ABCMdb

ABCC7 p.Asp110His

Admin's notes:	Class II-III (maturation defect, gating defect) Veit et al.
ClinVar:	c.328G>C , p.Asp110His D , Pathogenic c.328G>T , p.Asp110Tyr ? , not provided c.330C>A , p.Asp110Glu ? , not provided
CF databases:	c.328G>C , p.Asp110His D , CF-causing ; CFTR1: c.330C>A , p.Asp110Glu (CFTR1) ? , This mutation was detected by DGGE analysis followed by direct sequencing in two CF infants, a girl carrying [delta]F508 in the other chromosome and a boy carrying G542X in the other chromosome, both of Southern Italian origin (Sicilia region). It was never found in other 800 Italian CF chromosomes and in 100 control chromosomes from Italian population. The girl was diagnosed because of positive neonatal screening (persistent neonatal hypertrypsinemia), sweat chloride was 42, 57, and 68 mEq/l on repeated tests. Delayed meconium emission. No respiratory symptoms, pancreatic sufficiency and normal growth at 6 months. The boy presented at 6 months because of metabolic alkalemic diselectrolitemia and bronchiolitis. Neonatal screening was negative. Sweat chloride was 80, 70, 59 and 88 mEq/l on repeated occasions. At 2.5yrs, he is pancreatic sufficient, his growth is in the normal range and he presents no respiratory problems. This mutation was also reported by Aquino et al. (22/02/2000): It abolishes a Scrf I site. This substitution involves a quite conserved residue among species (N110 in the squale), in an intracellular loop. It doesn't affect the charge of the CFTR protein. It was found in an Italian CF patient with pancreatic sufficiency and bearing [delta]F508 on the other chromosome. No other mutation was found after analysis of 14 exons. The deleterious effect of D110E remains to be demonstrated. c.328G>T , p.Asp110Tyr (CFTR1) D , This mutation was found by SSCA and direct DNA sequencing in a CBAVD patient. (reported in Human Reproduction (2000) 15, 1476-1483). c.328G>A , p.Asp110Asn (CFTR1) ? ,
Predicted by SNAP2:	A: D (91%), C: D (91%), E: D (85%), F: D (95%), G: D (95%), H: D (63%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: D (85%), P: D (95%), Q: D (95%), R: D (95%), S: D (85%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: N, C: D, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: D, Q: N, R: N, S: N, T: N, V: N, W: D, Y: N,

[switch to compact view]
Comments [show]

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Disease-associated mutations in the extracytoplasm... J Biol Chem. 2001 May 4;276(18):14848-54. Epub 2001 Feb 6. Hammerle MM, Aleksandrov AA, Riordan JR
Disease-associated mutations in the extracytoplasmic loops of cystic fibrosis transmembrane conductance regulator do not impede biosynthetic processing but impair chloride channel stability.
J Biol Chem. 2001 May 4;276(18):14848-54. Epub 2001 Feb 6., 2001-05-04 [PMID:11278813]

Abstract [show]
Consistent with its function as a chloride channel regulated entirely from the cytoplasmic side of the plasma membrane, the cystic fibrosis transmembrane conductance regulator (CFTR) glycoprotein exposes little of its mass on the exterior surface of cells. The first and fourth extracytoplasmic loops (ELs) contain approximately 15 and 30 residues, respectively; the other four ELs are extremely short. To examine the influence of missense mutants in ELs detected in patients with cystic fibrosis, we have expressed them in mammalian (baby hamster kidney (BHK21)) cells and assessed their biosynthetic processing and chloride channel activity. In contrast to previous findings that 18 of 30 disease-associated missense mutations in cytoplasmic loops caused retention of the nascent polypeptides in the endoplasmic reticulum, all the EL mutants studied matured and were transported to the cell surface. This pronounced asymmetry is consistent with the notion that endoplasmic reticulum quality control of nascent CFTR is exerted primarily on the cytoplasmic side of the membrane. Although this set of EL mutations has little effect on CFTR maturation, most of them seriously compromise its chloride channel activity. Substitutions at six different positions in EL1 and single positions in EL2 and EL4 all destabilized the open state, some of them severely, indicating that the ELs contribute to the stability of the CFTR ion pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 TABLE I Oligonucleotide primers used to generate mutations Mutation Primer S108F GGAAGAATCATAGCTTtCTATGACCCGGATAAC Y109C AGAATCATAGCTTCCTgTGACCCGGATAACAAG D110H ATCATAGCTTCCTATcACCCGGATAACAAGGAG P111A ATAGCTTCCTATGACgCGGATAACAAGGAGGAA P111L ATAGCTTCCTATGACCtGGATAACAAGGAGGAA E116K CCGGATAACAAGGAGaAACGCTCTATCGCGATT R117C GATAACAAGGAGGAAtGCTCTATCGCGATTTAT R117H GATAACAAGGAGGAACaCTCTATCGCGATTTAT R117L GATAACAAGGAGGAACtCTCTATCGCGATTTAT R117P GATAACAAGGAGGAACcCTCTATCGCGATTTAT E217G ATGGGGCTAATCTGGGgGTTGTTACAGGCGTCT T908N TATGCAGTGATTATCAaCAGCACCAGTTCGTAT P1013L GTCGCAGTTTTACAACtCTACATCTTTGTTGCA FIG. 2. Login to comment
117 A, squares, wild type; circles, S108F; triangles, Y109C; diamonds, D110H; crosses, wild type without stimulation. Login to comment
126 Replacing the aspartate residue in the next position by histidine (D110H) resulted in a much more normal looking channel with a major mean conductance of about 8.5 pS. Login to comment
171 For example a nucleotide binding domain mutation, G551D, precludes virtually all TABLE II Relative charge transport capacity of mutants Mutants S108F Y109C D110H P111L P111A E116K R117H R117C R117L R117P E217G T908N P1013L Imutant/Iwt 100% 11 15 27 173 105 12 80 27 5 11 10 48 170 FIG. 5. Login to comment

[hide] DHPLC screening of cystic fibrosis gene mutations. Hum Mutat. 2002 Apr;19(4):374-83. Ravnik-Glavac M, Atkinson A, Glavac D, Dean M
DHPLC screening of cystic fibrosis gene mutations.
Hum Mutat. 2002 Apr;19(4):374-83., [PMID:11933191]

Abstract [show]
Denaturing high performance liquid chromatography (DHPLC) using ion-pairing reverse phase chromatography (IPRPC) columns is a technique for the screening of gene mutations. In order to evaluate the potential utility of this assay method in a clinical laboratory setting, we subjected the PCR products of 73 CF patients known to bear CFTR mutations to this analytic technique. We used thermal denaturation profile parameters specified by the MELT program tool, made available by Stanford University. Using this strategy, we determined an initial analytic sensitivity of 90.4% for any of 73 known CFTR mutations. Most of the mutations not detected by DHPLC under these conditions are alpha-substitutions. This information may eventually help to improve the MELT algorithm. Increasing column denaturation temperatures for one or two degrees above those recommended by the MELT program allowed 100% detection of CFTR mutations tested. By comparing DHPLC methodology used in this study with the recently reported study based on Wavemaker 3.4.4 software (Transgenomic, Omaha, NE) [Le Marechal et al., 2001) and with previous SSCP analysis of CFTR mutations [Ravnik-Glavac et al., 1994] we emphasized differences and similarities in order to refine the DHPLC system and discuss the relationship to the alternative approaches. We conclude that the DHPLC method, under optimized conditions, is highly accurate, rapid, and efficient in detecting mutations in the CFTR gene and may find high utility in screening individuals for CFTR mutations. Hum Mutat 19:374-383, 2002. Published 2002 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X. Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL. Login to comment

[hide] Variant cystic fibrosis phenotypes in the absence ... N Engl J Med. 2002 Aug 8;347(6):401-7. Groman JD, Meyer ME, Wilmott RW, Zeitlin PL, Cutting GR
Variant cystic fibrosis phenotypes in the absence of CFTR mutations.
N Engl J Med. 2002 Aug 8;347(6):401-7., 2002-08-08 [PMID:12167682]

Abstract [show]
BACKGROUND: Cystic fibrosis is a life-limiting autosomal recessive disorder with a highly variable clinical presentation. The classic form involves characteristic findings in the respiratory tract, gastrointestinal tract, male reproductive tract, and sweat glands and is caused by loss-of-function mutations in the cystic fibrosis transmembrane conductance regulator (CFTR ) gene. Nonclassic forms of cystic fibrosis have been associated with mutations that reduce but do not eliminate the function of the CFTR protein. We assessed whether alteration in CFTR function is responsible for the entire spectrum of variant cystic fibrosis phenotypes. METHODS: Extensive genetic analysis of the CFTR gene was performed in 74 patients with nonclassic cystic fibrosis who had been referred by 34 medical centers. We evaluated two families that each included a proband without identified mutations and a sibling with nonclassic cystic fibrosis to determine whether there was linkage to the CFTR locus and to measure the extent of CFTR function in the sweat gland and nasal epithelium. RESULTS: Of the 74 patients studied, 29 had two mutations in the CFTR gene, 15 had one mutation, and 30 had no mutations. A final genotype of two mutations was more common among patients who had been referred after screening for common cystic fibrosis-causing mutations identified one mutation than among those who had been referred after screening had identified no such mutations (26 of 34 patients vs. 3 of 40 patients, P<0.001). Comparison of clinical features and sweat chloride concentrations revealed no significant differences among patients with two, one, or no CFTR mutations. Haplotype analysis in the two families revealed no linkage to CFTR. Although each of the affected siblings had elevated sweat chloride concentrations, measurements of cyclic AMP-mediated ion and fluid transport in the sweat gland and nasal epithelium demonstrated the presence of functional CFTR. CONCLUSIONS: Factors other than mutations in the CFTR gene can produce phenotypes clinically indistinguishable from nonclassic cystic fibrosis caused by CFTR dysfunction.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 MUTATION IDENTIFIED BY SCREENING FOR COMMON MUTATIONS MUTATION IDENTIFIED BY DNA SEQUENCING NO. OF PATIENTS ∆F508 5T* 3 ∆F508 D1152H 2 ∆F508 2789+2insA 2 ∆F508 R117C 2 ∆F508 D110H 1 ∆F508 2789+5G→A 1 ∆F508 P205S 1 ∆F508 L967S 1 ∆F508 I1027T 1 ∆F508 L206W 1 ∆F508 T1053I and 5T 1 ∆F508 V920M and 5T 1 ∆F508 R1070W 1 ∆F508 D579G 1 ∆F508 P67L 1 ∆F508 2811G→T†‡ 1 G85E F191V† 1 R117H G103X and 5T 1 I148T I556V 1 G542X R1162L 1 W1282X D1152H 1 None L138ins and 3272-26 A→G 1 None G463D† and 5T 1 None F693L and 5T 1 ∆F508 None 6 G551D None 1 W1282X None 1 None 5T 4 None 2307insA 1 None L997F 1 None V520I 1 None None 30 in Subject II-2 in Family 1. Login to comment

[hide] Highest heterogeneity for cystic fibrosis: 36 muta... Am J Med Genet. 2002 Dec 1;113(3):250-7. Kilinc MO, Ninis VN, Dagli E, Demirkol M, Ozkinay F, Arikan Z, Cogulu O, Huner G, Karakoc F, Tolun A
Highest heterogeneity for cystic fibrosis: 36 mutations account for 75% of all CF chromosomes in Turkish patients.
Am J Med Genet. 2002 Dec 1;113(3):250-7., 2002-12-01 [PMID:12439892]

Abstract [show]
We analyzed the CFTR locus in 83 Turkish cystic fibrosis patients to identify mutations, haplotypes, and the carrier frequency in the population. We detected 36 different mutations in 125 (75%) of the total 166 CF chromosomes. Seven novel mutations were identified: four missense (K68E, Q493P, E608G, and V1147I), two splice-site (406 -3T > C and 3849 +5G > A), and one deletion (CFTRdele17b,18). The data showed that the Turkish population has the highest genetic heterogeneity at the CFTR locus reported so far. The results of this thorough molecular analysis at the CFTR locus of a population not of European descent shows that CF is not uncommon in all such populations. The large number of mutations present, as well as the high heterogeneity in haplotypes associated with the mutations suggests that most of the mutations have persisted for a long time in the population. Consistently, the carrier frequency is assessed to be high, indicating that the disease in the population is ancient.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Haplotypes Associated With the Mutations Identified in 83 Turkish CF Patients* Mutation Total number of alleles Number of alleles Number of patients Haplotypes Homo Hetero DF508 39 (23.5) 6 7 23 M 28 13 1 0 1 6 7 23 M 30 13 1 0 1 6 9 23 M 31 13 1 0 1 6 7 23 M 31 13 11 4 3 6 7 23 M 7 17 2 0 2 6 7 16 M 31 13 3 1 1 6 7 17 M 31 13 17 5 7 6 7 17 M 32 13 3 1 1 1677delTA 12 (7.2) 7 7 16 V 30 13 12 5 2 2183AA > G 7 (4.2) 7 7 16 M 30 13 1 0 1 7 9 16 M 31 13 4 2 0 7 7 16 M 32 13 2 1 0 G542X 6 (3.6) 6 7 23 M 32 13 6 3 0 F1052V 5 (3.0) 6 7 17 M 7 13 4 1 2 7 5 17 M 7 17 1 0 1 W1282X 5 (3.0) 7 7 17 M 7 17 4 1 2 7 7 17 M 7 18 1 0 1 E92K 4 (2.4) 7 7 16 V 46 13 3 1 1 7 7 17 V 46 13 1 0 1 1525 À 1G > A 4 (2.4) 7 7 17 M 7 17 4 2 0 2789 þ 5G > A 4 (2.4) 7 9 17 M 7 17 3 1 1 7 5 17 M 7 17 1 0 1 N1303K 4 (2.4) 7 7 23 M 31 13 2 0 2 6 7 22 M 30 13 1 0 1 6 7 23 M 30 13 1 0 1 A46D 3 (1.8) 6 9 23 M 31 13 1 0 1 6 7 23 M 31 13 2 1 0 2184insA 3 (1.8) 7 5 17 V 30 13 1 0 1 7 7 16 V 30 13 2 0 2 R1070Q 3 (1.8) 7 7 16 M 31 13 1 0 1 7 7 17 M 31 13 2 0 2 Q493Pa 2 (1.2) 6/7 5 16 M 46 13 2 1 0 3849 þ 5G > Aa 2 (1.2) 7 7 16 M 31 13 2 1 0 CFTRdele17b,18a 2 (1.2) 6 9 16 V - - 2 1 0 K68Ea 1 (0.6) 6 9 17 M 7 13 1 0 1 R74W 1 (0.6) 6 7 16 M 32 16 1 0 1 306delTAGA 1 (0.6) 7 7 16 M 7 17 1 0 1 D110H 1 (0.6) 7 9 16 V 30 13 1 0 1 I125T 1 (0.6) 6 7 23 V 7 16 1 0 1 406 À 3T > Ca 1 (0.6) 7 7 16 V 33 17 1 0 1 I148T 1 (0.6) 6/7 7 16/17 M 7 17/23 1 0 1 621 þ 1G > T 1 (0.6) 6 7 21 V 31 13 1 0 1 R347P 1 (0.6) 7 9 17 V 30 13 1 0 1 S466X 1 (0.6) 7 7 23 M 33 13 1 0 1 L571S 1 (0.6) 7 7 16 V 29 13 1 0 1 1717 À 1G > A 1 (0.6) 7 9 17 M 7 16 1 0 1 E608Ga 1 (0.6) 7 9 16 M/V 29/31 13 1 0 1 2043delG 1 (0.6) 7 9 17 M 7 17 1 0 1 P1013L 1 (0.6) 6 5 16 M 21 18 1 0 1 R1066L 1 (0.6) 7 7 17 M 7 13 1 0 1 3129del4 1 (0.6) 7 7 16 V 29 13 1 0 1 V1147Ia 1 (0.6) 6 7 17 M 33 17 1 0 1 S1235R 1 (0.6) 6 7 17 M 39 13 1 0 1 CFTRdele2,3 1 (0.6) 7 7 16 V 33 13 1 0 1 Total 125 (75) 125 32 61 *The order of the polymorphisms is IVS6GATT, Tn, IVS8CA, M470V, IVS17BTA and IVS17BCA. Login to comment

[hide] Mutations of the CFTR gene in Turkish patients wit... Hum Reprod. 2004 May;19(5):1094-100. Epub 2004 Apr 7. Dayangac D, Erdem H, Yilmaz E, Sahin A, Sohn C, Ozguc M, Dork T
Mutations of the CFTR gene in Turkish patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2004 May;19(5):1094-100. Epub 2004 Apr 7., [PMID:15070876]

Abstract [show]
BACKGROUND: Mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) can cause congenital bilateral absence of the vas deferens (CBAVD) as a primarily genital form of cystic fibrosis. The spectrum and frequency of CFTR mutations in Turkish males with CBAVD is largely unknown. METHODS: We investigated 51 Turkish males who had been diagnosed with CBAVD at the Hacettepe University, Ankara, for the presence of CFTR gene mutations by direct sequencing of the coding region and exon/intron boundaries. RESULTS: We identified 27 different mutations on 72.5% of the investigated alleles. Two-thirds of the patients harboured CFTR gene mutations on both chromosomes. Two predominant mutations, IVS8-5T and D1152H, accounted for more than one-third of the alleles. Five mutations are described for the first time. With one exception, all identified patients harboured at least one mutation of the missense or splicing type. Presently available mutation panels would have uncovered only 7-12% of CFTR alleles in this population cohort. CONCLUSIONS: Although cystic fibrosis is relatively rare in Turkey, CFTR mutations are responsible for the majority of CBAVD in Turkish males. Because of a specific mutation profile, a population-specific panel should be recommended for targeted populations such as CBAVD in Turkey or elsewhere.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 We next screened for six further CFTR gene mutations of the coding region and ¯anking intron sequences by previously described restriction-enzyme based methods: G85E, D110H, R347H, 2789+5G®A, D1152H, N1303K (DoÈrk et al., 1994a, 1997). Login to comment
40 Finally, the 5'-UTR and minimum promoter region were Table I. CFTR gene mutations identi®ed in 51 CBAVD patients Mutation Location Nucleotide alteration Predicted effect Allele frequency (%) Reference IVS8-5T Intron 8 Deletion of 2T between 1342±12 and 1342±6 Aberrant splicing 20 (19.6)a Chu et al. 1993 D1152H Exon 18 G®C at 3586 Amino acid substitution 15 (14.7)a Highsmith et al. 1992* D110H Exon 4 G®C at 460 Amino acid substitution 3 (2.9) Dean et al. 1990 DF508 Exon 10 Deletion of 3 nt at 1652±1655 Amino acid deletion 3 (2.9) Kerem et al. 1989 2789+5G®A Intron 14b G®A at 2789+5 Aberrant splicing 3 (2.9) Highsmith et al. 1997 L997F Exon 17a G®C at 3123 Amino acid substitution 3 (2.9) Fanen et al. 1992b CFTRdele2 (ins186) Introns 1±2 Deletion of 8.1 kb and insertion of 186 bp In-frame-deletion 2 (2.0) DoÈrk et al. 2000b R347H Exon 7 G®A at 1172 Amino acid substitution 2 (2.0) Cremonesi et al. 1992 E831X Exon 14a G®T at 2623 Truncation 2 (2.0) Ferec et al. 1992* 1767del6 Exon 11 Deletion of 6 nt at 1767±1773 In-frame-deletion 2 (2.0) (a) This study 3041-15T®G Intron 15 T®G at 3041±15 Aberrant splicing? Login to comment
56 Several mutations were already known as `mild' alleles in cystic ®brosis, e.g. D110H, R347H or 2789+5G®A, and have been described previously in studies of patients with CBAVD. Login to comment
72 CFTR genotypes in 51 patients with congenital bilateral absence of the vas deferens Mutation genotypes IVS8-(TG)mTn M470V n (%) Two mutations detected: D1152H/D1152H (TG)11 7T/ (TG)11 7T V/V 5 (9.8) IVS8-5T/IVS8-5T (TG)13 5T/ (TG)13 5T M/M 2 (3.9) (TG)12 5T/ (TG)13 5T M/V 1 (1.9) (TG)12 5T/ (TG)12 5T V/V 1 (1.9) IVS8-5T/D1152H (TG)12 5T/ (TG)11 7T V/V 2 (3.9) IVS8-5T/DF508 (TG)12 5T/ (TG)10 9T M/V 2 (3.9) IVS8-5T/2789+5G®A (TG)12 5T/ (TG)10 7T M/V 2 (3.9) IVS8-5T/365insT (TG)13 5T/ (TG)11 7T M/V 1 (1.9) IVS8-5T/D110H (TG)12 5T/ (TG)11 7T M/V 1 (1.9) IVS8-5T/E585X (TG)12 5T/ (TG)10 7T M/V 1 (1.9) IVS8-5T/2752-15C®G (TG)12 5T/ (TG)11 7T V/V 1 (1.9) IVS8-5T/M952I (TG)12 5T/ (TG)10 7T M/V 1 (1.9) IVS8-5T/3120+1G®A (TG)12 5T/ (TG)11 7T V/V 1 (1.9) D1152H/A349V (TG)10 7T/ (TG)11 7T M/V 1 (1.9) D1152H/2789+5G®A (TG)10 7T/ (TG)11 7T M/V 1 (1.9) D1152H/G1130A (TG)10 7T/ (TG)11 7T M/V 1 (1.9) CFTRdele2(ins186)/ IVS8-6T (TG)13 6T/ (TG)11 7T M/V 1 (1.9) CFTRdele2(ins186)/D110H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) E831X/D110H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) E831X/1677delTA (TG)11 7T/ (TG)11 7T V/V 1 (1.9) R334Q/R347H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) 1767del6/1767del6 (TG)11 7T/ (TG)11 7T V/V 1 (1.9) 3041-15T®G/3041-15T®G (TG)12 7T/ (TG)12 7T M/M 1 (1.9) 3041-13del7/3041-13del7 (TG)10 7T/ (TG)10 7T M/M 1 (1.9) R1070W/3272-26A®G (TG)10 7T/ (TG)11 7T M/V 1 (1.9) I853F/L997F (TG)11 7T/ (TG)10 9T V/V 1 (1.9) One mutation detected: L997F/? Login to comment

[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

[hide] Genotype-phenotype correlation and frequency of th... Genet Med. 2004 Sep-Oct;6(5):421-5. Monaghan KG, Highsmith WE, Amos J, Pratt VM, Roa B, Friez M, Pike-Buchanan LL, Buyse IM, Redman JB, Strom CM, Young AL, Sun W
Genotype-phenotype correlation and frequency of the 3199del6 cystic fibrosis mutation among I148T carriers: results from a collaborative study.
Genet Med. 2004 Sep-Oct;6(5):421-5., [PMID:15371907]

Abstract [show]
PURPOSE: We expect that the mutation panel currently recommended for preconception/prenatal CF carrier screening will be modified as new information is learned regarding the phenotype associated with specific mutations and allele frequencies in various populations. One such example is the I148T mutation, originally described as a severe CF mutation. After implementation of CF population-based carrier screening, we learned that I148T exists as a complex allele with 3199del6 in patients with clinical CF, whereas asymptomatic compound heterozygotes for I148T and a second severe CF mutation were negative for 3199del6. METHODS: We performed reflex testing for 3199del6 on 663 unrelated specimens, including I148T heterozygotes, compound heterozygotes, and a homozygous individual. RESULTS: Less than 1% of I148T carriers were also positive for 3199del6. Excluding subjects tested because of a suspected or known CF diagnosis or positive family history, 0.6% of I148T-positive individuals were also positive for 3199del6. We identified 1 I148T homozygote and 6 unrelated compound heterozygous individuals with I148T and a second CF variant (2 of whom also carried 3199del6). In addition, one fetus with echogenic bowel and one infertile male were heterozygous for I148T (3199del6 negative). CONCLUSIONS: Reflex testing for 3199del6 should be considered whenever I148T is identified. Reflex testing is of particular importance for any symptomatic patient or whenever one member of a couple carries a deleterious CF mutation and the other member is an I148T heterozygote. Further population data are required to determine if I148T, in the absence of 3199del6, is associated with mild or atypical CF or male infertility.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Case 6, a female for whom no clinical information is available, was compound heterozygous for D110H and I148T/ 3199del6. Login to comment
66 Sex Race Indication Genotype Poly T status Clinical information 1 Female Asian Carrier screening I148Ta /I148Ta12 9T/9T Asymptomatic 2 Male Not provided Infertility I148Ta /⌬F508 Not determined CBAVD 3 Male Not provided Infertility I148Ta heterozygote Negative for 5T Obstructive azoospermia 4 Male Caucasian Infertility I148Ta /S1235R20 7T/9T None available 5 Male Caucasian Family history of CF mutation I148Ta /⌬F508 9T/9T Fertile male who underwent carrier screening after the identification of ⌬F508 in the heterozygous form in his child during newborn screening, child`s mother is negative for 25 mutation ACOG/ACMG CF panel 6 Female Armenian Family history of CF mutation D110H/I148T (3199del6 positive) Not determined Clinical information on this individual is not available, despite multiple attempts to obtain. Login to comment
105 The second individual underwent testing due to the presence of two different CF mutations in her two children and was found to have the genotype D110H/I148T(3199del6). Login to comment
108 D110H is a rare CF sequence variant, originally reported in a mildly affected CF patient,18 and recently in homozygous form in an infant with metabolic alkalosis.19 The remaining I148T compound heterozygotes were negative for 3199del6. Login to comment

[hide] Rapid detection of CFTR gene rearrangements impact... J Med Genet. 2004 Nov;41(11):e118. Niel F, Martin J, Dastot-Le Moal F, Costes B, Boissier B, Delattre V, Goossens M, Girodon E
Rapid detection of CFTR gene rearrangements impacts on genetic counselling in cystic fibrosis.
J Med Genet. 2004 Nov;41(11):e118., [PMID:15520400]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
136 The subjects were divided into three groups according to the results of a previous screening: (i) 43 CF patients who fulfilled the diagnostic criteria of CF15 and who carried a CF mutation, and seven parents of deceased CF patients, a CF mutation having already been identified in the other parent (50 unidentified CF alleles); (ii) 12 CF patients with no identified CF mutation (24 unidentified CF alleles); and (iii) 16 patients apparently homozygous for a CFTR mutation and who had CF (F508del 2n = 6-, 2104insA22109del10, S945L, 3120+1GRA, N1303K) or a CFTR related disease, that is, isolated CBAVD (D110H, R117H, L997F, R74W-D1270N) or DB (R334W, R668C- G576A-D443Y) (0-16 unidentified CF alleles). Login to comment

[hide] Comprehensive cystic fibrosis mutation epidemiolog... Ann Hum Genet. 2005 Jan;69(Pt 1):15-24. Castaldo G, Polizzi A, Tomaiuolo R, Cazeneuve C, Girodon E, Santostasi T, Salvatore D, Raia V, Rigillo N, Goossens M, Salvatore F
Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population.
Ann Hum Genet. 2005 Jan;69(Pt 1):15-24., [PMID:15638824]

Abstract [show]
We screened the whole coding region of the cystic fibrosis transmembrane regulator (CFTR) gene in 371 unrelated cystic fibrosis (CF) patients from three regions of southern Italy. Forty-three mutations detected 91.5% of CF mutated chromosomes by denaturing gradient gel electrophoresis analysis, and three intragenic CFTR polymorphisms predicted a myriad of rare mutations in uncharacterized CF chromosomes. Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711 + 1G > T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Several mutations frequently found in northern Italy (e.g., R1162X, 711 + 5G > T) and northern Europe (e.g., G551D, I507del and 621 + 1G > T) are absent from the studied population. The I148T-3195del6 complex allele was present in two CF chromosomes, whereas I148T was present in both alleles (as a single mutation) in another CF patient and in five CF carriers; this could result from crossover events. The haplotype analysis of three intragenic polymorphisms (IVS8CA, IVS17bTA and IVS17bCA) compared with data from other studies revealed that several mutations (3849 + 10kbC > T, 1717-1G > A, E585X, 3272-26G > A, L558S, 2184insA and R347P) originated from multiple events, whereas others (R1158X and S549R) could be associated with one or more intragenic recombinant events. Given the large population migration from southern Italy, knowledge of the CF molecular epidemiology in this area is an important contribution to diagnosis, counselling and interlaboratory quality control for molecular laboratories worldwide.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
62 A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n. Login to comment
85 Present study case (n) Mutation references* Haplotype (n. of repeats) Other studies case (n) W1282X 16 17-7-17 26 1, 2, 3 1259insA 11 16-33-13 852del22 11 16-33-13 4016insT 11 16-30-13 I502T 8 16-30-13 L1065P 4 16-30-13 2522insC 4 23-30-13 2789+5G>A 2 17-7-17 9 1, 2, 3 D1152H 2 16-7-13 2711delT 1 16-45-13 2 3 D110H 1 16-32-13 Y849X 1 16-30-13 * References: 1: Morral et al., 1996 2: Claustres et al., 1996 3: Hughes et al., 1996b peculiar to Sardinia, is absent in our population (Rendine et al. 1997). Login to comment

[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]

Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T. Login to comment

[hide] Indirect CFTR mutation identification by PCR/OLA a... Genet Test. 2005 Winter;9(4):285-91. Stanziale P, Savino M, De Bonis P, Granatiero M, Zelante L, Bisceglia L
Indirect CFTR mutation identification by PCR/OLA anomalous electropherograms.
Genet Test. 2005 Winter;9(4):285-91., [PMID:16379540]

Abstract [show]
Mutations of CFTR gene are responsible for cystic fibrosis (CF) and other clinical conditions such as congenital absence of the vas deferens (CAVD), chronic pancreatitis (IP), and idiopathic disseminated bronchiectasis (DBE) classified as CFTR-related disorders. The PCR/OLA assay is designed to detect 31 known mutations including the 24 most common CF mutations worldwide, as identified by the CF Consortium. In order to define the CFTR genotype a series of 1812 individuals from central-southern Italy with and without CF manifestations were screened by using the PCR/OLA assay. Here we report the description of five cases of anomalous electropherograms obtained after PCR/OLA analysis, that led to the identification, in the homozygous state, of two point mutations (D110H and S589N) not included in the assay test panel, a large gene deletion (CFTRdel14b_17b), and an exonic polymorphism (c.4002A > G). Haplotype and real time PCR analysis were also performed in the subject carrying the large CFTR deletion. The study demonstrates that the PCR/OLA assay, besides being an efficient and user-friendly method to screen known mutations in the CFTR gene, may also function as a mutation/polymorphism-scanning assay, at least for certain nucleotide changes located in some critical regions of the gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 Here we report the description of five cases of anomalous electropherograms obtained after PCR/OLA analysis, that led to the identification, in the homozygous state, of two point mutations (D110H and S589N) not included in the assay test panel, a large gene deletion (CFTRdel14b_17b), and an exonic polymorphism (c.4002A Ͼ G). Login to comment
45 A: Sequencing analysis of exon 4 in case 1 and wild-type control sample. The arrow indicates the nucleotide change leading to the D110H mutation. Login to comment
62 This nucleotide transversion generates the D110H mutation (substitution histidine for aspartic acid), often associated with CABVD (Dork et al., 1997). Login to comment
118 In addition, because the D110H and S589N changes, similar to CFTRdel14b_17b, are rare mutations (CF Genetic Analysis Consortium: www.genet.sickkids.on.ca/CFTR) and the c.4002A Ͼ G allelic frequency is 1.32%, as resulted by the analysis performed in 113 control individuals from central-southern Italy (data not shown), it seems to be reasonable to postulate consanguinity in all the families. Login to comment

[hide] Mutations in the cystic fibrosis transmembrane reg... Am J Respir Crit Care Med. 2006 Oct 1;174(7):787-94. Epub 2006 Jul 13. Wilschanski M, Dupuis A, Ellis L, Jarvi K, Zielenski J, Tullis E, Martin S, Corey M, Tsui LC, Durie P
Mutations in the cystic fibrosis transmembrane regulator gene and in vivo transepithelial potentials.
Am J Respir Crit Care Med. 2006 Oct 1;174(7):787-94. Epub 2006 Jul 13., 2006-10-01 [PMID:16840743]

Abstract [show]
AIM: To examine the relationship between cystic fibrosis transmembrane regulator gene mutations (CFTR) and in vivo transepithelial potentials. METHODS: We prospectively evaluated 162 men including 31 healthy subjects, 21 obligate heterozygotes, 60 with congenital bilateral absence of the vas deferens (CBAVD) and 50 with CF by extensive CFTR genotyping, sweat chloride and nasal potential difference testing. RESULTS: Six (10%) men with CBAVD carried no CFTR mutations, 18 (30%) carried one mutation, including the 5T variant, and 36 (60%) carried mutations on both alleles, for a significantly higher rate carrying one or more mutations than healthy controls (90% versus 19%, p < 0.001). There was an overlapping spectrum of ion channel measurements among the men with CBAVD, ranging from values in the control and obligate heterozygote range at one extreme, to values in the CF range at the other. All pancreatic-sufficient patients with CF and 34 of 36 patients with CBAVD with mutations on both alleles carried at least one mild mutation. However, the distribution of mild mutations in the two groups differed greatly. Genotyping, sweat chloride and nasal potential difference (alone or in combination) excluded CF in all CBAVD men with no mutations. CF was confirmed in 56% and 67% of CBAVD men carrying 1 and 2 CFTR mutations, respectively. CONCLUSION: Abnormalities of CFTR transepithelial function correlate with the number and severity of CFTR gene mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 CFTR GENE MUTATIONS IN THE PATIENT GROUPS Control Subjects (n ϭ 31) Heterozygotes (n ϭ 21) CBAVD-1 (n ϭ 18) CBAVD-2 (n ϭ 36) CF-PS (n ϭ 24) CF-PI (n ϭ 26) G542X*/R75Q ⌬F508*/- (n ϭ 16) ⌬F508* (n ϭ 6) ⌬F508*/2789ϩ5G→A* ⌬F508*/R117H [5T]* (n ϭ 4) ⌬F508*/⌬F508* (n ϭ 11) ⌬F508* ⌬F508*/5T W1282X*/5T (n ϭ 8) R334W*/R334W* ⌬F508*/A455E* (n ϭ 2) ⌬F508*/G542X* (n ϭ 2) G542X* W1282X*/- (n ϭ 2) D1152H† ⌬F508*/R117H [7T] (n ϭ 10) ⌬F508*/3849ϩ10kbC→T* (n ϭ 2) ⌬F508*/G551D* (n ϭ 2) R117H[7T] G85E† /R75Q L206W† ⌬F508*/R117C [7T] G551D*/3849ϩ10kbC→T* ⌬F508*/621ϩ1G→T* (n ϭ 2) S431G R75Q/- A198P G551D*/R117H [7T] ⌬F508*/3272-26A→G† (n ϭ 2) ⌬F508*/2789ϩ5 G→A* 5T ⌬F508*/5T (n ϭ 8) ⌬F508*/P574H† (n ϭ 2) ⌬F508*/W1282X* G542X*/5T ⌬F508*/I1234V† ⌬F508*/G85E* W1282X*/5T ⌬F508*/P67L† ⌬F508*/L1077P† (n ϭ 2) ⌬F508*/P67L† ⌬F508*/R347H† G551D*/G480C† ⌬F508*/L206W† ⌬F508*/5T ⌬F508*/- (n ϭ 2) ⌬F508*/M952T† ⌬F508*/875ϩ1G→C† -/- ⌬F508*/S549R† G551D*/R75Q A455E*/L206W† ⌬F508*/- (n ϭ 2) 621ϩG→T*/R117C [7T] A455E*/- R117H [7T]/5T ⌬I507*/- R117L[7T]/5T -/- R117H/R117H [7T/7T] D979A/5T 5T/-741T→G 4016insT† /D110H Definition of abbreviations: CBAVD ϭ congenital bilateral absence of the vas deferens; CF-PI ϭ pancreatic-insufficient cystic fibrosis; CF-PS ϭ pancreatic-sufficient cystic fibrosis. Login to comment

[hide] Detection of cystic fibrosis transmembrane conduct... Hum Reprod. 2007 May;22(5):1285-91. Epub 2007 Feb 28. Ratbi I, Legendre M, Niel F, Martin J, Soufir JC, Izard V, Costes B, Costa C, Goossens M, Girodon E
Detection of cystic fibrosis transmembrane conductance regulator (CFTR) gene rearrangements enriches the mutation spectrum in congenital bilateral absence of the vas deferens and impacts on genetic counselling.
Hum Reprod. 2007 May;22(5):1285-91. Epub 2007 Feb 28., [PMID:17329263]

Abstract [show]
BACKGROUND: Mutations in the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene have been widely detected in infertile men with congenital bilateral absence of the vas deferens (CBAVD). Despite extensive analysis of the CFTR gene using varied screening methods, a number of cases remain unsolved and could be attributable to the presence of large gene rearrangements, as recently shown for CF patients. METHODS: We carried out a complete CFTR gene study in a group of 222 CBAVD patients with strict diagnosis criteria and without renal anomaly, and searched for rearrangements using a semi-quantitative assay in a subgroup of 61 patients. RESULTS: The overall mutation detection rate was 87.8%, and 82% of patients carried two mutations. Ten out of the 99 different mutations accounted for 74.6% of identified alleles. Four large rearrangements were found in patients who already carried a mild mutation: two known partial deletions (exons 17a to 18 and 22 to 23), a complete deletion and a new partial duplication (exons 11 to 13). The rearrangements accounted for 7% of the previously unknown alleles and 1% of all identified alleles. CONCLUSIONS: Screening for rearrangements should be part of comprehensive CFTR gene studies in CBAVD patients and may have impacts on genetic counselling for the patients and their families.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 C)] þ [I556V] 1 Apparent homozygosity 3 0-3 1 [R117H] þ [R117H] 1 1 [D110H] þ [D110H] 1 [R74W;D1270 N] þ [R74W;D1270 N] 1 Total 61 57-75 4 F508del, 2221dupA, as well as variants at the IVS8(TG)m(T)n polymorphic site. Login to comment

[hide] Diversity of the basic defect of homozygous CFTR m... J Med Genet. 2008 Jan;45(1):47-54. Stanke F, Ballmann M, Bronsveld I, Dork T, Gallati S, Laabs U, Derichs N, Ritzka M, Posselt HG, Harms HK, Griese M, Blau H, Mastella G, Bijman J, Veeze H, Tummler B
Diversity of the basic defect of homozygous CFTR mutation genotypes in humans.
J Med Genet. 2008 Jan;45(1):47-54., [PMID:18178635]

Abstract [show]
BACKGROUND: Knowledge of how CFTR mutations other than F508del translate into the basic defect in cystic fibrosis (CF) is scarce due to the low incidence of homozygous index cases. METHODS: 17 individuals who are homozygous for deletions, missense, stop or splice site mutations in the CFTR gene were investigated for clinical symptoms of CF and assessed in CFTR function by sweat test, nasal potential difference and intestinal current measurement. RESULTS: CFTR activity in sweat gland, upper airways and distal intestine was normal for homozygous carriers of G314E or L997F and in the range of F508del homozygotes for homozygous carriers of E92K, W1098L, R553X, R1162X, CFTRdele2(ins186) or CFTRdele2,3(21 kb). Homozygotes for M1101K, 1898+3 A-G or 3849+10 kb C-T were not consistent CF or non-CF in the three bioassays. 14 individuals exhibited some chloride conductance in the airways and/or in the intestine which was identified by the differential response to cAMP and DIDS as being caused by CFTR or at least two other chloride conductances. DISCUSSION: CFTR mutations may lead to unusual electrophysiological or clinical manifestations. In vivo and ex vivo functional assessment of CFTR function and in-depth clinical examination of the index cases are indicated to classify yet uncharacterised CFTR mutations as either disease-causing lesions, risk factors, modifiers or neutral variants.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 E92K and D110H (data not shown) are located in the first ectoplasmic loop. Login to comment

[hide] CFTR mutations in Turkish and North African cystic... Genet Test. 2008 Mar;12(1):25-35. Lakeman P, Gille JJ, Dankert-Roelse JE, Heijerman HG, Munck A, Iron A, Grasemann H, Schuster A, Cornel MC, Ten Kate LP
CFTR mutations in Turkish and North African cystic fibrosis patients in Europe: implications for screening.
Genet Test. 2008 Mar;12(1):25-35., [PMID:18373402]

Abstract [show]
AIMS: To obtain more insight into the variability of the CFTR mutations found in immigrant cystic fibrosis (CF) patients who are living in Europe now, and to estimate the test sensitivity of different frequently used methods of DNA analysis to detect CF carriers or patients among these Turkish or North African immigrants. METHODS: A survey among 373 European CF centers asking which CFTR mutations had been found in Turkish and North African CF patients. RESULTS: 31 and 26 different mutations were reported in Turkish and North African patients, identifying 64.2% (113/176) and 87.4% (118/135) alleles, respectively (p < 0.001). The mean sensitivity (detection rate) of three most common CFTR mutation panels to detect these mutations differed between Turkish and North African people, 44.9% (79/176) versus 69.6% (94/135) (p < 0.001), and can be increased to 57.4% (101/176) and 79.3% (107/135) (p < 0.001), respectively, by expanding these panels with 13 mutations which have been found on two or more alleles. CONCLUSION: 35.8% and 12.6%, respectively, of CF alleles in Turkish and North African patients living in Europe now had not been identified. Among these populations, the test sensitivity of common CFTR mutation panels is insufficient for use in screening programs in Europe, even after expansion with frequent Turkish and North African mutations. This raises questions about whether and how to implement CF carrier and neonatal screening in a multiethnic society.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 Identity and Frequency of CFTR Mutations on Unrelated Turkish (Tr) and North African (NA) CF alleles Total number of allelesa Number of CF patients with this mutationb Mutation Exon All Tr NA Homozygote Compound heterozygote: two mutations found Compound heterozygote: one mutation found F508delc 10 73 33 40 27 11 6 N1303K 21 22 12 10 10 5 2 711 þ 1G > T Intron 5 14 - 14 7 2 0 G542X 11 14 6 8 7 1 0 R1162X 19 11 - 11 1 5 2 2183AA > G 13 9 9 - 3 3 1 W1282X 20 7 3 4 2 3 1 2789 þ 5G > A Intron 14b 6 3 3 1 4 1 L227R 6a 4 - 4 3 1 0 1677delTA 10 4 4 - 2 1 1 2184insA 13 4 4 - 1 2 0 R334W 7 4 4 - 1 1 1 G85E 3 4 3 1 1 2 0 R709X 13 3 - 3 2 0 0 L732X 13 3 3 - 2 0 0 2184delA 13 3 3 - 0 3 0 del exon 1-4d 1-4 3 3 - 1 1 0 del exon 19 19 2 2 - 2 0 0 3849 þ 10kbC > T Intron 19 2 - 2 1 0 0 S549N 11 2 1 1 0 1 1 3120 þ G > A Intron 16 2 2 - 1 0 0 3601-2A > G Intron 18 2 2 - 1 0 0 D1152H 18 2 2 - 1 0 0 E1104X 17b 2 - 2 1 0 0 S1159F 19 2 2 - 1 0 0 S977F 16 2 - 2 0 1 0 2347delG 13 2 - 2 1 0 0 4096-3C > G Intron 21 1 1 - 1 0 0 E831X 14a 1 1 - 1 0 0 L619S 13 1 1 - 1 0 0 1525-1G > Ac Intron 9 1 1 - 1 0 0 F1052V 17b 1 1 - 1 0 0 3130delA 17a 1 1 - 1 0 0 R352Q 7 1 - 1 0 1 0 1812-1G > A Intron 11 1 - 1 0 1 0 R553X 11 1 - 1 0 0 1 IVS8-5T Intron 8 1 1 - 0 1 0 R1066C 17b 1 - 1 0 1 0 3129del4 17a 1 - 1 0 1 0 D110H 4 1 1 - 0 1 0 R117H 4 1 - 1 0 1 0 S945L 15 1 - 1 0 1 0 1716G=A 10 1 - 1 0 0 1 711 þ 3A > G Intron 5 1 1 - 0 1 0 R75X 3 1 1 - 0 1 0 R764X 13 1 - 1 0 1 0 S1196X 19 1 1 - 0 1 0 S492F 10 1 - 1 0 1 0 G551D 11 1 - 1 1 0 0 del exon 2 2 1 1 - 1 0 0 Subtotal 231 113 118 - No mutation 80 63 17 - Total 311 176 135 88 60 18 a n ¼ 311 alleles, based on 166 CF patients (332 alleles) with both parents and 22 CF patients (22 alleles) with one parent from Turkey or North Africa, minus 43 alleles of homozygous CF patients with consanguineous parents of whom only one allele was taken into account. Login to comment

[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT. Login to comment
97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction. Login to comment
98 Mutation Disorder Gender Age (years) Notes and refs ΔF508/R117H M 47 (C) [20,21] ΔF508/R117H F 36 (C) [20,21] ΔF508/R117H M 43 (C) [20,21] G542X/D1152H M 40 (C) R1162X/2789+5G→A CBAVD M 44 (C) R117H/2789+5G→A CBAVD M 42 (C) N1303K/D110H CBAVD M 32 (C) N1303K/D1152H M 40 (C) 2789+5G→A/R1066H M 40 (C) Abbreviations: CBAVD: Congenital Bilateral Absence of the Vas Deference; M: Male; F: Female. Login to comment
105 Among the subjects tested, 9 resulted to be compound heterozygotes: ΔF508/R117H (n=3), G542X/D1152H (n=1), R1162X/2789+5G→A (n=1), R117H/2789 + 5G→A (n = 1), N1303K/D110H (n = 1), N1303K/D1152H (n = 1), 2789 + 5G→A/R1066H (n = 1) (Table 2b). Login to comment

[hide] Association of cystic fibrosis genetic modifiers w... Fertil Steril. 2010 Nov;94(6):2122-7. Epub 2010 Jan 25. Havasi V, Rowe SM, Kolettis PN, Dayangac D, Sahin A, Grangeia A, Carvalho F, Barros A, Sousa M, Bassas L, Casals T, Sorscher EJ
Association of cystic fibrosis genetic modifiers with congenital bilateral absence of the vas deferens.
Fertil Steril. 2010 Nov;94(6):2122-7. Epub 2010 Jan 25., [PMID:20100616]

Abstract [show]
OBJECTIVE: To investigate whether genetic modifiers of cystic fibrosis (CF) lung disease also predispose to congenital bilateral absence of the vas deferens (CBAVD) in association with cystic fibrosis transmembrane conductance regulator (CFTR) mutations. We tested the hypothesis that polymorphisms of transforming growth factor (TGF)-beta1 (rs 1982073, rs 1800471) and endothelin receptor type A (EDNRA) (rs 5335, rs 1801708) are associated with the CBAVD phenotype. DESIGN: Genotyping of subjects with clinical CBAVD. SETTING: Outpatient and hospital-based clinical evaluation. PATIENT(S): DNA samples from 80 subjects with CBAVD and 51 healthy male controls from various regions of Europe. This is one of the largest genetic studies of this disease to date. INTERVENTION(S): None. MAIN OUTCOME MEASURE(S): Genotype analysis. RESULT(S): For single nucleotide polymorphism (SNP) rs 5335, we found increased frequency of the CC genotype among subjects with CBAVD. The difference was significant among Turkish patients versus controls (45.2% vs. 19.4%), and between all cases versus controls (36% vs. 15.7%). No associations between CBAVD penetrance and polymorphisms rs 1982073, rs 1800471, or rs 1801708 were observed. CONCLUSION(S): Our findings indicate that endothelin receptor type A polymorphism rs 5335 may be associated with CBAVD penetrance. To our knowledge, this is the first study to investigate genetic modifiers relevant to CBAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Portuguese CFTR alleles Spanish CFTR alleles Turkish CFTR alleles 5T 22 F508del 11 5T 20 F508del 14 5T 9 D1152H 14 R334W 5 D443Ya 3 D110H 3 R117H 3 G576Aa 3 F508del 2 S1235R 3 R668Ca 3 3041-11del7 2 N1303K 2 G542X 2 1767del6 2 P205S 2 R117H 2 2789þ5G>A 2 D614G 2 V232D 2 CFTRdele2(ins186) 2 G542X 1 L997F 1 3120þ1G>A 1 L206W 1 H609R 1 G1130A 1 V562I 1 N1303H 1 M952I 1 I507del 1 L206W 1 365insT 1 3272-26A>G 1 3272-26A/G 1 E585X 1 2789þ5G>A 1 L15P 1 2752-15C>G 1 G576Aa 1 R347H 1 R334Q 1 R668Ca 1 2689insG 1 R347H 1 CFTRdele2,3 1 R1070W 1 E831X 1 L1227S 1 I 1027T 1 R1070W 1 E831X 1 3272-26A>G 1 L997F 1 I853F 1 A349V 1 6T 1 Note: CFTR ¼ cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] Alternative splicing at a NAGNAG acceptor site as ... PLoS Genet. 2010 Oct 7;6(10). pii: e1001153. Hinzpeter A, Aissat A, Sondo E, Costa C, Arous N, Gameiro C, Martin N, Tarze A, Weiss L, de Becdelievre A, Costes B, Goossens M, Galietta LJ, Girodon E, Fanen P
Alternative splicing at a NAGNAG acceptor site as a novel phenotype modifier.
PLoS Genet. 2010 Oct 7;6(10). pii: e1001153., [PMID:20949073]

Abstract [show]
Approximately 30% of alleles causing genetic disorders generate premature termination codons (PTCs), which are usually associated with severe phenotypes. However, bypassing the deleterious stop codon can lead to a mild disease outcome. Splicing at NAGNAG tandem splice sites has been reported to result in insertion or deletion (indel) of three nucleotides. We identified such a mechanism as the origin of the mild to asymptomatic phenotype observed in cystic fibrosis patients homozygous for the E831X mutation (2623G>T) in the CFTR gene. Analyses performed on nasal epithelial cell mRNA detected three distinct isoforms, a considerably more complex situation than expected for a single nucleotide substitution. Structure-function studies and in silico analyses provided the first experimental evidence of an indel of a stop codon by alternative splicing at a NAGNAG acceptor site. In addition to contributing to proteome plasticity, alternative splicing at a NAGNAG tandem site can thus remove a disease-causing UAG stop codon. This molecular study reveals a naturally occurring mechanism where the effect of either modifier genes or epigenetic factors could be suspected. This finding is of importance for genetic counseling as well as for deciding appropriate therapeutic strategies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
188 Age at diagnosis, gender: M, F Ethnic origin Genotype Sweat test* (mmol/l) Phenotype References Birth, F - E831X/G551D 100 Early childhood: MI, PI, and lung infections Adulthood: PI and no pulmonary symptoms 15 Twins 13y, M Turkish E831X/591del18 89/94 Recurrent nasal polyps 16 Adult, M Turkish E831X/D110H - CBAVD 17 Adult, M Turkish E831X/1677delTA - CBAVD 17 Adult, M Turkish E831X/DF508 92/94 CBAVD PS and mild lung disease 18 Adult, M Portuguese E831X/DF508 - CBAVD 19 First year, F - E831X/DF508 100 PS and no lung involvement French registry First year, M Turkish E831X/E831X 70 PS and mild lung disease This study III10 Adult, F Turkish E831X/E831X 70 PS and no lung involvement This study III5 Neonatal diagnosis, M Turkish E831X/E831X 74 PS and mild lung disease This study IV1 Abbreviations: CBAVD, congenital bilateral absence of the vas deferens; MI, meconium ileus; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment

[hide] Clinical outcome of preimplantation genetic diagno... Eur J Hum Genet. 2007 Jul;15(7):752-8. Epub 2007 Apr 18. Keymolen K, Goossens V, De Rycke M, Sermon K, Boelaert K, Bonduelle M, Van Steirteghem A, Liebaers I
Clinical outcome of preimplantation genetic diagnosis for cystic fibrosis: the Brussels' experience.
Eur J Hum Genet. 2007 Jul;15(7):752-8. Epub 2007 Apr 18., [PMID:17440499]

Abstract [show]
Preimplantation genetic diagnosis is an alternative for prenatal diagnosis that makes it possible to perform the diagnosis of a chromosomal or monogenic disorder at the preimplantation embryo level. Cystic fibrosis is one of the monogenic diseases for which PGD can be performed. In this study, we looked at the requests and PGD cycles for this particular disorder over an 11-year period. Sixty-eight percent of the requests eventually led to at least one complete PGD cycle. In 80% of the cycles, an embryo transfer was performed and an ongoing pregnancy was obtained in 22.2% of the cycles with oocyte retrieval. After embryo transfer, a couple had 27.8% chance of giving birth to a liveborn child. No misdiagnosis was recorded. The rate of perinatal deaths/stillborn children was relatively high, but no excess of major congenital anomalies was observed in the surviving children.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 Table 1 Assessment of CF risk Couples with PGD (n ¼ 47) Couples without PGD (n ¼ 22) All couples (n ¼ 69)(%) CF risk assessment Affected child or foetus 23 14 37 (53.6) CBAVD (without other CF complaints) 7 3 10 (14.5) During fertility work-up (not CBAVD) 10 10 (14.5) Positive family history 3 2 5 (7.2) CF patient (with CBAVD in males) 4 4 (5.8) Unknown 2 2 (2.9) Preconceptual screening 1 1 (1.4) Table 2 Reasons for choosing PGD Couples with PGD (n ¼ 47) Couples without PGD (n ¼ 22) All couples (n ¼ 69) Reason for choosing/informing about PGD Fertility problems 24 7 31 (44.9%) Objection to abortion 15 2 17 (24.6%) History of termination of pregnancy 8 1 9 (13%) Unknown 11 11 (15.9%) Other 1 1 (1.4%) Table 3 Genotypes of the couples with PGD cycles Female partner Male partner Number of couples with this genotype p.F508del/- p.F508del/- 17 p.F508del/- p.R117H/- (7T/9T) 1 p.2789+5G4A/- p.D110H/p.D110H 1 p.G542X/- p.F508del/- 1 p.R334Q/- p.F508del/- 1 p.R553X/- p.F508del/- 2 p.1717-1G4A p.2183AA4G/5T 1 p.F508del/- p.F508del/? Login to comment

[hide] Mid-trimester hyperechogenic bowel in a fetus of T... Arch Iran Med. 2012 Jul;15(7):449-51. doi: 012157/AIM.0015. Kazandi M, Turan V, Selvi Demirtas G, Akercan F, Aykut A, Ozkinay F
Mid-trimester hyperechogenic bowel in a fetus of Turkish origin carrying a rarely seen mutation of cystic fibrosis.
Arch Iran Med. 2012 Jul;15(7):449-51. doi: 012157/AIM.0015., [PMID:22724884]

Abstract [show]
Cystic fibrosis (CF) is one of the most common severe autosomal recessive genetic disorders, characterized primarily by chronic obstructive lung disease and maldigestion disorder. The disease is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. Here we present a case of a fetus with hyperechogenic bowel, in which compound heterozygosity was established for the mutations p.IIe1000fsX1001 and p.Asp110His subsequent to amniocentesis. The mutations were most likely disease-causing, and pregnancy was terminated.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Once the most frequent mutations have been accounted for, rarer mutations should be investigated.10 In this study we present a fetus with hyperechogenic bowel carrying a rarely seen compound heterozygous mutation of p.IIe1000fsX1001 and p.Asp110His in the CFTR gene. Login to comment
13 Also p.Asp110His mutation was identified whe- UH WKH F* ! Login to comment
17 The result was consistent with Asp110His heterozygous mutation. Login to comment
39 The cases that have previously reported the p.Asp110His mutation were prone to severe salt loss upon exposure to heat or exercise, were overweight and had normal lung function.15 There have been several reports about a mild CF phenotype of isolated hypotonic dehydration associated with specific CFTR mutations, including p.Asp110His.16-18 An Iranian study on males with congenital bilateral absence of the vas deferens (CVDA) showed the c.3130delA mutation with a frequency of 2.9%.19 In the present study, following termination of pregnancy, paternal and maternal mutations were detected in molecular studies. Login to comment
16 The result was consistent with Asp110His heterozygous mutation. Login to comment
38 The cases that have previously reported the p.Asp110His mutation were prone to severe salt loss upon exposure to heat or exercise, were overweight and had normal lung function.15 There have been several reports about a mild CF phenotype of isolated hypotonic dehydration associated with specific CFTR mutations, including p.Asp110His.16-18 An Iranian study on males with congenital bilateral absence of the vas deferens (CVDA) showed the c.3130delA mutation with a frequency of 2.9%.19 In the present study, following termination of pregnancy, paternal and maternal mutations were detected in molecular studies. Login to comment

[hide] A haplotype framework for cystic fibrosis mutation... J Mol Diagn. 2006 Feb;8(1):119-27. Elahi E, Khodadad A, Kupershmidt I, Ghasemi F, Alinasab B, Naghizadeh R, Eason RG, Amini M, Esmaili M, Esmaeili Dooki MR, Sanati MH, Davis RW, Ronaghi M, Thorstenson YR
A haplotype framework for cystic fibrosis mutations in Iran.
J Mol Diagn. 2006 Feb;8(1):119-27., [PMID:16436643]

Abstract [show]
This is the first comprehensive profile of cystic fibrosis transmembrane conductance regulator (CFTR) mutations and their corresponding haplotypes in the Iranian population. All of the 27 CFTR exons of 60 unrelated Iranian CF patients were sequenced to identify disease-causing mutations. Eleven core haplotypes of CFTR were identified by genotyping six high-frequency simple nucleotide polymorphisms. The carrier frequency of 2.5 in 100 (1 in 40) was estimated from the frequency of heterozygous patients and suggests that contrary to popular belief, cystic fibrosis may be a common, under-diagnosed disease in Iran. A heterogeneous mutation spectrum was observed at the CFTR locus in 60 cystic fibrosis (CF) patients from Iran. Twenty putative disease-causing mutations were identified on 64 (53%) of the 120 chromosomes. The five most common Iranian mutations together represented 37% of the expected mutated alleles. The most frequent mutation, DeltaF508 (p.F508del), represented only 16% of the expected mutated alleles. The next most frequent mutations were c.1677del2 (p.515fs) at 7.5%, c.4041C>G (p.N1303K) at 5.6%, c.2183AA>G (p.684fs) at 5%, and c.3661A>T (p.K1177X) at 2.5%. Three of the five most frequent Iranian mutations are not included in a commonly used panel of CF mutations, underscoring the importance of identifying geographic-specific mutations in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 Both domains are conserved in the ATP-binding cassette transporters.33 In addition, mutations p.D110H, p.R334W, p.T338I, p.L467F, and p.P1013L altered predicted exon splicing enhancer motifs in the CFTR gene, suggesting that they may have a deleterious effect on splicing. Login to comment
111 of Patients Total alleles* Associated haplotype Global distributionHom Het Exon 1 c.134TϾC M1T 1 1 Rare Exon 3 c.386GϾA G85E 1 1 Global Exon 4 c.460GϾC D110H 1 1 H2 Europe Exon 7 c.1132CϾT R334W 1 1 H2 Global Exon 7 c.1145CϾT T338I 1 1 Europe Intron 9 c.1525-1GϾA Mis-splicing 1 1 H8 Pakistan Exon 10 c.1529CϾG S466X 1 2 H4 Germany Exon 10 c.1531CϾT L467F 1 1 Rare Exon 10 c.1649TϾC I506T 1 2 H8 Lebanon Exon 10 c.1652del3† ⌬F508 6 7 19 H5 Global Exon 10 c.1677delTA 515fs 4 1 9 H1 Europe Exon 11 c.1756GϾT G542X 1 1 H5 Global Exon 12 c.1821CϾA Y563X 2 2 Europe Exon 13 c.2183AAϾG 684fs 3 6 H3 Europe Exon 17a c.3170CϾT P1013L 1 1 Turkey Exon 19 c.3616CϾT R1162X 2 2 H2 Germany Exon 19 c.3661AϾT K1177X 1 1 3 H2 Bahrain Intron 20 c.4005ϩ1GϾA Mis-splicing 1 2 H2 Europe Exon 21 c.4041CϾG N1303K 3 1 7 H5 Global Exon 23 c.4363CϾT Q1412X 1 1 Rare *A total of 64 (53%) of the 120 expected alleles were observed. Login to comment

[hide] Cystic fibrosis presenting as metabolic alkalosis ... J Cyst Fibros. 2004 Jun;3(2):135-6. Salvatore D, Tomaiuolo R, Abate R, Vanacore B, Manieri S, Mirauda MP, Scavone A, Schiavo MV, Castaldo G, Salvatore F
Cystic fibrosis presenting as metabolic alkalosis in a boy with the rare D579G mutation.
J Cyst Fibros. 2004 Jun;3(2):135-6., [PMID:15463898]

Abstract [show]
We report on a 10-month-old boy with hypotonic dehydration and metabolic alkalosis. Sweat test was borderline and genetic analysis was negative for common mutations. Analysis of the whole coding regions of the CFTR gene revealed the rare mutation D579G in homozygosity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
17 Indeed, there are several reports about a mild CF phenotype of isolated hypotonic dehydration, associated with specific CFTR mutations, such as T338I, D110E and D110H [6-8]. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 g D44G, 300delA, W57X, 405+1G>A, D110H, E116K, 541del4, 542del7, L137R, 621+2T>G, I175V, H199R, H199Y, C225X, V232D, Q290X, E292X, G314V, T338I, 1221delCT, W401X, Q452P, I502T, 1716+2T>C, G544S, R560S, A561E, V562I, Y569D, 1898+3A>G, 1898+5G>A, G628R(G>A), 2143delT, G673X, R851X, Q890X, S977F, 3129del4, 3154delG, 3271+1G>A, G1061R, R1066L, R1070W, 3601-17T>C, S1196X, 3732delA, G1249R, 3898insC, 4374+1G>A, del25kb. Login to comment
152 Twenty-four non F508del mutations were found associated with the 9T allele: 394delTT, L90S, D110H, R117G, 621+1G>T, V232D, A455E, G542X, R851L, T908N, 2789+5G>A, 2896insAG, H939R, 3007delG, I980K, I1027T, R1066H, A1067T, D1154G, 3737delA, R74W+D1270N, N1303I, N1303K, D1377H. Login to comment

[hide] A comparison of fluorescent SSCP and denaturing HP... Hum Mutat. 2000;15(6):556-64. Ellis LA, Taylor CF, Taylor GR
A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning.
Hum Mutat. 2000;15(6):556-64., [PMID:10862085]

Abstract [show]
We examined 67 different mutations in 16 different amplicons in a comparison of mutation detection by fluorescent single strand conformation polymorphism (F-SSCP) and by denaturing HPLC (DHPLC). F-SSCP was used to analyze fluorescent amplicons with internal size standards and automated fragment analysis (GeneScan, PE Applied Biosystems, Foster City, CA). In DHPLC, unlabelled amplicons were analyzed by reverse phase HPLC with fragment detection by absorbance at 260nm. Both methods had high sensitivity (95-100%) and specificity (100%). Overall, F-SSCP with external temperature control was the more sensitive method, but DHPLC was particularly useful for the rapid analysis of novel fragments.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE. Login to comment

[hide] Analysis of the CFTR gene in Turkish cystic fibros... Hum Genet. 1998 Feb;102(2):224-30. Onay T, Topaloglu O, Zielenski J, Gokgoz N, Kayserili H, Camcioglu Y, Cokugras H, Akcakaya N, Apak M, Tsui LC, Kirdar B
Analysis of the CFTR gene in Turkish cystic fibrosis patients: identification of three novel mutations (3172delAC, P1013L and M1028I).
Hum Genet. 1998 Feb;102(2):224-30., [PMID:9521595]

Abstract [show]
In order to determine the spectrum of cystic fibrosis (CF) mutations in the Turkish population, a complete coding region of the cystic fibrosis transmembrane conductance regulator (CFTR) gene including exon-intron boundaries, on 122 unrelated CF chromosomes from 73 Turkish CF families was analysed by denaturing gradient gel electrophoresis and multiplex heteroduplex analysis on MDE gel matrix. In addition to 15 previously reported mutations and 12 polymorphisms, three novel mutations, namely 3172delAC, P1013L and M1028I, were detected. DeltaF508 was found to be present on 18.8% of CF chromosomes. The second most common mutation was 1677delTA, with a frequency of 7.3%, followed by G542X and 2183AA-->G mutations, with frequencies of 4.9%. These four most common mutations in Turkish CF population account for approximately 36% of mutations. This study could only detect 52.5% of disease-causing mutations in this population; 47.5% of CF alleles remain to be identified, reflecting the high molecular heterogeneity of the Turkish population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Mutations 1677delTA, G542X and 2183AA→G have frequencies greater or equal to approximately 5%, whereas F1052V, 2043delG, D110H, N1303K, L571S and 296+9 A→T have frequencies of 2%. Login to comment
78 D110H 4 Asp→His at 110 G→C at 460 2 (1.64) Dean et al. 1990 8. Login to comment
124 Other mutations, namely F1052V, 2043delG, D110H, L571S and 296+9 A→T, have been detected with frequencies of 1.6% in Turkish CF chromosomes. Login to comment

[hide] Cystic fibrosis phenotype associated with pancreat... J Biol Chem. 1997 Nov 28;272(48):30563-6. Fanen P, Labarthe R, Garnier F, Benharouga M, Goossens M, Edelman A
Cystic fibrosis phenotype associated with pancreatic insufficiency does not always reflect the cAMP-dependent chloride conductive pathway defect. Analysis of C225R-CFTR and R1066C-CFTR.
J Biol Chem. 1997 Nov 28;272(48):30563-6., [PMID:9374552]

Abstract [show]
We have previously screened the cystic fibrosis transmembrane conductance regulator (CFTR) gene and identified new disease-causing mutations. C225R and R1066C are both associated with pancreatic insufficiency, but the former mutation is associated with mild and unusual lung disease, whereas the latter is associated with severe lung disease. In the present study, we expressed these mutants heterologously in HeLa cells, and we analyzed protein synthesis by immunoprecipitation and chloride channel function by using a halide-sensitive fluorescent dye, 6-methoxy-N-ethylquinolinium. Immunoprecipitation and functional studies showed that cells transfected with C225R-CFTR exhibit cAMP-dependent chloride fluxes; C225R-CFTR protein is poorly expressed but fully glycosylated and can be compared with R117H-CFTR. R1066C-CFTR protein is not correctly processed and, unlike DeltaF508-CFTR, this defect cannot be corrected by reduced temperature or overexpression in butyrate-treated cells; defective processing may occur at a different step in the biosynthetic pathway. These results point to two different mechanisms underlying the same pancreatic status and suggest that it is unwise to use pancreatic sufficiency and insufficiency to define mild and severe cystic fibrosis (CF) disease, respectively. Finally, the experimental model described here may be helpful to predict the pulmonary status of CF patients bearing mutations located in putative membrane-spanning domains of the CFTR protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
100 Five patients had pancreatic insufficiency while the sixth had normal pancreatic function and was a compound heterozygote for a mild mutation (D110H) (14). Login to comment

[hide] Distinct spectrum of CFTR gene mutations in congen... Hum Genet. 1997 Sep;100(3-4):365-77. Dork T, Dworniczak B, Aulehla-Scholz C, Wieczorek D, Bohm I, Mayerova A, Seydewitz HH, Nieschlag E, Meschede D, Horst J, Pander HJ, Sperling H, Ratjen F, Passarge E, Schmidtke J, Stuhrmann M
Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens.
Hum Genet. 1997 Sep;100(3-4):365-77., [PMID:9272157]

Abstract [show]
Congenital absence of the vas deferens (CAVD) is a frequent cause for obstructive azoospermia and accounts for 1%-2% of male infertility. A high incidence of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has recently been reported in males with CAVD. We have investigated a cohort of 106 German patients with congenital bilateral or unilateral absence of the vas deferens for mutations in the coding region, flanking intron regions and promotor sequences of the CFTR gene. Of the CAVD patients, 75% carried CFTR mutations or disease-associated CFTR variants, such as the "5T" allele, on both chromosomes. The distribution of mutation genotypes clearly differed from that observed in cystic fibrosis. None of the CAVD patients was homozygous for delta F508 and none was compound heterozygous for delta F508 and a nonsense or frameshift mutation. Instead, homozygosity was found for a few mild missense or splicing mutations, and the majority of CAVD mutations were missense substitutions. Twenty-one German CAVD patients were compound heterozygous for delta F508 and R117H, which was the most frequent CAVD genotype in our study group. Haplotype analysis indicated a common origin for R117H in our population, whereas another frequent CAVD mutation, viz. the "5T allele" was a recurrent mutation on different intragenic haplotypes and multiple ethnic backgrounds. We identified a total of 46 different mutations and variants, of which 15 mutations have not previously been reported. Thirteen novel missense mutations and one unique amino-acid insertion may be confined to the CAVD phenotype. A few splice or missense variants, such as F508C or 1716 G-->A, are proposed here as possible candidate CAVD mutations with an apparently reduced penetrance. Clinical examination of patients with CFTR mutations on both chromosomes revealed elevated sweat chloride concentrations and discrete symptoms of respiratory disease in a subset of patients. Thus, our collaborative study shows that CAVD without renal malformation is a primary genital form of cystic fibrosis in the vast majority of German patients and links the particular expression of clinical symptoms in CAVD with a distinct subset of CFTR mutation genotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 The V938G substitution was identified in two unrelated patients, one homozygote with unilateral ab- 368 Table 1A Frequency distribution and haplotypes of CFTR mutations in 106 CAVD patients Mutationa Nucleotide changesb Locationc Frequencyd Haplotypee Referencef 174delA deletion of A at 174 exon 1 1 D3 This study E56K G→A at 298 exon 3 1 B3 This study D58N G→A at 304 exon 3 1 C2 This study D110H G→A at 460 exon 4 2 C2 Dean et al. (1990) R117H G→A at 482 exon 4 24 B6 Dean et al. (1990) A120T G→A at 490 exon 4 1 n.p. Chillón et al. (1994) ̃L138 insertion of CTA after 546 exon 4 1 A2 This study L206W T→G at 749 exon 6a 1 B8 Claustres et al. (1993) M265R T→G at 926 exon 6b 1 A2 Schwarz et al. (pers. comm.) R297W C→T at 1021 exon 7 1 C2 This study 1078delT deletion of T at 1078 exon 7 1 C2 Claustres et al. (1992) R334W C→T at 1132 exon 7 1 B1 Gasparini et al. (1991) R334L G→T at 1133 exon 7 1 D3 This study I336K T→A at 1139 exon 7 1 A2 Cuppens et al. (1993) R347H G→A at 1172 exon 7 3 D1 Cremonesi et al. (1992) L375F A→C at 1257 exon 8 1 B3 Jézéquel et al. (1996) ∆F508 deletion of 3 bp between 1652-1655 exon 10 57 B1 Kerem et al. (1989) G542X G→T at 1756 exon 11 2 B1 Kerem et al. (1990) R553X C→T at 1789 exon 11 1 A4 Cutting et al. (1990) L568F G→T at 1836 exon 12 1 B3 This study 2184insA insertion of A at 2184 exon 13 1 D3 Dörk et al. (1994b) 2789+5 G→A G→A at 2789+5 intron 14b 4 D3 Highsmith et al. (1997) R933S A→T at 2931 exon 15 1 n.p. Login to comment
137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level. Login to comment
145 Maldigestion 13 25 5T/D58N 184 99 55 - 14 34 5T/̃L138 177 80 53 - 15 33 5T/1078delT 187 87 56 Recurrent bronchitis 16 31 5T/G542X 181 85 79 - 17 31 5T/2184insA n.d. n.d. 60 Borderline pancreatic sufficiency 18 31 5T/D979A n.d. n.d. 55 Recurrent infections, FEVI 76% 19 29 5T/D1152H n.d. n.d. 57 - 20 32 5T/W1282X 180 76 n.d. Recurrent infections, nasal polyposis 21 37 5T/unknown 180 74 n.d. Nasal polyposis 22 28 D110H/D110H 175 80 n.d Asthma bronchiale, obstipation 23 33 R334L/I336K 170 65 n.d. Recurrent infections, nasal polyposis, maldigestion, salt depletion episodes 24 35 N1303K/R347H 167 77 93 - 25 30 V938G/174delA n.d. n.d. 42 - 26 29 V938G/V938G 197 115 n.d. Asthma bronchiale Fig.2 Spectrum of CFTR mutation genotypes in CF patients (left) and in patients with congenital absence of the vas deferens (right). Login to comment
148 Whereas none of the males with isolated CAVD was homozygous for ∆F508, homozygosity was observed for four other mutations: one Lebanese and one Turkish male with CBAVD were homozygous for the mutations D110H and 2789+5 G→A, respectively, both of which had previously been identified as very mild CF mutations (Dean et al. 1990; Highsmith et al. 1997). Login to comment
196 Our analysis adds mutations D110H, 2789+5 G→A and V938G to the growing list of CFTR mutations that, in the homozygous state, can result in a restricted and primarily genital expression of disease. Login to comment

[hide] A novel cystic fibrosis mutation, Y109C, in the fi... Hum Mol Genet. 1994 Jun;3(6):1001-2. Schaedel C, Kristoffersson AC, Kornfalt R, Holmberg L
A novel cystic fibrosis mutation, Y109C, in the first transmembrane domain of CFTR.
Hum Mol Genet. 1994 Jun;3(6):1001-2., [PMID:7524909]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 Two other substitution mutations, D110H and R117H, have been reported in the same sequence (3). Login to comment

[hide] A new missense mutation (E92K) in the first transm... Hum Mol Genet. 1993 Jan;2(1):79-80. Nunes V, Chillon M, Dork T, Tummler B, Casals T, Estivill X
A new missense mutation (E92K) in the first transmembrane domain of the CFTR gene causes a benign cystic fibrosis phenotype.
Hum Mol Genet. 1993 Jan;2(1):79-80., [PMID:7683954]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 SSCP conditions for exon 4 of the CFTR gene, which allow discrimination of mutant and wild type alleles, were developed for several control mutations at this exon: D110H, R117H, 556delA and 621+ 1G-T (8, 9). Login to comment

[hide] Genetic determination of exocrine pancreatic funct... Am J Hum Genet. 1992 Jun;50(6):1178-84. Kristidis P, Bozon D, Corey M, Markiewicz D, Rommens J, Tsui LC, Durie P
Genetic determination of exocrine pancreatic function in cystic fibrosis.
Am J Hum Genet. 1992 Jun;50(6):1178-84., [PMID:1376016]

Abstract [show]
We showed elsewhere that the pancreatic function status of cystic fibrosis (CF) patients could be correlated to mutations in the CF transmembrane conductance regulator (CFTR) gene. Although the majority of CF mutations--including the most common, delta F508--strongly correlated with pancreatic insufficiency (PI), approximately 10% of the mutant alleles may confer pancreatic sufficiency (PS). To extend this observation, genomic DNA of 538 CF patients with well-documented pancreatic function status were analyzed for a series of known mutations in their CFTR genes. Only 20 of the 25 mutations tested were found in this population. They accounted for 84% of the CF chromosomes, with delta F508 being the most frequent (71%), and the other mutations accounted for less than 5% each. A total of 30 different, complete genotypes could be determined in 394 (73%) of the patients. The data showed that each genotype was associated only with PI or only with PS, but not with both. This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as delta F508, delta I507, Q493X, G542X, R553X, W1282X, 621 + 1G----T, 1717-1G----A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 Intron 10: 1717-1G-'A Exon 11: G542X .......... S549R ........... G551D .......... R553X .......... R560T .......... Exon 12: Y563N .......... P574H .......... Exon 19: 3659delC ....... Exon 20: W1282X ....... Exon 21: N1303K ..... G460-C A deletion G482-'A A deletion T575-C 621 + 1G-T C1132-T C1172- G C1496-A G1505-'T G1570-T C1609-T 3-bp deletion 3-bp deletion G1690-T G1717-1-A G1756-T T1779-G G1784- A C1789-T G1811-C T1819- A C1853- A C deletion G3978-A C4041-G Asp 110-His Frameshift Arg 117-His Frameshift Ile 148-Thr Splice mutation Arg 334-Trp Arg 347-Pro Ala 455- Glu Gly 458-'Val Gly480-Cys Gln 493- stop del of Ile 507 del of Phe 508 Val 520-Phe Splice mutation Gly 542- stop Ser 549-'Arg Gly 551-WAsp Arg 553- stop Arg 560- Thr Tyr 563- Asn Pro 574-His Frameshift Trp 1282-stop Asn 1303-Lys Dean et al. 1990 White et al. 1991 Dean et al. 1990 Zielenski et al. 1991a F. Rininsland, D. Bozon, and L.-C. Tsui, unpublished data Zielenski et al. 1991a Gasparini et al. 1991 Dean et al. 1990 Kerem et al. 1990b Cuppens et al. 1990 Strong et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1989b Jones et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Cutting et al. 1990 Cutting et al. 1990 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Vidaud et al. 1990 Osborne et al. 1990 PI or PS, but not with both. Login to comment
66 As shown in table 3, meconium ileus Table 2 1181 Table 3 Frequency of 25 CF Mutations in Chromosomes of the Toronto Study Population Mutation AF508 ...... G551D...... G542X...... 621 +1G-'T N1303K..... W1282X..... R1 17H...... 1717-1G-~A R560T...... A1507 ...... R553X...... V52OF ...... R334W ..... A455E...... I148T ...... Q493X...... P574H...... R347P ...... SS6delA ..... 3659delC .... G480C...... 444delA ..... D110H...... G458V...... S549R ...... Y563N...... Login to comment

[hide] Simultaneous screening for 11 mutations in the cys... Mol Cell Probes. 1992 Feb;6(1):33-9. Cuppens H, Buyse I, Baens M, Marynen P, Cassiman JJ
Simultaneous screening for 11 mutations in the cystic fibrosis transmembrane conductance regulator gene by multiplex amplification and reverse dot-blot.
Mol Cell Probes. 1992 Feb;6(1):33-9., [PMID:1372093]

Abstract [show]
An assay is described in which 11 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene can be screened simultaneously. Six different exons of the CFTR gene are amplified in a single multiplex amplification. Biotinylated dUTP is incorporated into the different fragments during the amplification process. A sample of this mixture is then hybridized to 21 different poly-dT tailed oligonucleotide probes which are bound to a nylon membrane. In order to screen the different mutations in a single step hybridization, the length of the different oligonucleotides and the amount used in the assay were optimized. The detection is performed by binding avidin-alkaline phosphatase to the biotin, followed by a chemiluminescent reaction. By means of this fast and sensitive assay, about 85% of all the cystic fibrosis mutations in the Belgian population can be detected.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
19 Frequency of 31 mutations in the CFTR gene in 194 Belgian CF chromosomes The 51255X, W1316X ;5 S549N, G551D, R553X, A559T;6 D110H, R117H, R347P;' Q493X, S5491, S549R(T-+G), R560T, Y563N, P574H ;9 W846X, Y913C;10 2556insAT;" R334W;" S549R(A-+C);'6 444delA, 3821deIT;" 621 +1G-*T18 mutations were not present in this random sample of the Belgian CF population . Login to comment

[hide] A 96-well formatted method for exon and exon/intro... Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5. Lucarelli M, Narzi L, Piergentili R, Ferraguti G, Grandoni F, Quattrucci S, Strom R
A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene.
Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5., [PMID:16635477]

Abstract [show]
Full genotypic characterization of subjects affected by cystic fibrosis (CF) is essential for the definition of the genotype-phenotype correlation as well as for the enhancement of the diagnostic and prognostic value of the genetic investigation. High-sensitivity diagnostic methods, capable of full scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, are needed to enhance the significance of these genetic assays. A method for extensive sequencing of the CFTR gene was optimized. This method was applied to subjects clinically positive for CF and to controls from the general population of central Italy as well as to a single subject heterozygous for a mild mutation and with an uncertain diagnosis. Some points that are crucial for the optimization of the method emerged: a 96-well format, primer project and purification, and amplicon purification. The optimized method displayed a high degree of diagnostic sensitivity; we identified a subset of 13 CFTR mutations that greatly enhanced the diagnostic sensitivity of common methods of mutational analysis. A novel G1244R disease causing mutation, leading to a CF phenotype with pancreatic sufficiency but early onset of pulmonary involvement, was detected in the subject with an uncertain diagnosis. Some discrepancies between our results and previously published CFTR sequence were found.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 In this work, we found a limited subset of 13 mutations (not included in the PCR/OLA/SCS assay) in 7 CFTR exons, significantly improving the sensitivity of standard assays: D110H, R117C, and H139R (exon 4); R334L, T338I, and A349V (exon 7); S549R(A->C) (exon 11); Y849X (exon 14a); L997F (exon 17a); L1065P, R1066C, and L1077P (exon 17b); and G1244E (exon 20). Login to comment

[hide] Newborn screening for cystic fibrosis in Alberta: ... Paediatr Child Health. 2010 Nov;15(9):590-4. Lilley M, Christian S, Hume S, Scott P, Montgomery M, Semple L, Zuberbuhler P, Tabak J, Bamforth F, Somerville MJ
Newborn screening for cystic fibrosis in Alberta: Two years of experience.
Paediatr Child Health. 2010 Nov;15(9):590-4., [PMID:22043142]

Abstract [show]
On April 1, 2007, Alberta became the first province in Canada to introduce cystic fibrosis (CF) to its newborn screening program. The Alberta protocol involves a two-tier algorithm involving an immunoreactive trypsinogen measurement followed by molecular analysis using a CF panel for 39 mutations. Positive screens are followed up with sweat chloride testing and an assessment by a CF specialist. Of the 99,408 newborns screened in Alberta during the first two years of the program, 221 had a positive CF newborn screen. The program subsequently identified and initiated treatment in 31 newborns with CF. A relatively high frequency of the R117H mutation and the M1101K mutation was noted. The M1101K mutation is common in the Hutterite population. The presence of the R117H mutation has created both counselling and management dilemmas. The ability to offer CF transmembrane regulator full sequencing may help resolve diagnostic dilemmas. Counselling and management challenges are created when mutations are mild or of unknown clinical significance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
124 Due to milder TAbLe 4 Cystic fibrosis transmembrane regulator full screen results for inconclusive cases with borderline and elevated sweat chloride results ID Sweat chloride, bc;mol/L IRT, bc;g/L 1st mutation 2nd mutation Mutation description (reference) 14920 67/72 194 F508del D110H Associated with mild or atypical CF (5) 14490 105 271 F508del W1204X Rare but associated with classic CF (6) 15810 95 162 1717G࢐A Exon 2-3 del Associated with classic CF (7) 17167 110 178 F508del Not sequenced N/A 15905 40 94 3849+10kb 2789+1G࢐A Not previously reported. Login to comment
142 Three mutations (D110H, L206W and 5T) were identified that are associated with a mild or variable phenotype. Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
87 Similarly, the baseline chloride transport and ivacaftor response were higher for mutant CFTR forms with mild defects in channel conductance (30-84% of normal; D110H-, R347H, and R352Q-CFTR) [17-19], compared with those with severe defects in CFTR channel conductance (undetectable R334W- and T338I-CFTR) [9,20]. Login to comment
92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3. Login to comment

[hide] Ivacaftor: a review of its use in patients with cy... Drugs. 2013 Sep;73(14):1595-604. doi: 10.1007/s40265-013-0115-2. Deeks ED
Ivacaftor: a review of its use in patients with cystic fibrosis.
Drugs. 2013 Sep;73(14):1595-604. doi: 10.1007/s40265-013-0115-2., [PMID:24030637]

Abstract [show]
Ivacaftor (Kalydeco) is a potentiator of the cystic fibrosis transmembrane conductance regulator (CFTR) and is the first drug that treats an underlying cause of cystic fibrosis to be licensed for use. Ivacaftor increases the open probability (i.e. gating) of CFTR channels with the G551D mutation, thus enhancing chloride transport, and is indicated in a number of countries for the treatment of cystic fibrosis in patients aged >/=6 years who carry this mutation. This review focuses on pharmacological, clinical efficacy and tolerability data relevant to the use of ivacaftor in this indication. In two 48-week, double-blind, phase III trials in patients aged >/=12 (STRIVE) or 6-11 (ENVISION) years with cystic fibrosis and the G551D mutation, oral ivacaftor 150 mg every 12 h significantly improved lung function relative to placebo, when used in combination with standard care. Significant improvements in pulmonary exacerbation risk (in STRIVE) as well as bodyweight and some aspects of health-related quality of life (both studies) were also seen with the drug versus placebo. Moreover, the beneficial effects of ivacaftor on parameters such as lung function and bodyweight were maintained over up to 96 weeks of treatment in an ongoing open-label extension of these studies. Ivacaftor was generally well tolerated, with headache, oropharyngeal pain, upper respiratory tract infection and nasal congestion being among the most common adverse events. Thus, ivacaftor expands the current treatment options for patients with cystic fibrosis who have the G551D mutation. Its potential for use in patients with other CFTR mutations is also of interest.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 Further in vitro data suggest that other CFTR proteins with residual function may also be potentiated by ivacaftor, including those with mutations that affect conductance (e.g. R117H, D110H), mildly affect CFTR processing (e.g. E56K, P67L) or have uncharacterized effects (e.g. D110E, S1235R) [5, 16]. Login to comment

[hide] Neonatal screening for cystic fibrosis: comparing ... J Cyst Fibros. 2014 Jul;13(4):384-90. doi: 10.1016/j.jcf.2014.01.004. Epub 2014 Feb 7. Sarles J, Giorgi R, Berthezene P, Munck A, Cheillan D, Dagorn JC, Roussey M
Neonatal screening for cystic fibrosis: comparing the performances of IRT/DNA and IRT/PAP.
J Cyst Fibros. 2014 Jul;13(4):384-90. doi: 10.1016/j.jcf.2014.01.004. Epub 2014 Feb 7., [PMID:24513262]

Abstract [show]
BACKGROUND: French health authorities promoted a study on 553,167 newborns comparing the performances of IRT/DNA and IRT/PAP for CF newborn screening. METHODS: In parallel to IRT/DNA, PAP was assayed in newborns with IRT>50 mug/L. Provisional PAP cutoffs at 3.0 mug/L when 50<IRT<100 mug/L and 1.7 mug/L when IRT>100 were used. Positive newborns were subjected to sweat test. Optimal cutoffs were established by a non-inferiority method. RESULTS: 95 CF newborns were identified (83 classical forms (ClF), including 9 meconium ileus (MI), and 12 atypical (mild) forms (AF) Of them, IRT/DNA identified 85 (73 ClF including 5 MI and 12 AF). PAP cutoffs at 1.8 mug/L when 50< IRT<100 mug/L and 0.6 mug/L when IRT>100 mug/L would identify 82 CF: 77 ClF, including 8 MI, and 5 AF. The number of sweat tests was 314 and 1039 in the IRT/DNA and IRT/PAP strategies, respectively. CONCLUSIONS: Using the optimal cutoffs, the sensitivity of the IRT/PAP strategy would not be inferior to that of IRT/DNA if identification of MF is not required.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
158 IRT d3 Ctrl IRT PAP Cl- Mut 1 Mut 2 1 66 68 0.4 80 ƊF508del ƊF508del 2 87.8 106.5 0.5 137 E1104X E1104X 3 93.2 105.8 0.8 82 G91R ƊF508del 4 71.1 56.7 0.3 80.0 ƊF508del ƊF508del 5 67.9 54.4 1.5 99.0 ƊF508del ƊF508del 6 87.1 82.9 4.5 70.0 E1104X D110H 7 61.5 62 5.0 88.0 R553X A455E 8 62.4 63.0 14.6 110.0 2183AANG 907delCins11 9 117.0 81.5 15.6 130.0 S466X S466X Lines 1-3: false negatives in the IRT/PAP strategy, 6-9: false negatives in the IRT/DNA strategy, due to mutations not detected by the Elucigeneࡊ CF30, 45: false negatives in both strategies. Login to comment

[hide] Three charged amino acids in extracellular loop 1 ... J Gen Physiol. 2014 Aug;144(2):159-79. doi: 10.1085/jgp.201311122. Epub 2014 Jul 14. Cui G, Rahman KS, Infield DT, Kuang C, Prince CZ, McCarty NA
Three charged amino acids in extracellular loop 1 are involved in maintaining the outer pore architecture of CFTR.
J Gen Physiol. 2014 Aug;144(2):159-79. doi: 10.1085/jgp.201311122. Epub 2014 Jul 14., [PMID:25024266]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) bears six extracellular loops (ECL1-6); ECL1 is the site of several mutations associated with CF. Mutation R117H has been reported to reduce current amplitude, whereas D110H, E116K, and R117C/L/P may impair channel stability. We hypothesized that these amino acids might not be directly involved in ion conduction and permeation but may contribute to stabilizing the outer vestibule architecture in CFTR. We used cRNA injected oocytes combined with electrophysiological techniques to test this hypothesis. Mutants bearing cysteine at these sites were not functionally modified by extracellular MTS reagents and were blocked by GlyH-101 similarly to WT-CFTR. These results suggest that these three residues do not contribute directly to permeation in CFTR. In contrast, mutants D110R-, E116R-, and R117A-CFTR exhibited instability of the open state and significantly shortened burst duration compared with WT-CFTR and failed to be locked into the open state by AMP-PNP (adenosine 5'-(beta,gamma-imido) triphosphate); charge-retaining mutants showed mainly the full open state with comparably longer open burst duration. These interactions suggest that these ECL1 residues might be involved in maintaining the outer pore architecture of CFTR. A CFTR homology model suggested that E116 interacts with R104 in both the closed and open states, D110 interacts with K892 in the fully closed state, and R117 interacts with E1126 in the open state. These interactions were confirmed experimentally. The results suggest that D110, E116, and R117 may contribute to stabilizing the architecture of the outer pore of CFTR by interactions with other charged residues.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Mutation R117H has been reported to reduce current amplitude, whereas D110H, E116K, and R117C/L/P may impair channel stability. Login to comment
31 H&#e4;mmerle et al. (2001) reported that mutations D110H, E116K, and R117H induce no trafficking defect when expressed in baby hamster kidney (BHK) cells but affect channel function significantly. Login to comment
32 When studied in planar lipid bilayers, R117H-CFTR had gating kinetics similar to WT-CFTR, but a reduced single-channel conductance, whereas D110H- and E116K- CFTR displayed unstable channel openings, leading the authors to propose that ECL1 might contribute to maintaining the open pore architecture of CFTR (H&#e4;mmerle et al., 2001). Login to comment
36 CF-causing mutations have been identified in ECL1, including S108F, Y109C/N, D110H/ Y/N,P111A/L,E116K/Q,andR117C/G/H/P/L.Among these residues, D110, E116, and R117 are charged amino acids fully conserved among nine species (Fig. 1 A). Login to comment

[hide] Mechanisms of CFTR functional variants that impair... PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul. LaRusch J, Jung J, General IJ, Lewis MD, Park HW, Brand RE, Gelrud A, Anderson MA, Banks PA, Conwell D, Lawrence C, Romagnuolo J, Baillie J, Alkaade S, Cote G, Gardner TB, Amann ST, Slivka A, Sandhu B, Aloe A, Kienholz ML, Yadav D, Barmada MM, Bahar I, Lee MG, Whitcomb DC
Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.
PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul., [PMID:25033378]

Abstract [show]
CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
346 First, almost all CF-causing mutations involving residues located in the MSD transmembrane segments are encountered in MSD1 and generally concern positions lining the pore (G85E, E92K, D110H, P205S, R334W, I336K, T338I, S341P, R347H/R347P, and R352Q) (Fig. 7a). Login to comment
354 Finally, two CF-causing mutations involve amino acids which are implied in salt bridges: (1) D110 in TM2 (mutation D110H; salt bridge with R1128, distances of 4.0 and 5.0 A da; ) and (2) R334 in ECL3 (mutation R334W; salt bridge with D891, distances of 3.8 and 4.4 A da; ) (Fig. 7b). Login to comment

[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]

Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17]. Login to comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment
74 However, the sensitivity of the IRT/NGS algorithm would have decreased as much as 50% for classic CF cases when a positive screen is defined as two CF-causing mutations because of uncommon mutations found in five patients Table 2ߒ Cases with a second mutation detected from the next-generation sequencing panel Case no. IRT (ng/ml) Second-tier DNA Additional mutation Sweat chloride (mmol/l) Clinical assessmenta Test 1 Test 2 1 64 F508del D110H 71.4 67.1 CF 2 327 F508del Q1313X N/A N/A CF 3 297 F508del Q1313X N/A N/A CF 4 71 R117H (7T) R347H 45.2 41.5 CRMSb 5 148 F508del R117C 40 38 CRMSb 6 66 F508del 5Tc 36.9 30.8 CRMSb 7 147 F508del D1152Hc 27.9 24.6 CRMSb 8 121 F508del D1152Hc 11 QNS Carrier 9 176 F508del D1152Hc 24 26 Carrier CF, cystic fibrosis; CRMS, CFTR-related metabolic syndrome; IRT, immunoreactive trypsinogen; QNS, quantity not sufficient. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
163 (A) Frequencies of mutated genotypes, with a prevalence ࣙ0.006 in the CF (PI + PS) population, are reported in frequency decreasing order according to CF (PI + PS); the last genotype with a prevalence = 0.008 in the CF (PI + PS) population is the F508del/D110H (p.[Phe508del];[Asp110His]). Login to comment
286 These patients had the following mutations on the other allele: F508del (p.Phe508del) (3 CF-PS and 1 CFTR-RD), W1282X (p.Trp1282*) (2 CF-PS), Q779X (p.Gln779*) (2 CF-PS siblings), D110H (p.Asp110His) (1 CF-PS), D614G (p.Asp614Gly) (1 CF-PS), unknown (1 CBAVD). Login to comment
290 [1210-14TG[11];1210-12T[5]]), with no other mutations in cis, was found in 1 CFTR-RD patient and 1 CBAVD patient with, respectively, the 3849+10kbC>T (c.3717+12191C>T) and the D110H (p.Asp110His) mutations on the other allele. Login to comment
366 [227_228insT;1210-14TG[12];1210-12T[5]] uncertain: CF-PI and/or CF-PS and/or CFTR-RD 359insT nd; T5 varying clinical consequence G85E c.254G>A CF-PI,CF-PS CF-causing p.Gly85Glu D110H c.328G>C CF-PS CF-causing p.Asp110His R117C c.349C>T CF-PS CF-causing p.Arg117Cys R117H c.350G>A CFTR-RD varying clinical consequence p.Arg117His [R117L;L997F] c. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment
92 Well known examples include missense variants D110H, R117C, L206W, R347P, R347H, R1066H, or splice variants that produce both aberrant and full-length transcript such as 3849+10kbC4T, 2789+5G4A, 3272-26 A4G, 711+3 A4G. Login to comment

[hide] Single-cell high resolution melting analysis: A no... J Cyst Fibros. 2015 Oct 19. pii: S1569-1993(15)00217-9. doi: 10.1016/j.jcf.2015.09.009. Destouni A, Poulou M, Kakourou G, Vrettou C, Tzetis M, Traeger-Synodinos J, Kitsiou-Tzeli S
Single-cell high resolution melting analysis: A novel, generic, pre-implantation genetic diagnosis (PGD) method applied to cystic fibrosis (HRMA CF-PGD).
J Cyst Fibros. 2015 Oct 19. pii: S1569-1993(15)00217-9. doi: 10.1016/j.jcf.2015.09.009., [PMID:26493493]

Abstract [show]
BACKGROUND: Institutions offering CF-PGD face the challenge of developing and optimizing single cell genotyping protocols that should cover for the extremely heterogeneous CF mutation spectrum. Here we report the development and successful clinical application of a generic CF-PGD protocol to facilitate direct detection of any CFTR nucleotide variation(s) by HRMA and simultaneous confirmation of diagnosis through haplotype analysis. METHODS: A multiplex PCR was optimized supporting co-amplification of any CFTR exon-region, along with 6 closely linked STRs. Single cell genotypes were established through HRM analysis following melting of the 2nd round PCR products and were confirmed by STR haplotype analysis of the 1st PCR products. The protocol was validated pre-clinically, by testing 208 single lymphocytes, isolated from whole blood samples from 4 validation family trios. Fifteen PGD cycles were performed and 103 embryos were biopsied. RESULTS: In 15 clinical PGD cycles, genotypes were achieved in 88/93 (94.6%) embryo biopsy samples, of which 57/88 (64.8%) were deemed genetically suitable for embryo transfer. Amplification failed at all loci for 10/103 blastomeres biopsied from poor quality embryos. Six clinical pregnancies were achieved (2 twin, 4 singletons). PGD genotypes were confirmed following conventional amniocentesis or chorionic villus sampling in all achieved pregnancies. CONCLUSIONS: The single cell HRMA CF-PGD protocol described herein is a flexible, generic, low cost and robust genotyping method, which facilitates the analysis of any CFTR genotype combination. Single-cell HRMA can be beneficial to other clinical settings, for example the detection of single nucleotide variants in single cells derived from clinical tumor samples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 Validation case no. Genotype combination (HGVS CFTR reference sequences NM000492.3 and NG016465.1) Light scanner (LSC) exons (Montgomery et al. 2007) Number of cells tested Amplicons in multiplex RxNa PCR efficiency (%) Overall ADO (%) 1 p.Arg334Gln and c.489+3ANG 7.2 and 4.2 48 8 98.85% 2% 2 p.Phe508del and p.Leu732X 10 and 13.3 60 8 98% 1.66% 3 p.Phe508del and p.Asp110His 10 and 4.1 60 8 96.60% 3.33% 4 p.Phe508del and p.Gly542X 10 and 11 40 8 98% 3% Total lymphocytes tested 208 a RxN: reaction, ADO: allele drop-out 3 The mutation p.Phe508del could otherwise more rapidly be detected by fluorescent fragment analysis by incorporating the relevant primer set in the first PCR. Login to comment

[hide] Newborn Screening for Cystic Fibrosis in Californi... Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16. Kharrazi M, Yang J, Bishop T, Lessing S, Young S, Graham S, Pearl M, Chow H, Ho T, Currier R, Gaffney L, Feuchtbaum L
Newborn Screening for Cystic Fibrosis in California.
Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16., [PMID:26574590]

Abstract [show]
OBJECTIVES: This article describes the methods used and the program performance results for the first 5 years of newborn screening for cystic fibrosis (CF) in California. METHODS: From July 16, 2007, to June 30, 2012, a total of 2 573 293 newborns were screened for CF by using a 3-step model: (1) measuring immunoreactive trypsinogen in all dried blood spot specimens; (2) testing 28 to 40 selected cystic fibrosis transmembrane conductance regulator (CFTR) mutations in specimens with immunoreactive trypsinogen values >/=62 ng/mL (top 1.6%); and (3) performing DNA sequencing on specimens found to have only 1 mutation in step 2. Infants with >/=2 mutations/variants were referred to CF care centers for diagnostic evaluation and follow-up. Infants with 1 mutation were considered carriers and their parents offered telephone genetic counseling. RESULTS: Overall, 345 CF cases, 533 CFTR-related metabolic syndrome cases, and 1617 carriers were detected; 28 cases of CF were missed. Of the 345 CF cases, 20 (5.8%) infants were initially assessed as having CFTR-related metabolic syndrome, and their CF diagnosis occurred after age 6 months (median follow-up: 4.5 years). Program sensitivity was 92%, and the positive predictive value was 34%. CF prevalence was 1 in 6899 births. A total of 303 CFTR mutations were identified, including 78 novel variants. The median age at referral to a CF care center was 34 days (18 and 37 days for step 2 and 3 screening test-positive infants, respectively). CONCLUSIONS: The 3-step model had high detection and low false-positive levels in this diverse population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 Second mutation not detected by using DNA sequencing 5 c.1521_1523delCTT (F508del)/ (Ex6b_10dup) White (n = 3) Meconium ileus (n = 4) c.1652G.A (G551D)/ c.3964-78_4242+577del (CFTRdel22,23) Hispanic (n = 1) Family history (n = 2) c.1519_1521delATC (I507del)/ c.1680-877G.Tc Unknown (n = 1) Symptoms (n = 3) c.1521_1523delCTT (F508del)/ c.328G.C (D110H)d c.1521_1523delCTT (F508del)/ (mutation not identified) cDNA, complementary DNA. Login to comment