeker E, Dodge J, Doull I, Farrell P, Ferec C, Girodon E, Johannesson M, Kerem B, Knowles M, Munck A, Pignatti PF, Radojkovic D, Rizzotti P, Schwarz M, Stuhrmann M, Tzetis M, Zielenski J, Elborn JS
Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice.
J Cyst Fibros. 2008 May;7(3):179-96., [PMID:18456578]

Abstract [show]
It is often challenging for the clinician interested in cystic fibrosis (CF) to interpret molecular genetic results, and to integrate them in the diagnostic process. The limitations of genotyping technology, the choice of mutations to be tested, and the clinical context in which the test is administered can all influence how genetic information is interpreted. This paper describes the conclusions of a consensus conference to address the use and interpretation of CF mutation analysis in clinical settings. Although the diagnosis of CF is usually straightforward, care needs to be exercised in the use and interpretation of genetic tests: genotype information is not the final arbiter of a clinical diagnosis of CF or CF transmembrane conductance regulator (CFTR) protein related disorders. The diagnosis of these conditions is primarily based on the clinical presentation, and is supported by evaluation of CFTR function (sweat testing, nasal potential difference) and genetic analysis. None of these features are sufficient on their own to make a diagnosis of CF or CFTR-related disorders. Broad genotype/phenotype associations are useful in epidemiological studies, but CFTR genotype does not accurately predict individual outcome. The use of CFTR genotype for prediction of prognosis in people with CF at the time of their diagnosis is not recommended. The importance of communication between clinicians and medical genetic laboratories is emphasized. The results of testing and their implications should be reported in a manner understandable to the clinicians caring for CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1236 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment
1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment

[hide] Estimating the age of CFTR mutations predominantly... J Cyst Fibros. 2008 Mar;7(2):168-73. Epub 2007 Sep 6. Fichou Y, Genin E, Le Marechal C, Audrezet MP, Scotet V, Ferec C
Estimating the age of CFTR mutations predominantly found in Brittany (Western France).
J Cyst Fibros. 2008 Mar;7(2):168-73. Epub 2007 Sep 6., [PMID:17825628]

Abstract [show]
BACKGROUND: Disparities in the spectrum of mutations within the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene are commonly observed in populations from different ethnical and/or geographical origins. The occurrence of CF in Brittany (western France) is one of the highest in populations from Caucasian origin (<1/2000 in specific areas). The W846X(2), 1078delT and G551D mutations, as well as the I1027T polymorphism in cis with the DeltaF508 mutation (currently referred to as p.F508del) are particularly frequent in this area. We investigated the age of the respective variants in the region of interest. METHODS: Several polymorphic markers surrounding the CFTR gene were genotyped. Allele frequencies as well as mutation rates and other parameters were used to calculate the respective age of the most recent common ancestors in the region of interest by a previously employed, simple likelihood-based method. RESULTS: Following haplotype reconstruction and simulation, the ages were estimated to be approximately 600, 1000, 1200 and 600 years, respectively (with a 95% confidence interval). CONCLUSIONS: These datings thus provide historical insights in the context of understanding population migrations. They also underline the usefulness of this method for estimating the age of rare mutations with a limited number of carriers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Primers amplifying the regions of interest were designed with PrimerQuestSM from Table 1 Genotypes of CF patients W846X2 1078delT G551D Mutation in trans Number Mutation in trans Number Mutation in trans Number ΔF508 6 ΔF508 21 ΔF508 18 R117C 1 1078delTa 2 E60K 1 ΔI507 1 4005+1GNA 2 W79X 1 Y563N 1 L610S 1 C225X 1 1078delTb 1 W846X2 b 1 F311L 1 621+1GNT 1 R1066H 1 R347H 1 2789+5GNA 1 1221delCT 1 G542X 1 3849+4ANG 1 1717-1GNA 1 G551D 1 3659delC 1 R553G 1 S942F 1 Y1092X 1 621+1GNT 1 2789+5GNA 1 4006-1GNA 1 Unidentified 1 Total 13 Total 31 Total 32 a One particular case: in this individual, the two chromosomes 7 are identical by descent. Login to comment

[hide] Cystic fibrosis mutations and genotype-pulmonary p... J Cyst Fibros. 2006 Jan;5(1):33-41. Epub 2005 Nov 4. Braun AT, Farrell PM, Ferec C, Audrezet MP, Laxova A, Li Z, Kosorok MR, Rosenberg MA, Gershan WM
Cystic fibrosis mutations and genotype-pulmonary phenotype analysis.
J Cyst Fibros. 2006 Jan;5(1):33-41. Epub 2005 Nov 4., [PMID:16275171]

Abstract [show]
BACKGROUND: Although there are more than 1000 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, most of them are uncommon and only limited information exists regarding genotype-pulmonary phenotype relationships. METHODS: We determined and classified the CFTR mutations using denaturing high-performance liquid chromatography and developed new, quantitative methods to categorize pulmonary phenotypes. RESULTS: Two novel alleles were discovered, namely G1047R and 1525-2A-->G, which were accompanied by F508del and G551D mutations, respectively. Assessment of numerous options revealed that CF pulmonary phenotype categorization in children cannot be accomplished with clinical or pulmonary function data but is facilitated by longitudinal quantitative chest radiology. It was most useful to categorize pulmonary disease status by evaluating the typical pattern of abnormalities in patients homozygous for the F508del mutation, and then compare patients with minor mutations to this typical CF pulmonary phenotype. By this method, both patients with novel mutations have pulmonary phenotypes typical of F508del homozygotes. However, patients with class IV mutations (e.g., R347P) or with pancreatic sufficiency showed serial chest radiographs that were atypically mild. CONCLUSIONS: Longitudinal quantitative chest radiography provides a new strategy for CF pulmonary phenotype categorization that should be useful for genotype-phenotype delineation in individual patients and in both epidemiologic studies and clinical trials involving groups of children with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Thereafter, the longitudinal patterns of WCXR and BCXR for the two patients with novel mutations (i.e., G1047R and 1525-2AYG) were superimposed on the Table 1 Summary of patient characteristics Characteristics F508del homozygote group (n =38) Pancreatic sufficiency groupa (n =19) Sex Male 25 8 Female 13 11 Center Madison 21 12 Milwaukee 17 7 Group Screened 38 3 Control 0 14 Other 0 2 Meconium ileus Yes 6 0 No 32 19 Mean age at diagnosis (weeks)TS.D. 7.15T2.4 193.1T192 Mean sweat Cl mEq/lTS.D. Login to comment
81 101.0T9.5 83.5T21.2 CXR scores at diagnosis WCXR 2.48T32b 4.68T71 BCXR 21.9T0.3 21.1T.48 Pulmonary function at 8 years FEV1 (%)c 97T4 104T2 FVC (%)c 103T3 103T2 FEV1/FVC% 0.92T0.03 0.98T.01 FEF25 - 75% 99T11 104T5 a Mild pancreatic phenotype mutations include: R117H occurring with F508del (n =5) and G542X (n =1); R117C with F508del (n =2); R347P with F508del (n =1), R1066H (n =1) and 2184insA (n À1), 2789+5G>A with F508del (n =3); 3272À26A>G with F508del (n =1); 3849+10kbC>T with F508del (n =1); L138ins with 3272À26A>G (n =1); R352Q with F508del (n =1); and 1336K with F508del (n =1). Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
73 Genomic DNA Samples Used for Mutation Evaluation on the APEX Array Mutations validated with native DNA CFTRdel 2,3 (21 kb) 394delTT G85E R75X 574delA Y122X R117C R117H 621 ϩ 1GϾT 621 ϩ 3AϾG 711 ϩ 1GϾT I336K R334W R347P IVS8-5T IVS8-7T IVS8-9T A455E ⌬F508 ⌬I507 1677delTA 1717 - 1GϾA G542X G551D R553X R560T S549N 1898 ϩ 1GϾA 1898 ϩ 1GϾC 2183AAϾG 2043delG R668C 2143delT 2184delA 2184insA 2789 ϩ 5GϾA S945L 3120 ϩ 1GϾA I1005R 3272 - 26AϾG R1066C G1069R Y1092X (CϾA) 3500 - 2AϾT R1158X R1162X 3659delC S1235R 3849 ϩ 10 kb CϾT W1282X primer. Login to comment

[hide] The necessity of complete CFTR mutational analysis... Fertil Steril. 2004 Oct;82(4):947-9. Wong LJ, Alper OM, Hsu E, Woo MS, Margetis MF
The necessity of complete CFTR mutational analysis of an infertile couple before in vitro fertilization.
Fertil Steril. 2004 Oct;82(4):947-9., [PMID:15482777]

Abstract [show]
OBJECTIVE: To determine the genotype of a triplet resulted from an IVF procedure, with discordant cystic fibrosis (CF) phenotype. DESIGN: Molecular diagnosis of CF. SETTING: Affected triplet followed at the CF Clinic Center of Children's Hospital Los Angeles was referred to Molecular Genetics Laboratory at Georgetown University Medical Center for comprehensive DNA analysis of the cystic fibrosis transmembrane regulator (CFTR) gene. PATIENT(S): Three affected children and the healthy parents with negative family history of CF. MAIN OUTCOME MEASURE(S): Temporal temperature gradient gel electrophoresis and direct DNA sequencing were used to detect and to identify the mutations. RESULT(S): The child with classic CF had DeltaF508 and R553X mutations. Two children with mild CF symptoms had DeltaF508 and R117C. The father carried two mutations, R553X and R117C. The mother is a carrier for DeltaF508. CONCLUSION(S): Mutational analysis of the CFTR gene should always be recommended to the infertile couples seeking for IVF. The CFTR mutation screening would be essential if the man has congenital bilateral absence of vas deferens (CBAVD) despite the negative family history of CF. Option of complete CFTR gene analysis at a cost of about 1,500-2,000 dollars should be made available if one mutation is found in the male partner with congenital bilateral absence of vas deferens.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Two children with mild CF symptoms had ⌬F508 and R117C. Login to comment
7 The father carried two mutations, R553X and R117C. Login to comment
14 Key Words: Cystic fibrosis, CFTR, R117C, triplet CF, IVF, infertility Cystic fibrosis (CF) is the most common, life-shortening autosomal recessive disease in whites with extreme morbidity and mortality. Login to comment
67 A rare mutation, R117C, was identified. Login to comment
69 Triplet 1 2 3 Age at diagnosis At birth 2 month 3 year Genotype ⌬F508/R553X ⌬F508/R117C ⌬F508/R117C Sex M M F Sweat chloride (mEq/L) 98 48 67 Pancreatic function PI PS PS Enzyme supplement Pancreacarb MS8 None None Microbial colonization n/a n/a n/a Height/weight (at 3,4,4 years of age) 92.7 cm (Ͻ5%) 97 cm (5%) 98 cm (25%) 12.7 kg (Ͻ5%) 13.4 kg (10%) 13.8 kg (10%) Complications Biliary atresia Developmental delay DIOS Allergic rhinitis Hearing loss RAD Hypospadia Allergic rhinitis UAVD Allergic rhinitis Meconium ileus Yes No No Note: PI ϭ pancreatic insufficiency as determined by the patient`s dependence on pancreatic enzyme supplements; PS ϭ pancreatic sufficiency; UAVD ϭ unilateral absence of vas deferens; DIOS ϭ distal intestinal obstruction syndrome; RAD ϭ reactive airways disease; n/a ϭ not available. Login to comment
76 Subsequent genotyping of the family members revealed a compound heterozygote of ⌬F508/R117C in patient 2, and a compound heterozygote of R553X/R117C in the father. Login to comment
79 The R117C is a rare mutation with a frequency of about 0.2% in the US white CF population (10). Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 f 306insA, W79X, R117C, P205S, L227R, I336K, 1248+1G>A, 1609delCA, 1717-8G>A, S549R(T>G), S549N, 1812-1G>A, P574H, 2176insC, R709X, E827X, D836Y, 3007delG, L1065P, L1077P, H1085R, M1101K, 4021insT. Login to comment
171 CFTR Mutation Genotypes Identified Both in Cystic Fibrosis (CF) and in Congenital Bilateral Absence of the Vas Deferens (CBAVD) CF CBAVD F508del/5T 3 143 F508del/2789+5G>A 53 1 F508del/3272-26A>G 17 4 F508del/R117H* 10 39 F508del/R117C 2 2 F508del/L206W 12 4 F508del/R347H 10 5 F508del/R347L 1 1 F508del/D443Y 1 5 F508del/Y569C 1 1 F508del/P574H 3 1 F508del/G628R(G>A) 2 1 F508del/V920M 1 1 F508del/R1070W 2 3 F508del/D1152H 6 8 F508del/S1235R 3 1 F508del/T1246I 1 1 F508del/D1270N+R74W 2 3 F508delN1303I 1 1 3659delC/R347H 1 1 G542X/T338I 2 2 R347H/R1066H 1 1 *The only case with CF whose alleles at IVS8(T)n were reported had mutation R117H associated with a 5T allele. Login to comment

[hide] Is meconium ileus genetically determined or associ... J Med Genet. 1998 Mar;35(3):262-3. De Braekeleer M, Allard C, Leblanc JP, Aubin G, Simard F
Is meconium ileus genetically determined or associated with a more severe evolution of cystic fibrosis?
J Med Genet. 1998 Mar;35(3):262-3., [PMID:9541118]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 Although the A455E mutation is Table 1 Distribution of meconium ileus among CFTR genotypes in Saguenay Lac-Saint-Jean No of CF Proportion No of CFpatients Proportion Proportion ofMI Genotypes patients (%) with meconium ileus (%) among genotypes AF508/AF508 52 39.4 5 26.3 9.6 AF508/621+G-*T 34 25.8 9 47.4 26.5 AF508/A455E 14 10.6 0 0.0 0.0 621+1G-*T/A455E 8 6.1 0 0.0 0.0 621+1G-*T/G85E 2 1.5 1 5.3 50.0 621+1G-*T/Y1092X 1 0.8 0 0.0 0.0 AF508/Y1092X 4 3.0 1 5.3 25.0 A455E/R117C 1 0.8 0 0.0 0.0 AF508/I148T 2 1.5 0 0.0 0.0 621+1G-*T/ 4 3.0 0 0.0 0.0 711 +1G-*T 621+1G-4T/S489X 1 0.8 0 0.0 0.0 AF508/Q890X 1 0.8 1 5.3 100.0 621+1G->T/ 6 4.5 2 10.5 33.3 621+1G-sT AF508/unknown 1 0.8 1 5.3 100.0 Unknown/unknown 1 0.8 0 0.0 0.0 Table 2 Main clinicalfindings in patients with meconium ileus With MI Without MI p value No of patients 18 18 Sex (M/IF) 6/12 6/12 No of patients alive 16 17 Mean age (SD) 16.75 (9.7) 16.70 (7.9) p=0.99 Mean birth weight (SD) 3.24 (0.40) 3.02 (0.47) p=O.18 Mean birth height (SD) 50.0 (2.27) 50.0 (2.58) p=0.86 Currentweightcentile (SD) 26.7 (24.5) 14.1 (18.0) p=0.06 Current height centile (SD) 29.9 (25.1) 20.6 (25.6) p=0.33 Sweat chloride concentration (mEq/l) 105.9 (6.5) 101.1 (9.8) p=O.12 Mean FVC (SD) 89.7 (24.4) 93.0 (17.0) p=0.75 Mean FEV (SD) 73.1 (23.9) 75.4 (18.7) p=0.81 Mean Shwachman score (SD) 82.8 (11.8) 79.2 (12.6) p=0.36 Colonisation with Pseudomonas aeruginosa 13 14 p=0.70 Staphyloccoccus aureus 16 17 p=0.55 Haemophilus influenzae 13 14 p=0.70 Pseudomonas maltophilia 4 6 p=0.46 Pseudomonas cepacia 0 1 Pancreatic insufficiency 18 18 DIOS 7 1 p=0.016 Rectal prolapse 1 2 p=0.55 Recurrent abdominal pain 6 1 p=0.035 Diabetes mellitus 5 0 p=0.016 Liver complications 3* 0 p=0.07 Nasal polyposis 6 6 p=1.00 DIOS=distal intestinal obstruction syndrome. Login to comment

[hide] Complete identification of cystic fibrosis transme... Clin Genet. 1998 Jan;53(1):44-6. De Braekeleer M, Mari C, Verlingue C, Allard C, Leblanc JP, Simard F, Aubin G, Ferec C
Complete identification of cystic fibrosis transmembrane conductance regulator mutations in the CF population of Saguenay Lac-Saint-Jean (Quebec, Canada).
Clin Genet. 1998 Jan;53(1):44-6., [PMID:9550360]

Abstract [show]
Over the past few years, we have conducted a systematic study of 230 cystic fibrosis (CF) chromosomes in the Saguenay Lac-Saint-Jean (SLSJ) population which has a high CF incidence (1/936 live births). We identified 11 mutations accounting for 100% of the CF chromosomes found in patients born in SLSJ. Our results indicate that denaturing gradient gel electrophoresis (DGGE) is a powerful method of identifying CF mutations. They have also considerable implications for genetic counselling and molecular characterization of doubtful patients. They make carrier screening technically feasible in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Distributon of CFTR mutations in CF patients born in SLSJ Mutations No. CF chromosomes Proportion(%) AF508 120 621tlG-T 51 A455E 17 Y1092X 3 1148T 2 711+1G+T 2 G85E 1 Q890X 1 s489x 1 R117C 1 R1158X 1 60 25.5 8.5 1.5 1 1 0.5 0.5 0.5 0.5 0.5 Table 1 gives the distribution of the mutations found on the C F chromosomes from patients born in the SLSJ region. Login to comment
43 Distributionof CFtR genotypes in CF patients born in SLSJ Genotypes No. CF patients AFS08/AF508 AF5@/621+lG-T AF508/A455E 621t 1G+T/A455E 621t 1G+T/621 t 1G-T AF508,N109W AF508/1148T 621t1G+T/711 t1G+T 621t 1G+T/G85E 621t1G+T/YlO92X A455E/R117C 621+1G+TjS489X AF508/Q890X AF508/R1158X 37 30 6 5 2 2 2 1 1 1 1 1 1 45 De Braekeleer et al. identify 100% of the CFTR mutations in the CF population born in SLSJ. Login to comment

[hide] Distinct spectrum of CFTR gene mutations in congen... Hum Genet. 1997 Sep;100(3-4):365-77. Dork T, Dworniczak B, Aulehla-Scholz C, Wieczorek D, Bohm I, Mayerova A, Seydewitz HH, Nieschlag E, Meschede D, Horst J, Pander HJ, Sperling H, Ratjen F, Passarge E, Schmidtke J, Stuhrmann M
Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens.
Hum Genet. 1997 Sep;100(3-4):365-77., [PMID:9272157]

Abstract [show]
Congenital absence of the vas deferens (CAVD) is a frequent cause for obstructive azoospermia and accounts for 1%-2% of male infertility. A high incidence of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has recently been reported in males with CAVD. We have investigated a cohort of 106 German patients with congenital bilateral or unilateral absence of the vas deferens for mutations in the coding region, flanking intron regions and promotor sequences of the CFTR gene. Of the CAVD patients, 75% carried CFTR mutations or disease-associated CFTR variants, such as the "5T" allele, on both chromosomes. The distribution of mutation genotypes clearly differed from that observed in cystic fibrosis. None of the CAVD patients was homozygous for delta F508 and none was compound heterozygous for delta F508 and a nonsense or frameshift mutation. Instead, homozygosity was found for a few mild missense or splicing mutations, and the majority of CAVD mutations were missense substitutions. Twenty-one German CAVD patients were compound heterozygous for delta F508 and R117H, which was the most frequent CAVD genotype in our study group. Haplotype analysis indicated a common origin for R117H in our population, whereas another frequent CAVD mutation, viz. the "5T allele" was a recurrent mutation on different intragenic haplotypes and multiple ethnic backgrounds. We identified a total of 46 different mutations and variants, of which 15 mutations have not previously been reported. Thirteen novel missense mutations and one unique amino-acid insertion may be confined to the CAVD phenotype. A few splice or missense variants, such as F508C or 1716 G-->A, are proposed here as possible candidate CAVD mutations with an apparently reduced penetrance. Clinical examination of patients with CFTR mutations on both chromosomes revealed elevated sweat chloride concentrations and discrete symptoms of respiratory disease in a subset of patients. Thus, our collaborative study shows that CAVD without renal malformation is a primary genital form of cystic fibrosis in the vast majority of German patients and links the particular expression of clinical symptoms in CAVD with a distinct subset of CFTR mutation genotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 This initial screening included the mutations ∆F508, G542X, R553X, G551D, N1303K, 1717-1 G→A, 3272-26 A→G, Y1092X, 2143delT, R347P, R347H, R334W, I336K, R117H, R117C, 2789+5 G→A, 3849+10kB C→T and the "5T" allele, the latter two splice variants being tested according to the instructions of Highsmith et al. (1994) and Chillón et al. (1995). Login to comment

[hide] Fluorescent multiplex microsatellites used to defi... Hum Mutat. 1996;8(3):229-35. Hughes D, Wallace A, Taylor J, Tassabehji M, McMahon R, Hill A, Nevin N, Graham C
Fluorescent multiplex microsatellites used to define haplotypes associated with 75 CFTR mutations from the UK on 437 CF chromosomes.
Hum Mutat. 1996;8(3):229-35., [PMID:8889582]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene contains three highly informative microsatellites: IVS8CA, IVS17bTA, and IVS17bCA. Their analysis improves prenatal/ carrier diagnosis and generates haplotypes from CF chromosomes that are strongly associated with specific mutations. Microsatellite haplotypes were defined for 75 CFTR mutations carried on 437 CF chromosomes (220 for delta F508, 217 for other mutations) from Northern Ireland and three English regions: the North-West, East Anglia, and the South. Fluorescently labelled microsatellites were amplified in a triplex PCR reaction and typed using an ABI 373A fluorescent fragment analyser. These mutations cover all the common and most of the rare CF defects found in the UK, and their corresponding haplotypes and geographic region are tabulated here. Ancient mutations, delta F508, G542X, N1303K, were associated with several related haplotypes due to slippage during replication, whereas other common mutations were associated with the one respective haplotype (e.g., G551D and R560T with 16-7-17, R117H with 16-30-13, 621 + 1G > T with 21-31-13, 3659delC with 16-35-13). This simple, fast, and automated method for fluorescent typing of these haplotypes will help to direct mutation screening for uncharacterised CF chromosomes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 CF 8CA-17bTA-17bCA Mutation chromosomes % Normal Laboratoryb Reference' HaplotVpe 1)15-29-13 557delT Nl Graham et al.. 1992 21 16-07-17 MU (G>T) 3) 16-24-13 4) 16-25-13 5) 16-29-13 6) 16-30-13 7) 16-30-14 8) 16-31-13 9) 16-31-14 10) 16-32-13 12) 16-33-13 13) 16-34-13 14) 16-35-13 11)16-32-17 15)1645-13 16) 1646-13 17) 1646-14 19) 17-07-17 18)16-53-13 20)17-29-14 21) 17-31-13 22) 17-32-13 23) 17-35-13 24) 17-51-11 25) 17-55-13 27) 17-58-13 28) 21-31-13 29) 22-31-13 31)23-22-17 26) 17-56-13 30) 22-33-13 32) 23-29-13 33)23-31-13 34)23-32-13 35)23-33-13 36)23-34-13 37) 23-36-13 38)24-22-17 39) 24-31-13 182delT P67L R75X L206W 1154insTC 146linsAGAT Q493x V520F 1717-1G>A G551D R560T V562L R709X S1196X L1254X R1283M G85E 2184insA 711+lG>T 3495delA 4279insA SlOR L88S R117C R117H G178R 1717-1G>A Y563N W1098R G1123R 3850- 1G>A E6OX %%deIT 1138insG R34P 2183AA>G 2184delA R1158X 1078delT R1162X 3849G>A Q141W R347P Y917C G2iX 711+3A>G 441delA 3130de115 3659delC 1898+1G>A R709X 2711delT R1158X E92K 3849+lOkbC>T 2118delAACT 4048insCC 296+1 2 T S Q22OX R297Q A1507 2789+5G>A 3120+1G>A W128W 1811+lG>C AF508 E831X R116W AF508 W846X1 3120G>A R785X R553X R553X R553X 621+1G>T G542X G542X Y1182X N1303K AF508 G54W 3041delG 1525-1G>A N1303K G542X G542X G542X 394delTT R709X N1303K 1 1 1 2 1 1 4 2 3 4 2 26 8 1 1 1 1 1 8 1 1 1 1 1 1 1 19 1 2 1 1 1 1 7 1 1 2 1 1 2 1 1 1 1 1 1 1 1 2 1 1 7 4 1 2 1 1 2 1 1 4 Asian 1 2 1Asian 5 4 i Afro-Caribbean 5 1 42 (19%) 1 1 57 (26%) 1 2 1 1 1 2 12 2 11.4 0.4 4.9 16.3 1.1 3.8 1.9 10.6 2.3 1.5 2.3 1.5 2.7 4.5 0.4 0.8 0.8 0.4 0.8 0.4 1 2 1 7 1 1 1Asian 1 1.5 0.8 0.8 NI G NI, M M NI NI. Login to comment

[hide] Haplotype analysis of 94 cystic fibrosis mutations... Hum Mutat. 1996;8(2):149-59. Morral N, Dork T, Llevadot R, Dziadek V, Mercier B, Ferec C, Costes B, Girodon E, Zielenski J, Tsui LC, Tummler B, Estivill X
Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers.
Hum Mutat. 1996;8(2):149-59., [PMID:8844213]

Abstract [show]
We have analyzed 416 normal and 467 chromosomes carrying 94 different cystic fibrosis (CF) mutations with polymorphic genetic markers J44, IVS6aGATT, IVS8CA, T854, IVS17BTA, IVS17BCA, and TUB20. The number of mutations found with each haplotype is proportional to its frequency among normal chromosomes, suggesting that there is no preferential haplotype in which mutations arise and thus excluding possible selection for specific haplotypes. While many common mutations in the worldwide CF population showed absence of haplotype variation, indicating their recent origins, some mutations were associated with more than one haplotype. The most common CF mutations, delta F508, G542X, and N1303K, showed the highest number of slippage events at microsatellites, suggesting that they are the most ancient CF mutations. Recurrence was probably the case for 9 CF mutations (R117H, H199Y, R347YH, R347P, L558S, 2184insA, 3272-26A-->G, R1162X, and 3849 + 10kbC-->T). This analysis of 94 CF mutations should facilitate mutation screening and provides useful data for studies on population genetics of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 CFTR Haplotypes for Diallelic and Multiallelic DNA Markers for 94 CF Mutations" J44-GATT- 8CA-17BTA- No. of T854-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 2-7-1-2 17-47-13 (55.4%) 17-46-13 17-45-13 17-34-13 17-32-13 17-31-14 17-31-13 17-29-14 17-28-13 16-48-13 16-46-14 16-46-13 16-45-13 16-44-13 16-35-13 16-33-13 16-32-13 16-31-14 16-31-13 16-30-13 16-29-13 16-26-13 16-25-13 16-24-13 14-31-13 1-7-2-1 17-7-17 (16.8%) R334W R334W 3860ins31 G1244E R1162X R1162X R1162X G91R MllOlK R347P R334W R117C E92K 3849+lOkbC+T 3293delA 1811+1.6kb A-tG 1811+1.6kb A-tG 2184insA P205S 3659delC G673X 11005R I336K W58S R347P W846X 405+1-A G178R 3905insT R1162X R347H 3100insA E60X 1078delT 4005+1-A K710X 1677delTA H199Y 3601-2AjG 3850-3T+G 3272-26A-tG 3850-1-A 1812-1-A R117H L1059X S492F Y1092X Y569H 3732delA C866Y 711+1G+T 711+1-T G85E 1949del84 2789+5-A H1085R W1282X R1066C 2043delG V456F 2 1 1 1 2 1 6 2 2 1 2 1 1 2 1 1 4 1 1 1 3 2 1 1 1 1 1 1 2 7 1 1 1 1 2 1 1 3 19 3 3 1 1 2 1 1 5 1 1 1 1 3 6 3 5 1 13 2 1 1 - 0.48 0.48 - - - 0.24 - - - 2.65 2.40 1.93 2.65 1.68 2.65 0.72 13.94 13.46 1.93 - 0.72 0.24 3.37 - b b fP fP fP t b,fb.fP h fb t h t h h fP fP b.h b h h b h h h h h fb fb,fP.t fP fP fP9t fP b t fPh b h fb b.fb,h fb*fP b,fP h h t h fb fb,fp,h.t fP fP fb t b.fP,t b,fb,h,t b f b h h fb b,fb.fP,h fP h h Gasparini et al. (1991b) Chilldn et al. (1993a) Devoto et al. (1991) Gasparini et al. (1991b) Dork et al. (1993a) Guillermit et al. (1993) Zielenski et al. (1993) Dean et al. (1990) Dork et al. (1994a) Nunes et al. (1993) Highsmith et al. (1994) Ghanem et al. (1994) Chilldn et al. (1995) Dork et al. (1994a) Dork et al. (1993a) Chilldn et al. (1993b) Kerem et al. (1990) Dork et al. (1994a) Dork et al. (1994a) Cuppenset al. (1993) Fanen et al. (1992) Maggio et al. (personal communication) Audrezet et al. (1993) Vidaud et al. (1990) Dork et al. (1993b) Zielenski et al. (1991a) Chilldn et al. (1994b) Malik et al. (personal communication) Cremonesi et at. Login to comment

[hide] CFTR gene variant for patients with congenital abs... Am J Hum Genet. 1995 Oct;57(4):958-60. Zielenski J, Patrizio P, Corey M, Handelin B, Markiewicz D, Asch R, Tsui LC
CFTR gene variant for patients with congenital absence of vas deferens.
Am J Hum Genet. 1995 Oct;57(4):958-60., [PMID:7573058]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 More recently, CFTR alleles Letters to the Editor Table I CFTR Mutations Detected in the CBAVD Patients Number of Percentage Genotype Patients of Total AF508 IVS8/ST 16 W1282X IVS8/5T 9 AF508 R117H(7T) 4 N1303K IVS8/5T 2 IVS8/ST IVS8/5T 2 AF508 R117C 1 AF508 D1152H 1............ 1 58.6 AF508 S50Y 1 R553X R117H(7T) 1 R117H(7T) R117H(7T) 1 G542X IVS8/5T 1 1717-1G-+A IVS8/ST 1 1525-1G-A IVS8/5T 1 IVS8/5T Unknown 4 AF508 Unknown 4. Login to comment

[hide] Is congenital bilateral absence of vas deferens a ... Am J Hum Genet. 1995 Jan;56(1):272-7. Mercier B, Verlingue C, Lissens W, Silber SJ, Novelli G, Bonduelle M, Audrezet MP, Ferec C
Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients.
Am J Hum Genet. 1995 Jan;56(1):272-7., [PMID:7529962]

Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) is an important cause of sterility in men. Although the genetic basis of this condition is still unclear, it has been shown recently that some of these patients carry mutations in their cystic fibrosis transmembrane conductance regulator (CFTR) genes. To extend this observation, we have analyzed the entire coding sequence of the CFTR gene in a cohort of 67 men with CBAVD, who are otherwise healthy. We have identified four novel missense mutations (A800G, G149R, R258G, and E193K). We have shown that 42% of subjects were carriers of one CFTR allele and that 24% are compound heterozygous for CFTR alleles. Thus, we have been unable to identify 76% of these patients as carrying two CFTR mutations. Furthermore, we have described the segregation of CFTR haplotypes in the family of one CBAVD male; in this family are two male siblings, with identical CFTR loci but displaying different phenotypes, one of them being fertile and the other sterile. The data presented in this family, indicating a discordance between the CBAVD phenotype and a marked carrier (delta F508) chromosome, support the involvement of another gene(s), in the etiology of CBAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 In addition, we identified the following missense mutations: four R668C, one A800G, one (G628R + S1235R, borne on the same chromosome), one (R74W + D1270N, borne on the same chromosome), six R117H, one F1052V, one R117C, one S1235R, one G149R, one R258G, two R347H, one R1066H, one R75L, and one E193K. Login to comment
77 of Patients Genotypea 1 AF508 + (G628R + S1235R) 1 AF508 + (R74W + D1270N) 2 AF508 + R668C 4 AF508 + R117H 1 AF508 + R258G 1 AF508 + R75L 1 E193K + N1303K 1 R347H + R1066H 1 R117C + W1282X 1 R553X + R668C 1 G149R + R668C 1 R117H+R117H 18 AF508/unidentified 4 W1282X/unidentified 1 G542X/unidentified 1 N1303K/unidentified 1 S1235R/unidentified 1 R347H/unidentified 1 A800G/unidentified 1 F1052V/unidentified 23 unidentified/unidentified a In parentheses are the two mutations located on the same haplotype. Login to comment

[hide] Independent origins of cystic fibrosis mutations R... Am J Hum Genet. 1994 Nov;55(5):890-8. Morral N, Llevadot R, Casals T, Gasparini P, Macek M Jr, Dork T, Estivill X
Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene.
Am J Hum Genet. 1994 Nov;55(5):890-8., [PMID:7526685]

Abstract [show]
Microsatellite analysis of chromosomes carrying particular cystic fibrosis mutations has shown different haplotypes in four cases: R334W, R347P, R1162X, and 3849 + 10kbC-->T. To investigate the possibility of recurrence of these mutations, analysis of intra- and extragenic markers flanking these mutations has been performed. Recurrence is the most plausible explanation, as it becomes necessary to postulate either double recombinations or single recombinations in conjunction with slippage at one or more microsatellite loci, to explain the combination of mutations and microsatellites if the mutations arose only once. Also in support of recurrence, mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T involve CpG dinucleotides, which are known to have an increased mutation rate. Although only 15.7% of point mutations in the coding sequence of CFTR have occurred at CpG dinucleotides, approximately half of these CpG sites have mutated at least once. Specific nucleotide positions of the coding region of CFTR, distinct from CpG sequences, also seem to have a higher mutation rate, and so it is possible that the mutations observed are recurrent. G-->A transitions are the most common change found in those positions involved in more than one mutational event in CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 Slippage usually results in the addition or subtraction of one repeat unit either side Table 5 CpG Dinucleotides in CFTR Gene That Have More than One Mutational Event Position Change Mutation Reference 223 ......... CT R31C Ghanem et al. 1994 224 ......... GT R31L Zielenski et al., in press 355 ........ C- >T R75X Dork et al., in press 356 ......... G--*T R75L B. Costes, personal communication 356 ......... G-aA R75Q' Zielenski et al. 1991b 481 ......... CT R117C D6rk et al., in press 482 ......... G-oA R117H Dean etal. Login to comment

[hide] Detection of more than 50 different CFTR mutations... Hum Genet. 1994 Nov;94(5):533-42. Dork T, Mekus F, Schmidt K, Bosshammer J, Fislage R, Heuer T, Dziadek V, Neumann T, Kalin N, Wulbrand U, et al.
Detection of more than 50 different CFTR mutations in a large group of German cystic fibrosis patients.
Hum Genet. 1994 Nov;94(5):533-42., [PMID:7525450]

Abstract [show]
We have conducted a comprehensive study of the molecular basis of cystic fibrosis (CF) in 350 German CF patients. A screening approach based on single-strand conformation analysis and direct sequencing of genomic polymerase chain reaction products has allowed us to detect the molecular defects on 95.4% of the CF chromosomes within the coding region and splice sites of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The spectrum of sequence changes comprises 54 different mutations, including 17 missense mutations, 14 nonsense mutations, 11 frameshift mutations, 10 splice site variants and two amino acid deletions. Eleven of these mutations have not previously been described. Our results reflect the marked mutational heterogeneity of CF in a large sample of patients from a non-isolated population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 Table 1 Frequency distribution and haplotypes of CFTR mutations in 700 German CF chromosomes Mutation~ Nucleotide changesb Locationc Frequencyd Haplotype~ Referencef Q39x C--~T at 247 Exon 2 1 (0.1%) D3 Cutting et al. (1992) E60X G-+T at 310 Exon 3 1 (0.1%) A2 Malone et al. (*) R75X C--+T at 355 Exon 3 1 (0.1%) C2 This study 405+1 G---~A G-+A at 405+1 Intron 3 1 (0.1%) C2 D6rk et al. (1993c) E92X G--~T at 406 Exon 4 2 (0.3%) B2 Will et al. (1994) R117C C---~Tat 481 Exon 4 1 (0.1%) C2 This study R117H G--+A at 482 Exon 4 2 (0.3%) B6 Dean et al. (1990) 621+1 G--+T G--+T at 621+1 Intron 4 1 (0.1%) B1 Zielenski et al. (1991b) H199Y C--+T at 727 Exon 6a 1 (0.1%) A2 This study (*) 1078delT Deletion of T at 1078 Exon 7 4 (0.6%) C2 Claustres et al. (1992) R334W C-~T at 1132 Exon 7 2 (0.3%) BI Gasparini et al. (1991) 1336K T-->A at 1139 Exon 7 3 (0.4%) A2 Cuppens et al. (1993) R347P G--+C at 1172 Exon 7 11 (1.6%) A2, C2 Dean et al. (1990) 1342-2 A--+C A--+C at 1342-2 Intron 8 3 (0.4%) A4 D/3rk et al. (1993b) Q414X C--+T at 1372 Exon 9 1 (0.1%) D3 D6rk et al. (1994a) A455E C-+A at 1496 Exon 9 1 (0.1%) BI Kerem et al. (1990) V456F G--~T at 1498 Exon 9 1 (0.1%) B3 D6rk et al. (1994a) A1507 Deletion of 3 bp between 1648-1653 Exon 10 1 (0.1%) D5 Kerem et al. (1990) AF508 Deletion of 3 bp between 1652-1655 Exon 10 504 (72.0%) B1, DI, B7 Kerem et al. (1989) 1717-1 G--+A G--+A at 1717-1 lntron 10 6 (0.9%) B3 Kerem et al. (1990) G542X G--+T at 1756 Exon 11 10 (1.4%) B1 Kerem et al. (1990) G551D G--+A at 1784 Exon 11 7 (l.0%) B3 Cutting et al. (1990) Q552X C-+T at 1786 Exon 11 1 (0.1%) A4 Devoto et al. (1991) R553X C--+T at 1789 Exon 11 16 (2.3%) A4, B4, D3 Cutting et al. (1990) L558S T--+C at 1805 Exon 11 1 (0.1%) C2 Maggio et al. (*) 1811+I.6kBA-+G A--+Gat 1811+l.6kB lntron 11 1 (0.1%) A2 Chillonetal. Login to comment
86 Whereas one heterozygote R117C/2184insA presents with borderline disease (see below), three compound heterozygotes AF508/2184insA are pancreatic insufficient with severe forms of CF. Login to comment
87 We thus classify 2184insA as the "pancreas-insufficient" and R117C as the "pancreas-sufficient" allele. Login to comment
95 (1) In the first transmembrane domain, the mutation R117C was initially identified in a 12-year-old pancreatic sufficient German CF patient. This mutation occurs at the same CpG dinucleotide as the previously described and extensively characterized mutation Rll7H (Dean et al. 1990; Kiesewetter et al. 1993; Sheppard et al. 1993; The CF Genotype-Phenotype Consortium 1993) A G C T A G C T A G C T C G C T Control R 117 H R 117 C Fig. 5 Direct sequencing of the two mild missense mutations (arrows) R117H (middle) and R117C (right) in exon 4 in heterozygous patients A G C T A G C T G T T T_~- T Control L 619 S Fig.6 Direct sequencing of the missense substitution L619S (arrow, right) in exon 13 (Fig. 5). Login to comment

[hide] Exon 9 of the CFTR gene: splice site haplotypes an... Hum Genet. 1994 Jan;93(1):67-73. Dork T, Fislage R, Neumann T, Wulf B, Tummler B
Exon 9 of the CFTR gene: splice site haplotypes and cystic fibrosis mutations.
Hum Genet. 1994 Jan;93(1):67-73., [PMID:7505767]

Abstract [show]
The alternatively spliced exon 9 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene codes for the initial part of the amino-terminal nucleotide-binding fold of CFTR. A unique feature of the acceptor splice site preceding this exon is a variable length polymorphism within the polypyrimidine tract influencing the extent of exon 9 skipping in CFTR mRNA. We investigated this repeat for its relationship to CFTR mutations and intragenic markers on 200 chromosomes from German patients with cystic fibrosis (CF). Four frequent length variations were strongly associated with the four predominant haplotypes previously defined by intragenic marker dimorphisms. One of these alleles displayed absolute linkage disequilibrium to the major CF mutation delta F508. Other frequent CFTR mutations were linked to one particular splice site haplotype indicating that differential exon 9 skipping contributes little to the clinical heterogeneity among CF patients with an identical mutation. We also identified a novel missense mutation (V456F) and a novel nonsense mutation (Q414X) within the coding region of exon 9. The missense mutation V456F adjacent to Walker motif A was present in a pancreas-sufficient CF patient. In contrast, the pancreas-insufficient Q414X/delta F508 compound heterozygote suffered from a severe form of the disease, indicating that alternative splicing of exon 9 does not overcome the deleterious effect of a stop codon with this exon.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Association of (TG),Tm alleles with CFTR mutations (TG),Tm CFTR mutationsa (TG)llT7 E60X, E92X, R117C, 1078delT, R347P, R553X, 2184delA, 2184insA, I1005R, 3272-26A--~G, L1059X, Y1092X, R1162X, 3659delC, 3850-3T-oG, S1251N Q39X, R117H, Q414X, V456F, AI507, 1717-1G--~A, G551D, 2043delG, 2183AA---~G, 2184insA, 2789 + 5 G---~A,3272-26A---~G, R1066C, L1077P, 3849 + l0 kB C---~T,4374 + 1 G---~T 621 + 1 G---~T,R334W, A455E, AF508, G542X, 2143delT, 3849 + 10 kB C---~T,NI303K 405 + 1 G----~A,1342-2 A---~C,R553X (TG)IoT7 (TG)10T9 (TG)12T7 a References are compiled in Tsui (1992), except for 2143delT (Dtrk et al. 1992b), 3850-3 T---~G,4374 + 1 G---~T,1342-2 A---~C (Dtrk et al. 1993a, b), Q414X, V456F (this work), 405 + 1 G---~A, E92X, R117C, 2184delA, 2184insA, I1005R, L1059X (T. Login to comment

[hide] Detection of novel and rare mutations in exon 4 of... Hum Mol Genet. 1992 Sep;1(6):439-40. Shackleton S, Beards F, Harris A
Detection of novel and rare mutations in exon 4 of the cystic fibrosis gene by SSCP.
Hum Mol Genet. 1992 Sep;1(6):439-40., [PMID:1284529]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 Panel B: lane c contains the patient with the R117C mutation. Login to comment

[hide] A 96-well formatted method for exon and exon/intro... Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5. Lucarelli M, Narzi L, Piergentili R, Ferraguti G, Grandoni F, Quattrucci S, Strom R
A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene.
Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5., [PMID:16635477]

Abstract [show]
Full genotypic characterization of subjects affected by cystic fibrosis (CF) is essential for the definition of the genotype-phenotype correlation as well as for the enhancement of the diagnostic and prognostic value of the genetic investigation. High-sensitivity diagnostic methods, capable of full scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, are needed to enhance the significance of these genetic assays. A method for extensive sequencing of the CFTR gene was optimized. This method was applied to subjects clinically positive for CF and to controls from the general population of central Italy as well as to a single subject heterozygous for a mild mutation and with an uncertain diagnosis. Some points that are crucial for the optimization of the method emerged: a 96-well format, primer project and purification, and amplicon purification. The optimized method displayed a high degree of diagnostic sensitivity; we identified a subset of 13 CFTR mutations that greatly enhanced the diagnostic sensitivity of common methods of mutational analysis. A novel G1244R disease causing mutation, leading to a CF phenotype with pancreatic sufficiency but early onset of pulmonary involvement, was detected in the subject with an uncertain diagnosis. Some discrepancies between our results and previously published CFTR sequence were found.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 In this work, we found a limited subset of 13 mutations (not included in the PCR/OLA/SCS assay) in 7 CFTR exons, significantly improving the sensitivity of standard assays: D110H, R117C, and H139R (exon 4); R334L, T338I, and A349V (exon 7); S549R(A->C) (exon 11); Y849X (exon 14a); L997F (exon 17a); L1065P, R1066C, and L1077P (exon 17b); and G1244E (exon 20). Login to comment

[hide] CFTR gene mutations and asthma in the Norwegian En... Respir Med. 2006 Dec;100(12):2121-8. Epub 2006 May 5. Munthe-Kaas MC, Lodrup Carlsen KC, Carlsen KH, Skinningsrud B, Haland G, Devulapalli CS, Pettersen M, Eiklid K
CFTR gene mutations and asthma in the Norwegian Environment and Childhood Asthma study.
Respir Med. 2006 Dec;100(12):2121-8. Epub 2006 May 5., [PMID:16678395]

Abstract [show]
BACKGROUND: Several candidate genes have been implicated in the etiology of asthma, including the gene coding for the cystic fibrosis transmembrane conductance regulator (CFTR). Mutations in the CFTR gene result in derangements of mucociliary clearance. Homozygotes for CFTR mutations develop cystic fibrosis (CF), a disorder characterized mainly by lung and pancreas disease. OBJECTIVE: To investigate whether there was an increased frequency of CFTR mutations in asthma patients. METHODS: Seven hundred and three subjects aged 10-11 years from the environment and childhood asthma (ECA) study were included in the present study. Possible associations between asthma, reduced lung function, bronchial hyperresponsiveness (BHR), and increased or decreased nitrogen oxide (NO) levels (based on structural parental interview, spirometry, PD20 methacholine challenge test and exhaled NO measurements), and the five most common CFTR mutations in Norway (DeltaF508, R117H, R117C, 4005+2T-->C, 394delTT), the modulating polymorphisms IVS8(TG)mTn and the IVS8-5T were investigated. RESULTS: No association were found between asthma, reduced lung function, BHR or exhaled NO levels and CF heterozygosity. However, the IVS8(TG)11T7 haplotype was associated with normal lung function. CONCLUSIONS: Our results do not support the hypothesis that CFTR mutations or polymorphisms play a role in the pathogenesis of asthma in children. However, the distribution of Tn(TG)m haplotypes differed between individuals with reduced lung function and individuals with normal lung function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Possible associations between asthma, reduced lung function, bronchial hyperresponsiveness (BHR), and increased or decreased nitrogen oxide (NO) levels (based on structural parental interview, spirometry, PD20 methacholine challenge test and exhaled NO measurements), and the five most common CFTR mutations in Norway (DF508, R117H, R117C, 4005+2T-C, 394delTT), the modulating polymorphisms IVS8(TG)mTn and the IVS8-5T were investigated. Login to comment
25 CFTR mutation Alleles (%) F508del 184 (62.2) R117C 12 (4.1) R117H 12 394delTT 11 (3.8) 4005+2T-C 11 G551D 6 (2.0) 3659delC 5 (1.7) E60X 4 (1.4) V232D 4 1525-2A-G 3 (1.0) N1303K 3 G542X 2 (0.7) E279X 2 R75X 2 S912X 2 E116X 1 (0.3) L295Q 1 R347L 1 Q493X 1 I506L 1 I507del 1 R553X 1 G576A 1 621-1G-T 1 2183AA-G 1 S945L 1 R1162X 1 I1234V 1 3849+10 kbC-T 1 W1282X 1 Unknown 18 (6.5) Total alleles 296 (100%) Mutations detected with OLA31 m kit-74%. Login to comment
52 In order to correlate the IVS8 Tn(TG)m haplotype to the fragment lengths, a couple of samples were sequenced and used as standards.30 R117C was analyzed by PCR with the forward primer 50 -M13-TTCACATATGGTATGACCCTC and reverse primer 50 - TTGTACCAGCTCACTACCTA followed by restriction digestion by BsmI and visualized on agarose gel. The fragment sizes from normal samples were 330 and 126 bp, while heterozygote samples got additional bands of 228 and 102 bp.31 R117H was analyzed in two separate PCR`s with a common forward primer C: 50 TCACATATGGTATGACCCTC, and with normal specific arms reverse primer in one tube 50 -CTTATGCCTAGATAAATCGCGA- TAGAAC and mutated specific arms reverse primer 50 -CTTATGCCTAGATAAATCGCGATAGACT in the other tube. Login to comment

[hide] [Cystic fibrosis in a woman aged seventy]. Ned Tijdschr Geneeskd. 2010;154:A1342. Ras JE, van Velzen E, van Berkhout FT, van den Brand JJ
[Cystic fibrosis in a woman aged seventy].
Ned Tijdschr Geneeskd. 2010;154:A1342., [PMID:20619026]

Abstract [show]
A seventy-year-old woman was admitted to hospital with a Staphylococcus aureus respiratory tract infection. She had a history of extensive bronchiectasis and allergic bronchopulmonary aspergillosis (ABPA). Cystic fibrosis (CF) was suspected and cystic fibrosis transmembrane conductance regulator (CFTR) gene analysis showed F508del and R117H-7T mutations. In these mutations there is residual activity in the chloride channel in the cell membrane coded by the CFTR gene. This results in a much milder disease pattern varying from no disease at all to isolated organ disease. This type of disease is known as non-classical cystic fibrosis. In our patient the diagnosis of cystic fibrosis was made exceptionally late in life.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 6 Massie RJH, Poplawski N, Wilcken B, Goldblattz J, Byrnes C, Robertson C. Intron-8 polythymidine sequence in Australasian individuals with CF mutations R117H and R117C. Login to comment

[hide] Newborn screening for cystic fibrosis in Alberta: ... Paediatr Child Health. 2010 Nov;15(9):590-4. Lilley M, Christian S, Hume S, Scott P, Montgomery M, Semple L, Zuberbuhler P, Tabak J, Bamforth F, Somerville MJ
Newborn screening for cystic fibrosis in Alberta: Two years of experience.
Paediatr Child Health. 2010 Nov;15(9):590-4., [PMID:22043142]

Abstract [show]
On April 1, 2007, Alberta became the first province in Canada to introduce cystic fibrosis (CF) to its newborn screening program. The Alberta protocol involves a two-tier algorithm involving an immunoreactive trypsinogen measurement followed by molecular analysis using a CF panel for 39 mutations. Positive screens are followed up with sweat chloride testing and an assessment by a CF specialist. Of the 99,408 newborns screened in Alberta during the first two years of the program, 221 had a positive CF newborn screen. The program subsequently identified and initiated treatment in 31 newborns with CF. A relatively high frequency of the R117H mutation and the M1101K mutation was noted. The M1101K mutation is common in the Hutterite population. The presence of the R117H mutation has created both counselling and management dilemmas. The ability to offer CF transmembrane regulator full sequencing may help resolve diagnostic dilemmas. Counselling and management challenges are created when mutations are mild or of unknown clinical significance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
189 Massie RJ, Poplawski N, Wilcken B, Goldblatt J, Byrnes C, Robertson C. Intron-8 polythymidine sequence in Australasian individuals with CF mutations R117H and R117C. Login to comment

[hide] PGD for cystic fibrosis patients and couples at ri... Reprod Biomed Online. 2013 May;26(5):420-30. doi: 10.1016/j.rbmo.2013.01.006. Epub 2013 Jan 29. Rechitsky S, Verlinsky O, Kuliev A
PGD for cystic fibrosis patients and couples at risk of an additional genetic disorder combined with 24-chromosome aneuploidy testing.
Reprod Biomed Online. 2013 May;26(5):420-30. doi: 10.1016/j.rbmo.2013.01.006. Epub 2013 Jan 29., [PMID:23523379]

Abstract [show]
Preimplantation genetic diagnosis (PGD) for inherited disorders is presently applied for more than 300 different conditions. The most frequent PGD indication is cystic fibrosis (CF), the largest series of which is reviewed here, totalling 404 PGD cycles. This involved testing for 52 different CFTR mutations with almost half of the cases (195/404 cycles) performed for DeltaF508 mutation, one-quarter (103/404 cycles) for six other frequent mutations and only a few for the remaining 45 CFTR mutations. There were 44 PGD cycles performed for 25 CF-affected homozygous or double-heterozygous CF patients (18 male and seven female partners), which involved testing simultaneously for three mutations, resulting in birth of 13 healthy CF-free children and no misdiagnosis. PGD was also performed for six couples at a combined risk of producing offspring with CF and another genetic disorder. Concomitant testing for CFTR and other mutations resulted in birth of six healthy children, free of both CF and another genetic disorder in all but one cycle. A total of 96 PGD cycles for CF were performed with simultaneous aneuploidy testing, including microarray-based 24-chromosome analysis, as a comprehensive PGD for two or more conditions in the same biopsy material.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 Mutation Region Legacy name cDNA name Protein name # of Patient Number of cycles Number of transfers Number of embryos transferred Pregnancy Birth 125G/C c.-8G>C NA Promoter 1 2 2 2 1 (1) 0 E60X c.178G>T p.Glu60X Exon 3 1 1 1 1 0 0 G85E c.254G>A p.Gly85Glu Exon 3 1 1 1 2 1 1 R75Q c.224G>A p.Arg75Gln Exon 3 1 1 1 1 1 1 R75X c.223C>T p.Arg75X Exon 3 1 1 1 2 1 2 A120T c.358G>A p.Ala120Thr Exon 4 1 1 1 1 0 0 R117C c.349C>T p.Arg117Cys Exon 4 2 6 3 5 1 1 R117H c.350G>A p.Arg117His Exon 4 14 22 19 38 8 6 621+1G-T c.489 &#b1; 1G>T - Intron 4 4 7 4 6 2 1 852del22 c.720_741 p.Gly241GlufsX13 Exon 6 1 1 0 0 0 0 L206W c.617T>G p.Leu206Trp Exon 6 1 2 1 2 0 0 A349V c.1046C>T p.Ala349Val Exon 8 1 2 2 4 2 4 1078delT c.948delT p.Phe316LeufsX12 Exon 8 1 1 1 1 1 0 1154ins-TC c.1022_1023insTC p.Phe342HisfsX28 Exon 8 1 2 1 2 0 0 Q359K/T360K c. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... PLoS One. 2013 Apr 17;8(4):e61176. doi: 10.1371/journal.pone.0061176. Print 2013. Schippa S, Iebba V, Santangelo F, Gagliardi A, De Biase RV, Stamato A, Bertasi S, Lucarelli M, Conte MP, Quattrucci S
Cystic fibrosis transmembrane conductance regulator (CFTR) allelic variants relate to shifts in faecal microbiota of cystic fibrosis patients.
PLoS One. 2013 Apr 17;8(4):e61176. doi: 10.1371/journal.pone.0061176. Print 2013., [PMID:23613805]

Abstract [show]
INTRODUCTION: In this study we investigated the effects of the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene variants on the composition of faecal microbiota, in patients affected by Cystic Fibrosis (CF). CFTR mutations (F508del is the most common) lead to a decreased secretion of chloride/water, and to mucus sticky secretions, in pancreas, respiratory and gastrointestinal tracts. Intestinal manifestations are underestimated in CF, leading to ileum meconium at birth, or small bowel bacterial overgrowth in adult age. METHODS: Thirty-six CF patients, fasting and under no-antibiotic treatment, were CFTR genotyped on both alleles. Faecal samples were subjected to molecular microbial profiling through Temporal Temperature Gradient Electrophoresis and species-specific PCR. Ecological parameters and multivariate algorithms were employed to find out if CFTR variants could be related to the microbiota structure. RESULTS: Patients were classified by two different criteria: 1) presence/absence of F508del mutation; 2) disease severity in heterozygous and homozygous F508del patients. We found that homozygous-F508del and severe CF patients exhibited an enhanced dysbiotic faecal microbiota composition, even within the CF cohort itself, with higher biodiversity and evenness. We also found, by species-specific PCR, that potentially harmful species (Escherichia coli and Eubacterium biforme) were abundant in homozygous-F508del and severe CF patients, while beneficial species (Faecalibacterium prausnitzii, Bifidobacterium spp., and Eubacterium limosum) were reduced. CONCLUSIONS: This is the first report that establishes a link among CFTR variants and shifts in faecal microbiota, opening the way to studies that perceive CF as a 'systemic disease', linking the lung and the gut in a joined axis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 Patient Sex Age (years) CFTR allele, = CFTR allele, R Criterion I(a) Criterion II (1 = severe, 0 = mild)(b) Pancreatic status(d) FEV1% BMI 1 M 17 F508del M1V 2 (1) 1 65 17.91 2 F 23 F508del Y569D 2 (1) 0 97 18.66 3 (s1)(c) F 20 P1013L F508del 2 (0) 0 87 18.67 4 M 11 F508del L997F (without R117L) 2 0 0 110 21.33 5 (s1)(c) M 11 P1013L F508del 2 (0) 0 100 23.14 6 M 8 R553X F508del 2 1 0 80 15.87 7 M 3 F508del unknown 2 (0) 0 nd nd 8 F 33 F508del F508del 1 1 1 73 18.61 9 M 10 F508del L1077P 2 1 0 94 19.79 10 M 9 F508del G542X 2 1 1 100 16.00 11 F 9 4167delCTAAGCC L1065P 3 nd 1 76 14.57 12 F 14 R117C (without (TG)12T5) F508del 2 0 0 94 18.44 13 F 11 F508del 991del5 2 1 1 109 17.80 14 M 42 (TG)12T5 F508del 2 0 0 106 23.78 15 (s2)(c) M 9 F508del F508del 1 1 1 82 15.45 16 M 10 F508del R347P 2 (0) 0 89 15.91 17 (s2)(c) F 6 F508del F508del 1 1 1 110 15.20 18 (s3)(c) M 39 2789+5G.A N1303K 3 nd 0 105 19.33 19 (s3)(c) F 41 2789+5G.A N1303K 3 nd 0 80 19.47 20 F 26 N1303K W1282X 3 nd 1 90 19.57 21 M 7 CFTRdele2,3 (21 kb) N1303K 3 nd 1 107 12.85 22 F 9 F508del L997F (without R117L) 2 0 0 113 25.21 23 M 7 P5L W1282X 3 nd 0 89 22.31 24 M 9 2789+5G.A F508del 2 (1) 1 97 15.60 25 F 2 F508del F508del 1 1 1 nd nd 26 F 32 N1303K N1303K 3 nd 1 107 21.22 27 M 14 L1065R T338I 3 nd 0 116 21.50 28 M 12 711+3A.G S549R(A.C) 3 nd 0 97 20.00 29 M 13 unknown R117H (without (TG)12T5) 3 nd 0 104 19.36 30 M 14 F508del G542X 2 1 1 84 21.87 31 F 13 F508del F508del 1 1 1 85 18.00 32 F 41 2789+5G.A N1303K 3 nd 1 84 21.08 33 F 21 L1065P F508del 2 (0) 0 62 18.29 34 F 50 D1152H F508del 2 (0) 0 63 23.74 35 M 29 F508del 2790-2A.G 2 (1) 0 92 24.46 36 F 45 unknown W1282X 3 nd 0 69 23.42 a (Hm = 1; Ht = 2; N = 3). Login to comment
63 Class IV or V: R117H, 2789+5G.A, TG12T5, R347P, D1152H, R117C. Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
53 However, the following four exceptions were noted. The estimated total protein level for R117C-CFTR (38 &#b1; 5% normal CFTR) was lower (P b 0.05; ANOVA followed by Tukey's least significant difference test; n = 12) compared with normal CFTR, suggesting that the baseline level of chloride transport may be underestimated. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3. Login to comment

[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]

Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 The 69-mutation panel was a combined panel that included variants approved by the Food and Drug Administration with 10 additional variants (R117C, R352Q, S364P, 3120G>A, 2869insG, G480C, 405+3A>C, 1812-1G>A, 444delA, and F311del) added on the basis of their published frequencies and relevancy to CF. Login to comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment
99 Several alleles not found on the ACMG/ACOG panel were found at relatively high frequency (Table 2), including D1152H (4.0%), L206W (2.4%), c.3744delA (0.9%), F311del (0.8%), R117C (0.7%), and S549N (0.6%). Login to comment

[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]

Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

[hide] CFTR mutations spectrum and the efficiency of mole... PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014. Zietkiewicz E, Rutkiewicz E, Pogorzelski A, Klimek B, Voelkel K, Witt M
CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.
PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014., [PMID:24586523]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans Pathogenic mutations 1 1 L15Ffs10X c.43delC 175delC 1 CFMDB 1717-1G.A 2 2 G27V 21.92 c.80G.T 212G.T 1 Novel F508del 2 2 S18RfsX16 c.54-5940_273 +10250del21kb exon2,3del21kb 66 IL19 various CF mutations i2 i2 IVS2_Donor c.164+1G.A 296+1G.A 3 CFMDB various CF mutations 3 3 G85E 22.61 c.254G.A 386G.A 1 IL17 unknown 3 3 E60X c.178G.T 310G.T 0 IL17 x 3 3 L88IfsX22 c.262_263delTT 394delTT 0 IL17 x 4 4 E92K 21.92 c.274G.A 406G.A 2 CFMDB c.164+1G.A; c.2051- 2AA.G 4 4 L101X c.302T.G 434T.G 1 CFMDB c.3717+12191C.T 4 4 K114IfsX5 c.341_353del13bp 473del13bp 1 Novel F508del 4 4 R117H 20.35 c.350G.A 482G.A 5 IL17 F508del; 2x unknown 4 4 R117C 22.07 c.349C.T 481C.T 2 CFMDB S1206X;1x unknown 4 4 L137_L138insT c.412_413insACT L138ins 1 CFMDB F508del 4 4 R153I 22.61 c.458G.T 590G.T 2 Novel F508del; c.3527delC i4 i4 IVS4_Donor c.489+1G.T 621+1G.T 5 IL17 F508del; c.489+1G.T 5 5 L165X c.494T.A 626T.A 1 Novel F508del i5 i5 IVS5_Donor c.579+1G.T 711+1G.T 0 IL19 x i5 i5 IVS5_Donor c.579+3A.G 711+3A.G 2 CFMDB 2,3del21kb; c.2052-3insA i5 i5 IVS5_Donor c.579+5G.A 711+5G.A 0 IL17 x 7 8 F311L 20.90 c.933C.G 965C.G 2 CFMDB 2x F508 7 8 G314R 20.58 c.940G.A 1072G.A 4 CFMDB various CF mutations 7 8 F316LfsX12 c.948delT 1078delT 1 IL17 unkown 7 8 R334W 22.41 c.1000C.T 1132C.T 6 IL17 various CF mutations 7 8 I336K 22.07 c.1007T.A 1139T.A 2 CFMDB 2,3de21kb; F508del 7 8 R347P 22.27 c.1040G.C 1172G.C 11 IL17 various CF mutations i7 i8 IVS8_Donor c.1116+2T.A 1248+2T.A 1 Novel Q1412X 9 10 A455E 22.61 c.1364C.A 1496C.A 0 IL17 x i9 i10 IVS10_Donor c.1392+1G.A 1524+1G.A 1 CFMDB c.3816-7delGT 10 11 S466X c.1397C.G 1529C.G 1 CFMDB G542X 10 11 I507del c.1519_1521delATC 1651delATC 2 IL19 F508del 10 11 F508del c.1521_1523delCTT 1654delCTT 805 IL19 various CF mutations i10 i11 IVS11_Acceptor c.1585-1G.A 1717-1G.A 27 IL19 various CF mutations 11 12 G542X c.1624G.T 1756G.T 25 IL19 various CF mutations 11 12 G551D 21.24 c.1624G.T 1756G.T 5 IL19 various CF mutations 11 12 Q552X c.1654C.T 1786C.T 0 IL19 x 11 12 R553X c.1657C.T 1789C.T 14 IL19 various CF mutations 11 12 R560T 21.92 c.1679G.C 1811G.C 0 IL19 x i12 i13 IVS13_Donor c.1766+1G.A 1898+1G.A 6 IL19 various CF mutations i12 i13 IVS13_Donor c.1766+1G.C 1898+1G.C 1 CFMDB F508del 13 14 H620P 21.73 c.1859A.C 1991A.C 1 CFMDB F508del 13 14 R668C//G576A 21.61//1.73 c.2002C.T//c.1727G.C 2134C.T// 1859G.C 5 b CFMDB// rs1800098 c.1585-1G.A; 4 unknown 13 14 L671X c.2012delT 2143delT 27 IL17 various CF mutations 13 14 K684SfsX38 c.2051_2052delAAinsG 2183AA.G 10 IL17 various CF mutations 13 14 K684NfsX38 c.2052delA 2184delA 0 IL17 x 13 14 Q685TfsX4 c.2052_2053insA 2184insA 15 CFMDB various CF mutationsc , 1 unknown Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 13 14 L732X c.2195T.G 2327T.G 1 CFMDB F508del 14A 15 R851X c.2551C.T 2683C.T 3 CFMDB various CF mutations 14A 15 I864SfsX28 c.2589_2599del11bp 2721del11bp 2 CFMDB F508del; 2,3del21kb i14B i16 IVS16_Donor c.2657+2_2657+3insA 2789+2insA 1 CFMDB F508del i14B i16 IVS16_Donor c.2657+5G.A 2789+5G.A 0 IL17 unkown 15 17 Y919C 21.02 c.2756A.G 2888A.G 1 CFMDB unknown 15 17 H939HfsX27 c.2817_2820delTACTC 2949delTACTC 1 Novel unkown i15 i17 IVS17_Donor c.2908+3A.C 3040+3A.C 1 Novel F508del i16 i18 IVS18_Donor c.2988+1G.A 3120+1G.A 0 IL19 x 17A 19 I1023_V1024del c.3067_3072delATAGTG 3199del6 0 IL19 x i17A i19 IVS19 c.3140-26A.G 3272-26A.G 9 IL19 various CF mutations 17B 20 L1065R 21.90 c.3194T.G 3326T.G 1 CFMDB F508del 17B 20 Y1092X c.3276C.A 3408C.A 1 CFMDB R334W i18 i21 IVS21_Donor c.3468+2_3468+3insT 3600+2insT 11 CFMDB various CF mutationsd , 1 unknown 18 21 E1126EfsX7 c.3376_3379delGAAG 3508delGAAG 1 Novel F508del 19 22 R1158X c.3472C.T 3604C.T 2 CFMDB F508del; R553X 19 22 R1162X c.3484C.T 3616C.T 1 IL17 F508del 19 22 L1177SfsX15 c.3528delC 3659delC 4 IL17 various CF mutations 19 22 S1206X c.3617C.A 3749C.A 1 CFMDB R117C i19 i22 IVS22 c.3717+12191C.T 3849+10kbC.T 58 IL17 various CF mutations 20 23 G1244R 22.62 c.3730G.C 3862G.C 1 CFMDB F508del 20 23 S1251N 22.28 c.3752G.A 3884G.A 0 IL19 x 20 23 L1258FfsX7 c.3773_3774insT 3905insT 0 IL19 x 20 23 V1272VfsX28 c.3816_3817delGT 3944delGT 1 CFMDB c.1392+1G.A 20 23 W1282X c.3846G.A 3978G.A 9 IL19 various CF mutations 21 24 N1303K 22.62 c.3909C.G 4041C.G 18 IL19 various CF mutations 22 25 V1327X c.3979delG 4111delG 1 Novel F508del 22 25 S1347PfsX13 c.4035_4038dupCCTA c.4167dupCCTA 1 CFMDB 2,3del21kb 23 26 Q1382X c.4144C.T 4276C.T 1 CFMDB F508del 23 26 Q1412X c.4234C.T 4366C.T 2 CFMDB F508del; c.1116+2T.A i23 i26 IVS26_Donor c.4242+1G.T 4374+1G.T 1 CFMDB F508del Sequence changes of uncertain pathogenic effect, tentatively counted as mutations 6A 6 E217G 0.30 c.650A.G 782A.G 1 CFMDB; rs1219109046 unknown 7 8 R352Q 20.01 c.1055G.A 1187G.A 1 CFMDB; rs121908753 F508del 7 8 Q359R 0.33 c.1076A.G 1208A.G 1 CFMDB F508del i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)12 1332-12Tn_- 34TGm 6 CFMDB F508del; 3x unknown i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)13 1332-12Tn_- 34TGm 2 CFMDB 2143delT; 1x unknown i8 i9 IVS9 c.1210-12T8 1332-12Tn 1 Novel unknown 10 11 I506V 20.21 c.1516A.G 1648A.G 1 CFMDB; rs1800091 unknown 12 13 V562L 0.79 c.1684G.C 1816G.C 1 CFMDB; rs1800097 unknown 13 14 G723V 0.44 c.2168G.T 2300G.T 1 CFMDB; rs200531709 unknown 15 17 D924N 0.03 c.2770G.A 2902G.A 1 CFMDB; rs201759207 unknown patient with F508del on another allele) was not supported by the SVM value (+0.35); the patient was PS and had ambiguous chloride values (45, 64 and 83 mmol/L). Login to comment
137 Mutations a Poland Czechs Slovakia c Germany Lithuania W. Ukraine E. Hungary Romania c Bulgaria Serbia Greece Number of chromosomes 1476 1200 856 700 98 264 80 256 208 352 874 F508del 54.54 b 67.42 d 66.80 d 72.00 d 52.0 54.17 70.00 56.3 65.38 d 72.28 d 53.40 exon2,3del21kb (l.n.CFTRdele2,3_21kb) 4.47 5.75 2.26 1.2 f 2.0 4.17 5.00 1.6 NA 0 e 0.34 e c.3717+12191C.T (l.n.3849+10kbC.T) 3.93 1.67 e 4.28 1.00 e NA 0.76 0 0.4 e 1.44 0 e 0.11 e c.2012delT (l.n.2143delT) 1.83 0.92 1.10 0.71 0 1.14 0 0 e 0 0 e 0 e c.1585-1G.A (l.n.1717-1G.A) 1.83 0.33 e NA 0.86 0 0.38 1.25 0.4 0 0 e 0 e G542X 1.69 2.00 4.06 d 1.43 0 2.65 3.75 3.9 3.37 2.57 3.90 d R347P 1.57 0.92 1.10 1.57 0 0 1.25 NA 1.44 0 e 0.11 e N1303K 1.22 2.42 2.03 2.29 2.0 4.92 d 5.00 0.8 6.73 d 0 2.63 c.2052-2053insA (l.n.2184insA) 1.02 0.42 1.58 0.57 0 7.20 d 5.00 d 0 0.48 0.28 0 e R553X 0.95 0.50 0.90 2.29 4.2 d 0.38 0 NA 0 0 0 c.3468+223insT (l.n.3600+2insT) 0.75 0.25 NA 0 e 0 NA 0 NA 0 0 0 e c.2051-2052AA.G (l.n.2183AA.G) 0.68 0.08 NA 0.57 0 0.38 0 0.8 0 0 1.38 W1282X 0.61 0.58 0.50 0.71 1.0 2.27 0 2.3 d 0.96 0 0.67 c.3140-26A.G (l.n.3272-26A.G) 0.61 0.67 0.50 0.86 0 0.76 0 0.4 0 0 0.81 l.n.IVS8 T 5 _TG 12-13 0.54 NA NA NA 0 NA NA NA NA 0 NA R334W 0.41 0.25 NA 0.29 0 0.76 0 0.4 0 0.28 0.81 c.1766+1G.A (l.n.1898+1G.A) 0.41 1.42 d 0.50 0 0 1.14 0 NA 0 0 0.11 c.489+1G.T (l.n.621+1G.T) 0.34 0.42 NA 0.14 0 0.76 0 0.8 0 2.86 d 5.72 d R117H 0.34 NA NA 0.29 0 0 0 0.4 0 0 0.23 G551D 0.34 2.91 d 0.50 1.00 0 0 0 0 0 0 0.34 G314R 0.37 0 NA 0 0 0 0 NA 0 0 0 R668C 0.34 0 NA 0 0 0 0 NA 0 0 0 c.3528delC (l.n.3659delC) 0.27 0.17 NA 0.57 0 0 0 NA 0 0 0 c.164+1G.A (l.n.296+1G.A) 0.20 0.08 NA 0 0 0 0 NA 0 0 0 R851X 0.20 0.08 NA 0 0 0 0 NA 0 0 0 I336K 0.14 0.58 NA 0.45 0 0 0 NA 0 0 0 R1158X 0.14 0.08 NA 0 0 0 0 NA 0 0 1.03 E92K 0.14 0.08 NA 0 0 0.38 0 NA 0 0 0 R153I 0.14 0 NA 0 0 0 0 NA 0 0 0 c.579+3A.G (l.n.711+3A.G) 0.14 0.17 NA 0 0 0 0 NA 0 0 0.69 c.2589-2599del11bp (l.n.2721- 31del11bp) 0.14 0.08 NA 0 0 0.38 0 NA 0 0 0 I507del 0.14 0.08 NA 0.15 0 0 0 0 0 0.28 0.69 R117C 0.14 0.08 NA 0.15 0 0 0 NA 0 0 0.23 of mutation panels [20]), listed in Table 4, were compared to those reported for several Central and Southeastern European countries [21-29]. Login to comment

[hide] Three charged amino acids in extracellular loop 1 ... J Gen Physiol. 2014 Aug;144(2):159-79. doi: 10.1085/jgp.201311122. Epub 2014 Jul 14. Cui G, Rahman KS, Infield DT, Kuang C, Prince CZ, McCarty NA
Three charged amino acids in extracellular loop 1 are involved in maintaining the outer pore architecture of CFTR.
J Gen Physiol. 2014 Aug;144(2):159-79. doi: 10.1085/jgp.201311122. Epub 2014 Jul 14., [PMID:25024266]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) bears six extracellular loops (ECL1-6); ECL1 is the site of several mutations associated with CF. Mutation R117H has been reported to reduce current amplitude, whereas D110H, E116K, and R117C/L/P may impair channel stability. We hypothesized that these amino acids might not be directly involved in ion conduction and permeation but may contribute to stabilizing the outer vestibule architecture in CFTR. We used cRNA injected oocytes combined with electrophysiological techniques to test this hypothesis. Mutants bearing cysteine at these sites were not functionally modified by extracellular MTS reagents and were blocked by GlyH-101 similarly to WT-CFTR. These results suggest that these three residues do not contribute directly to permeation in CFTR. In contrast, mutants D110R-, E116R-, and R117A-CFTR exhibited instability of the open state and significantly shortened burst duration compared with WT-CFTR and failed to be locked into the open state by AMP-PNP (adenosine 5'-(beta,gamma-imido) triphosphate); charge-retaining mutants showed mainly the full open state with comparably longer open burst duration. These interactions suggest that these ECL1 residues might be involved in maintaining the outer pore architecture of CFTR. A CFTR homology model suggested that E116 interacts with R104 in both the closed and open states, D110 interacts with K892 in the fully closed state, and R117 interacts with E1126 in the open state. These interactions were confirmed experimentally. The results suggest that D110, E116, and R117 may contribute to stabilizing the architecture of the outer pore of CFTR by interactions with other charged residues.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Mutation R117H has been reported to reduce current amplitude, whereas D110H, E116K, and R117C/L/P may impair channel stability. Login to comment
109 Therefore, we performed experiments to investigate the modification of WT-, D110C-, E116C-, and R117C-CFTR by MTSET (ET+ ) and MTSES (ES&#e032; ) with the TEVC technique; R334C-CFTR was used as a positive control (Zhang et al., 2005b). Login to comment
140 However, under the same conditions, no functional modifications were observed for any of the three ECL1 cysteine mutants studied (D110C-, E116C-, and R117C-CFTR). Login to comment
141 These data differ from those of Zhou et al. (2008) who reported that R117C-CFTR could be modified by both ET+ and ES&#e032; . Login to comment
143 Zhou et al. (2008) preincubated cells expressing R117C-CFTR in solution with ET+ or ES&#e032; before the experiment and compared the data with a group of unexposed cells, whereas we investigated the effects of modification in real time and compared data before and after exposure to the reagents in the same oocytes. Login to comment
144 Our data could be interpreted in two ways: (1) the thiol groups of the engineered cysteines in D110C-, E116C-, and R117C-CFTR were not exposed and therefore unable to be modified by ET+ or ES&#e032; , or (2) the three cysteines Figure 2.ߓ Some ECL1 mutants exhibited decreased burst duration. Login to comment
170 GlyH-101 blocked D110C- and R117C-CFTR similarly to WT-CFTR, whereas E116C-CFTR was also blocked significantly by GlyH-101 (P < 0.01), but less efficaciously than the other two mutants or the WT. Login to comment
189 The data presented so far resolve our first two questions in this paper: (1) Charge-swapping mutations of D110, E116, and R117 of ECL1 destabilize the open state, indicating that these residues contribute to maintaining the outer mouth open pore architecture of CFTR; (2) based Figure 4.ߓ Effects of 1 mM MTSET+ (ET+ ) and MTSES&#e032; (ES&#e032; ) on WT-, D110C-, E116C-, R117C-, and R334C-CFTR. Login to comment
196 Figure 5.ߓ Effects of 2.5 &#b5;M GlyH-101 on WT-, D110C-, E116C-, and R117C-CFTR. Login to comment
402 The single-channel amplitudes of R117C- and R117C/E1126C-CFTR were slightly, but significantly, smaller than that of WT-CFTR (Fig. 12 C). Login to comment
408 The mean burst duration of R117E/E1126R-CFTR was significantly longer than that of R117A- and R117C-CFTR. Login to comment
410 (A) Representative single-channel current traces of E1126R-, R117E/E1126R-, R117C-, and R117C/E1126C-CFTR recorded under the same experimental conditions as Fig. 2 and their all-points amplitude histograms (right). Login to comment
412 #, P < 0.01 indicates a significant difference between WTand R117C-CFTR; **, P < 0.01 indicates a significant difference between WTand E1126R-CFTR, between R117C and R117E/E1126R-CFTR, and between R117C and R117C/E1126C. Login to comment
431 R117C/E1126C-CFTR exhibited very brief openings to multiple open states, including s1, s2, and f, with significantly shorter mean burst duration compared with R117C-CFTR (P < 0.01), likely caused by mutual repulsion by the partial negative charges at the two cysteines, leading to unstable open states (Fig. 12, A and B). Login to comment

[hide] Mechanisms of CFTR functional variants that impair... PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul. LaRusch J, Jung J, General IJ, Lewis MD, Park HW, Brand RE, Gelrud A, Anderson MA, Banks PA, Conwell D, Lawrence C, Romagnuolo J, Baillie J, Alkaade S, Cote G, Gardner TB, Amann ST, Slivka A, Sandhu B, Aloe A, Kienholz ML, Yadav D, Barmada MM, Bahar I, Lee MG, Whitcomb DC
Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.
PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul., [PMID:25033378]

Abstract [show]
CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
352 Interestingly, amino acid R117, which is involved in the mutations R117C and R117H and is located in the first extracellular loop (ECL1) at the very beginning of TM2, can make a salt bridge with E1124 in ECL6 (distances of 5.5 and 5.8 A da; ) and might thus, among others, participate in the stabilization of the open form of the channel (Fig. 7b). Login to comment
353 The R117H mutation (varying clinical consequence) appears less severe than R117C (CF-causing), as histidine probably retains part of the attraction with the glutamate E1124 situated at 7.9 A da; . Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment
74 However, the sensitivity of the IRT/NGS algorithm would have decreased as much as 50% for classic CF cases when a positive screen is defined as two CF-causing mutations because of uncommon mutations found in five patients Table 2ߒ Cases with a second mutation detected from the next-generation sequencing panel Case no. IRT (ng/ml) Second-tier DNA Additional mutation Sweat chloride (mmol/l) Clinical assessmenta Test 1 Test 2 1 64 F508del D110H 71.4 67.1 CF 2 327 F508del Q1313X N/A N/A CF 3 297 F508del Q1313X N/A N/A CF 4 71 R117H (7T) R347H 45.2 41.5 CRMSb 5 148 F508del R117C 40 38 CRMSb 6 66 F508del 5Tc 36.9 30.8 CRMSb 7 147 F508del D1152Hc 27.9 24.6 CRMSb 8 121 F508del D1152Hc 11 QNS Carrier 9 176 F508del D1152Hc 24 26 Carrier CF, cystic fibrosis; CRMS, CFTR-related metabolic syndrome; IRT, immunoreactive trypsinogen; QNS, quantity not sufficient. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
366 [227_228insT;1210-14TG[12];1210-12T[5]] uncertain: CF-PI and/or CF-PS and/or CFTR-RD 359insT nd; T5 varying clinical consequence G85E c.254G>A CF-PI,CF-PS CF-causing p.Gly85Glu D110H c.328G>C CF-PS CF-causing p.Asp110His R117C c.349C>T CF-PS CF-causing p.Arg117Cys R117H c.350G>A CFTR-RD varying clinical consequence p.Arg117His [R117L;L997F] c. Login to comment

[hide] Inconclusive diagnosis of cystic fibrosis after ne... Pediatrics. 2015 Jun;135(6):e1377-85. doi: 10.1542/peds.2014-2081. Epub 2015 May 11. Ooi CY, Castellani C, Keenan K, Avolio J, Volpi S, Boland M, Kovesi T, Bjornson C, Chilvers MA, Morgan L, van Wylick R, Kent S, Price A, Solomon M, Tam K, Taylor L, Malitt KA, Ratjen F, Durie PR, Gonska T
Inconclusive diagnosis of cystic fibrosis after newborn screening.
Pediatrics. 2015 Jun;135(6):e1377-85. doi: 10.1542/peds.2014-2081. Epub 2015 May 11., [PMID:25963003]

Abstract [show]
OBJECTIVES: To prospectively study infants with an inconclusive diagnosis of cystic fibrosis (CF) identified by newborn screening (NBS; "CF screen positive, inconclusive diagnosis" [CFSPID]) for disease manifestations. METHODS: Infants with CFSPID and CF based on NBS from 8 CF centers were prospectively evaluated and monitored. Genotype, phenotype, repeat sweat test, serum trypsinogen, and microbiology data were compared between subjects with CF and CFSPID and between subjects with CFSPID who did (CFSPID-->CF) and did not (CFSPID-->CFSPID) fulfill the criteria for CF during the first 3 years of life. RESULTS: Eighty-two subjects with CFSPID and 80 subjects with CF were enrolled. The ratio of CFSPID to CF ranged from 1:1.4 to 1:2.9 in different centers. CFTR mutation rates did not differ between groups; 96% of subjects with CFSPID and 93% of subjects with CF had 2 mutations. Subjects with CFSPID had significantly lower NBS immunoreactive trypsinogen (median [interquartile range]:77 [61-106] vs 144 [105-199] mug/L; P < .0001) than did subjects with CF. Pseudomonas aeruginosa and Stenotrophomonas maltophilia were isolated in 12% and 5%, respectively, of subjects with CFSPID. CF was diagnosed in 9 of 82 (11%) subjects with CFSPID (genotype and abnormal sweat chloride = 3; genotype alone = 4; abnormal sweat chloride only = 2). Sweat chloride was abnormal in CFSPID-->CF patients at a mean (SD) age of 21.3 (13.8) months. CFSPID-->CF patients had significantly higher serial sweat chloride (P < .0001) and serum trypsinogen (P = .009) levels than did CFSPID-->CFSPID patients. CONCLUSIONS: A proportion of infants with CFSPID will be diagnosed with CF within the first 3 years. These findings underscore the need for clinical monitoring, repeat sweat testing at age 2 to 3 years, and extensive genotyping.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 TABLE 3 Characteristics of Subjects With CFSPID Who Later Met Diagnostic Criteria of CF Subject Number Allele 1 Allele 2 Ethnicity NBS IRT, mg/L Initial Sweat Chloride, mmol/L Highest Sweat Chloride, mmol/L Country 1 F508del R117C White 105.8 36 61 Canada 2 F508del S1455X White 66.6 46 74 Canada 3 F508del P67L White 151.2 38 38 Canada 4 F508del L206W White 83.8 58 64 Canada 5 G542X L206W White 67 49 66 Canada 6 F508del L206W White 59.9 45 45 Canada 7 R1162X R117H-7T White 126 36 70 Italy 8 2183AA.G R117C White 129 32 32 Italy 9 F508del R117C White 80.4 48 56 Canada e OOI et al including in newborn-screened infants with equivocal CF diagnosis and in older individuals with single-organ manifestations of CF.17,18,20-22 As in the case of the 7 subjects who were initially classified as CFSPID but who were subsequently recognized to carry 2 disease-causing mutations on the basis of the CFTR2 project, the diagnostic consequences (benign versus disease-causing) of the CFTR mutations identified in all of the other subjects with CFSPID may not be apparent until later on, when new genetic information becomes available and classification of CFTR mutations currently considered to be of "unknown" consequences is updated. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment
92 Well known examples include missense variants D110H, R117C, L206W, R347P, R347H, R1066H, or splice variants that produce both aberrant and full-length transcript such as 3849+10kbC4T, 2789+5G4A, 3272-26 A4G, 711+3 A4G. Login to comment

[hide] Identification and frequencies of cystic fibrosis ... Clin Biochem. 2015 Oct 21. pii: S0009-9120(15)00473-7. doi: 10.1016/j.clinbiochem.2015.10.007. Pepermans X, Mellado S, Chialina S, Wagener M, Gallardo L, Lande H, Bordino W, Baran D, Bours V, Leal T
Identification and frequencies of cystic fibrosis mutations in central Argentina.
Clin Biochem. 2015 Oct 21. pii: S0009-9120(15)00473-7. doi: 10.1016/j.clinbiochem.2015.10.007., [PMID:26500004]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 rs name HGVS p. name HGVS c. name Legacy name n (%) Screening panel CFTR1 database CFTR2 database rs199826652 p.Phe508del c.1521_1523delCTT F508del 94 (56.6) Yes Yes CF-causing rs113993959 p.Gly542* c.1624G N T G542X 7 (4.2) Yes Yes CF-causing No p.Asn1303Lys c.3909C N G N1303K 5 (3) Yes Yes CF-causing rs74767530 p.Arg1162* c.3484C N T R1162X 4 (2.4) Yes Yes CF-causing rs75961395 p.Gly85Glu c.254G N A G85E 3 (1.8) Yes Yes CF-causing rs78756941 NA c.489 + 1G N T 621 + 1G N T 3 (1.8) Yes Yes CF-causing rs76713772 NA c.1585-1G N A 1717-1G N A 3 (1.8) Yes Yes CF-causing No p.Lys684Serfs*38 c.2051_2052delAAinsG 2183AA N G 3 (1.8) Yes Yes CF-causing rs397508173 p.Ser4* c.11C N A S4X 2 (1.2) No Yes No rs121909011 p.Arg334Trp c.1000C N T R334W 2 (1.2) Yes Yes CF-causing rs77010898 p.Trp1282* c.3846G N A W1282X 2 (1.2) Yes Yes CF-causing rs397508141 p.Leu34_Gln39del c.100_117delTTGTCAGACATATACCAA 232del18 1 (0.6) No Yes No No p.Leu49Pro c.146 T N C L49P &#a7; 1 (0.6) No No No rs77834169 p.Arg117Cys c.349C N T R117C 1 (0.6) Yes Yes CF-causing No p.Arg117Pro c.350G N C R117P 1 (0.6) No Yes No rs80282562 p.Gly178Arg c.532G N A G178R 1 (0.6) Yes Yes CF-causing rs121908803 p.Pro205Ser c.613C N T P205S 1 (0.6) No Yes CF-causing rs121908752 p.Leu206Trp c.617 T N G L206W 1 (0.6) Yes Yes CF-causing No p.Arg347Pro c.1040G N C R347P 1 (0.6) Yes Yes CF-causing rs397508155 p.Tyr362* c.1086 T N A Y362X 1 (0.6) No Yes No rs74597325 p.Arg553* c.1657C N T R553X 1 (0.6) Yes Yes CF-causing rs1800098 + rs1800100 p.[Gly576Ala(;)Arg668Cys] c. Login to comment
126 Genotype N Frequency (%) Total N Total frequency (%) Category I: p.Phe508del/p.Phe508del p.Phe508del/p.Phe508del 30 36.1 30 36.1 Category II: p.Phe508del/Other p.Phe508del/p.Gly542* 5 6 p.Phe508del/p.Asn1303Lys 3 3.6 p.Phe508del/p.Gly85Glu 2 2.4 p.Phe508del/c.1585-1G N A 2 2.4 p.Phe508del/c.2051_2052delAAinsG 2 2.4 p.Phe508del/p.Trp1282* 2 2.4 p.Phe508del/p.Arg117Pro 1 1.2 p.Phe508del/p.Pro205Ser 1 1.2 p.Phe508del/p.Leu206Trp 1 1.2 p.Phe508del/p.Arg553* 1 1.2 p.Phe508del/p.Ser589Ile 1 1.2 p.Phe508del/p.Ser737Phe 1 1.2 p.Phe508del/p.Arg1162* 1 1.2 p.Phe508del/c.1766 + 1G N A 1 1.2 p.Phe508del/p.Leu34_Gln39del 1 1.2 p.Phe508del/p.Leu812Phefs*11 1 1.2 p.Phe508del/c.3140-26A N G 1 1.2 p.Phe508del/c.3873 + 1G N A 1 1.2 p.Phe508del/p.Ser1297Phefs*5 1 1.2 p.Phe508del/c.4242_4242 + 1delGGinsTT 1 1.2 p.Phe508del/c.489 + 1G N T 1 1.2 31 37.5 Category III: Other/other p.Gly542*/p.Asn1303Lys 1 1.2 p.Asn1303Lys/p.Gly85Glu 1 1.2 c.489 + 1G N T/p.Lys684Serfs*38 1 1.2 c.489 + 1G N T/p.Gly542* 1 1.2 p.Arg1162*/p.Ser4* 1 1.2 p.Arg1162*/p.Tyr362* 1 1.2 p.Arg334Trp/c.1585-1G N A 1 1.2 p.Arg334Trp/p.Ser821Argfs*4 1 1.2 p.Arg347Pro/p.Ser4* 1 1.2 c.2657 + 5G N A/p.Tyr852Leufs*44 # 1 1.2 p.Arg1162*/p.Leu49Pro # 1 1.2 11 13.2 Category IV: A single mutation p.Phe508del/WT 3 3.6 c.2988 + 1G N A/WT 1 1.2 p.Arg117Cys/WT 1 1.2 p.Gly178Arg/WT 1 1.2 p.[Gly576Ala(;)Arg668Cys]/TG11-5T 1 1.2 7 8.4 Category V: Wild type 4 4.8 #: new mutation submitted to CFTR1 database [1]; other = other mutation than p.Phe508del. Login to comment