ABCMdb

ABCC7 p.Ser549Asn

Admin's notes:	Class III (gating defect) Veit et al.
ClinVar:	c.1647T>G , p.Ser549Arg D , Pathogenic c.1645A>C , p.Ser549Arg D , Pathogenic c.1646G>T , p.Ser549Ile D , Pathogenic
CF databases:	c.1646G>A , p.Ser549Asn D , CF-causing ; CFTR1: c.1645A>C or c.1647T>G , p.Ser549Arg D , CF-causing ; CFTR1: ; CFTR1: The CF chromosome with this mutation is carried by a non-Ashkenazic Jewish patient in Morocco. The chromosome also has the B haplotype. Detection of this mutation may be achieved by ASO hybridization or allele-specific PCR. c.1646G>T , p.Ser549Ile (CFTR1) ? , This mutation destroys a Ddel site, similar to G549N, and therefore one cannot distinguish the two by Ddel digestion.
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (59%), K: D (95%), L: D (95%), M: D (95%), N: N (72%), P: D (95%), Q: D (95%), R: N (57%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

III (gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Proportion of cystic fibrosis gene mutations not d... JAMA. 1999 Jun 16;281(23):2217-24. Mak V, Zielenski J, Tsui LC, Durie P, Zini A, Martin S, Longley TB, Jarvi KA
Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia.
JAMA. 1999 Jun 16;281(23):2217-24., 1999-06-16 [PMID:10376575]

Abstract [show]
CONTEXT: Infertile men with obstructive azoospermia may have mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, many of which are rare in classic cystic fibrosis and not evaluated in most routine mutation screening. OBJECTIVE: To assess how often CFTR mutations or sequence alterations undetected by routine screening are detected with more extensive screening in obstructive azoospermia. DESIGN: Routine screening for the 31 most common CFTR mutations associated with the CF phenotype in white populations, testing for the 5-thymidine variant of the polythymidine tract of intron 8 (IVS8-5T) by allele-specific oligonucleotide hybridization, and screening of all exons through multiplex heteroduplex shift analysis followed by direct DNA sequencing. SETTING: Male infertility clinic of a Canadian university-affiliated hospital. SUBJECTS: Of 198 men with obstructive (n = 149) or nonobstructive (n = 49; control group) azoospermia, 64 had congenital bilateral absence of the vas deferens (CBAVD), 10 had congenital unilateral absence of the vas deferens (CUAVD), and 75 had epididymal obstruction (56/75 were idiopathic). MAIN OUTCOME MEASURE: Frequency of mutations found by routine and nonroutine tests in men with obstructive vs nonobstructive azoospermia. RESULTS: Frequency of mutations and the IVS8-5T variant in the nonobstructive azoospermia group (controls) (2% and 5.1% allele frequency, respectively) did not differ significantly from that in the general population (2% and 5.2%, respectively). In the CBAVD group, 72 mutations were found by DNA sequencing and IVS8-5T testing (47 and 25, respectively; P<.001 and P = .002 vs controls) vs 39 by the routine panel (P<.001 vs controls). In the idiopathic epididymal obstruction group, 24 mutations were found by DNA sequencing and IVS8-5T testing (12 each; P=.01 and P=.14 vs controls) vs 5 by the routine panel (P=.33 vs controls). In the CUAVD group, 2 mutations were found by routine testing (P=.07 vs controls) vs 4 (2 each, respectively; P=.07 and P=.40 vs controls) by DNA sequencing and IVS8-5T testing. The routine panel did not identify 33 (46%) of 72, 2 (50%) of 4, and 19 (79%) of 24 detectable CFTR mutations and IVS8-5T in the CBAVD, CUAVD, and idiopathic epididymal obstruction groups, respectively. CONCLUSIONS: Routine testing for CFTR mutations may miss mild or rare gene alterations. The barrier to conception for men with obstructive infertility has been overcome by assisted reproductive technologies, thus raising the concern of iatrogenically transmitting pathogenic CFTR mutations to the progeny.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 Analysis for 31 of the most common CFTR mutations found within the white CF population,60 consisting of ⌬F508, W1282X, G542X, G551D, N1303K, R553X, G85E, R117H, S549N, V520F, R334W, A455E, R347P, R1162X, Y122X, S549R, 621+1G→T, ⌬I507, R560T, R347H, 3659delC, Q493X, 1898+1G→T, 711+1G→T, 3849+10C→T, 1717-1G→A, 3849+4A→G, 3905insT, 1078delT, 2183AA→G, and 2789+5G→A. Briefly, the technique involved amplification by polymerase chain reaction61 of the relevant exons, followed by digestion with appropriate restriction endonucleases and acrylamide gel electrophoresis with ethidium bromide staining. Login to comment

[hide] Two buffer PAGE system-based SSCP/HD analysis: a g... Eur J Hum Genet. 1999 Jul;7(5):590-8. Liechti-Gallati S, Schneider V, Neeser D, Kraemer R
Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease.
Eur J Hum Genet. 1999 Jul;7(5):590-8., [PMID:10439967]

Abstract [show]
The large size of many disease genes and the multiplicity of mutations complicate the design of an adequate assay for the identification of disease-causing variants. One of the most successful methods for mutation detection is the single strand conformation polymorphism (SSCP) technique. By varying temperature, gel composition, ionic strength and additives, we optimised the sensitivity of SSCP for all 27 exons of the CFTR gene. Using simultaneously SSCP and heteroduplex (HD) analysis, a total of 80 known CF mutations (28 missense, 22 frameshift, 17 nonsense, 13 splicesite) and 20 polymorphisms was analysed resulting in a detection rate of 97.5% including the 24 most common mutations worldwide. The ability of this technique to detect mutations independent of their nature, frequency, and population specificity was confirmed by the identification of five novel mutations (420del9, 1199delG, R560S, A613T, T1299I) in Swiss CF patients, as well as by the detection of 41 different mutations in 198 patients experimentally analysed. We present a three-stage screening strategy allowing analysis of seven exons within 5 hours and analysis of the entire coding region within 1 week, including sequence analysis of the variants. Additionally, our protocol represents a general model for point mutation analysis in other genetic disorders and has already been successfully established for OTC deficiency, collagene deficiency, X-linked myotubular myopathy (XLMTM), Duchenne and Becker muscular dystrophy (DMD, BMD), Wilson disease (WD), Neurofibromatosis I and II, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, and defects in mitochondrial DNA. No other protocol published so far presents standard SSCP/HD conditions for mutation screening in different disease genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Intron 19, all 27 exons and their exon-intron boundaries, including the 24 most common mutations worldwide (G85E, R117H, 621 + 1G- > T, 711 + 1G- > T, 1078delT, R334W, R347P, A455E, I507, F508, 1717-1G- > A, G542X, S549N, G551D, R553X, R560T, 1898 + 1G- > A, 2184delA, 2789 + 5G- > A, R1162X, 3659delC, 3849 + 10kbC- > T, W1282X, N1303K) (Cystic Fibrosis Genetic Analysis Consortium 1994), and the 15 most common mutations in our population (I148T, 1078delT, R334W, R347P, F508, 1717-1G- > A, G542X, R553X, 2347delG, D1152H, R1162X, 3849 + 10kbC- > T, 3905insT, W1282X, N1303K), were considered in this study. Login to comment
61 The slots C present wild type (wt) sequences, 1-8 present amplification products from CF patients with the following genotypes: 1 = R553X/R553X; 2 = 1717-1G- > A/wt; 3 = R553X/wt; 4 = G542X/wt; 5 = G542X/1717-1G- > A; 6 = G551D/wt; 7 = R560T/wt; 8 = S549N/wt. Login to comment

[hide] Partial CFTR genotyping and characterisation of cy... Clin Genet. 2000 Jan;57(1):56-60. Zebrak J, Skuza B, Pogorzelski A, Ligarska R, Kopytko E, Pawlik J, Rutkiewicz E, Witt M
Partial CFTR genotyping and characterisation of cystic fibrosis patients with myocardial fibrosis and necrosis.
Clin Genet. 2000 Jan;57(1):56-60., [PMID:10733236]

Abstract [show]
Myocardial necrosis and fibrosis is a rare complication of cystic fibrosis (CF) causing sudden and unexpected death in infancy due to cardiac arrest. Characteristic morphological lesions are recognisable postmortem. The 18 CF patients with this complication had varied clinical features including mild pulmonary involvement, early onset severe pancreatic insufficiency, and profound electrocardiogram (ECG) changes. In this group of patients, 5 were deltaF508 homozygotes, 1 was deltaF508/ N1303K and 1 was a deltaF508/M compound heterozygote. A pair of affected siblings (deltaF508 homozygotes) were fully concordant for myocardial involvement and for the general course of the disease. The co-existence of a genetic predisposition to myocardial lesions resulting most probably from severe cystic fibrosis transmembrane (CFTR) genotypes (such as deltaF508/deltaF508, deltaF508/N1303K) and deficiency of certain trophic factors necessary for metabolism of the myocardium, are postulated to cause myocardial complications in CF leading to circulatory failure and early death.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 The latter was negative for 14 other mutations: DI507, 1717-1GA, G542X, G551D, R553X, R560T, 3849+10kbCT, N1303K, W1282X, S549I, S549N, 621+1GT, 2789+5GA, R117H. Login to comment

[hide] Spectrum of CFTR mutations in Mexican cystic fibro... Hum Genet. 2000 Mar;106(3):360-5. Orozco L, Velazquez R, Zielenski J, Tsui LC, Chavez M, Lezana JL, Saldana Y, Hernandez E, Carnevale A
Spectrum of CFTR mutations in Mexican cystic fibrosis patients: identification of five novel mutations (W1098C, 846delT, P750L, 4160insGGGG and 297-1G-->A).
Hum Genet. 2000 Mar;106(3):360-5., [PMID:10798368]

Abstract [show]
We have analyzed 97 CF unrelated Mexican families for mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Our initial screening for 12 selected CFTR mutations led to mutation detection in 56.66% of the tested chromosomes. In patients with at least one unknown mutation after preliminary screening, an extensive analysis of the CFTR gene by single stranded conformation polymorphism (SSCP) or by multiplex heteroduplex (mHET) analysis was performed. A total of 34 different mutations representing 74.58% of the CF chromosomes were identified, including five novel CFTR mutations: W1098C, P750L, 846delT, 4160insGGGG and 297-1G-->A. The level of detection of the CF mutations in Mexico is still lower than that observed in other populations with a relatively low frequency of the deltaF508 mutation, mainly from southern Europe. The CFTR gene analysis described here clearly demonstrated the high heterogeneity of our CF population, which could be explained by the complex ethnic composition of the Mexican population, in particular by the strong impact of the genetic pool from southern European countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 R553X, G551D, S549N, R1162X, and 3120+1G→A were tested by PCR-based restriction analysis as previously described (Osborne et al. 1992; Jones et al. 1992; Picci et al. 1992; Shoshani et al. 1992). Login to comment
41 The second most common mutation was G542X, present in 6.1% of CF chromosomes, followed by ∆I507 and S549N (each 2.5%), N1303K (2.06%) and 2055del→A (1.03%). Login to comment
69 First, we tested these patients for 12 mutations selected for the following reasons: five are the most common mutations worldwide (∆F508, G542X, N1303K, G551D and R553X; CFGAC 1994); 362 Table 1 Frequency of the CFTR gene mutations in 97 (194 chromosomes) Mexican patients Mutation Number of Frequency affected alleles (%) ∆F508 79 40.72 G542X 12 6.18 ∆I507 5 2.57 S549N 5 2.57 N1303K 4 2.06 R75X 3 1.54 406-1G→A 3 1.54 I148T 3 1.54 2055del9→A 2 1.03 935delA 2 1.03 I506T 2 1.03 3199del6 2 1.03 2183AA→G 2 1.03 G551D 1 0.51 R553X 1 0.51 1924del7 1 0.51 G551S 1 0.51 1078delT 1 0.51 Y1092X 1 0.51 R117H 1 0.51 G85E 1 0.51 3849+10KbC→T 1 0.51 1716G→A 1 0.51 W1204X 1 0.51 W1098Ca 1 0.51 846delTa 1 0.51 P750La 1 0.51 V754M 1 0.51 R75Q 1 0.51 W1069X 1 0.51 L558S 1 0.51 4160insGGGGa 1 0.51 297-1G→Aa 1 0.51 H199Y 1 0.51 2869insG 0 0 R1162X 0 0 3120+1G→A 0 0 Total 34 145 74.58% aNovel mutations detected in this study Fig.1 Sequencing ladders showing the CFTR novel mutations. Login to comment
70 a W1098C (antisense), b P750L (antisense), c 846delT (antisense), d 4160insGGGG (antisense), e 297-1GA (antisense) three mutations were found in our population during a preliminary screening by SSCP (S549N, 2055del9→A and 1924del7; Orozco et al. 1997); ∆I507 was found during the screening for ∆F508 (Orozco et al. 1994); and three mutations described at least once in Hispanic populations (R1162X, 2869insG; Casals et al. 1997; 3120+ 1G→A; CFGAC 1994). Login to comment
77 It is noteworthy that the S549N mutation was relatively frequent in our patients (2.5%) whereas its worldwide frequency is below 0.1%, and it was absent in a sample of 640 Spanish CF families (Casals et al. 1997), and in 114 Argentinean families (Chertkoff et al. 1997). Login to comment

[hide] A hypothesis regarding the origin and spread of th... QJM. 2000 May;93(5):313-5. Dawson KP, Frossard PM
A hypothesis regarding the origin and spread of the cystic fibrosis mutation deltaF508.
QJM. 2000 May;93(5):313-5., [PMID:10825408]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Indirect supporting large Asian population sample and occurrence of a evidence for this hypothesis may be found in the homozygous S549N mutation in an inbred Pakistani family. Login to comment

[hide] Effect of genistein on native epithelial tissue fr... Br J Pharmacol. 2000 Aug;130(8):1884-92. Mall M, Wissner A, Seydewitz HH, Hubner M, Kuehr J, Brandis M, Greger R, Kunzelmann K
Effect of genistein on native epithelial tissue from normal individuals and CF patients and on ion channels expressed in Xenopus oocytes.
Br J Pharmacol. 2000 Aug;130(8):1884-92., [PMID:10952679]

Abstract [show]
The flavonoid genistein has been shown to activate a Cl(-) conductance in various cell types expressing CFTR. We examined if similar effects can be observed when genistein is applied to native ex vivo tissues from human respiratory tract and rectum. We further compared the effects when genistein was applied to oocytes of Xenopus laevis expressing CFTR. In oocytes, both wtCFTR and DeltaF508-CFTR were activated by genistein while both cyclic AMP (K(v)LQT1) and Ca(2+) (SK4) activated K(+) channels were inhibited at high concentrations of genistein. Biopsies from nasal polyps and rectal mucosa were obtained from normal individuals (non-CF) and CF patients and in the presence of amiloride (10 micromol l(-1); mucosal side) the effects of genistein were assessed using a perfused Ussing chamber. In non-CF airway epithelia, genistein (50 micromol l(-1); mucosal side) increased lumen negative I(sc) but had no additional effects on tissues pre-stimulated with IBMX and forskolin (100 micromol l(-1) and 1 micromol l(-1); both sides). In non-CF rectal biopsies, in the presence of amiloride (10 micromol l(-1); mucosal side) and indomethacin (10 micromol l(-1); basolateral side), genistein increased lumen negative I(sc) and enabled cholinergic (carbachol; CCH, 100 micromol l(-1); basolateral side) stimulation of Cl(-) secretion indicating activation of luminal CFTR Cl(-) channels. However, after stimulation with IBMX/forskolin, genistein induced opposite effects and significantly inhibited CCH activated I(sc). In CF airway and intestinal tissues genistein failed to induce Cl(-) secretion. Thus, genistein is able to activate luminal CFTR Cl(-) conductance in non-CF tissues and mutant CFTR in oocytes. However, additional inhibitory effects on basolateral K(+) conductance and missing effects in native CF tissues do not support the use for pharmacological intervention in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 In all CF patients from whom rectal biopsies were studied DNA analysis was carried out for the following CFTR mutations: DF508; R117H and S108F in exon 4; R347P, R347H, I336K and T338I in exon 7; S549N, G551D, R553X, G542X, Q552X, 1717-1 G?A in exon 11; W1282X and 3905insT in exon 20; N1303K in exon 21 and 3849+10kB C?T in intron 19. Login to comment

[hide] Prenatal detection by real-time quantitative PCR a... Clin Chem. 2000 Sep;46(9):1417-20. Costes B, Girodon E, Vidaud D, Flori E, Ardalan A, Conteville P, Fanen P, Niel F, Vidaud M, Goossens M
Prenatal detection by real-time quantitative PCR and characterization of a new CFTR deletion, 3600+15kbdel5.3kb (or CFTRdele19).
Clin Chem. 2000 Sep;46(9):1417-20., [PMID:10973878]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The mutations tested were S549N, S549R, R553X, G551D, V520F, ⌬I507, ⌬F508, Q493X, 1717-1G3A, G542X, R560T, R347P, R347H, 3849ϩ4A3G, W1282X, R334W, 1078delT, 3849ϩ10kbC3T, R1162X, N1303K, 3659delC, 3905insT, A455E, R117H, Y122X, 2183AA3G, 2789ϩ5G3A, 1898ϩ1G3A, 621ϩ1G3T, 711ϩ1G3T, and G85E. Login to comment

[hide] Mutation in the gene responsible for cystic fibros... JAMA. 2000 Oct 11;284(14):1814-9. Wang X, Moylan B, Leopold DA, Kim J, Rubenstein RC, Togias A, Proud D, Zeitlin PL, Cutting GR
Mutation in the gene responsible for cystic fibrosis and predisposition to chronic rhinosinusitis in the general population.
JAMA. 2000 Oct 11;284(14):1814-9., 2000-10-11 [PMID:11025834]

Abstract [show]
CONTEXT: Chronic rhinosinusitis (CRS) is a common condition in the US general population, yet little is known about its underlying molecular cause. Chronic rhinosinusitis is a consistent feature of the autosomal recessive disorder cystic fibrosis (CF). OBJECTIVE: To determine whether mutations in the cystic fibrosis transmembrane regulator (CFTR) gene, which is responsible for CF, predispose to CRS. DESIGN: Case-control study conducted from 1996 to 1999 in which the DNA of CRS patients and controls was typed for 16 mutations that account for 85% of CF alleles in the general population. Chronic rhinosinusitis patients with 1 CF mutation were evaluated for a CF diagnosis by sweat chloride testing, nasal potential difference measurement, and DNA analysis for additional mutations. SETTING: Otolaryngology-head and neck clinic of a US teaching hospital. PARTICIPANTS: One hundred forty-seven consecutive adult white patients who met stringent diagnostic criteria for CRS and 123 CRS-free white control volunteers of similar age range, geographic region, and socioeconomic status. MAIN OUTCOME MEASURES: Presence of CF mutations by DNA analysis among CRS patients vs controls. RESULTS: Eleven CRS patients were found to have a CF mutation (DeltaF508, n = 9; G542X, n = 1; and N1303K, n = 1). Diagnostic testing excluded CF in 10 of these patients and led to CF diagnosis in 1. Excluding this patient from the analyses, the proportion of CRS patients who were found to have a CF mutation (7%) was significantly higher than in the control group (n = 2 [2%]; P =.04, both having DeltaF508 mutations). Furthermore, 9 of the 10 CF carriers had the polymorphism M470V, and M470V homozygotes were overrepresented in the remaining 136 CRS patients (P =.03). CONCLUSION: These data indicate that mutations in the gene responsible for CF may be associated with the development of CRS in the general population. JAMA. 2000;284:1814-1819.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Analysis of CFTR Genes Genomic DNA samples extracted from the blood of participants were screened for 16 mutations (R117H, 621+1G→T, R334W, R347P, A455E, ⌬I507, ⌬F508, 1717-1 G→A, G542X, S549N, G551D, R553X, R560T, 3849+10 Kb C→T, W1282X, and N1303K) that account for 85% of CF alleles in the white population using the multiplex reverse dot hybridization system (Roche Molecular Systems, Alameda, Calif).16,17 This test also identified the 5T, 7T, and 9T variants of the splice acceptor site in intron 8 and F508C, I507V, and I506V (exon 10) polymorphisms of the CFTR gene. Login to comment

[hide] Unilateral renal agenesis associated with congenit... Hum Reprod. 2001 Feb;16(2):282-8. McCallum T, Milunsky J, Munarriz R, Carson R, Sadeghi-Nejad H, Oates R
Unilateral renal agenesis associated with congenital bilateral absence of the vas deferens: phenotypic findings and genetic considerations.
Hum Reprod. 2001 Feb;16(2):282-8., [PMID:11157821]

Abstract [show]
An association between congenital bilateral absence of the vas deferens (CBAVD), normal renal anatomy and cystic fibrosis (CF) gene mutations is well established (CF/CBAVD). We postulate that unilateral renal agenesis (URA) and CBAVD (URA/CBAVD) may have a non-CF mutation-mediated genetic basis that leads to abnormal development of the entire mesonephric duct at a very early stage in embryo development (< or =7 weeks). The physical, laboratory and radiographic findings of men with URA/CBAVD (n = 17) and CF/CBAVD (n = 97) were compared; the fertilization and pregnancy rates in the URA/CBAVD population calculated, and the incidence of renal agenesis in immediate family members and offspring of men with URA/CBAVD analysed. No statistical differences could be identified within any of the above comparisons. The fertilization rate for the URA/CBAVD group was 58.2 +/- 26.3%. Eight infants and two fetuses had normal renal anatomy, while one terminated male fetus had bilateral renal and vasal agenesis. Thirty first-order relatives had normal renal units. Anatomical expression of the reproductive ductal derivatives in men with URA/CBAVD and CF/CBAVD was similar, but the phenotypic outcome of the renal portion of the mesonephric duct was different. The potential for transmission of this fatal anomaly reinforces the need for prenatal ultrasounds with all pregnancies involving URA/CBAVD men.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Therereflects the 26 mutation/5T allele polymorphism assessment at the was no history of maternal diabetes, obvious teratogen exposurepresent time at Boston University Center for Human Genetics: or evidence of known congenital syndromes in themselves, orR117H; 1717-1G→A; G542X; 621ϩ1; S549N; R560T; I507; G551D; their families, that the men in either group could recall. Login to comment

[hide] The molecular basis of cystic fibrosis in South Af... Clin Genet. 2001 Jan;59(1):37-41. Goldman A, Labrum R, Claustres M, Desgeorges M, Guittard C, Wallace A, Ramsay M
The molecular basis of cystic fibrosis in South Africa.
Clin Genet. 2001 Jan;59(1):37-41., [PMID:11168023]

Abstract [show]
The spectrum of CFTR mutations in three South African populations is presented. To date. a total of 192 white patients (384 chromosomes) with confirmed CF have been tested. deltaF508 accounts for 76% of the CF chromosomes in this group, with 3272-26A-->G, 394delTT and G542X occurring at the following frequencies: 4, 3.6 and 1.3%, respectively. A further 11 mutations account for 6% of CF chromosomes. A total of 91% of the CF-causing mutations can now be detected in the South African white population. Haplotype analysis suggests a founder effect in South Africans of European origin for the two common CFTR mutations, 3272-26A-->G and 394delTT. The diagnosis of CF has been confirmed in 14 coloured and 12 black CF patients. In the coloured population, both the deltaF508 and 3120 + 1G-->A mutations occur at appreciable frequencies of 43 and 29%, respectively. In the black population, the most common CF-causing mutation, the 3120 + 1G-->A mutation, occurs at an estimated frequency of 46%. Four other mutations have been detected, resulting in the identification of a total of 62.5% of mutations in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 Five other mutations were identified in the white population, G542X, R553X, S549N, 621+lGT and N1303K which together account for a further 3% of mutations (5). Login to comment
58 Frequency of CFTR mutations in white CF chromosomes Mutation Number of chromosomes Frequency (%) DF508 291 76 3272-26AG 16 4 394delTT 14 3.6 G542X 5 1.3 R553X 4 1 1W1282X 4 14N1303K G551D 3 0.8 3120+1GA 2 0.5 R117H 1 0.3 Q493X 1 0.3 S549N 1 0.3 621+1GT 1 0.3 1717-1GA 1 0.3 2789+5GA 1 0.3 91Total 349/384 Table 2. Login to comment

[hide] XV-2c/KM-19 haplotype analysis of cystic fibrosis ... Am J Med Genet. 2001 Aug 15;102(3):277-81. Orozco L, Gonzalez L, Chavez M, Velazquez R, Lezana JL, Saldana Y, Villarreal T, Carnevale A
XV-2c/KM-19 haplotype analysis of cystic fibrosis mutations in Mexican patients.
Am J Med Genet. 2001 Aug 15;102(3):277-81., 2001-08-15 [PMID:11484207]

Abstract [show]
We analyzed 97 unrelated Mexican cystic fibrosis (CF) patients and their first-degree relatives to study the association of XV2C/TaqI/KM19/PstI haplotypes with CF mutations in this population. Haplotype phases could be established in 148 CF and 110 normal chromosomes, and haplotype distributions of normal and CF chromosomes differed significantly (P < 0.001). DeltaF508 and G542X mutations accounted for 56% of CF chromosomes and were found to be associated with haplotype B in 97.2% and 72.7% of chromosomes, respectively. The haplotype distribution of CF chromosomes carrying other rare and unknown mutations was similar to that of normal chromosomes (P > 0.05), haplotypes A and C being the most frequent. This is in accordance with the extensive heterogeneity and the spectrum of mutations reported in Mexican CF patients. We also report the haplotype distribution of all informative chromosomes bearing rare mutations; some were found to be associated with previously reported haplotypes, whereas others were found on different haplotypes. Recombination or recurrence of mutations may explain these different associations, although other intragenic markers must be used to better understand the origin and dispersion of CF mutations in our country. XK haplotype analysis allowed carrier detection among sibs in 24.3% of families, showing that this method may be useful for carrier detection in populations with high allelic heterogeneity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Among those found in more than one chromosome, S549N was associated only with haplotype A, N1303K only with haplotype B, DI507 only with D, and 2055del9!A only with A. Login to comment
65 Distribution of XK Haplotype on Chromosomes Bearing Uncommon Cystic Fibrosis (CF) Mutations A B C D S549N 4/4 DI507 3/3 N1303K 3/3 2055 del9!A 2/2 I148T 1/1 406-1G!A 1/1 R75X 1/1 I506T 1/1 935delA 1/1 2183AA!G 1/1 1924del7 1/1 G551S 1/1 1078delT 1/1 R117H 1/1 384910KbC!T 1/1 1716G!A 1/1 W1204X 1/1 W1098C 1/1 846delT 1/1 R75Q 1/1 W1069X 1/1 L558S 1/1 4160insGGGG 1/1 297-1G!A 1/1 Fig. Login to comment
86 Mutation S549N is relatively frequent in Mexico (2.5%) and was associated with haplotype A in all informative chromosomes. Login to comment
87 As far as we know, there are no previous reports of XK haplotypes associated with S549N, which is very uncommon in other populations [CFGAC, 1994]. Login to comment

[hide] Intron-8 polythymidine sequence in Australasian in... Eur Respir J. 2001 Jun;17(6):1195-200. Massie RJ, Poplawski N, Wilcken B, Goldblatt J, Byrnes C, Robertson C
Intron-8 polythymidine sequence in Australasian individuals with CF mutations R117H and R117C.
Eur Respir J. 2001 Jun;17(6):1195-200., [PMID:11491164]

Abstract [show]
Compound heterozygotes for a severe cystic fibrosis transmembrane conductance regulator (CFTR) mutation and the R117H or R117C mutation (R117H/C) have clinical presentations that vary from classic cystic fibrosis (CF) to an incidental genetic finding. The aim of this study was to assess the influence of the intron-8 polythvmidine sequence (IVS8) on the relationship between genotype and phenotype of individuals with R117H/C. All individuals with R117H/C known to CF clinics in Australia and New Zealand were retrospectively studied by collecting information on genotype, age, pancreatic status, sweat electrolytes, sputum microbiology and pulmonary function. Forty-one individuals (39 with R117H and two with R117C), 16 on an IVS8-5T background and 25 on an IVS8-7T background were identified. Twelve individuals presented clinically, four were siblings of known R117H/C compound heterozygotes and 25 were detected by newborn screening. Eleven of 14 of the IVS8-5T group (78%) with sweat chloride results available had sweat CI > 60 mmol x L(-1) compared to 5 (20%) of the R117H/7T group (Chi-squared=10.4, p=0.001). Two were pancreatic insufficient, both IVS8-5T. Two IVS8-5T individuals have recently died (aged 43 and 19) and of the 14 surviving IVS8-5T group, 11 (79%) are symptomatic compared to eight (32%) of the IVS8-7T individuals (Chi-squared=6.1, p=0.01). In conclusion, most individuals with R117H/C on a IVS8-5T background have an elevated sweat chloride and clinical cystic fibrosis, which in some cases is severe. Most individuals with R117H/C on an IVS8-7T background do not have clinical cystic fibrosis but should be followed for the development of clinical disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 Infants with a positive (w60 mmol?L-1 ) or borderline (40 - 60 mmol?L-1 ) sweat chloride and in whom there is an unidentified mutation are referred for an extended mutation analysis which includes: DF508, R117H, G551D, A455E, G542X, N1303K, W1282X, 1717-1, R560T, R347P, R334W, R1162X, S549N, 621z1, 3849z10CwT, and the IVS8 polythymidine sequence. Login to comment

[hide] A combined analysis of the cystic fibrosis transme... Mol Biol Evol. 2001 Sep;18(9):1771-88. Chen JM, Cutler C, Jacques C, Boeuf G, Denamur E, Lecointre G, Mercier B, Cramb G, Ferec C
A combined analysis of the cystic fibrosis transmembrane conductance regulator: implications for structure and disease models.
Mol Biol Evol. 2001 Sep;18(9):1771-88., [PMID:11504857]

Abstract [show]
Over the past decade, nearly 1,000 variants have been identified in the cystic fibrosis transmembrane conductance regulator (CFTR) gene in classic and atypical cystic fibrosis (CF) patients worldwide, and an enormous wealth of information concerning the structure and function of the protein has also been accumulated. These data, if evaluated together in a sequence comparison of all currently available CFTR homologs, are likely to refine the global structure-function relationship of the protein, which will, in turn, facilitate interpretation of the identified mutations in the gene. Based on such a combined analysis, we had recently defined a "functional R domain" of the CFTR protein. First, presenting two full-length cDNA sequences (termed sCFTR-I and sCFTR-II) from the Atlantic salmon (Salmo salar) and an additional partial coding sequence from the eastern gray kangaroo (Macropus giganteus), this study went further to refine the boundaries of the two nucleotide-binding domains (NBDs) and the COOH-terminal tail (C-tail), wherein NBD1 was defined as going from P439 to G646, NBD2 as going from A1225 to E1417, and the C-tail as going from E1418 to L1480. This approach also provided further insights into the differential roles of the two halves of CFTR and highlighted several well-conserved motifs that may be involved in inter- or intramolecular interactions. Moreover, a serious concern that a certain fraction of missense mutations identified in the CFTR gene may not have functional consequences was raised. Finally, phylogenetic analysis of all the full-length CFTR amino acid sequences and an extended set of exon 13--coding nucleotide sequences reinforced the idea that the rabbit may represent a better CF model than the mouse and strengthened the assertion that a long-branch attraction artifact separates the murine rodents from the rabbit and the guinea pig, the other Glires.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
100 Moreover, all of the 11 most common missense mutations or single-amino-acid deletions (i.e., F508del, G551D, N1303K, R117H, R347P, I507del, G85E, R560T, A455E, R334W, and S549N) identified in classic and atypical CF patients worldwide (http://www.genet.sickkids.on.ca/cftr) occur in stringently conserved residues across the 15 CFTR sequences. Login to comment

[hide] The S549R (T-->G) cystic fibrosis gene mutation. J Trop Pediatr. 2001 Aug;47(4):196-8. Dawson KP, Frossard PM
The S549R (T-->G) cystic fibrosis gene mutation.
J Trop Pediatr. 2001 Aug;47(4):196-8., [PMID:11523757]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 A study of 27 177 CF chromosomes from 29 European and three north African countries showed that of the 272 mutations examined, S549R occurred on 12 occasions (0.04 per cent) and the S549N on 16 occasions (0.059 per cent). Login to comment

[hide] Mutations of the cystic fibrosis gene in patients ... Am J Gastroenterol. 2001 Sep;96(9):2657-61. Truninger K, Malik N, Ammann RW, Muellhaupt B, Seifert B, Muller HJ, Blum HE
Mutations of the cystic fibrosis gene in patients with chronic pancreatitis.
Am J Gastroenterol. 2001 Sep;96(9):2657-61., [PMID:11569691]

Abstract [show]
OBJECTIVE: Several studies have reported an increased frequency of cystic fibrosis gene mutations in idiopathic but not in alcoholic chronic pancreatitis. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis has not been analyzed. The aim of our study was to determine the frequency of cystic fibrosis gene mutations in patients with chronic pancreatitis with long-term follow-up and to see whether patients with mutations have a clinically different natural course compared to those without mutations. METHODS: Eighty two patients with chronic pancreatitis and 11 patients with recurrent acute pancreatitis of our well defined pancreatitis cohort were screened for the 31 most common cystic fibrosis gene mutations. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis was assessed. RESULTS: A cystic fibrosis gene mutation was detected in five of 49 patients with alcoholic chronic pancreatitis (10.2%; 2.3 times the expected frequency) and in three of 14 patients with idiopathic-juvenile chronic pancreatitis (21.4%; 4.8 times the expected frequency). No mutations were found in the remaining patients with chronic pancreatitis of rare causes, hereditary pancreatitis, and recurrent acute pancreatitis. The frequency of pancreatic calcifications was significantly higher in patients with alcoholic chronic pancreatitis without mutations. This result was not confirmed in patients with idiopathic-juvenile chronic pancreatitis. The duration of pain and the frequency of exocrine and endocrine insufficiency was comparable in both subgroups irrespective of the mutation status. CONCLUSION: Our data indicate a significantly increased frequency of cystic fibrosis gene mutations both in patients with alcoholic and idiopathic-juvenile chronic pancreatitis. The natural course was similar in patients with mutations compared to those without mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Using multiplex PCR, 15 genomic fragments were amplified which contain the following mutations: ⌬F508, ⌬I507, Q493X, V520F, 1717-1G3A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ϩ 10kbC3T, 3849 ϩ 4A3G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 ϩ 1G3T, R117H, Y122X, 711 ϩ 1G3T; 1078delT, R347P, R347H, R334W, A455E, 1898 ϩ 1G3A, 2183AA3G, 2789 ϩ 5G3A. Login to comment

[hide] Cystic fibrosis phenotype evaluation and paternity... Hum Reprod. 2001 Oct;16(10):2093-7. Josserand RN, Bey-Omar F, Rollet J, Lejeune H, Boggio D, Durand DV, Durieu I
Cystic fibrosis phenotype evaluation and paternity outcome in 50 males with congenital bilateral absence of vas deferens.
Hum Reprod. 2001 Oct;16(10):2093-7., [PMID:11574497]

Abstract [show]
BACKGROUND: Most infertile males with congenital bilateral absence of vas deferens (CBAVD) carry mutations on the cystic fibrosis transmembrane conductance regulator gene and may express mild cystic fibrosis (CF) symptoms. Barriers to paternity for these men can now be overcome by assisted reproduction. Our aims were to investigate the CF-related phenotype and clinical outcome for 50 patients with CBAVD seen at a CF adult centre between 1992 and 1999. METHODS AND RESULTS: The investigation of the patients included screening for 22 CF mutations and identification of the poly-T variant of intron 8, sweat testing, clinical investigation for CF-related extra-genital manifestations, and genetic counselling. CFTR mutations were detected on 56 alleles of the 50 patients. A total of 15 (30%) was compound heterozygote and 26 (52%) heterozygote. In all, 38% of the patients had a positive sweat test. Four patients were diagnosed with typical CF not detected previously. Twenty-one patients became fathers following ICSI (eight cases), artificial insemination by donor or IVF with sperm donor (seven cases) or through adoption (six cases). A mail survey allowed the identification of CF-related clinical symptoms. Information on the occurrence of CF-related symptoms was obtained for 58.5% of patients: in the absence of initial symptoms, no new clinical signs were reported. CONCLUSION: Patients diagnosed with CBAVD need genetic counselling before assisted reproduction. Even when no wish for paternity is expressed, CF gene screening should be associated with at least a sweat test and clinical evaluation because of possible mild forms of CF disease. Medical follow-up did not reveal any new symptoms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Leukocytes samples were analysed for a series of 22 CF mutations including the five most frequently encountered in our region (The CF Genotype Consortium, 1994): ∆F508, G542X, N1303K, 1717-G-A, 885E; and 17 others: R117H, R334W, R347H, R347P, 556delA, S549N, S549I, S549R, G551D, R553X, R560T, G1244E, S1255X, W1282X, R1283K, 3898ins C, D1270N. Login to comment

[hide] Analysis of exocrine pancreatic function in cystic... Eur J Clin Invest. 2001 Sep;31(9):796-801. Walkowiak J, Herzig KH, Witt M, Pogorzelski A, Piotrowski R, Barra E, Sobczynska-Tomaszewska A, Trawinska-Bartnicka M, Strzykala K, Cichy W, Sands D, Rutkiewicz E, Krawczynski M
Analysis of exocrine pancreatic function in cystic fibrosis: one mild CFTR mutation does not exclude pancreatic insufficiency.
Eur J Clin Invest. 2001 Sep;31(9):796-801., [PMID:11589722]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most common cause of exocrine pancreatic insufficiency in childhood. The aim of the present study is to evaluate the correlation between genotype and exocrine pancreatic insufficiency in CF patients. The special emphasis was put on the analysis of mild CFTR mutations. DESIGN: The study comprised 394 CF patients and 105 healthy subjects (HS). Elastase-1 concentrations were measured in all subjects. RESULTS: Severe pancreatic insufficiency was associated with the presence of two CFTR gene mutations (DeltaF508, N1303K, CFTR dele 2,3 (21kb), G542X, 1717-1G-A, R533X, W1282X, 621GT, 2183AAG, R560T, 2184insA and DeltaI507, G551D, 895T) and mild insufficiency with the presence of at least one mutation (R117H, 3171insC, A155P2, 138insL, 296 + 1G-A, E92GK, E217G, 2789 + 5G-A. 3849 + 1kbC-T/3849 + 1kbC-T) genotype resulted in high elastase-1-values. However, in case of patients with genotype DeltaF508/3849 + 10kbC-T, 1717-1GA/3849 + 10kbC-T as well as with DeltaF508/R334W, both high and low elastase-1 concentrations were found. Low E1 values were found in a patient with DeltaF508/R347P genotype. CONCLUSION: Patients who carry two 'severe' mutations develop pancreatic insufficiency, whereas those who carry at least one 'mild' usually remain pancreatic sufficient. However, the presence of one mild mutation does not exclude pancreatic insufficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Previously, it has been shown that pancreatic insufficiency was related to mutation G551D and pancreatic sufficiency to R347W and S549N [11]. Login to comment

[hide] Improved detection of CFTR mutations in Southern C... Hum Mutat. 2001 Oct;18(4):296-307. Wong LJ, Wang J, Zhang YH, Hsu E, Heim RA, Bowman CM, Woo MS
Improved detection of CFTR mutations in Southern California Hispanic CF patients.
Hum Mutat. 2001 Oct;18(4):296-307., [PMID:11668613]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause cystic fibrosis (CF), a common autosomal recessive disease in Caucasians. The broad mutation spectrum varies among different patient groups. Current molecular diagnoses are designed to detect 80-97% of CF chromosomes in Caucasians and Ashkenazi Jews but have a much lower detection rate in Hispanic CF patients. Grebe et al. [1994] reported a 58% detection rate in Hispanic patients. Since then, there has been no large-scale, complete mutational analysis of Hispanic CF patients. In this study, the mutations in 62 Hispanic patients from southern California were investigated. The entire coding and flanking intronic regions of the CFTR gene were analyzed by temporal temperature gradient gel electrophoresis (TTGE) followed by sequencing to identify the mutations. Eleven novel mutations were discovered in this patient group: 3876delA, 406-1G>A, 935delA, 663delT, 3271delGG, 2105-2117del13insAGAAA, 3199del6, Q179K, 2108delA, 3171delC, and 3500-2A>T. Among the mutations, seven were out-of-frame insertions and deletions that result in truncated proteins, two were splice-site mutations, one was an in-frame 6 bp deletion, and one was a missense mutation that involved the non-conservative change of glutamine-179 to lysine. All patients presented severe classical clinical course with pancreatic insufficiency and poor growth, consistent with the nature of truncation mutation. The results indicate that TTGE screening following the analysis of recurrent mutations will substantially improve the mutation detection rate for Hispanic CF patients from southern California.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
96 Seven other mutations, I148T, S549N, R334W, 3120+1G to A, 406-1G>A, 935delA, and R1066C, occurred twice. Login to comment
210 It also differs from that reported for Argentine patients [Chertkoff et al., 1997], where W1282X accounts for 3.1% of mutant alleles, compared to 0.8% in this study, while S549N mutation was not found in a total of 228 Argentine CF chromosomes, compared to 2.4% in our study. Login to comment

[hide] Genetic and clinical features of false-negative in... Acta Paediatr. 2002;91(1):82-7. Padoan R, Genoni S, Moretti E, Seia M, Giunta A, Corbetta C
Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis.
Acta Paediatr. 2002;91(1):82-7., [PMID:11883825]

Abstract [show]
A study was performed on the delayed diagnosis of cystic fibrosis (CF) in infants who had false-negative results in a neonatal screening programme. The genetic and clinical features of false-negative infants in this screening programme were assessed together with the efficiency of the screening procedure in the Lombardia region. In total, 774,687 newborns were screened using a two-step immunoreactive trypsinogen (IRT) (in the years 1990-1992), IRT/IRT + delF508 (1993-1998) or IRT/IRT + polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) protocol (1998-1999). Out of 196 CF children born in the 10 y period 15 were false negative on screening (7.6%) and molecular analysis showed a high variability in the genotypes. The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E. In three patients no mutation was identified after denaturing gradient gel electrophoresis of the majority of CFTR gene exons. Conclusion: The clinical phenotypes of CF children diagnosed by their symptoms at different ages were very mild. None of them presented with a severe lung disease. The majority of them did not seem to have been damaged by the delayed diagnosis. The combination of IRT assay plus genotype analysis (1998-1999) appears to be a more reliable method of detecting CF than IRT measurement alone or combined with only the delF508 mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 It was initially performed by polyacrylamide gel electrophoretic (PAGE) analysis for the delF508 mutation, and later by polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) (31 mutations: G85E, 621 ‡ 1G ® T, R117H, Y122X, 711 ‡ 1G ® T, 1078delT, R347P, R347H, R334W, A455E, 1898 ‡ 1G ® A, 2183-AA ® G, 2789 ‡ 5G ® A, DelF508, I507del, Q493X, V520F, 1717-1G ® A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ‡ 10kbC ® T, 3849 ‡ 4A ® G, R1162X, 3659delC, W1282X, 3905insT, N1303K) (14). Login to comment

[hide] DHPLC screening of cystic fibrosis gene mutations. Hum Mutat. 2002 Apr;19(4):374-83. Ravnik-Glavac M, Atkinson A, Glavac D, Dean M
DHPLC screening of cystic fibrosis gene mutations.
Hum Mutat. 2002 Apr;19(4):374-83., [PMID:11933191]

Abstract [show]
Denaturing high performance liquid chromatography (DHPLC) using ion-pairing reverse phase chromatography (IPRPC) columns is a technique for the screening of gene mutations. In order to evaluate the potential utility of this assay method in a clinical laboratory setting, we subjected the PCR products of 73 CF patients known to bear CFTR mutations to this analytic technique. We used thermal denaturation profile parameters specified by the MELT program tool, made available by Stanford University. Using this strategy, we determined an initial analytic sensitivity of 90.4% for any of 73 known CFTR mutations. Most of the mutations not detected by DHPLC under these conditions are alpha-substitutions. This information may eventually help to improve the MELT algorithm. Increasing column denaturation temperatures for one or two degrees above those recommended by the MELT program allowed 100% detection of CFTR mutations tested. By comparing DHPLC methodology used in this study with the recently reported study based on Wavemaker 3.4.4 software (Transgenomic, Omaha, NE) [Le Marechal et al., 2001) and with previous SSCP analysis of CFTR mutations [Ravnik-Glavac et al., 1994] we emphasized differences and similarities in order to refine the DHPLC system and discuss the relationship to the alternative approaches. We conclude that the DHPLC method, under optimized conditions, is highly accurate, rapid, and efficient in detecting mutations in the CFTR gene and may find high utility in screening individuals for CFTR mutations. Hum Mutat 19:374-383, 2002. Published 2002 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X. Login to comment

[hide] Complete screening of the CFTR gene in Argentine c... Clin Genet. 2002 Mar;61(3):207-13. Visich A, Zielenski J, Castanos C, Diez G, Grenoville M, Segal E, Barreiro C, Tsui LC, Chertkoff L
Complete screening of the CFTR gene in Argentine cystic fibrosis patients.
Clin Genet. 2002 Mar;61(3):207-13., [PMID:12000363]

Abstract [show]
In order to establish the nature and the distribution of mutations causing cystic fibrosis (CF) in 220 unrelated Argentine families, the present authors conducted an extensive molecular analysis of the CF transmembrane regulator (CFTR) gene. First, a direct mutation analysis of 13 common mutations was done, enabling the detection of 319 out of 440 CF alleles (72.52%). Then an exhaustive screening of the entire coding region and the adjacent sequences of the CFTR gene was performed in all patients carrying at least one unidentified CF allele using the multiplex heteroduplex analysis assay followed by direct DNA sequencing. Thirty-nine different CF mutations, including five previously undescribed mutations (i.e. L6V, Y362X, 1353insT, 2594delGT and 2686insT) and two novel polymorphisms (i.e. 1170G/C and 3315A/C) were identified. As a result, the overall detection rate increased by up to 83.45%. Besides DeltaF508, only five mutations showed frequencies higher than 1%. In addition, a total of 49% of the mutations were rare because they were found in only one CF family. This wide spectrum of CF mutations is in agreement with the heterogeneous ethnic origin of the Argentine population. The data obtained here may have important consequences for the development of adequate strategies for the molecular diagnosis of CF in Argentina.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Screening for DF508 and 12 other known mutations DF508 and 11 other frequent mutations (i.e. DI507, G551D, R553X, S549N, S549I, R1162X, 1811π1.6KbA»T, G542X, 1717-1G»A, 208 W1282X and N1303K) were detected as previously described (5). Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment
113 Mexico ∆F508 (41.6%) G551S (0.5%) 75.5 57.0 35 374/194 Orozco et al.[1993]; Villalobos- G542X (5.6%) 1078delT (0.5%) Torres et al. [1997]; Liang et al. ∆I507 (2.5%) Y1092X (0.5%) [1998]; Orozco et al. [2000] S549N (1.9%) R117H (0.5%) N1303K (1.7%) G85E (0.5%) R75X (1.5%) 1716G→A (0.5%) 406-1G→A (1.5%) W1204X (0.5%) I148T (1.5%) W1098C (0.5%) 3849+10KbC→T (1.5%) 846delT (0.5%) 621+1G→T (1.2%) P750L (0.5%) 2055del9→A (1.0%) V754M (0.5%) 935delA (1.0%) R75Q (0.5%) I506T (1.0) W1096X (0.5%) 3199del6 (1.0%) L558S (0.5%) 2183AA→G (1.0%) 4160insGGGG (0.5%) G551D (0.5%) 297-1G→A (0.5%) R553X (0.5%) H199Y (0.5%) 1924del7 (0.5%) United States ∆F508 (68.6%) R553X (0.9%) 79.7 63.5 10 25048 Cystic Fibrosis Foundation (total) G542X (2.4%) 621+1G→T (0.9%) [1998] G551D (2.1%) 1717-1G→A (0.7%) W1282X (1.4%) 3849+10KbC→T (0.7%) N1303K (1.3%) R117H (0.7%) United States ∆F508 (48.0%) S1255X (1.4%) 77.3 59.8 16 160/148 Carles et al. [1996]; Macek et al. (African 3120+1G→A (12.2%) 444delA (0.7%) [1997]; Dörk et al. [1998]; American) 2307insA (2.0%) R334W (0.7%) Friedman et al. [1998] A559T (2.0%) ∆I507 (0.7%) R553X (2.0%) 1717-1G→A (0.7%) ∆F311 (2.0%) G542X (0.7%) G480C (1.4%) S549N (0.7%) 405+3A→C (1.4%) G551D (0.7%) United States 1) L1093P - - 1 2 Yee et al. [2000] (Cherokee) United States Non-French: French: Non- Non- Non- Non- Bayleran et al. [1996] (Maine) ∆F508 (82.0%) ∆F508 (58%) French: French: French: French: G542X (2.6%) 711+1G→T (8.3%) 95.3 90.8 11 191 G551D (2.6%) I148T (4.2%) French: French: French: French: N1303K (2.1%) A455E (4.2%) 80.3 64.5 8 72 R560T (1.0%) 1717-1G→A (1.4%) Total: 621+1G→T (1.0%) G85E (1.4%) 263 711+1G→T (1.0%) 621+1G→T (1.4%) R117H (1.0%) Y1092X (1.4%) 1717-1G→A (1.0%) G85E (0.5%) W1282X (0.5%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS589 United States ∆F508 (46.0%) R334W (1.6%) 58.5 34.2 7 129 Grebe et al. [1994] (SW Hispanic) G542X (5.4%) W1282X (0.8%) 3849+10KbC→T (2.3%) R553X (0.8%) R1162X (1.6%) United States 1) R1162X - - 3 17 Mercier et al. [1992] (SW Native 2) D648V American) 3) G542X United States 1) R1162X 3) G542X - - 4 16 Mercier et al. [1994] (Zuni Pueblo) 2) 3849+10KbC®T 4) D648V Venezuela ∆F508 (29.6%) G542X (3.7%) 33.3 11.1 2 54 Restrepo et al. [2000] Other Regions Australia ∆F508 (76.9%) 621+1G→T (1.1%) 88.7 78.7 8 761/464 CFGAC [1994] G551D (4.5%) N1303K (0.9%) G542X (2.8%) W1282X (0.6%) R553X (1.3%) R117H (0.6%) East Asia 1) 1898+1G®T 2) 1898+5G®T - - 2 28 Suwanjutha et al. [1998] Hutterite 1) M1101K (69.0%) 2) DF508 (31.0%) - - 2 32 Zielenski et al. [1993] Brethren New Zealand ∆F508 (78.0%) N1303K (1.9%) 87.4 76.4 5 636 CFGAC [1994] G551D (4.4%) 621+1G→T (1.1%) G542X (2.0%) *This table presents the mutation panels for all regions investigated in this study. Login to comment
213 Ideal Recommended CFTR Mutation Screening Panel for 2001 Neonatal Screening in the USA* Location Estimated Mutation in CFTRa percentageb Reason for inclusion DF508 Exon 10 68.6% CFF registry, >1%, Pan-European G542X Exon 11 2.4% CFF registry, >1%, Mediterranean G551D Exon 11 2.1% CFF registry, >1%, Celtic W1282X Exon 20 1.4% CFF registry, >1%, Ashkenazi Jew N1303K Exon 21 1.3% CFF registry, >1%, Mediterranean R553X Exon 11 0.9% CFF registry, >0.5%, Hispanic 621+1G®T Intron 4 0.9% CFF registry, >0.5%, multi-ethnic 1717-1G®A Intron 10 0.7% CFF registry, >0.5%, Italian 3849+10KbC®T Intron 19 0.7% CFF registry, >0.5%, Hispanic R117Hc Exon 4 0.7% CFF registry, >0.5% 1898+1G→T Intron 12 0.4% CFF registry, >0.1%, East Asian DI507 Exon 10 0.3% CFF registry, >0.1%, Hispanic 2789+5G®A Intron 14b 0.3% CFF registry, >0.1% G85E Exon 3 0.3% CFF registry, >0.1% R347P Exon 7 0.2% CFF registry, >0.1% R334W Exon 7 0.2% CFF registry, >0.1%, multi-ethnic R1162X Exon 19 0.2% CFF registry, >0.1%, multi-ethnic R560T Exon 11 0.2% CFF registry, >0.1% 3659delC Exon 19 0.2% CFF registry, >0.1% A455E Exon 9 0.2% CFF registry, >0.1% 2184delA Exon 13 0.1% CFF registry, >0.1% S549N Exon 11 0.1% CFF registry, >0.1%, multi-ethnic 711+1G®T Intron 5 0.1% CFF registry, >0.1% R75X Exon 3 0.2% Hispanic 406-1G→A Intron 3 0.2% Hispanic I148T Exon 4 0.2% Hispanic, French 2055del9→A Exon 13 0.1% Hispanic 935delA Exon 6b 0.1% Hispanic I506T Exon 10 0.1% Hispanic 3199del6 Exon 17a 0.1% Hispanic 2183AA→G Exon 13 0.1% Hispanic 3120+1G®A Intron 16 1.5% African American, Arabian 2307insA Exon 13 0.2% African American A559T Exon 11 0.2% African American ∆F311 Exon 7 0.2% African American G480C Exon 10 0.2% African American 405+3A→C Intron 3 0.2% African American S1255X Exon 20 0.2% African American L1093P Exon 17b Undetermined Native American D648V Exon 13 Undetermined Native American I1234V Exon 19 Undetermined Arabian linkage S549R Exon 11 Undetermined Arabian linkage 1898+5G→T Intron 12 Undetermined East Asian linkage CFTRdele2,3 Exons 2,3 Undetermined Eastern European linkage (Slavic) Y1092X Exon 17b Undetermined French linkage 394delTT Exon 3 Undetermined Nordic linkage Y569D Exon 12 Undetermined Pakistani linkage 3905insT Exon 20 Undetermined Swiss linkage (also: Amish, Acadian, Mennonite) 1898+1G®A Intron 12 Undetermined Welsh linkage M1101k Exon 17b Undetermined Hutterite ancestry *This table presents the top 50 mutations in the USA based on the Cystic Fibrosis Foundation CF Registry data from 1997 [Cystic Fibrosis Foundation, 1998], and data generated during our investigation. Login to comment

[hide] Development and evaluation of a PCR-based, line pr... Clin Chem. 2002 Jul;48(7):1121-3. Wang X, Myers A, Saiki RK, Cutting GR
Development and evaluation of a PCR-based, line probe assay for the detection of 58 alleles in the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
Clin Chem. 2002 Jul;48(7):1121-3., [PMID:12089190]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 During the evaluation phase, a sample that was previously genotyped as a compound heterozygote, S549N/ R553X, hybridized as expected with the R553X wild-type and mutant probes. Login to comment
83 However, the presence of the R553X and S549N mutations precluded hybridization to the G551D wild-type probe (data not shown). Login to comment

[hide] Predicting the risk of cystic fibrosis with abnorm... Am J Med Genet. 2002 Jun 15;110(2):109-15. Muller F, Simon-Bouy B, Girodon E, Monnier N, Malinge MC, Serre JL
Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases.
Am J Med Genet. 2002 Jun 15;110(2):109-15., 2002-06-15 [PMID:12116247]

Abstract [show]
Hyperechogenic fetal bowel is prenatally detected by ultrasound during the second trimester of pregnancy in 0.1-1.8% of fetuses. It has been described as a normal variant but has often been associated with severe diseases, notably cystic fibrosis (CF). The aim of our study was to determine the risk of CF in a prospective study of 641 fetuses with ultrasonographically abnormal fetal bowel and the residual risk when only one mutation is detected in the fetus. Fetal cells and/or parental blood cells were screened for CFTR mutations. Two screening steps were used, the first covering the mutations most frequently observed in French CF patients (mutation detection rate of 70-90%) and, when a CF mutation was detected, a DGGE-sequencing strategy. We observed a 3.1% risk of CF when a digestive tract anomaly was prenatally observed at routine ultrasound examination. The risk was higher when hyperechogenicity was associated with bowel dilatation (5/29; 17%) or with the absence of gall bladder (2/8; 25%). The residual risk of CF was 11% when only one CF mutation was detected by the first screening step, thereby justifying in-depth screening. Mutations associated with severe CF (DeltaF508 mutation) were more frequently observed in these ultrasonographically and prenatally detected CF cases. However, the frequency of heterozygous cases was that observed in the normal population, which demonstrates that heterozygous carriers of CF mutations are not at increased risk for hyperechogenic bowel. In conclusion, fetal bowel anomalies indicate a risk of severe cystic fibrosis and justify careful CFTR molecular analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 þ 10kbC ! Login to comment

[hide] Genotype-phenotype correlation in cystic fibrosis:... Am J Med Genet. 2002 Jul 22;111(1):88-95. Salvatore F, Scudiero O, Castaldo G
Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes.
Am J Med Genet. 2002 Jul 22;111(1):88-95., 2002-07-22 [PMID:12124743]

Abstract [show]
More than 1,000 mutations have been identified in the cystic fibrosis (CF) transmembrane regulator (CFTR) disease gene. The impact of these mutations on the protein and the wide spectrum of CF phenotypes prompted a series of Genotype-Phenotype correlation studies. The CFTR genotype is invariably correlated with pancreatic status-in about 85% of cases with pancreatic insufficiency and in about 15% of cases with pancreatic sufficiency. The correlations between the CFTR genotype and pulmonary, liver, and gastrointestinal expression are debatable. The heterogeneous phenotype in CF patients bearing the same genotype or homozygotes for nonsense mutations implicated environmental and/or genetic factors in the disease. However, the discordant phenotype observed in CF siblings argued against a major role of environmental factors and suggested that genes other than CFTR modulate the CF phenotype. A locus that modulates gastrointestinal expression was identified in mice and subsequently in humans. By analyzing nine CF patients discordant for meconium ileus we were able to show that this locus had a dominant effect. Moreover, in a collaborative study we found a higher rate of polymorphisms in beta-defensin genes 1 and 2 in CF patients and in controls. In another multicenter study mutations in alpha-1 antitrypsin (A1AT) and mannose binding lectin genes were found to be independent risk factors for liver disease in CF patients. The body of evidence available suggests that the variegated CF phenotype results from complex interactions between numerous gene products.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 A series of mutations usually associated with pancreatic sufficiency have been identified and defined as ''mild`` with reference to pancreatic status [Kerem et al., 1989c]: G85E, G91R, R117H, E193K, P205S, R334W, T338I, R347H, R347L, R347P, R352Q, A455E, S492F, S549N, P574H, D579G, 711 þ 5 G > A, C866Y, F1052V, H1054D, R1066H, R1068H, H1085R, D1152H, S1159P, S1251N, F1286S, G1349D, 2789 þ 5 G > A, and 3849 þ 10kb C > T [Dean et al., 1990; Cutting et al., 1990a; Cremonesi et al., 1992; Highsmith et al., 1994]. Login to comment

[hide] Screening for cystic fibrosis in newborn infants: ... J Med Screen. 2002;9(2):60-3. Corbetta C, Seia M, Bassotti A, Ambrosioni A, Giunta A, Padoan R
Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population.
J Med Screen. 2002;9(2):60-3., [PMID:12133923]

Abstract [show]
OBJECTIVE: To assess the performance of a two tier neonatal screening programme (IRT/DNA/IRT) for cystic fibrosis, based on immunoreactive trypsinogen (IRT) followed by direct cystic fibrosis transmembrane conductance regulator (CFTR) gene analysis (based on a panel of up to 31 mutations) in hypertrypsinaemic newborn infants and to compare it with a previous screening protocol. SETTING: The study comprised all the newborn infants in the period 1 October 1998 to 31 December 1999 in the Lombardia region, north western Italy. METHODS: The screening strategy consisted of an immunoreactive trypsinogen assay from dried blood spots, a polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (PCR-OLA), and a sequence code separation. RESULTS: 104 609 newborn infants were screened. 1457 hypertrypsinaemic infants (1.39%) were analysed with the PCR-OLA assay. 18 newborn homozygotes or compound heterozygotes for CFTR mutations were identified and referred to the cystic fibrosis (CF) centre at a mean age of 3 weeks. 125 infants presenting only one mutation were recalled for a sweat test: a diagnosis of CF was made in 13 infants, and parents of 112 neonates identified as carriers (1:13) received genetic counselling. The remaining 1314 hypertrypsinaemic newborn infants were recalled for IRT retesting and 177 were referred for a sweat test because the second IRT measurement was above the cut off value. Among this group a further two infants were diagnosed with CF (1.1%) leading to a CF prevalence of 1:3170. CONCLUSIONS: This strategy resulted in an early and accurate diagnosis of CF. The IRT/DNA/IRT protocol with an OLA assay was shown to be useful in an Italian population with a genetic heterogeneity, leading to the identification of 94% of infants with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
266 Mutations identified by the assay are G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183-AA→G, 2789+5G→A, delF508, I507del, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, and N1303K. Login to comment

[hide] Demographics of the UK cystic fibrosis population:... Eur J Hum Genet. 2002 Oct;10(10):583-90. McCormick J, Green MW, Mehta G, Culross F, Mehta A
Demographics of the UK cystic fibrosis population: implications for neonatal screening.
Eur J Hum Genet. 2002 Oct;10(10):583-90., [PMID:12357328]

Abstract [show]
The objective was to determine the composition of the Cystic Fibrosis (CF) Population attending specialist UK CF centres in terms of age, gender, age at diagnosis, genotype and ethnicity. With the planned introduction of the national CF screening programme in the UK, cystic fibrosis transmembrane regulator (CFTR) mutations were compared between different ethnic groups enabling a UK-specific frequency of mutations to be defined. Data were analysed from the patient biographies held in the UK CF Database (see www.cystic-fibrosis.org.uk). The currently registered population of 5,274 CF patients is 96.3% Caucasian with a male preponderance that significantly increases with age. The majority of the 196 non-Caucasian CF patients are from the Indian Subcontinent (ISC), of which one in 84 UK CF patients are of Pakistani origin. The commonest CFTR mutation, deltaF508, is found in 74.1% of all CF chromosomes. In the Caucasian CF population, 57.5% are deltaF508 homozygotes but the UK ISC CF population with only 24.7%, has significantly fewer deltaF508 homozygotes patients (95% confidence interval (CI) 0.2-0.4). The distribution of Caucasian patients with deltaF508/deltaF508, deltaF508/Other and Other/Other does not fit the expected distribution with a Hardy-Weinberg model unless those patients without a detected mutation are excluded (P<0.001). The UK CF Database has shown the UK CF population to have distinct characteristics separate from the North American and European CF Registries. The ISC group contains many mutations not recognised by current genetic analysis, and one in four ISC patients have no CFTR mutations identified. The CFTR analysis proposed for the screening programme would detect 96% of patients registered in the database, but is unlikely to achieve the desired >80% detection rates in the ethnic minority groups. Screen-positive, non-Caucasian infants without an identifiable CFTR mutation should be referred for a sweat test and genetic counselling when serum trypsinogen concentrations remain elevated after birth.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 The additional eleven are S549N, 3849+4A?G, 3905insT, 2789+5G?A, Y122X, 711+1G?T, R347P, R347H, R334W, A455E and 3281AA?G. Login to comment

[hide] Standards and guidelines for CFTR mutation testing... Genet Med. 2002 Sep-Oct;4(5):379-91. Richards CS, Bradley LA, Amos J, Allitto B, Grody WW, Maddalena A, McGinnis MJ, Prior TW, Popovich BW, Watson MS, Palomaki GE
Standards and guidelines for CFTR mutation testing.
Genet Med. 2002 Sep-Oct;4(5):379-91., [PMID:12394352]

Abstract [show]
One mission of the ACMG Laboratory Quality Assurance (QA) Committee is to develop standards and guidelines for clinical genetics laboratories, including cytogenetics, biochemical, and molecular genetics specialties. This document was developed under the auspices of the Molecular Subcommittee of the Laboratory QA Committee by the Cystic Fibrosis (CF) Working Group. It was placed on the "fast track" to address the preanalytical, analytical, and postanalytical quality assurance practices of laboratories currently providing testing for CF. Due to the anticipated impact of the ACMG recommendation statement endorsing carrier testing of reproductive couples, it was viewed that CF testing would increase in volume and that the number of laboratories offering CF testing would also likely increase. Therefore, this document was drafted with the premise of providing useful information gained by experienced laboratory directors who have provided such testing for many years. In many instances, "tips" are given. However, these guidelines are not to be interpreted as restrictive or the only approach but to provide a helpful guide. Certainly, appropriately trained and credentialed laboratory directors have flexibility to utilize various testing platforms and design testing strategies with considerable latitude. We felt that it was essential to include technique-specific guidelines of several current technologies commonly used in laboratories providing CF testing, since three of the four technologies discussed are available commercially and are widely utilized. We take the view that these technologies will change, and thus this document will change with future review.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Mutations not included in the 25 mutation core testing panel that have been reported in these populations include D1270N, W1089X, and S549N.13-15 CF 2.8.4 Insufficient information is available for the Asian American population. Login to comment

[hide] Survey of CF mutations in the clinical laboratory. BMC Clin Pathol. 2002 Nov 19;2(1):4. Huber K, Mirkovic B, Nersesian R, Myers A, Saiki R, Bauer K
Survey of CF mutations in the clinical laboratory.
BMC Clin Pathol. 2002 Nov 19;2(1):4., 2002-11-19 [PMID:12437773]

Abstract [show]
BACKGROUND: Since it is impossible to sequence the complete CFTR gene routinely, clinical laboratories must rely on test systems that screen for a panel of the most frequent mutations causing disease in a high percentage of patients. Thus, in a cohort of 257 persons that were referred to our laboratory for analysis of CF gene mutations, reverse line probe assays for the most common CF mutations were performed. These techniques were evaluated as routine first-line analyses of the CFTR gene status. METHODS: DNA from whole blood specimens was extracted and subjected to PCR amplification of 9 exons and 6 introns of the CFTR gene. The resulting amplicons were hybridised to probes for CF mutations and polymorphisms, immobilised on membranes supplied by Roche Molecular Systems, Inc. and Innogenetics, Inc. Denaturing gradient gel electrophoresis and sequencing of suspicious fragments indicating mutations were done with CF exon and intron specific primers. RESULTS: Of the 257 persons tested over the last three years (referrals based on 1) clinical symptoms typical for/indicative of CF, 2) indication for in vitro fertilisation, and 3) gene status determination because of anticipated parenthood and partners or relatives affected by CF), the reverse line blots detected heterozygote or homozygote mutations in the CFTR gene in 68 persons (26%). Eighty-three percent of those affected were heterozygous (47 persons) or homozygous (10 persons) for the DeltaF508 allele. The only other CF-alleles that we found with these tests were the G542X allele (3 persons), the G551D allele (3 persons), the 3849+10kb C-T allele (2 persons) the R117H allele (2 persons) and the 621+1G-T allele (1 person).Of the fifteen IVS8-5T-polymorphisms detected in intron 8, seven (47%) were found in males referred to us from IVF clinics. These seven 5T-alleles were all coupled with a heterozygous DeltaF508 allele, they make up 35% of the males with fertility problems (20 men) referred to us. CONCLUSIONS: In summary, the frequency of CF chromosomes in the cohort examined with these tests was 26%, with the DeltaF508 allele affecting 83% of the CF chromosomes. It is a substantial improvement for routine CF diagnostics to have available a test system for 30 mutations plus the polypyrimidine length variants in intron 8. Our results show that this test system allows a routine first-line analyses of the CFTR gene status.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 F508C, I507V, I506V polymorphism exon 11 1717-1G → A, G542X, S549N, G551D, R553X, R560T exon 20 W1282X exon 21 N1303K intron 19 3849+10kb C → T Innogenetics assay: exon 3 394delTT, G85E, E60X exon/intron 4 621+1G-T, R117H exon 7 1078delT, R347P, R334W exon 13 2143delT, 2183AA-G, 2184delA exon 19 R1162X, 3659delC intron 5 711+5G-A intron8/exon 9 A455E,, 5T,7T,9T intron 14b 2789+5G-A intron 19 3849+10kb C-T Table 2: Genotypes of patients with mutations, final results Group 1) (patients with symptoms typical for/indicative of CF) No. Login to comment

[hide] Analysis of cystic fibrosis transmembrane conducta... Am J Med Genet A. 2003 Jul 1;120A(1):72-6. Timmreck LS, Gray MR, Handelin B, Allito B, Rohlfs E, Davis AJ, Gidwani G, Reindollar RH
Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina.
Am J Med Genet A. 2003 Jul 1;120A(1):72-6., 2003-07-01 [PMID:12794695]

Abstract [show]
The relationship between cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations and congenital absence of the uterus and vagina (CAUV) was examined. CFTR mutations have previously been associated with congenital bilateral absence of the vas deferens (CBAVD). CBAVD is caused by a disruption in the vas deferens, a Wolffian duct derivative. Because the embryologic development of the Mullerian ducts directly depends on the prior normal development of the Wolffian ducts, the same gene products may be necessary for normal embryologic development of both ductal systems. This study evaluated the role of CFTR mutations in the development of CAUV. DNA samples from 25 patients with CAUV were tested for the presence of 33 of the most common CFTR mutations. Protein-coding DNA fragments from the CFTR gene were amplified in vitro by the polymerase chain reaction (PCR) and analyzed for mutations using allele-specific oligonucleotide (ASO) probes. Two patients were heterozygous for CFTR mutations. One was heterozygous for the W1282X mutation and the other was heterozygous for the DeltaF508 mutation. The incidence of the 33 CFTR mutations found in the patients with CAUV (8%) was twice that found in the general population (4%), but much less than the incidence of CFTR mutations in men with CBAVD (80%). This data suggests that it is unlikely for CFTR mutations to cause CAUV in females as they cause CBAVD in some males. Furthermore, the data suggest that CAUV in females may be the same disorder as CBAVD in males who do not have CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 CFTR Gene Mutations Tested DF508 R334W Y1092X 5T variant Y122X R347H G542X S549R 3,849 þ 4 G551D 3,849 þ 10 kb 2,789 þ 5 W1282X R553X 711 þ 1 3,905 þ T 621 þ 1 1,898 þ 1 N1303K 1,717À1 R1162X R117H 1078dT A455E D1507 Q493X 218dA R347P V520F G85E R560T S549N 3659dC Wolffian duct must occur at a time when the Mu¨llerian duct is no longer dependent on the Wolffian duct for development. Login to comment

[hide] 1154insTC is not a rare CFTR mutation. Am J Med Genet A. 2003 Jul 15;120A(2):294-5. Alper OM, Wong LJ, Hostetter G, Cook J, Tenenholz B, Hsu E, Woo MS
1154insTC is not a rare CFTR mutation.
Am J Med Genet A. 2003 Jul 15;120A(2):294-5., 2003-07-15 [PMID:12833419]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 The frequency of this mutation was about 0.5%, higher than some of the mutations, such as DI507, R334W, R347P, and S549N that were in the routine screening panels [Cystic Fibrosis Genetic Analysis Consortium, 1994; Friedman et al., 1995]. Login to comment

[hide] Mutation analysis of the cystic fibrosis transmemb... Eur J Hum Genet. 2003 Sep;11(9):687-92. Perri F, Piepoli A, Stanziale P, Merla A, Zelante L, Andriulli A
Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis.
Eur J Hum Genet. 2003 Sep;11(9):687-92., [PMID:12939655]

Abstract [show]
Susceptibility to alcoholic chronic pancreatitis (ACP) could be genetically determined. Mutations in cationic trypsinogen (PRSS1), cystic fibrosis transmembrane conductance regulator (CFTR), and serine protease inhibitor, Kazal type 1 (SPINK1) genes have been variably associated with both the hereditary and the idiopathic form of chronic pancreatitis (CP). Our aim was to analyze the three genes in ACP patients. Mutational screening was performed in 45 unrelated ACP patients and 34 patients with alcoholic liver disease (ALD). No mutation of PRSS1 was found in ACP and ALD patients. Three mutations of CFTR were detected in four ACP patients with a prevalence (8.9%) not significantly different from that observed (3.0%) in ALD patients and from that expected (3.2%) in our geographical area. Neither compound heterozygotes for CFTR nor trans-heterozygotes for CFTR/SPINK1 were found. One ACP patient (2.2%) was found to carry the most common mutation (N34S) of SPINK1 compared to none of the ALD patients (P=NS). In five other patients (two with ACP and three with ALD) other rare variants, including P55S, were found. In contrast with the hereditary and the idiopathic forms of CP, in which mutations of PRSS1, CFTR, and SPINK1 genes may occur, ACP is still a "gene(s)-orphan" disease. The supposed genetic susceptibility to ACP relies on other yet unknown gene(s) which could affect the alcohol metabolism or modulate the pancreatic inflammatory response to alcohol abuse.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Mutation screening of the CFTR gene The 31 most frequent mutations (F508del, I507del, G551D, G542X, N1303K, 1717-1G4A, W1282X, R553X, R347P, R347H, R334W, 3849+10kb C4T, R117H, 621+1G4T, A455E, S549N, R560T, S549R, V520F, Q493X, 3849+ 4A4G, 1078delT, R1162X, 3659delC, 3905insT, Y122X, 2183delAA4G, 2789+5G4A, 1898+1G4A, 711+1G4T, and G85E) were examined with the polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (OLA, Applied Biosystems, Foster City, CA, USA) and finally a sequence-coded separation. Login to comment

[hide] High allelic heterogeneity between Afro-Brazilians... Genet Test. 2003 Fall;7(3):213-8. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, Phillips JA 3rd, Allito B, Heim RA, Sugarman EA, Probst CM, Faucz F, Culpi L
High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing.
Genet Test. 2003 Fall;7(3):213-8., [PMID:14641997]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by at least 1,000 different mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR). To determine the frequency of 70 common worldwide CFTR mutations in 155 Euro-Brazilian CF patients and in 38 Afro-Brazilian CF patients, we used direct PCR amplification of DNA from a total of 386 chromosomes from CF patients born in three different states of Brazil. The results show that screening for seventy mutations accounts for 81% of the CF alleles in Euro-Brazilians, but only 21% in the Afro-Brazilian group. We found 21 different mutations in Euro-Brazilians and only 7 mutations in Afro-Brazilians. The frequency of mutations and the number of different mutations detected in Euro-Brazilians are different from Northern European and North American populations, but similar to Southern European populations; in Afro-Brazilians, the mix of CF-mutations is different from those reported in Afro-American CF patients. We also found significant differences in detection rates between Euro-Brazilian (75%) and Afro-Brazilian CF patients (21%) living in the same state, Minas Gerais. These results, therefore, have implications for the use of DNA-based tests for risk assessment in heterogeneous populations like the Brazilians. Further studies are needed to identify the remaining CF mutations in the different populations and regions of Brazil.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes. Login to comment

[hide] Structure of nucleotide-binding domain 1 of the cy... EMBO J. 2004 Jan 28;23(2):282-93. Epub 2003 Dec 18. Lewis HA, Buchanan SG, Burley SK, Conners K, Dickey M, Dorwart M, Fowler R, Gao X, Guggino WB, Hendrickson WA, Hunt JF, Kearins MC, Lorimer D, Maloney PC, Post KW, Rajashankar KR, Rutter ME, Sauder JM, Shriver S, Thibodeau PH, Thomas PJ, Zhang M, Zhao X, Emtage S
Structure of nucleotide-binding domain 1 of the cystic fibrosis transmembrane conductance regulator.
EMBO J. 2004 Jan 28;23(2):282-93. Epub 2003 Dec 18., 2004-01-28 [PMID:14685259]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) is an ATP-binding cassette (ABC) transporter that functions as a chloride channel. Nucleotide-binding domain 1 (NBD1), one of two ABC domains in CFTR, also contains sites for the predominant CF-causing mutation and, potentially, for regulatory phosphorylation. We have determined crystal structures for mouse NBD1 in unliganded, ADP- and ATP-bound states, with and without phosphorylation. This NBD1 differs from typical ABC domains in having added regulatory segments, a foreshortened subdomain interconnection, and an unusual nucleotide conformation. Moreover, isolated NBD1 has undetectable ATPase activity and its structure is essentially the same independent of ligand state. Phe508, which is commonly deleted in CF, is exposed at a putative NBD1-transmembrane interface. Our results are consistent with a CFTR mechanism, whereby channel gating occurs through ATP binding in an NBD1-NBD2 nucleotide sandwich that forms upon displacement of NBD1 regulatory segments.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
216 CF mutations in NBD1 The majority of sites of CF-causing missense mutations occur in NBD1, primarily in its a-subdomain, and the locations in the mNBD1 structure of the most common of these (A455E, G480C, I506T, DI507, DF508, S549N, S549R, G551D, A559T, R560T, Y569D, and D648V; Bobadilla et al, 2002) are shown in Figure 3D. Login to comment

[hide] Improved detection of cystic fibrosis mutations in... Hum Reprod. 2004 Mar;19(3):540-6. Epub 2004 Jan 29. Danziger KL, Black LD, Keiles SB, Kammesheidt A, Turek PJ
Improved detection of cystic fibrosis mutations in infertility patients with DNA sequence analysis.
Hum Reprod. 2004 Mar;19(3):540-6. Epub 2004 Jan 29., [PMID:14998948]

Abstract [show]
BACKGROUND: Accurate determination of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene is critical for genetic counselling and treatment of obstructive azoospermia. Of concern is that detection rates with routine CFTR mutation panels vary widely depending on patient ancestry; and such panels have limited value for azoospermic patients, who are more likely to carry rare mutations. An alternative approach offers comprehensive, CFTR mutation analysis by a DNA sequence method. We investigated whether this method could improve CFTR detection rates in men with obstructive azoospermia in a prospective study of men with obstructive azoospermia and their partners who were referred for genetic counselling and testing at one of two institutions. METHODS: Sixteen patients with congenital absence of the vas deferens (CAVD, n = 14) or idiopathic obstructive azoospermia (n = 2) were studied. DNA from all patients was analysed for mutations by the DNA sequence method. In addition to this method, six men underwent CFTR analysis by a common 25 or 31 mutation panel coupled with poly T analysis. In 10 subjects, common mutation panel findings were inferred from DNA sequence method results. RESULTS: Overall, 12/16 (75%) azoospermic patients had one or more CFTR mutations and/or 5T alleles, including 12 mutations in 10 patients (two compound heterozygotes) and seven 5T alleles in six patients (one homozygote). The sequence method detected all mutations and three variants of unknown significance. By comparison, the common mutation panels detected only 3/12 mutations (25%) and 0/3 variants. CONCLUSION: The DNA sequence method detects more CFTR mutations than common mutation panels. Given the serious, clinical consequences of transmitting such mutations, this study underscores the importance of accurate, CFTR mutation detection in men with obstructive azoospermia and their partners.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Polyacrylamide gels were analysed for the presence of mutations following staining in ethidium bromide (EtBr) and image capture under UV using the Gel Doc 1000 system Table I. List of CFTR mutations included in common mutation panels American College of Medical Genetics CF panel (25 mutations) DF508 G542X G551D R117H W1282X N1303K R1162X 3849+10kbC®T DI507 R553X 1717-1G®A 621+1G®T R560T 3659delC 3120+1G®A I148T G85E R334W A455E 1898+1G®A 2148delA 711+1G®T 2789+5G®A R347P 1078delT Six additional mutations and one polymorphism in UCSF panel (31 mutations) Y1092X R347H 3849+4 Q493X 3905insT S549N F508C (polymorphism) (BioRad). Login to comment

[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

[hide] Rare CFTR mutation 1525-1G>A in a Pakistani patien... J Trop Pediatr. 2004 Apr;50(2):120-2. Wahab A, Al Thani G, Dawod ST, Kambouris M, Al Hamed M
Rare CFTR mutation 1525-1G>A in a Pakistani patient.
J Trop Pediatr. 2004 Apr;50(2):120-2., [PMID:15088804]

Abstract [show]
Cystic fibrosis (CF) is rare in non-Caucasian populations, and in such populations little is known about the spectrum of mutations and polymorphisms in the cystic fibrosis transmembrane conductance (CFTR) gene. We report the detection of a very rare CFTR mutation 1525-1G>A in intron 9 in a 5-year-old Pakistani child with typical clinical features of CF. It remains to be seen whether mutation 1525-1G>A is characteristic of Pakistani ethnicity with CF or associated with severe phenotypic features.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Two others (15 per cent) were homozygous for S549N, one (8 per cent) was homozygous for I19, and three (23 per cent) had unidentified mutations. Login to comment

[hide] Population-based newborn screening for genetic dis... Pediatrics. 2004 Jun;113(6):1573-81. Comeau AM, Parad RB, Dorkin HL, Dovey M, Gerstle R, Haver K, Lapey A, O'Sullivan BP, Waltz DA, Zwerdling RG, Eaton RB
Population-based newborn screening for genetic disorders when multiple mutation DNA testing is incorporated: a cystic fibrosis newborn screening model demonstrating increased sensitivity but more carrier detections.
Pediatrics. 2004 Jun;113(6):1573-81., [PMID:15173476]

Abstract [show]
OBJECTIVES: Newborn screening for cystic fibrosis (CF) provides a model to investigate the implications of applying multiple-mutation DNA testing in screening for any disorder in a pediatric population-based setting, where detection of affected infants is desired and identification of unaffected carriers is not. Widely applied 2-tiered CF newborn screening strategies first test for elevated immunoreactive trypsinogen (IRT) with subsequent analysis for a single CFTR mutation (DeltaF508), systematically missing CF-affected infants with any of the >1000 less common or population-specific mutations. Comparison of CF newborn screening algorithms that incorporate single- and multiple-mutation testing may offer insights into strategies that maximize the public health value of screening for CF and other genetic disorders. The objective of this study was to evaluate technical feasibility and practical implications of 2-tiered CF newborn screening that uses testing for multiple mutations (multiple-CFTR-mutation testing). METHODS: We implemented statewide CF newborn screening using a 2-tiered algorithm: all specimens were assayed for IRT; those with elevated IRT then had multiple-CFTR-mutation testing. Infants who screened positive by detection of 1 or 2 mutations or extremely elevated IRT (>99.8%; failsafe protocol) were then referred for definitive diagnosis by sweat testing. We compared the number of sweat-test referrals using single- with multiple-CFTR-mutation testing. Initial physician assessments and diagnostic outcomes of these screened-positive infants and any affected infants missed by the screen were analyzed. We evaluated compliance with our screening and follow-up protocols. All Massachusetts delivery units, the Newborn Screening Program, pediatric health care providers who evaluate and refer screened-positive infants, and the 5 Massachusetts CF Centers and their affiliated genetic services participated. A 4-year cohort of 323 506 infants who were born in Massachusetts between February 1, 1999, and February 1, 2003, and screened for CF at approximately 2 days of age was studied. RESULTS: A total of 110 of 112 CF-affected infants screened (negative predictive value: 99.99%) were detected with IRT/multiple-CFTR-mutation screening; 2 false-negative screens did not show elevated IRT. A total of 107 (97%) of the 110 had 1 or 2 mutations detected by the multiple- CFTR-mutation screen, and 3 had positive screens on the basis of the failsafe protocol. In contrast, had we used single-mutation testing, only 96 (87%) of the 110 would have had 1 or 2 mutations detectable by single-mutation screen, 8 would have had positive screens on the basis of the failsafe protocol, and an additional 6 infants would have had false-negative screens. Among 110 CF-affected screened-positive infants, a likely "genetic diagnosis" was made by the multiple-CFTR-mutation screen in 82 (75%) versus 55 (50%) with DeltaF508 alone. Increased sensitivity from multiple-CFTR-mutation testing yielded 274 (26%) more referrals for sweat testing and carrier identifications than testing with DeltaF508 alone. CONCLUSIONS: Use of multiple-CFTR-mutation testing improved sensitivity and postscreening prediction of CF at the cost of increased referrals and carrier identification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 The 16-mutation panel included ⌬F508, R117H, G551D, G542X, W1282X, N1303K, R334W, 621 ϩ 1GϾT, R553X, ⌬I507, 1717-1GϾA, R347P, R560T, 3849 ϩ 10kbCϾT, A455E, and S549N. Login to comment
80 The 27-mutation panel included all of the 16 except S549N and the following additional mutations: 3120 ϩ 1GϾA, 3659delC, A559T, R1162X, S1255X, 405 ϩ 3AϾC, 711 ϩ 1GϾT, 2789 ϩ 5GϾA, G480C, 2307insA, G85E, and 1078delT. Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Login to comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment
119 In the Hispanic population, our findings support the inclusion, minimally, of 3876delA, R1066C, S549N, and 1949del84 in a mutation panel. Login to comment

[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]

Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment

[hide] CLC-2 single nucleotide polymorphisms (SNPs) as po... BMC Med Genet. 2004 Oct 26;5:26. Blaisdell CJ, Howard TD, Stern A, Bamford P, Bleecker ER, Stine OC
CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity.
BMC Med Genet. 2004 Oct 26;5:26., 2004-10-26 [PMID:15507145]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. METHODS: The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). RESULTS: PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. CONCLUSIONS: CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 We examined human CLC-2 protein expression using lysates from primary nasal cells obtained from elective Table 1: Primers used to amplify CLC-2 polymorphisms Primer oligomer expected size (bp) rat hpolE1 dTCC GGG TCA ATA TCC TTC ACA TCG 2128 hClC-2 promoter dCGC CCG TGG CTC CAT CCC TTC 15F dGTC CCA GGA GTA GAC TTC C 760 bp 16R dCAC TGC CCT CTG GCC TC 17F dTCC CCT CCG GCC TAC CCC TTC CGG T 147 + 300 bp 18R dGGA AGG ATT CGG AGA GGG TTG GGG C Intron 1F dCGC TGC AGC ACG AGC AGA C 2273 Intron 1R dCCC AAG GTC CTG AGT GTA CC Exon 20F dGCC TCT TCT GTG GCA GTC C 481 Exon 20R dCTT CAG GGC TCA TCT CGC C ClC-2 expression by Western blot of nasal polyp lysatesfrom CF adults with the following genotypesFigure 1 ClC-2 expression by Western blot of nasal polyp lysates from CF adults with the following genotypes: Lanes 1,3,6 dF508/dF508; Lane 2: dF508/d559T; Lane 4: unknown; Lane 5: S549N/R553X; Lane 7,9: dF508/unknown; Lane 8: F508/ W1282X.; Lane 10, IB3-1 cell line, genotype F508/W1282X. Login to comment

[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]

Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

[hide] The prevalence and clinical characteristics of cys... Arch Dis Child. 2005 Jul;90(7):675-9. Mei-Zahav M, Durie P, Zielenski J, Solomon M, Tullis E, Tsui LC, Corey M
The prevalence and clinical characteristics of cystic fibrosis in South Asian Canadian immigrants.
Arch Dis Child. 2005 Jul;90(7):675-9., [PMID:15970608]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is considered to be rare among individuals from the Indian subcontinent. Furthermore, affected individuals are reported to experience a more severe clinical course. AIMS: It was hypothesised that CF is under diagnosed in people of South Asian origin and therefore the prevalence may be higher than previously estimated. METHODS: The prevalence of CF in the South Asian and in the general population living in the same geographic region (Metropolitan Toronto) were compared between 1996 and 2001. Population data were obtained from the Canadian census survey. CF phenotype and genotype data were obtained from the Toronto CF database. RESULTS: Among 381 patients with CF, 15 were of South Asian descent. The age related prevalence of CF among the South Asian and general populations was: 0-14 years, 1:9200 versus 1:6600; 15-24 years, 1:13,200 versus 1:7600; older than 25 years, 1:56,600 versus 1:12,400. Age at diagnosis, duration and severity of symptoms at diagnosis, current nutritional status, and FEV(1) were similar in the two groups. While not significant, FEV1 tended to be lower (48% versus 57% predicted) among adult South Asians, compared to the general CF population. Also, the percentage with pancreatic sufficiency was higher (27% versus 16%) and the frequency of DeltaF508 allele was lower (50% versus 65.1%). CONCLUSIONS: These data suggest that the prevalence and natural history of CF in South Asians is similar to that among individuals of European origin. The relatively lower prevalence among older South Asians may reflect an improving recognition of CF in this ethnic subgroup.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
303 Table 3 CFTR gene mutations among CF patients of South Asian origin and all patients living in the same geographic region in the CF population Mutation South Asian CF population Mutation General CF population (number, % of total alleles) (number, % of total alleles) No. identified % of alleles No. identified % of alleles DF508 13 50 DF508 375 65.1 L218X 2 7.7 W1282X 16 2.8 1525-1GRA 1 3.8 G551D 15 2.6 S549N 1 3.8 G542X 10 1.7 3849+10kbCRT 1 3.8 621+1GRT 10 1.7 V392G 1 3.8 R117H 7 1.2 N1303K 7 1.2 49 others (,1%) 89 16.4 Unidentified 7 26.9 Unidentified 47 8.2 What is already known on this topic N CF is rare in populations not of European Caucasian origin N More severe disease has been reported in South Asian CF patients N DF508, the most common mutation in Caucasians, is less prevalent in South Asians What this study adds N Prevalence and clinical course of CF in children of South Asian origin is similar to that in the general Toronto population N Previous reports reflect inadequate awareness of CF in this ethnic group N The prevalence of DF508 is confirmed to be lower in South Asians than other Caucasian groups Mei-Zahav, Durie, Zielenski, et al www.archdischild.com Authors` affiliations . Login to comment

[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2003 Dec;24(6):629-38. Gallati S
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2003 Dec;24(6):629-38., [PMID:16088579]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene, which encodes a protein expressed in the apical membrane of exocrine epithelial cells. CFTR functions principally as a cyclic adenosine monophosphate (cAMP)-induced chloride channel and appears capable of regulating other ion channels. Mutations affect CFTR through a variety of molecular mechanisms, which can produce little or no functional gene product at the apical membrane. More than 1000 different disease-causing mutations within the CFTR gene have been described. The potential of a mutation to contribute to the phenotype depends on its type, localization in the gene, and the molecular mechanism as well as on interactions with secondary modifying factors. Genetic testing can confirm a clinical diagnosis of CF and can be used for infants with meconium ileus, for carrier detection in individuals with positive family history and partners of proven CF carriers, and for prenatal diagnostic testing if both parents are carriers. Studies of clinical phenotype in correlation with CFTR genotype have revealed a very complex relationship demonstrating that some phenotypic features are closely determined by the underlying mutations, whereas others are modulated by modifier genes, epigenetic mechanisms, and environment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 Mutations (missense, nonsense, frameshift, splice, small and large in-frame deletions or insertions) con- Table 1 Distribution of theWorldwide 24 Most Common Cystic Fibrosis Mutationsa Exon/ Northern Southern North South Austral- Relative Mutation Intron Europe Europe America America asia Africa Asia Frequency G85E E 03 30 14 16 n.a. n.a. 0 7 0.15 R117H E 04 62 3 61 n.a. 7 0 0 0.30 621+1G→T I 04 97 37 154 n.a. 27 0 0 0.72 711+1G→T I 05 15 13 21 n.a. n.a. n.a. 0 0.11 1078delT E 07 53 2 1 n.a. 1 n.a. 0 0.13 R334W E 07 18 21 12 n.a. 2 0 0 0.12 R347P E 07 55 24 26 n.a. 1 0 0 0.24 A455E E 09 35 0 27 n.a. n.a. n.a. 0 0.14 ⌬I507 E 10 57 5 20 2 9 0 0 0.21 ⌬F508 E 10 14,866 4007 6901 342 2309 351 173 66.02 1717-1G→A I 10 160 65 44 n.a. 12 0 3 0.65 G542X E 11 439 259 234 38 56 9 27 2.42 S549N E 11 18 2 5 1 3 1 0 0.07 G551D E 11 356 37 206 1 117 0 0 1.64 R553X E 11 165 44 96 5 11 1 0 0.73 R560T E 11 40 0 24 0 3 0 0 0.15 1898+1G→A I 12 41 10 2 n.a. n.a. n.a. 0 0.12 2184delA E 13 14 7 8 n.a. n.a. n.a. 0 0.07 2789+5G→A I 14b 27 10 17 n.a. n.a. n.a. 0 0.12 R1162X E 19 36 68 19 0 2 0 0 0.28 3659delC E 19 39 1 14 n.a. n.a. n.a. 0 0.12 3849+10kbC→T I 19 23 8 57 n.a. n.a. n.a. 16 0.24 W1282X E 20 120 43 245 n.a. 6 2 120 1.22 N1303K E 21 209 179 130 11 23 8 29 1.34 Chromosomes 21,154 7281 10438 758 3095 515 608 screened Detection rate 80.2 66.7 79.9 52.8 83.7 72.2 61.7 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/. Login to comment
67 SSCP analysis is one of the most popular methods for the detection of sequence variants in polymerase chain reaction (PCR) amplified DNA fragments.29 The princi- Table 3 Cystic Fibrosis Mutations Detected by Commercial Kits INNO-LiPA Mutations CF2 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K CFTR12 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K, S1251N, R560T, 3905insT, Q552X CFTR17+Tn 394delTT, G85E, 621+1G→T, R117H, 1078delT, R347P, R334W, E60X, 2183AA→G, 2184delA, 711+5G→A, 2789+5G→A, R1162X, 3659delC, 3849+10kbC→T, 2143delT, A455E, (5T/7T/9T) Elucigene CF4 ⌬F508, G542X, G551D, 621+1G→T CF12 ⌬F508, G542X, G551D, N1303K, W1282X, 1717-1G→A, R553X, 621+1G→T, R117H, R1162X, 3849+10kbC→T, R334W CF20 1717-1G→A, G542X, W1282X, N1303K, ⌬F508, 3849+10kbC→T, 621+1G→T, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA→G, 3659delC, 1078delT, ⌬I507, R345P, S1251N, E60X CF Poly-T 5T/7T/9T OLA CF OLA assay ⌬F508, F508C, ⌬I507, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183AA→G, 2789+5G→A b Figure 2 Mutation screening of exon 19 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene using polymerase chain reaction (PCR) followed by single-strand conformation polymorphism/heteroduplex (SSCP/HD) analysis on a silver-stained polyacrylamide gel. Login to comment

[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]

Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T. Login to comment

[hide] Markedly elevated neonatal immunoreactive trypsino... Arch Dis Child. 2006 Mar;91(3):222-5. Epub 2005 Oct 21. Massie J, Curnow L, Tzanakos N, Francis I, Robertson CF
Markedly elevated neonatal immunoreactive trypsinogen levels in the absence of cystic fibrosis gene mutations is not an indication for further testing.
Arch Dis Child. 2006 Mar;91(3):222-5. Epub 2005 Oct 21., [PMID:16243854]

Abstract [show]
AIMS: To investigate the immunoreactive trypsinogen (IRT) values above the usual 99th centile laboratory cut-off and determine the value of offering further testing to those infants with a markedly elevated IRT but no cystic fibrosis transmembrane regulator (CFTR) gene mutation identified by the screening programme. METHODS: All babies born in Victoria, Australia, between 1991 and 2003, were screened by IRT followed by CF gene mutation analysis. RESULTS: Of the 806,520 babies born, 9268 with the highest IRT levels had CFTR mutation analysis. There were 123 DeltaF508 homozygotes and 703 heterozygotes (86 with CF, 617 carriers). A total of 8442 babies had no CFTR gene mutation, of whom 18 (0.21%) had CF. The total number of CF babies with IRT greater than the laboratory cut-off was 227 (2.4%). The IRT results of the CF patients were distributed normally, with the majority above the laboratory cut-off of newborn IRT results. There was no evidence of an excess of babies with CF in the very highest levels of IRT above the 99th centile. CONCLUSIONS: Only a small proportion of babies with a neonatal IRT >99th centile have CF. Additional CF testing for infants with an elevated IRT but no CFTR gene mutation has an extremely low yield, no matter how high the IRT result.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
222 *All patients underwent an extended CFTR mutation analysis for the following mutations in addition to DF508: G551D, R553X, G542X, R117H, N1303K, 621+1G-T, A455E, V520F, 1717-1G-A, W1282X, R1162X, 3849+10kbC-T, R347P, R334W, R560T, S549N. Login to comment

[hide] Detection of F508del mutation in cystic fibrosis t... Singapore Med J. 2006 Feb;47(2):129-33. Zilfalil BA, Sarina S, Liza-Sharmini AT, Oldfield NJ, Stenhouse SA
Detection of F508del mutation in cystic fibrosis transmembrane conductance regulator gene mutation among Malays.
Singapore Med J. 2006 Feb;47(2):129-33., [PMID:16435054]

Abstract [show]
INTRODUCTION: Cystic fibrosis (CF) is one of the common genetic disorders in the western world. It has been reported to be very rare in Asian populations. According to the Cystic Fibrosis Genetic Analysis Consortium, more than 1,000 mutations of the CF gene have been identified. The CF gene, named the cystic fibrosis transmembrane conductance regulator (CFTR), is located on chromosome 7 and composed of 27 exons. This study aims to detect possible CFTR gene mutations in Malays. METHODS: We analysed 50 blood samples from healthy Malays with no symptoms of CF. DNA was extracted from blood using commercially available extraction kits (Eppendorf, Germany). Identification of CFTR gene mutation was performed using the CF OLA (Oligonucleotide Ligation Assay) kit (Applied Biosystems, USA). The PCR-ligation products were electrophoresed on eight percent sequagel using an ABI PRISM 377 genetic analyser (Applied Biosystems, USA). Electrophoresis data was analysed using the Genotyper software and a report of the CF genotype for all loci tested was created using the CF Genotyper Template software. Out of 50, one sample (two percent) was detected to have the F508del mutation (3bp deletion at exon 10), which is one of the most common CFTR gene mutations in Caucasians. RESULTS: The F508del mutation allele was detected in one subject. This indicates that she was a CF carrier. CONCLUSION: We report the finding of a carrier of the F508del mutation of the CFTR gene in the Malay population. Our finding revealed that CF could also affect the Malay population. Larger studies are necessary to determine the exact gene frequency of this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 MUTATIONS R553X G551D 1507 del F508 del 1717-1 G>A G542X R560T R347P W1282X R334W 1078 Del T 3849 + 10KB C>T R1162X N1303K 3659 Del C A455E R117H 2183 AA>G 2789+5 G>A 1898 +1 G>A 621+1 G>T 711+1 G>T G85E S549N S549R V520F Q493X R347H 3849 +4 A>G 3905 INS T Y122X 4 software before running the gel electrophoresis in 1X TBE using ABI PRISM® 377 Genetic Analyzer (Applied Biosystems, USA) for 45 minutes. Login to comment

[hide] Variants in the glutamate-cysteine-ligase gene are... Am J Respir Crit Care Med. 2006 Aug 15;174(4):415-9. Epub 2006 May 11. McKone EF, Shao J, Frangolias DD, Keener CL, Shephard CA, Farin FM, Tonelli MR, Pare PD, Sandford AJ, Aitken ML, Kavanagh TJ
Variants in the glutamate-cysteine-ligase gene are associated with cystic fibrosis lung disease.
Am J Respir Crit Care Med. 2006 Aug 15;174(4):415-9. Epub 2006 May 11., 2006-08-15 [PMID:16690975]

Abstract [show]
BACKGROUND: Chronic progressive lung disease is the most serious complication of cystic fibrosis (CF). Glutathione plays an important role in the protection of the CF lung against oxidant-induced lung injury. OBJECTIVES: We hypothesized that a polymorphism in a novel candidate gene that regulates glutathione synthesis might influence CF lung disease. METHODS: In a cross-sectional study, subjects were recruited from CF clinics in Seattle and multiple centers in Canada. We tested for an association between CF lung disease and a functional polymorphism in the glutamate-cysteine ligase catalytic subunit (GCLC) gene. Multiple linear regression was used to test for association between polymorphisms of GCLC and severity of CF lung disease while adjusting for age, Pseudomonas aeruginosa infection, and cystic fibrosis transmembrane conductance regulator (CFTR) genotype. Analysis was repeated for patients with CF stratified by CFTR genotype. MEASUREMENTS AND MAIN RESULTS: A total of 440 subjects with CF participated in the study (51% male; mean [+/- SD] age, 26 +/- 11 yr; mean FEV(1), 62 +/- 28% predicted). In the total population, there was a trend toward an association between GCLC genotypes and CF lung disease (linear regression coefficient [SEM], 1.68 [1.0]; p = 0.097). In the stratified analysis, there was a highly significant association between GCLC genotype and CF lung function in subjects with a milder CFTR genotype (linear regression coefficient [SEM], 5.5 (1.7); p = 0.001). CONCLUSIONS: In patients with CF with a milder CFTR genotype, there is a strong association between functional polymorphisms of the GCLC gene and CF lung disease severity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
62 * Severe cystic fibrosis transmembrane conductance regulator (CFTR) mutations (Class I-III) ϭ G542X, R553X, W1282X, R1162X, 621-1G→T, 1717-1G→A, 1078⌬T, 3659⌬C, ⌬F508, ⌬I507, N1303K, S549N, G551D, R560T. Login to comment

[hide] CFTR 5T variant has a low penetrance in females th... Genet Med. 2006 Jun;8(6):339-45. Sun W, Anderson B, Redman J, Milunsky A, Buller A, McGinniss MJ, Quan F, Anguiano A, Huang S, Hantash F, Strom C
CFTR 5T variant has a low penetrance in females that is partially attributable to its haplotype.
Genet Med. 2006 Jun;8(6):339-45., [PMID:16778595]

Abstract [show]
PURPOSE: The study's purpose was to understand the molecular basis for different clinical phenotypes of the 5T variant, a tract of 5 thymidines in intron 8 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which disrupts processing of CFTR mRNA and reduces synthesis from the corresponding CFTR alleles. METHOD: We analyzed the polymorphic TG dinucleotide repeat adjacent to the 5T variant in intron 8 and the codon 470 in exon 10. Patients selected for this study were positive for both the 5T variant and the major cystic fibrosis mutation, Delta F508. Almost all Delta F508 mutation alleles occur in a 10TG-9T-470M haplotype. Therefore, it is possible to determine the haplotype of the 5T variant in trans. RESULTS: Of the 74 samples analyzed, 41 (55%) were 11TG-5T-470M, 31 (42%) were 12TG-5T-470V, and 2 (3%) were 13TG-5T-470M. Of the 49 cases for which we had clinical information, 17.6% of females (6/34) and 66.7% of males (10/15) showed symptoms resembling atypical cystic fibrosis. The haplotype with the highest penetrance in females (42% or 5/12) and more than 80% (5/6) in males is 12TG-5T-470V. We also evaluated 12 males affected with congenital bilateral absence of vas deferens and positive for the 5T variant; 10 of 12 had the 12TG-5T-470V haplotype. CONCLUSION: Overall, the 5T variant has a milder clinical consequence than previously estimated in females. The clinical presentations of the 5T variant are associated with the 5T-12TG-470M haplotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 These mutations include R347H, S549N, S549R, 3876delA, 394delT, 3905insT, and V520F, in addition to the 25-mutation core panel recommended by ACMG/ACOG for population-based CF screening. Login to comment

[hide] CFTR genotype as a predictor of prognosis in cysti... Chest. 2006 Nov;130(5):1441-7. McKone EF, Goss CH, Aitken ML
CFTR genotype as a predictor of prognosis in cystic fibrosis.
Chest. 2006 Nov;130(5):1441-7., [PMID:17099022]

Abstract [show]
STUDY RATIONALE: Certain CFTR genotypes are associated with reduced mortality. The accuracy of using CFTR genotype as a predictor of survival and the mechanisms through which CFTR genotype influences survival are unknown. PARTICIPANTS: All patients with cystic fibrosis (CF) enrolled in the US Cystic Fibrosis Foundation national registry between 1993 and 2002. DESIGN: We examined the prognostic value of CFTR genotype, grouped into "high-risk" and "low-risk" categories based on the effect of their CFTR genotype on phenotype and protein production. MEASUREMENTS AND RESULTS: Clinical and genetic data were available from 15,651 patients with CF. Patients with a high-risk CFTR genotype had a greater than twofold increased risk of death compared to patients with a low-risk CFTR genotype (relative risk, 2.25; 95% confidence interval [CI], 1.77 to 2.84; p < 0.001). This association was partly explained by lung function, nutritional status, pancreatic insufficiency, and Pseudomonas aeruginosa colonization. Of the 1,672 patients who died, median age at death for the high-risk CFTR genotype was 24.2 years (interquartile range, 18.4 to 32.0 years) and for the low-risk CFTR genotype was 37.6 years (interquartile range, 28.8 to 47.9 years; p < 0.001). The positive predictive value of this classification method as a test to identify patients who died before or after their 30th birthday was 69% (95% CI, 67 to 72%) with a negative predictive value of 71% (95% CI, 60 to 80%). CONCLUSIONS: Grouping patients into high-risk and low-risk CFTR genotype categories is associated with significant differences in survival and median age at death. These differences are not fully explained by lung function, nutritional measures, pancreatic insufficiency, or P aeruginosa colonization. Modest reassurance about the likelihood of a milder than average course can be provided for CF patients with a low-risk CFTR genotype, although it should be acknowledged that substantial phenotypic variability exists.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Alleles High-risk CFTR genotype Class I 2,131 G542X, R553X, W1282X, R1162X, 621-1G3T, 1717-1G3A, 1078⌬T, 3659⌬C Class II 11,231 ⌬F508, ⌬I507, N1303K, S549N, G85E Class III 783 G551D, R560T Low-risk CFTR genotype Class IV 391 R117H, R334W, R347P Class V 421 3849 ϩ 10KbC3T, 2789 ϩ 5G3A, A455E *Patients with both CFTR alleles in either class I, class II, or class III were grouped together as a high-risk genotype, while patients with at least one mutant allele in class IV and V were considered to have low-risk genotypes; 380 patients had both mutations in either class I, II, or III, while 314 patients had both mutations in either class IV or V (total, n ϭ 15,651). Login to comment

[hide] One multiplex control for 29 cystic fibrosis mutat... Genet Test. 2007 Fall;11(3):256-68. Lebo RV, Bixler M, Galehouse D
One multiplex control for 29 cystic fibrosis mutations.
Genet Test. 2007 Fall;11(3):256-68., [PMID:17949287]

Abstract [show]
A simple approach is described to synthesize and clone an inexhaustible supply of any homozygous and/or heterozygous controls diluted with yeast genomic DNA to mimic human genome equivalents for use throughout the entire multiplex mutation assay. As a proof of principle, the 25 cystic fibrosis mutation panel selected by the American College of Medical Genetics and four additional mutant sequences were prepared as a single control mixture. The 29 CFTR mutations were incorporated into 17 gene fragments by PCR amplification of targeted sequences using mutagenic primers on normal human genomic DNA template. Flanking primers selected to bind beyond all published PCR primer sites amplified controls for most assay platforms. The 17 synthesized 433-933-bp CFTR fragments each with one to four homozygous mutant sequences were cloned into nine plasmid vectors at the multiple cloning site and bidirectionally sequenced. Miniplasmid preps from these nine clones were mixed and diluted with genomic yeast DNA to mimic the final nucleotide molar ratio of two CFTR genes in 6 x 10(9) bp total human genomic DNA. This mixture was added to control PCR reactions prior to amplification as the only positive control sample. In this fashion >200 multiplex clinical PCR analyses of >4,000 clinical patient samples have been controlled simultaneously for PCR amplification and substrate specificity for 29 tested mutations without cross contamination. This clinically validated multiplex cystic fibrosis control can be modified readily for different test formats and provides a robust means to control for all mutations instead of rotating human genomic controls each with a fraction of the mutations. This approach allows scores of additional mutation controls from any gene loci to be added to the same mixture annually.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
229 The nine normal sequences detected at other tested mutation sites (3876delA; S1255X; 2307insA; 1898ϩ5G Ǟ T; S549R; S549N; V520F; Y122X; and 394delTT) reflected the correct sequence in this mixture of nine cloned sequences. Login to comment

[hide] Distribution of CFTR mutations in Saguenay- Lac-Sa... Genet Med. 2008 Mar;10(3):201-6. Madore AM, Prevost C, Dorfman R, Taylor C, Durie P, Zielenski J, Laprise C
Distribution of CFTR mutations in Saguenay- Lac-Saint-Jean: proposal of a panel of mutations for population screening.
Genet Med. 2008 Mar;10(3):201-6., [PMID:18344710]

Abstract [show]
PURPOSE: Saguenay-Lac-Saint-Jean is a region located in the northeastern part of the Province of Quebec, Canada, and is characterized by a founder effect. In this region, it has been documented that the incidence of cystic fibrosis reached 1/902 live births between 1975 and 1988, three times higher than the average incidence of 1/2500 live births reported in other Caucasian populations. This corresponds to a carrier rate of 1/15. METHODS: Using genotyping data from the Canadian Consortium for Cystic Fibrosis Genetic Studies, this article describes the cystic fibrosis transmembrane conductance regulator profile of the cystic fibrosis population living in the Saguenay-Lac-Saint-Jean region and compares it with cystic fibrosis populations living in three other regions of the Province of Quebec. RESULTS: Significant differences in allelic frequencies of common mutations (as DeltaF508, 621 + 1G>T and A455E), and in percentage of covered allele with three or six mutations, were found in Saguenay-Lac-Saint-Jean compared to other regions. Based on this result, two mutation panels exceeding 90% sensitivity threshold are now proposed for cystic fibrosis carrier screening in this region. CONCLUSION: The implementation of the proposed carrier screening program could diminish the incidence of this disease in this region and allow future parents to make informed decisions about family planning.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Altogether, the six mutations represent 95.89% of the CFTR allele of CF patients in the SLSJ population, whereas the proportions are 86.85, 85.27, and Table 2 Cystic fibrosis mutations present in the four populations studied Mutationa Allelic frequency (number of alleles [%]) Populationb 1 2 3 4 „F508 106 (62.35) 55 (72.37) 398 (72.36) 67 (57.78) 621 ؉ 1G>T 42 (24.71) 6 (7.89) 30 (5.45) 1 (0.85) A455E 12 (7.06) 2 (2.63) 14 (2.55) 1 (0.85) 3199del6 1 (0.59) 1 (1.32) 7 (1.27) 1 (0.85) 711 ؉ 1G>T 1 (0.59) 1 (1.32) 15 (2.73) 1 (0.85) Y1092X 1 (0.59) 1 (1.32) 5 (0.91) 0 R117C 2 (1.18) 0 0 0 ‚I507 1 (0.59) 2 (2.63) 10 (1.82) 0 L206W 1 (0.59) 1 (1.32) 9 (1.64) 0 R1158X 1 (0.59) 0 0 0 S489X 1 (0.59) 0 1 (0.18) 0 R553X 0 2 (2.63) 2 (0.36) 0 R334W 0 1 (1.32) 2 (0.36) 0 G542X 0 0 10 (1.82) 0 G85E 0 0 6 (1.09) 5 (4.24) N1303K 0 0 5 (0.91) 1 (0.85) IVS8-5T 0 0 4 (0.73) 0 W1282X 0 0 3 (0.55) 7 (5.93) R347P 0 0 1 (0.18) 2 (1.69) V520F 0 0 1 (0.18) 0 I1027T 0 0 1 (0.18) 0 R1066C/IVS 0 0 1 (0.18) 0 Q1313X 0 0 1 (0.18) 0 1898ϩ3GϾA 0 0 1 (0.18) 0 2183AAϾG 0 0 1 (0.18) 0 2951insA 0 0 1 (0.18) 0 G551D 0 0 0 2 (1.69) 1525-iG-A 0 0 0 2 (1.69) Y109C 0 0 0 1 (0.85) S549N 0 0 0 1 (0.85) 3154del1G 0 0 0 1 (0.85) UNKNOWN 1 (0.59) 4 (5.26) 20 (3.82) 25 (21.19) Number of alleles genotypedc 170 (100) 76 (100) 550 (100) 118 (100) a The six mutations included in the panels proposed are in bold. Login to comment

[hide] CFTR mutations in Turkish and North African cystic... Genet Test. 2008 Mar;12(1):25-35. Lakeman P, Gille JJ, Dankert-Roelse JE, Heijerman HG, Munck A, Iron A, Grasemann H, Schuster A, Cornel MC, Ten Kate LP
CFTR mutations in Turkish and North African cystic fibrosis patients in Europe: implications for screening.
Genet Test. 2008 Mar;12(1):25-35., [PMID:18373402]

Abstract [show]
AIMS: To obtain more insight into the variability of the CFTR mutations found in immigrant cystic fibrosis (CF) patients who are living in Europe now, and to estimate the test sensitivity of different frequently used methods of DNA analysis to detect CF carriers or patients among these Turkish or North African immigrants. METHODS: A survey among 373 European CF centers asking which CFTR mutations had been found in Turkish and North African CF patients. RESULTS: 31 and 26 different mutations were reported in Turkish and North African patients, identifying 64.2% (113/176) and 87.4% (118/135) alleles, respectively (p < 0.001). The mean sensitivity (detection rate) of three most common CFTR mutation panels to detect these mutations differed between Turkish and North African people, 44.9% (79/176) versus 69.6% (94/135) (p < 0.001), and can be increased to 57.4% (101/176) and 79.3% (107/135) (p < 0.001), respectively, by expanding these panels with 13 mutations which have been found on two or more alleles. CONCLUSION: 35.8% and 12.6%, respectively, of CF alleles in Turkish and North African patients living in Europe now had not been identified. Among these populations, the test sensitivity of common CFTR mutation panels is insufficient for use in screening programs in Europe, even after expansion with frequent Turkish and North African mutations. This raises questions about whether and how to implement CF carrier and neonatal screening in a multiethnic society.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 Identity and Frequency of CFTR Mutations on Unrelated Turkish (Tr) and North African (NA) CF alleles Total number of allelesa Number of CF patients with this mutationb Mutation Exon All Tr NA Homozygote Compound heterozygote: two mutations found Compound heterozygote: one mutation found F508delc 10 73 33 40 27 11 6 N1303K 21 22 12 10 10 5 2 711 þ 1G > T Intron 5 14 - 14 7 2 0 G542X 11 14 6 8 7 1 0 R1162X 19 11 - 11 1 5 2 2183AA > G 13 9 9 - 3 3 1 W1282X 20 7 3 4 2 3 1 2789 þ 5G > A Intron 14b 6 3 3 1 4 1 L227R 6a 4 - 4 3 1 0 1677delTA 10 4 4 - 2 1 1 2184insA 13 4 4 - 1 2 0 R334W 7 4 4 - 1 1 1 G85E 3 4 3 1 1 2 0 R709X 13 3 - 3 2 0 0 L732X 13 3 3 - 2 0 0 2184delA 13 3 3 - 0 3 0 del exon 1-4d 1-4 3 3 - 1 1 0 del exon 19 19 2 2 - 2 0 0 3849 þ 10kbC > T Intron 19 2 - 2 1 0 0 S549N 11 2 1 1 0 1 1 3120 þ G > A Intron 16 2 2 - 1 0 0 3601-2A > G Intron 18 2 2 - 1 0 0 D1152H 18 2 2 - 1 0 0 E1104X 17b 2 - 2 1 0 0 S1159F 19 2 2 - 1 0 0 S977F 16 2 - 2 0 1 0 2347delG 13 2 - 2 1 0 0 4096-3C > G Intron 21 1 1 - 1 0 0 E831X 14a 1 1 - 1 0 0 L619S 13 1 1 - 1 0 0 1525-1G > Ac Intron 9 1 1 - 1 0 0 F1052V 17b 1 1 - 1 0 0 3130delA 17a 1 1 - 1 0 0 R352Q 7 1 - 1 0 1 0 1812-1G > A Intron 11 1 - 1 0 1 0 R553X 11 1 - 1 0 0 1 IVS8-5T Intron 8 1 1 - 0 1 0 R1066C 17b 1 - 1 0 1 0 3129del4 17a 1 - 1 0 1 0 D110H 4 1 1 - 0 1 0 R117H 4 1 - 1 0 1 0 S945L 15 1 - 1 0 1 0 1716G=A 10 1 - 1 0 0 1 711 þ 3A > G Intron 5 1 1 - 0 1 0 R75X 3 1 1 - 0 1 0 R764X 13 1 - 1 0 1 0 S1196X 19 1 1 - 0 1 0 S492F 10 1 - 1 0 1 0 G551D 11 1 - 1 1 0 0 del exon 2 2 1 1 - 1 0 0 Subtotal 231 113 118 - No mutation 80 63 17 - Total 311 176 135 88 60 18 a n ¼ 311 alleles, based on 166 CF patients (332 alleles) with both parents and 22 CF patients (22 alleles) with one parent from Turkey or North Africa, minus 43 alleles of homozygous CF patients with consanguineous parents of whom only one allele was taken into account. Login to comment

[hide] Genetic determinants and epidemiology of cystic fi... Diabetes Care. 2008 Sep;31(9):1789-94. Epub 2008 Jun 5. Adler AI, Shine BS, Chamnan P, Haworth CS, Bilton D
Genetic determinants and epidemiology of cystic fibrosis-related diabetes: results from a British cohort of children and adults.
Diabetes Care. 2008 Sep;31(9):1789-94. Epub 2008 Jun 5., [PMID:18535191]

Abstract [show]
OBJECTIVE: Longer survival of patients with cystic fibrosis has increased the occurrence of cystic fibrosis-related diabetes (CFRD). In this study we documented the incidence of CFRD and evaluated the association between mutations responsible for cystic fibrosis and incident CFRD, while identifying potential risk factors. RESEARCH DESIGN AND METHODS: This was a population-based longitudinal study of 50 cystic fibrosis speciality clinics in the U.K. Subjects included 8,029 individuals aged 0-64 years enrolled in the U.K. Cystic Fibrosis Registry during 1996-2005. Of these, 5,196 with data and without diabetes were included in analyses of incidence, and 3,275 with complete data were included in analyses of risk factors. Diabetes was defined by physician diagnosis, oral glucose tolerance testing, or treatment with hypoglycemic drugs. RESULTS: A total of 526 individuals developed CFRD over 15,010 person-years. The annual incidence was 3.5%. The incidence was higher in female patients and in patients with mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene in classes I and II. In a multivariate model of 377 cases of 3,275 patients, CFTR class (relative risk 1.70 [95% CI 1.16-2.49], class I or II versus others), increasing age, female sex, worse pulmonary function, liver dysfunction, pancreatic insufficiency, and corticosteroid use were independently associated with incident diabetes. CONCLUSIONS: The incidence of CFRD is high in Britain. CFTR class I and II mutations increase the risk of diabetes independent of other risk factors including pancreatic exocrine dysfunction.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Genotypes associated with cystic fibrosis were coded into five established classes reflecting CFTR function of defective production, processing, regulation, conductance, and quantity of CFTR protein (12) as follows: I: G542X, R553X, W1282X, R1162X, 621-1G3T, 1717- 1G3 A, 1078⌬T, and 3659⌬C; II: ⌬F508, ⌬I507, N1303K, and S549N; III: G551Dand R560T; IV: R117H, R334W, G85E, and R347P; V: 3849ϩ5G3A, and A455E; and unknown: 711ϩIG3 T, 2184DA, and 1898ϩIG3 A. Login to comment

[hide] Identification and characterization of CFTR gene m... Ann Hum Genet. 2009 Jan;73(1):26-33. Epub 2008 Sep 8. Sharma N, Singh M, Kaur G, Thapa BR, Prasad R
Identification and characterization of CFTR gene mutations in Indian CF patients.
Ann Hum Genet. 2009 Jan;73(1):26-33. Epub 2008 Sep 8., [PMID:18782298]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. This study was performed on Indian CF patients (n = 50) to investigate the spectrum of mutations in the CFTR gene and their association with intragenic and extragenic marker haplotypes. We report identification of 14 previously known and eight novel mutations, namely 3986-3987delC, 876-6del4, 1792InsA, L69H, S158N, Q493L, I530L and E1329Q. The frequency of delta F508 was found to be 27%. Absolute linkage between delta F508 and the KM.19-GATT-TUB9-M470V-T854T haplotype (2-2-1-1-1) predicts a relatively recent appearance of delta F508 in Indian CF patients. Low frequency of delta F508 mutation and detection of eight novel and thirteen rare mutations reflect a heterogeneous spectrum of mutations in Indian CF patients. Failure to detect mutations in 34% of alleles indicates the possible presence of gross deletions involving one or more exons or may indicate the location of the molecular defects in either the noncoding parts of the gene or in the promoter region, which warrants analysis of those regions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 They included nine missense mutations (L69H, S158N, Q493L, Y517C, V520F, I530L, S549N, E1329Q, and Y1381H), one insertion mutation (1792insA), three splice site mutations (876-6del4, 1525-1G-A, 3120+1G-A), two deletion mutations (1161delC, 3986delC), and 1 nonsense mutation (L218X). Login to comment
68 S549N and 1525-1G-A were the second most common mutations observed in our population (5% each). Login to comment
96 Table 2 Genotypes of CF subjects (n=50) Genotype Number of subjects Delta F508/Delta F508 5 Delta F508/3849+10kb C-T 1 Delta F508/S549N 2 Delta F508/S158N 1 Delta F508/Y1381H 1 Delta F508/1525-1 G-A 2 V520F/R117H 1 I530L/I530L 1 876-6del4/876-6del4 1 1792ins A/1792insA 1 3986-3987delC/3986-3987delC 1 Delta F508/U 10 1161 delC/U 2 L69H/U 1 R117H/U 1 Q493L/U 1 Y517C/U 1 S549N/U 3 G551D/U 1 E1329Q/U 1 N1303K/U 1 Y1381H/U 1 L218X/U 1 R553X/U 1 1525-1G-A/U 3 3120+1G-A/U 2 3849+10kb C-T/U 2 U/U 1 U-unidentified Table 3 Outcome prediction scores of novel substitution mutations identified in Indian CF patients Wild type Mutant Position Output Reliablity Prediction L H 69 0.5210 0 Pathological S N 158 0.3304 3 Neutral Q L 493 0.7784 5 Pathological I L 530 0.0591 8 Neutral E Q 1329 0.1018 7 Neutral Molecular Modelling and Bioinformatics (MMB) program (http://mmb.pcb.ub.es/PMut/) was used for pathological predictions of novel sequence variants. Login to comment
113 We first identified five of the mutations by ARMS (Delta F508, R117H, R553X, N1303K & G551D) and one by restriction digestion (3849+10kbC-T) and later identified by SSCP eight known (Y517C, V520F, S549N, Y1381H, 1525-1G-A, 3120+1G-A, 1161delC and L218X) and eight previously unreported mutations (L69H, S158N, Q493L, I530L, E1329Q, 876-6del4, 1792insA and 3986-3987delC). Login to comment
119 S549N and 1525-1G-A were the second most common mutations, followed by 3849+10kbC-T. Login to comment
120 This corroborates the study of Shastri et al., (2008) which has recommended testing Indian CF patients for delta F508 followed by 1161delC, 3849+10kbC-T and S549N. Login to comment

[hide] Localization studies of rare missense mutations in... Hum Mutat. 2008 Nov;29(11):1364-72. Krasnov KV, Tzetis M, Cheng J, Guggino WB, Cutting GR
Localization studies of rare missense mutations in cystic fibrosis transmembrane conductance regulator (CFTR) facilitate interpretation of genotype-phenotype relationships.
Hum Mutat. 2008 Nov;29(11):1364-72., [PMID:18951463]

Abstract [show]
We have been investigating the functional consequences of rare disease-associated amino acid substitutions in the cystic fibrosis transmembrane conductance regulator (CFTR). Mutations of the arginine residue at codon 1070 have been associated with different disease consequences; R1070P and R1070Q with "severe" pancreatic insufficient cystic fibrosis (CF) and R1070W with "mild" pancreatic sufficient CF or congenital bilateral absence of the vas deferens. Intriguingly, CFTR bearing each of these mutations is functional when expressed in nonpolarized cells. To determine whether R1070 mutations cause disease by affecting CFTR localization, we created polarized Madin Darby canine kidney (MDCK) cell lines that express either wild-type or mutant CFTR from the same genomic integration site. Confocal microscopy and biotinylation studies revealed that R1070P was not inserted into the apical membrane, R1070W was inserted at levels reduced from wild-type while R1070Q was present in the apical membrane at levels comparable to wild-type. The abnormal localization of CFTR bearing R1070P and R1070W was consistent with deleterious consequences in patients; however, the profile of CFTR R1070Q was inconsistent with a "severe" phenotype. Reanalysis of 16 patients with the R1070Q mutation revealed that 11 carried an in cis nonsense mutation, S466X. All 11 patients carrying the complex allele R1070Q-S466X had severe disease, while 4 out of 5 patients with R1070Q had "mild" disease, thereby reconciling the apparent discrepancy between the localization studies of R1070Q and the phenotype of patients bearing this mutation. Our results emphasize that localization studies in relevant model systems can greatly assist the interpretation of the disease-causing potential of rare missense mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
171 Of those with CBAVD, one patient carried a mutation known to cause pancreatic insufficient CF (S549N [c.1646G4A; p.Ser549Asn]), a second patient carried a mutation associated with CBAVD (D1152 H [c.3454G4C; p.Asp1152His]), and the third carried a mutation of unknown disease association (F1337 V [c.4009T4G; Phe1337Val]). Login to comment

[hide] A novel approach to CFTR mutation testing by pyros... Clin Chem. 2009 Jun;55(6):1083-91. Epub 2009 Apr 16. Bickmann JK, Kamin W, Wiebel M, Hauser F, Wenzel JJ, Neukirch C, Stuhrmann M, Lackner KJ, Rossmann H
A novel approach to CFTR mutation testing by pyrosequencing-based assay panels adapted to ethnicities.
Clin Chem. 2009 Jun;55(6):1083-91. Epub 2009 Apr 16., [PMID:19372188]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a common autosomal recessive genetic disorder caused by a variety of sequence alterations in the CFTR gene [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)]. Because the relative prevalence of mutations strongly depends on the ethnic background, first-level testing of CF as defined by recent consensus recommendations ought to be adaptable to the ethnicity of patients. METHODS: We therefore developed and implemented a diagnostic approach to first-level testing for CF based on published mutation frequencies and Pyrosequencing (PSQ) technology that we complemented with standard procedures of mutation detection at the second level. RESULTS: The current test system of PSQ assays for 46 target CF mutations [including CFTRdele2,3 (21 kb) and 1342-6 (T)(n) (5T/7T/9T)] permits recombinations of single assays to optimize sensitivities for certain ethnicities. By easy expansion of the original mutation panel, the first-level test sensitivities with other ethnic groups would be increased, provided that the mutation frequencies are known. The test was validated with our local, ethnically mixed, but mainly German population (155 patients). The mutation-detection rate for the 92 patients whose CF was confirmed by the sweat test was 89.0% for the patients of German descent (73 of the 92 patients) and 73.7% for the patients of any other origin (19 of the 92 patients). Ethnicity-adapted testing panels for our foreign CF patients would increase the sensitivities for the respective groups by approximately 5%. CONCLUSIONS: PSQ-based genotyping is a reliable, convenient, highly flexible, and inexpensive alternative to conventional methods for first-level testing of CFTR, facilitating flexible adaptation of the analyzed mutation panel to any local ethnic group.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
100 Diagnostic evaluation of the PSQ-based first-level testing of a predominantly German CF population.a Panethnic population Clinical diagnosis All patients Sweat test-confirmed CF Suspected atypical CF Carrier screening Chromosomes, n 310 184 96 30 PSQ screen 168 (54.2%) 158 (85.9%) 5 (5.2%) 5 (33.3%) Conventional sequencing 25 (8.1%) 25 (13.6%) 0 (0%) 0 (0%) Total detected alleles 193 (62.3%) 183 (99.5%) 5 (5.2%) 5 (33.3%) German ethnicity Other ethnicities Clinical diagnosis Sweat test-confirmed CF Sweat test-confirmed CF Chromosomes, n 146 38 PSQ screen F508del 106 (72.6%) 14 (36.8%) I507del 1 (0.7%) 1 (2.6%) 1677delTA 0 (0%) 2 (5.3%) G551D 6 (4.1%) 0 (0%) R553X 2 (1.4%) 0 (0%) Q552X 1 (0.7%) 0 (0%) G542X 2 (1.4%) 1 (2.6%) S549N 0 (0%) 2 (5.3%) W1282X 1 (0.7%) 3 (7.9%) R117H 1 (0.7%) 0 (0%) 1342-12 (TG)11-5T 0 (0%) 0 (0%) R347P 2 (1.4%) 1 (2.6%) 3849ϩ10kb CϾT 2 (1.4%) 0 (0%) N1303K 3 (2.1%) 3 (7.9%) 1717-1 GϾA 1 (0.7%) 0 (0%) CFTRdele2,3 (21 kb) 2 (1.4%) 1 (2.6%) Sum 130 (89.0%) 28 (73.7%) Conventional sequencing 16 (11.0%) 9 (23.7%) Total detected alleles 146 (100%) 37 (97.4%) a Data are presented as the number of chromosomes (percent). Login to comment
118 An example of the integration of a mutation that was not primarily targeted (S549N) into a PSQ assay for G542X. Login to comment
121 Conventional sequencing of exon 11 confirmed the homozygous state of S549N, and MLPA analysis excluded the combination of S549N with a gross deletion. Login to comment
122 By changing the order of base injections, we obtained pyrograms optimized to detect S549N, facilitating automated genotype calling of this mutation in the future (extended assay, right panel). Login to comment
123 See Fig. 1 in the online Data Supplement for example pyrograms of a wild-type sample and heterozygous samples for G542X and S549N. Login to comment
153 The fact that simultaneously detecting some mutations (e.g.: F508del, 1677delTA, and I507del; G542X and S549N; or G551D, R553X, and Q552X) within a single assay improves the sensitivity of each PSQ run underlines even further the advantages that arise from detecting neighboring mutations as well as the target mutation within one assay (Table 2). Login to comment

[hide] Cystic fibrosis: defining a disease under-diagnose... Trop Med Int Health. 2009 May;14(5):542-5. Shah U, Frossard P, Moatter T
Cystic fibrosis: defining a disease under-diagnosed in Pakistan.
Trop Med Int Health. 2009 May;14(5):542-5., [PMID:19645745]

Abstract [show]
OBJECTIVE: Cystic fibrosis is frequently missed in the Pakistani population due to lack of appropriate diagnostic tools. Thus our aim was to define unknown disease-causing mutations to help create suitable diagnostic tests and improve understanding of what appears to be an aggressive and under-diagnosed disease in this population. METHODS: Patients with elevated sweat chloride values and clinically suspected CF were recruited from Aga Khan University, Pakistan. Mutations DF508, S549R, S549N, Y569D, 296 + 12(T>C), G553X, G551D and G551X were screened for by allele specific polymerase chain reactions. CFTR exons 10, 11 and 12 were sequenced by direct DNA sequencing. RESULTS: Of 150 patients tested by PCR, 26 (17.3%) were positive for DeltaF508. One patient was a F508/S549N compound heterozygote. Eighty-three of 87 patients sequenced for mutations in exon 10 were normal; 42/43 for exon 11 and 29 for exon 12 were normal. CONCLUSION: This first step in defining mutations involved in Pakistani CF suggests that DeltaF508 is uncommon and S549 was the only additional mutation identified in CFTR exons 10, 11 and 12. Identification of the remaining mutations and their frequency is required to design appropriate tests and improve understanding and management of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 One patient was a F508 / S549N compound heterozygote. Login to comment
29 For example, S549N (G>A) homozygosity previously reported from a Pakistani family has also been associated with significant disease, while in contrast another patient with a compound heterozygote mutation, S549R / R1158X gene, presented with a mild form of CF (Frossard et al. 1999; Romey et al. 1999). Login to comment
51 Common mutations such as DF508, S549R, S549N, Y569D, 296 + 12(T>C), R553X, G551D and G551X were screened by allele-specific polymerase chain reaction using published oligonucleotide sequences as template primers (Kerem et al. 1989; Riordan et al. 1989; Rommens et al. 1989; : Collins 1992b). Login to comment
60 The remaining 150 samples were tested by PCR for DF508, S549N, S549R, Y569D, 296 + 12(T>C), R553X, G551D, G551X (Table 1). Login to comment
64 One patient was identified with a compound DF508 / S549N mutation. Login to comment
81 These mutations were S549N, S549R, Y569D, 296 + 12(T>C), R553X, G551D and G551X. Login to comment
84 Some of the common mutations detected on PCR in our study, such as the S549N and S549R, were not confirmed by sequencing. We did confirm the results of one patient who was a compound heterozygote for the DF508 / S549N Table 1 Frequencies of mutations identified by allele specific PCR Mutations Homozygous Heterozygous delF508 12 14 S549N 0 1 S549R 1 19 Y569D 0 0 296 + 12(T>C) 0 0 R553X 0 0 G551D 0 0 G551X 0 0 Table 2 Mutations identified by sequencing Exon Sequenced (n) Mutations identified (n) Exon 10 87 4 Exon 11 43 1 Exon 12 29 0 Tropical Medicine and International Health volume 14 no 5 pp 542-545 may 2009 U. Shah et al. Cystic fibrosis in Pakistan ª 2009 Blackwell Publishing Ltd mutation and had very aggressive disease. Login to comment
87 Previously identified regional mutations, except for S549N, were not found in our patients. Login to comment

[hide] Non-classic cystic fibrosis associated with D1152H... Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15. Burgel PR, Fajac I, Hubert D, Grenet D, Stremler N, Roussey M, Siret D, Languepin J, Mely L, Fanton A, Labbe A, Domblides P, Vic P, Dagorne M, Reynaud-Gaubert M, Counil F, Varaigne F, Bienvenu T, Bellis G, Dusser D
Non-classic cystic fibrosis associated with D1152H CFTR mutation.
Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15., [PMID:19843100]

Abstract [show]
BACKGROUND: Limited knowledge exists on phenotypes associated with the D1152H cystic fibrosis transmembrane conductance regulator (CFTR) mutation. METHODS: Subjects with a D1152H allele in trans with another CFTR mutation were identified using the French Cystic Fibrosis Registry. Phenotypic characteristics were compared with those of pancreatic insufficient (PI) and pancreatic sufficient (PS) cystic fibrosis (CF) subjects in the Registry (CF cohort). RESULTS: Forty-two subjects with D1152H alleles were identified. Features leading to diagnosis included chronic sinopulmonary disease (n = 25), congenital absence of the vas deferens (n = 11), systematic neonatal screening (n = 4), and genetic counseling (n = 2). Median age at diagnosis was 33 [interquartile range (IQR, 24-41)] years in D1152H subjects. Median sweat chloride concentrations were 43.5 (39-63) mmol/l in D1152H subjects and were markedly lower than in PI and PS CF subjects (p < 0.05). Bronchiectasis was present in 67% of D1152H subjects, but Pseudomonas aeruginosa colonization and pancreatic insufficiency were present in <30% of subjects. Estimated rates of decline in forced expiratory volume in 1 s (FEV(1)) were lower in D1152H subjects vs PI CF subjects (p < 0.05). None of the D1152H subjects identified since 1999 had died or required lung transplantation. CONCLUSIONS: When present in trans with a CF-causing mutation, D1152H causes significant pulmonary disease, but all subjects had prolonged survival.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The CF genetic analysis panel used in France seeks for 32 mutations: G85E, 394delTT, 621+1G>T, 711+1G>T, R334W, R347P, R347H, 1078delT, 5T/7T/9T, A455E, F508del, I507del, V520F, 1717-1G>A, G542X, G551D, R553X, R560T, S549R (T>G), S549N, 1898+1G>A, 2183AA>G, 2184delA, 2789+5G>A, 3120+1G>A, R1162X, 3659delC, 3849+10kbC>T, W1282X, 3905insT, 3876delA, N1303K. Login to comment
98 Diagnostic features in 42 D1152H subjects according to the other CFTR mutation class Subject Sex (M/F) Other CFTR mutation Sweat Cl- mean (mmol/l) Age at diagnosis (years) Presentation at diagnosis Class I mutations 1 F W1282X 58 4 Pneumonia recurrent bronchitis 2 F W1282X 25 74 Bronchiectasis 3 M W1282X 43 33 CBAVD 4 M G542X 48 39 CBAVD 5 M G542X 72 27 CBAVD 6 F S1206X 18 13 Recurrent bronchitis+ diarrhea 7 F 394delTT 19 41 Bronchiectasis 8 F 394delTT 25 18 Bronchiectasis 9 F Q552X 56 43 Bronchiectasis Class II mutations 10 F F508del 13 42 Bronchiectasis 11 F F508del 40 32 Bronchiectasis 12 F F508del 52 23 Bronchiectasis 13 M F508del 51 15 Bronchiectasis 14 F F508del 100 24 Bronchiectasis 15 M F508del 79 26 Bronchiectasis 16 F F508del - 43 Bronchiectasis 17 M F508del - 23 Bronchiectasis 18 F F508del 19 55 Bronchiectasis 19 F F508del 25 33 Bronchiectasis 20 F F508del 78 15 Bronchiectasis 21 M F508del 90 40 Bronchiectasis 22 F F508del 44 42 Bronchiectasis 23 M F508del 88 11 Bronchiectasis 24 F F508del 63 47 Bronchiectasis 25 F F508del 43 33 Bronchiectasis 26 M F508 del 62 49 Bronchiectasis 27 M F508del 20 - CBAVD 28 M F508del - 27 CBAVD 29 M F508del 42 36 CBAVD 30 M F508del 36 34 CBAVD 31 M F508del 40 36 CBAVD 32 M F508del 41 30 CBAVD 33 M F508del 82 9 Asymptomatic genetic counseling 34 M F508del - 0 Neonatal screening 35 F F508del 53 0 Neonatal screening 36 F F508del 35 0 Neonatal screening 37 M F508del 35 0 Neonatal screening Class III mutation 38 F S549N 75 31 Bronchiectasis Class IV mutations 39 M E116K 80 41 ABPA+ diarrhea 40 M D1152H 34 34 CBAVD 41 M R1070Q 56 38 CBAVD Class V mutation 42 M 3849+10kbC>T 31 40 Asymptomatic genetic counseling ABPA, allergic bronchopulmonary aspergillosis; CBAVD, congenital bilateral absence of the vas deferens. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Cancer. 2010 Jan 1;116(1):203-9. McWilliams RR, Petersen GM, Rabe KG, Holtegaard LM, Lynch PJ, Bishop MD, Highsmith WE Jr
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations and risk for pancreatic adenocarcinoma.
Cancer. 2010 Jan 1;116(1):203-9., 2010-01-01 [PMID:19885835]

Abstract [show]
BACKGROUND: Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are common in white persons and are associated with pancreatic disease. The purpose of this case-control study was to determine whether CFTR mutations confer a higher risk of pancreatic cancer. METHODS: In a case-control study, the authors compared the rates of 39 common cystic fibrosis-associated CFTR mutations between 949 white patients with pancreatic adenocarcinoma and 13,340 white controls from a clinical laboratory database for prenatal testing for CFTR mutations. The main outcome measure was the CFTR mutation frequency in patients and controls. RESULTS: Overall, 50 (5.3%) of 949 patients with pancreatic cancer carried a common CFTR mutation versus 510 (3.8%) of 13,340 controls (odds ratio [OR], 1.40; 95% confidence interval [CI], 1.04-1.89; P = .027). Among patients who were younger when their disease was diagnosed (<60 years), the carrier frequency was higher than in controls (OR, 1.82; 95% CI, 1.14-2.94; P = .011). In patient-only analyses, the presence of a mutation was associated with younger age (median 62 vs 67 years; P = .034). In subgroups, the difference was seen only among ever-smokers (60 vs 65 years, P = .028). Subsequent sequencing analysis of the CFTR gene detected 8 (16%) compound heterozygotes among the 50 patients initially detected to have 1 mutation. CONCLUSIONS: Carrying a disease-associated mutation in CFTR is associated with a modest increase in risk for pancreatic cancer. Those affected appear to be diagnosed at a younger age, especially among smokers. Clinical evidence of antecedent pancreatitis was uncommon among both carriers and noncarriers of CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 * Mutations recommended for screening by the American College of Medical Genetics.16 Mutations not listed but included in the 39-site assay: 3120þ1G>A, R334W, 3569delC, 1078delT, S549N, 3876delA, 1898þ5G>T, 2307insA, Y1092X, M1101K, S1255X, Y122X, A559T; in the 33-site assay: 3120þ1G>A, R334W, 3569delC, S549N, 3876delA, F508C. Login to comment

[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT. Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

[hide] Mutational spectrum of cystic fibrosis in the Leba... J Cyst Fibros. 2010 Dec;9(6):406-10. Epub 2010 Aug 25. Farra C, Menassa R, Awwad J, Morel Y, Salameh P, Yazbeck N, Majdalani M, Wakim R, Yunis K, Mroueh S, Cabet F
Mutational spectrum of cystic fibrosis in the Lebanese population.
J Cyst Fibros. 2010 Dec;9(6):406-10. Epub 2010 Aug 25., [PMID:20797923]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most common autosomal recessive disease in Caucasians; it is however, considered to be rare in the Arab populations. Reports of the cystic fibrosis transmembrane regulator (CFTR) mutations from Arabs, especially from the Lebanese population, are limited. METHODS: Twenty-two unrelated Lebanese families, with at least one child with CF, were studied. DNA extracts from blood samples of patients and parents were screened for CFTR gene mutations. RESULTS: Eleven different mutations were identified. Of the 44 alleles studied, the most common mutations were: F508del (34%), N1303K (27%), W1282X (7%), and S4X (7%). Five mutations - not previously reported in the Lebanese population - were identified; these are: S549N, G542X, 2043delG, 4016insG, and R117H-7T. CONCLUSIONS: The most common CFTR mutations in addition to five mutations not previously described in the Lebanese population were identified. Identification of CFTR mutations in the Lebanese population is important for molecular investigations and genetic counseling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Five mutations - not previously reported in the Lebanese population - were identified; these are: S549N, G542X, 2043delG, 4016insG, and R117H-7T. Login to comment
27 Family Origin Community CM Sex CF mutations Age at diagnosis CP Sweat test 1 Bekaa Maronite No M W1282X Mount Lebanon Maronite F 4010del4 M W1282X/4010del4 1 year Pu Positive 2 North Sunnite Yes M N1303K North Sunnite F N1303K M N1303K/N1303K 7 months Pu, Gi, GR Positive 3 South Shiite Yes M F508del Shiite F F508del M F508del/F508del 2 years Pu, Gi, GR Positive 4 Mount Lebanon Greek-orthodox Yes M F508del Mount Lebanon Maronite F W1282X M F508del/W1282X 2 weeks Gi Positive 5 North Sunnite No M S549N North Sunnite F G542X M S549N/G542X 19 years Pu, Gi Positive 6 Bekaa Sunnite Yes M N1303K Bekaa Sunnite F N1303K M N1303K/N1303K 8 months Gi, GR Positive 7 Beirut Maronite No M 2789+5GNA Beirut Greek-Orthodox F F508del M F508del/2789+5GNA 6 months Pu, Gi, GR Positive 8 North Sunnite Yes M 2043delG North Sunnite F 2043delG M 2043delG/2043delG 6 weeks Gi No data 9 North Sunnite Yes M R117H-7T North Sunnite F R117H-7T M R117H-7T/R117H-7T 3 months Pu Positive 10 South Sunnite Yes M 4016insG South Sunnite F 4016insG M 4016insG/4016insG 3 months Pu Positive M 4016insG/4016insG 5 months Pu Positive 11 Mount Lebanon Maronite No M N1303K Mount Lebanon Greek-Catholic F N1303K M N1303K/N1303K 3 months Pu, Gi Positive 12 North Maronite No M S4X Mount Lebanon Maronite F N1303K M N1303K/S4X 1 month Pu, Gi, Gr Positive 13 Bekaa Greek-Catholic No M F508del No data Maronite F 4010del4 F F508del/4010del4 11 months Pu, Gi Positive 14 No data Greek-Catholic No M W1282X No data Maronite F F508del F W1282X/F508del 2 years No data Positive 15 Mount Lebanon Baptist No M F508del Mount Lebanon Maronite F N1303K F F508del/N1303K 3 years Pu, Gi, Gr Positive 16 North Sunnite Yes M F508del North Sunnite F F508del F F508del/F508del 9 months Pu, Gi, Gr Negative 17 North Sunnite Yes M N1303K Sunnite F N1303K F N1303K./N1303K 2 years Pu, Gr Positive 18 North Sunnite No M F508del North Sunnite F F508del F F508del/F508del 7 months Pu, Gi, Gr Positive 19 North Maronite No M F508del No data Maronite F F508del M F508del/F508del 7 years Pu, Gi, Gr Positive 20 Beirut Maronite No data M S4X No data Maronite F S4X M S4X/S4X 9 months Pu, Gi No data (continued on next page) diagnosis was based mainly on the clinical picture according to the consensus criteria [16] and was confirmed when possible by a positive sweat chloride test. Login to comment
39 These mutations were W1282X, 4010del4, N1303K, F508del, S549N, G542X, 2043delG, R117H-7T, 2789 + 5G NA, 4016insG, and S4X. Login to comment
42 Five mutations that were not previously reported in the Lebanese population were identified, these are: S549N, G542X, 2043delG, 4016insG and R117H-7T. Login to comment
51 Common CFTR mutations in the Lebanese population Frequency of CF alleles (%) Lebanona Palestine [17] Jordan [24] Syria [29] Saudi Arabia, United Arab Emirates, Oman, Qatar, Kuwait, and Jordan [1] Saudi Arabia [3,25] Bahrain [27] F508 del 36.3 23.5 7.4 1 patient 12 15 7.7 W1282X 13.8 10.6 N1303K 20 21 1.5 3-14 4010del4 7.5 2.3 S4X 6.3 2789+5GNA 2.5 2043delG 2.5 7 30.8 4016insG 2.5 R117H-7T 2.5 G542X 1.3 1.2 4096-28G→A 1.3 E672del 1.3 M952I 1.3 S549N 1.3 a Mutations in a total of 80 identified CF alleles in the Lebanese population from this study combined with Desgeorges et al. (1997) [2]. Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Low abundance of sweat duct Cl- channel CFTR in bo... Am J Physiol Regul Integr Comp Physiol. 2011 Mar;300(3):R605-15. Epub 2011 Jan 12. Brown MB, Haack KK, Pollack BP, Millard-Stafford M, McCarty NA
Low abundance of sweat duct Cl- channel CFTR in both healthy and cystic fibrosis athletes with exceptionally salty sweat during exercise.
Am J Physiol Regul Integr Comp Physiol. 2011 Mar;300(3):R605-15. Epub 2011 Jan 12., [PMID:21228336]

Abstract [show]
To understand potential mechanisms explaining interindividual variability observed in human sweat sodium concentration ([Na(+)]), we investigated the relationship among [Na(+)] of thermoregulatory sweat, plasma membrane expression of Na(+) and Cl(-) transport proteins in biopsied human eccrine sweat ducts, and basal levels of vasopressin (AVP) and aldosterone. Lower ductal luminal membrane expression of the Cl(-) channel cystic fibrosis transmembrane conductance regulator (CFTR) was observed in immunofluorescent staining of sweat glands from healthy young adults identified as exceptionally "salty sweaters" (SS) (n = 6, P < 0.05) and from patients with cystic fibrosis (CF) (n = 6, P < 0.005) compared with ducts from healthy young adults with "typical" sweat [Na(+)] (control, n = 6). Genetic testing of healthy subjects did not reveal any heterozygotes ("carriers") for any of the 39 most common disease-causing CFTR mutations in the United States. SS had higher baseline plasma [AVP] compared with control (P = 0.029). Immunostaining to investigate a potential relationship between higher plasma [AVP] (and sweat [Na(+)]) and ductal membrane aquaporin-5 revealed for all groups a relatively sparse and location-dependent ductal expression of the water channel with localization primarily to the secretory coil. Availability of CFTR for NaCl transport across the ductal membrane appears related to the significant physiological variability observed in sweat salt concentration in apparently healthy humans. At present, a heritable link between healthy salty sweaters and the most prevalent disease-causing CFTR mutations cannot be established.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
114 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X. Login to comment
119 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X. Login to comment

[hide] Implementation of the first worldwide quality assu... Clin Chim Acta. 2011 Jul 15;412(15-16):1376-81. Epub 2011 Apr 14. Earley MC, Laxova A, Farrell PM, Driscoll-Dunn R, Cordovado S, Mogayzel PJ Jr, Konstan MW, Hannon WH
Implementation of the first worldwide quality assurance program for cystic fibrosis multiple mutation detection in population-based screening.
Clin Chim Acta. 2011 Jul 15;412(15-16):1376-81. Epub 2011 Apr 14., 2011-07-15 [PMID:21514289]

Abstract [show]
BACKGROUND: CDC's Newborn Screening Quality Assurance Program collaborated with several U.S. Cystic Fibrosis Care Centers to collect specimens for development of a molecular CFTR proficiency testing program using dried-blood spots for newborn screening laboratories. METHODS: Adult and adolescent patients or carriers donated whole blood that was aliquoted onto filter paper cards. Five blind-coded specimens were sent to participating newborn screening laboratories quarterly. Proficiency testing results were evaluated based on presumptive clinical assessment. Individual evaluations and summary reports were sent to each participating laboratory and technical consultations were offered if incorrect assessments were reported. RESULTS: The current CDC repository contains specimens with 39 different CFTR mutations. Up to 45 laboratories have participated in the program. Three years of data showed that correct assessments were reported 97.7% of the time overall when both mutations could be determined. Incorrect assessments that could have lead to a missed case occurred 0.9% of the time, and no information was reported 1.1% of the time due to sample failure. CONCLUSIONS: Results show that laboratories using molecular assays to detect CFTR mutations are performing satisfactorily. The programmatic results presented demonstrate the importance and complexity of providing proficiency testing for DNA-based assays.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
129 Allele Allele Allele Allele p.Gly85Glu G85E (0.26) p.Arg117His R117H (0.54) c.489+1 GNT 621+1 GNT (1.3) p.Phe508del F508del (66.31) p.Arg347Pro R347P (0.36) p.lle507del I507del (0.90) p.Gly551Asp G551D (1.93) c.2052delA 2184delA (0.15) c.1585-1 GNA 1717-1 GNA (0.44) p.Gly542X G542X (2.64) c.3528delC 3659delC (0.28) p.Asn1303Lys N1303K (1.27) p.Arg553X R553X (1.21) p.Arg560Thr R560T (0.30) p.Arg1162X R1162X (0.30) c.2657+5 GNA 2789+5 GNA (0.38) c.3717+12191 CNT 3849+10kbCNT (0.85) c.2988+1 GNA 3120+1 GNA (0.86) p.Trp1282X W1282X (2.20) p.Ala455Glu A455E (0.26) c.1766+1 GNA 1898+1 GNA (0.13) c.579+1 GNT 711+1 GNT (0.35) p.Arg334Trp R334W (0.37) c.54-5940 _273+10250del21kb CFTR dele2,3 p.Ser549Asn S549N (0.14) c.1584 GNA 1716 G→A c.2051_2052delAAinsG 2183AANG (0.1) c.3140-26ANG 3272-26ANG c.262_263delTT 394delTT p.Arg1066Cys R1066C (0.03) p.Arg1066His R1066H c.1022_1023insTC 1154insTC c.2989-1 GNA 3121-1 GNA c.(?_2989)_(3139_? Login to comment

[hide] Clinical outcomes in infants with cystic fibrosis ... Pediatr Pulmonol. 2011 Apr 29. doi: 10.1002/ppul.21475. Ren CL, Desai H, Platt M, Dixon M
Clinical outcomes in infants with cystic fibrosis transmembrane conductance regulator (CFTR) related metabolic syndrome.
Pediatr Pulmonol. 2011 Apr 29. doi: 10.1002/ppul.21475., 2011-04-29 [PMID:21538969]

Abstract [show]
An unavoidable outcome of cystic fibrosis newborn screening (CF NBS) programs is the detection of infants with an indeterminate diagnosis. The United States CF Foundation recently proposed the term cystic fibrosis transmembrane conductance regulator related metabolic syndrome (CRMS) to describe infants with elevated immunoreactive trypsinogen (IRT) on NBS who do not meet diagnostic criteria for CF. The objective of this study was to describe the clinical outcomes of infants with CRMS identified through an IRT/DNA algorithm. We reviewed the records of all infants with CRMS diagnosed at our CF Center from 2002 to 2010. We identified 12 infants, and compared them to 27 infants diagnosed with CF by NBS. Compared to CF patients, CRMS patients were more likely to be pancreatic sufficient as assessed by fecal elastase measurement (100% vs. 8%, P < 0.01). Their weight for age percentile was normal from birth. A positive oropharyngeal (OP) culture for Pseudomonas aeruginosa (Pa) was found in 25% of CRMS patients. One patient with the F508del/R117H/7T genotype was reassigned the diagnosis of CF after he had a positive OP culture for Pa, and his follow up sweat Cl at 1 year of life was 73 mmol/L. CF patients were more likely to receive oral antibiotics and be hospitalized for pulmonary symptoms. Our results indicate that CRMS patients can develop signs of CF disease, but have a milder clinical course than CF infants. Close initial monitoring of these patients is warranted. Pediatr. Pulmonol. (c) 2011 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1-CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected. Login to comment
61 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1- CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected. Login to comment

[hide] Congenital bilateral absence of vas deferens with ... Clin Genet. 1998 Mar;53(3):202-4. Arduino C, Ferrone M, Brusco A, Garnerone S, Fontana D, Rolle L, Carbonara AO
Congenital bilateral absence of vas deferens with a new missense mutation (P499A) in the CFTR gene.
Clin Genet. 1998 Mar;53(3):202-4., [PMID:9630075]

Abstract [show]
We describe a congenital bilateral absence of the vas deferens (CBAVD) patient with a compound heterozygosity in the cystic fibrosis transmembrane regulator (CFTR) gene for a stop mutation W1282X and a new missense mutation P499A. The P499A is interpreted as a mild mutation whose phenotypic effects, in this case limited to the development of wolffian duct derivatives, are revealed only in combination with a severe CFTR mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Other missense mutations in this domain (A455E, P574H, G576A, S549N) have been found associated with a mild CF phenotype and their functional analysis in transfected cells revealed a low transport efficiency of the chloride channel and a reduced protein expression at the apical cell surface, which can explain the mild clinical phenotype (6). Login to comment

[hide] Mutations of the cystic fibrosis gene in patients ... N Engl J Med. 1998 Sep 3;339(10):645-52. Sharer N, Schwarz M, Malone G, Howarth A, Painter J, Super M, Braganza J
Mutations of the cystic fibrosis gene in patients with chronic pancreatitis.
N Engl J Med. 1998 Sep 3;339(10):645-52., 1998-09-03 [PMID:9725921]

Abstract [show]
BACKGROUND: The pancreatic lesions of cystic fibrosis develop in utero and closely resemble those of chronic pancreatitis. Therefore, we hypothesized that mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene may be more common than expected among patients with chronic pancreatitis. METHODS: We studied 134 consecutive patients with chronic pancreatitis (alcohol-related disease in 71, hyperparathyroidism in 2, hypertriglyceridemia in 1, and idiopathic disease in 60). We examined DNA for 22 mutations of the CFTR gene that together account for 95 percent of all mutations in patients with cystic fibrosis in the northwest of England. We also determined the length of the noncoding sequence of thymidines in intron 8, since the shorter the sequence, the lower the proportion of normal CFTR messenger RNA. RESULTS: The 94 male and 40 female patients ranged in age from 16 to 86 years. None had a mutation on both copies of the CFTR gene. Eighteen patients (13.4 percent), including 12 without alcoholism, had a CFTR mutation on one chromosome, as compared with a frequency of 5.3 percent among 600 local unrelated partners of persons with a family history of cystic fibrosis (P<0.001). A total of 10.4 percent of the patients had the 5T allele in intron 8 (14 of 134), which is twice the expected frequency (P=0.008). Four patients were heterozygous for both a CFTR mutation and the 5T allele. Patients with a CFTR mutation were younger than those with no mutations (P=0.03). None had the combination of sinopulmonary disease, high sweat electrolyte concentrations, and low nasal potential-difference values that are diagnostic of cystic fibrosis. CONCLUSIONS: Mutations of the CFTR gene and the 5T genotype are associated with chronic pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 DNA Studies We extracted DNA from buccal cells obtained by having the patients rinse their mouths with 10 ml of 4 percent sucrose.19 The CFTR locus was examined for the 22 mutations that together account for 95 percent of all such mutations in patients with cystic fibrosis in the northwest of England.20 The amplification- refractory mutation system Elucigene CF(4)m kit (Zeneca Diagnostics, Macclesfield, United Kingdom) was used to detect the four most common mutations: ∆F508, G551D, G542X, and 621+1(G→T)21; the polymerase chain reaction, restriction-enzyme analysis, and allele-specific oligonucleotide hybridization facilitated the detection of R560T, R117H, 1898+1(G→A), R553X, S549N, 1717¡1(G→A), N1303K, W1282X, E60X, 1154insTC, R347P, 3659delC, Q493X, V520F, R334W, ∆I507, 3849+10Kb(C→T), and 1078delT. Login to comment

[hide] Relation between mutations of the cystic fibrosis ... N Engl J Med. 1998 Sep 3;339(10):653-8. Cohn JA, Friedman KJ, Noone PG, Knowles MR, Silverman LM, Jowell PS
Relation between mutations of the cystic fibrosis gene and idiopathic pancreatitis.
N Engl J Med. 1998 Sep 3;339(10):653-8., 1998-09-03 [PMID:9725922]

Abstract [show]
BACKGROUND: It is unknown whether genetic factors predispose patients to idiopathic pancreatitis. In patients with cystic fibrosis, mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene typically cause pulmonary and pancreatic insufficiency while rarely causing pancreatitis. We examined whether idiopathic pancreatitis is associated with CFTR mutations in persons who do not have lung disease of cystic fibrosis. METHODS: We studied 27 patients (mean age at diagnosis, 36 years), 22 of whom were female, who had been referred for an evaluation of idiopathic pancreatitis. DNA was tested for 17 CFTR mutations and for the 5T allele in intron 8 of the CFTR gene. The 5T allele reduces the level of functional CFTR and is associated with an inherited form of infertility in males. Patients with two abnormal CFTR alleles were further evaluated for unrecognized cystic fibrosis-related lung disease, and both base-line and CFTR-mediated ion transport were measured in the nasal mucosa. RESULTS: Ten patients with idiopathic chronic pancreatitis (37 percent) had at least one abnormal CFTR allele. Eight CFTR mutations were detected (prevalence ratio, 11:1; 95 percent confidence interval, 5 to 23; P<0.001). In three patients both alleles were affected (prevalence ratio, 80:1; 95 percent confidence interval, 17 to 379; P<0.001). These three patients did not have lung disease typical of cystic fibrosis on the basis of sweat testing, spirometry, or base-line nasal potential-difference measurements. Nonetheless, each had abnormal nasal cyclic AMP-mediated chloride transport. CONCLUSION: In a group of patients referred for evaluation of idiopathic pancreatitis, there was a strong association between mutations in the CFTR gene and pancreatitis. The abnormal CFTR genotypes in these patients with pancreatitis resemble those associated with male infertility.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Pancreatograms were assessed for the severity of chronic pancreatitis according to published criteria by a reviewer who was unaware of the patients` histories (Table 1).19 DNA Studies We extracted DNA from blood samples20 and tested for 16 CFTR mutations - ∆F508, W1282X, R117H, 621+1(G→T), R334W, R347P, A455E, ∆I507, 1717¡1(G→A), G542X, S549N, G551D, R553X, R560T, N1303K, and 3849+10Kb(C→T) - using reverse dot blot strips (Roche Molecular Systems, Alameda, Calif.). Login to comment

[hide] Detection of CFTR mutations using temporal tempera... Electrophoresis. 2004 Aug;25(15):2593-601. Wong LJ, Alper OM
Detection of CFTR mutations using temporal temperature gradient gel electrophoresis.
Electrophoresis. 2004 Aug;25(15):2593-601., [PMID:15300780]

Abstract [show]
Cystic fibrosis (CF), caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, is one of the most common autosomal recessive diseases with variable incidences and mutation spectra among different ethnic groups. Current commercially available mutation panels designed for the analysis of known recurrent mutations have a detection rate between 38 to 95%, depending upon the ethnic background of the patient. We describe the application of a novel mutation detection method, temporal temperature gradient gel electrophoresis (TTGE), to the study of the molecular genetics of Hispanic CF patients. TTGE effectively identified numerous rare and novel mutations and polymorphisms. One interesting observation is that the majority of the novel mutations are splice site, frame shift, or nonsense mutations that cause severe clinical phenotypes. Our data demonstrate that screening of the 27 exons and intron/exon junctions of the CFTR gene by TTGE greatly improves the molecular diagnosis of Hispanic CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 For example, the p.Q98X and p.Q98R mutations in exon 4; and p.S466X and p.S492F mutations in exon 10, were detected in the temperature range of 52-607C and 51- 577C, respectively. The p.G542X, p.R553X, p.S549N, and p.A559T in exon 11; p.A561E, c.189811G.A, and c.189813A.G in exon 12; and p.W1204X in exon 19; were detected in the temperature range of 51 to 567C. Login to comment
96 Detection of known mutations and polymorphisms by TTGE Base substitution Mutation Exon or intron Homozygote or heterozygote Polymorphism or mutation # Alleles detected 1 c.386G.A p.G85E 3 Heterozygote Mutation 2 2 c.575T.C p.I148T 4 Heterozygote Mutation 2 3 c.406-1G.A Splice Int 4 Heterozygote Mutation 9 4 c.71111G.T Splice Int 5 Heterozygote Mutation 1 5 c.1059_1069del 3bp p.F311del 7 Heterozygote Mutation 2 6 c.1132C.T p.R334W 7 Heterozygote Mutation 2 7 c.1652_1655del 3bp p.F508del 10 Heterozygote Mutation 94 8 Homozygote Mutation 12 c.1540A/G p.M470V 10 Heterozygote Polymorphism 15 9 Homozygote Polymorphism 4 c.1756G.T p.G542X 11 Heterozygote Mutation 13 10 c.1784G.A p.G551D 11 Heterozygote Mutation 1 11 c.1778G.A p.S549N 11 Heterozygote Mutation 4 12 c.1789C.T p.R553X 11 Homozygote Mutation 2 13 c.1807G.A p.A559T 11 Heterozygote Mutation 2 14 c.189811G.A Splice Int 12 Heterozygote Mutation 1 15 c.1949del84bp Frameshift 13 Heterozygote Mutation 3 16 c.278915G.A Splice Int 14b Heterozygote Mutation 2 17 c.312011G.A Splice Int 16 Heterozygote Mutation 9 18 c.3171delC Frameshift 17a Heterozygote Mutation 1 19 c.3398G.A p.W1089X 17b Heterozygote Mutation 1 20 c.3425G.A p.W1098X 17b Heterozygote Mutation 1 21 c.3616C.T p.R1162X 19 Heterozygote Mutation 2 22 c.3791delC Frameshift 19 Heterozygote Mutation 1 23 c.3821delT Frameshift 19 Heterozygote Mutation 1 24 c.3876delA Frameshift 20 Heterozygote Mutation 4 25 c.3905insT Frameshift 20 Heterozygote Mutation 1 26 c.4041C.G p.N1303K 21 Heterozygote Mutation 2 Total 194 The translation starts at c.133 of CFTR CDNA sequence in GenBank Acc. Login to comment

[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]

Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 Our impression is that Table 3 Common CF mutations identified in this study and in several Latin American populations Mutation This study Hispanic1 Mexico2 Colombia3 Brazil4 Argentina5 Chile6 p.F508del 51.7 51.6 40.7 41.8 48.4 58.6 45.0 p.G542X 7.7 4.0 6.2 3.8 8.8 4.1 7.0 p.N1303K 2.9 0.8 2.0 0.5 2.5 2.7 - c.1811 + 1,6kbA > G 1.8 - - 6.5 - 0.9 - p.R334W 1.8 1.6 - 0.5 2.5 1.1 2.0 p.L206W 1.6 - - - 0.6 - - c.711 + 1G > T 1.6 - - - - - - p.Q890X 1.4 - - - - - - p.R1162X 1.3 0.8 - 1.1 2.5 0.4 2.0 c.2789 + 5G > A 1.2 - - 0.5 0.3 0.7 - p.R1066C 1.2 1.6 - 0.5 - 0.2 - p.I507del 1.0 - 2.6 - - 0.7 - c.2183AA > G 0.8 - 1.0 - 0.2 - p.G85E 0.7 0.8 0.5 - 1.3 0.7 - p.W1282X 0.7 0.8 - 1.1 1.3 2.7 5.0 c.3849 + 10kbC > T 0.4 4.0 0.5 - - 0.9 3.0 p.S549N - 2.4 2.6 - - - - c.3120 + 1G > A - 1.6 - 0.5 - - - c.3876delA - 5.6 - - - - - c.406-1G > A - 1.6 1.5 - - - - c.935delA - 1.6 1.0 - - - - p.R75X - 0.8 1.5 - - - - c.2055del9 - - 1.0 - - - - p.I506T - - 1.0 - - - - c.3199del6 - - 1.0 - - - - p.S549R 0.4 - - 2.2 - 0.2 - c.1717-1G > A 0.2 - - - 0.3 1.1 - p.G551D 0.2 0.8 0.5 - - - 1.0 p.R553X 0.4 - 0.5 - 0.6 0.2 1.0 No. Login to comment

[hide] Genetic, epidemiological, and clinical aspects of ... Am J Gastroenterol. 2010 Aug;105(8):1876-83. Epub 2010 May 25. Joergensen MT, Brusgaard K, Cruger DG, Gerdes AM, Schaffalitzky de Muckadell OB
Genetic, epidemiological, and clinical aspects of hereditary pancreatitis: a population-based cohort study in Denmark.
Am J Gastroenterol. 2010 Aug;105(8):1876-83. Epub 2010 May 25., [PMID:20502448]

Abstract [show]
OBJECTIVES: In a population-based, well-defined group of patients first regarded as having pancreatitis of unknown origin (PUO), we identified, described, and compared the clinical and genetic aspects of patients with hereditary pancreatitis (HP) and with cystic fibrosis transmembrane conductance regulator gene (CFTR) and serine protease inhibitor Kazal type 1 gene (SPINK1) mutations with patients who retained the diagnosis of true idiopathic pancreatitis (tIP) after genetic testing for HP, SPINK1, and CFTR mutations. METHODS: Patients with PUO were identified in the Danish National Registry of Patients or were referred by clinicians. DNA from blood was analyzed for cationic trypsinogen (PRSS1), SPINK1, and CFTR mutations. Considering the diagnosis of HP, a pedigree was drawn for each patient. RESULTS: A genetic mutation was found in 40% of 122 patients with PUO. After testing first-degree relatives of the 18 initially identified HP patients, 38 HP patients in total were identified, and 28 patients had SPINK1-CFTR mutations. Among HP patients, no p.N29I mutations were found and the p.A16V mutation was more frequent than previously reported, 45 and 32% had exocrine and endocrine insufficiency, respectively, and among tIP patients 9 and 12%, respectively. Pancreatic cancer was diagnosed in 5% of the HP families. CONCLUSIONS: The genotype of the Danish population with HP differs from that of previously described cohorts. The occurrence of exocrine and endocrine insufficiency is higher among patients with HP than in patients with SPINK1-CFTR mutations and tIP, and more HP families develop pancreatic cancer. Genetic testing thus helps to predict the prognosis of the pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 The samples were also tested for 33 CFTR mutations, and all 6 classeswererepresented:394delTT,p.R553X,621+1G>T,p.R1162X, 1717-1G>A,3659delC,p.G542X,2183AA>G,p.W1282X,1078delT, 711+1G>T, F508del, p.S549N, I507del, p.S549R, 2184delA, p.G551D, p.G85E, p.N1303K, p.R560T, p.R117H, p.R347H, p.R347P, p.R334W, 2789+5G>A, 3849+10kbC>T, p.A445E, 3120+1G>A, p.V520F,1898+1G>A,3876delA,3905insT,andIVS8-5T.DNAwas amplified by multiplex PCR (Hybaid 4 A62, Middlesex, UK). Login to comment

[hide] Cystic fibrosis in Chilean patients: Analysis of 3... J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30. Lay-Son G, Puga A, Astudillo P, Repetto GM
Cystic fibrosis in Chilean patients: Analysis of 36 common CFTR gene mutations.
J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30., [PMID:21036675]

Abstract [show]
BACKGROUND: CFTR gene mutations have worldwide differences in prevalence and data on Chilean patients is scarce. METHODS: We studied 36 of the most common CFTR mutations in Chilean patients from the CF National Program [Programa Nacional de Fibrosis Quistica (PNFQ)] of the Ministry of Health of Chile. RESULTS: Two hundred and eighty-nine patients were studied. Fourteen different mutations were identified with an overall allele detection rate of 42.0%. Mutations with frequencies greater than 1% were p.F508del (30.3% of alleles), p.R334W (3.3%), p.G542X (2.4%), c.3849+10Kb C>T (1.7%), and p.R553X (1.2%). A north to south geographical gradient was observed in the overall rate of detection. CONCLUSIONS: Southern European CFTR mutations predominate in the Chilean population, but a high percentage of alleles remain unknown. Geographical heterogeneity could be explained in part by admixture. Complementary analyses are necessary to allow for effective genetic counselling and improve cost-effectiveness of screening and diagnostic tests.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Mutation This study Rios et al. [4] Molina et al. [5] Repetto et al. [6] Perez et al. [13] CFGAC [2] (n=578) (%) (n=72) (%) (n=36) (%) (n=100) (%) (n=4102) (%) (n=43,849) (%) Chile Chile Chile Chile Latin-Americaa Worldwide Unknown 58.0 66.6 61.1 34.0 36.7 22.7 p.F508del 30.6 29.2 30.6 45.0 47.1 66.0 p.R334W 3.1 - - 2.0 0.8 0.1 p.G542X 2.4 0 8.3 7.0 5.0 2.4 c.3849+10Kb CNT 1.7 - - 3.0 0.3 0.2 p.R553X 1.2 4.2 0 1.0 0.4 0.7 p.R1162X 0.9 - - 2.0 1.0 0.3 p.1078delT 0.5 - - 0 b0.1 0.1 p.G85E 0.5 - - - 0.8 0.2 p.W1282X 0.2 - - 5.0 1.0 1.2 c.3120+1 GNA 0.2 - - - 0.3 - c.711+1 GNT 0.2 - - - 0.1 0.1 p.R117H 0.2 - - 0 b0.1 0.3 p.A455E 0.2 - - 0 0 0.1 p.I148T 0.2 - - - - - p.G551D 0 0 0 1.0 0.1 1.6 p.N1303K 0 0 0 0 1.8 1.3 c.621+1 GNT 0 - - 0 0.2 0.7 c.1717-1 GNA 0 - - 0 0.3 0.6 p.I507del 0 - - 0 0.2 0.2 p.R347P 0 - - 0 0 0.2 c.2789+5 GNA 0 - - - 0.2 0.1 c.1898+1 GNA 0 - - - 0.1 0.1 c.2184delA 0 - - - b0.1 0.1 p.S549N 0 - 0 - 0.1 0.1 c.3659delC 0 - - 0 0.1 0.1 p.R560T 0 - - - 0 0.1 c.1811+1.6Kb ANG 0 - - - 0.4 - c.2183AANG 0 - - 0 0.1 - p.S549R 0 - - - 0.1 - c.3272-26 ANG 0 - - - 0.1 - c.3199del6 0 - - - b0.1 - p.E60X 0 - - 0 0 - c.3905insT 0 - - - 0 - p.S1251N 0 - - 0 - - CFTRdele2,3 0 - - - - - p.R347H 0 - - - - - p.V520F 0 - - - - - p.Q552X 0 - - - - - c.394delTT 0 - - - - - c.711+1 GNA 0 - - - - - c.2143delT 0 - - - - - c.3876delA 0 - - - - - a Data from Chilean patients published in Rios et al., Molina et al., and Repetto et al. [4-6] included in this publication were excluded in this table to avoid repetition. Login to comment

[hide] Functional insertion of the SV40 large T oncogene ... J Biol Chem. 1991 Nov 5;266(31):21239-46. Chastre E, Di Gioia Y, Barbry P, Simon-Bouy B, Mornet E, Fanen P, Champigny G, Emami S, Gespach C
Functional insertion of the SV40 large T oncogene in cystic fibrosis intestinal epithelium. Characterization of CFI-3 cells.
J Biol Chem. 1991 Nov 5;266(31):21239-46., [PMID:1718974]

Abstract [show]
Intestinal epithelial cells were isolated from a fetus with cystic fibrosis (CF) and transfected with a plasmid vector recombined with the ori- mutant of SV40. A population of proliferative cells was then subcloned and designated as CFI-3. These cells had a doubling time of 24 h and were maintained in culture for up to 25 passages. At passage 8, CFI-3 cells did not produce any tumors in nude mice. Northern blot and immunofluorescence studies indicated that the extended lifespan of CFI-3 cells results in genomic insertion of SV40 LT. Intestinal CFI-3 cells are epithelial, according to the expression of the human cytokeratin 18 gene and poorly differentiated by phase-contrast and electron microscopy. Functional membrane receptors activated by vasoactive intestinal peptide (VIP), its natural analogue pituitary adenylate cyclase activating peptide (PACAP-38), and isoproterenol were observed in CFI-3 cells. Restriction fragment length polymorphism analysis of the PstI KM19 site revealed that the cftr locus was identical in the chorionic villi and in CFI-3 cells. The manifestation of CF in this family was not related to the common mutation delta F508, since this fetus was heterozygous for the substitutions S549N and N1303K. Chloride transport, assessed by the 125I efflux, was induced in CFI-3 cells by the calcium inophore ionomycin, but not by the adenylate cyclase activator forskolin, and was inhibited by the chloride channel blocker 5-nitro-2-(3-phenylpropylamino)benzoic acid. These results were confirmed in patch clamp studies in which the cpt cAMP analogue failed to stimulate membrane currents, while the calcium ionophore ionomycin stimulated inward currents. We conclude that intestinal CFI-3 cells retain the CF phenotype relating to defective regulation of Cl- channels, and therefore constitute a suitable model, 1) for elucidating the function of CFTR protein, 2) developing new therapeutic agents, and 3) correcting the CF defect by gene replacement therapy in vitro.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
143 This mutation changes a serine codon to asparagine within the first nucleotide binding fold and is referred to S549N. Login to comment
207 The S549N mutation observed here in intestinal CFI-3 cells causes a conservative substitution between uncharged polar amino acids. Login to comment

[hide] Multidrug resistance in Aspergillus nidulans invol... Mol Gen Genet. 1997 Apr 28;254(4):417-26. Del Sorbo G, Andrade AC, Van Nistelrooy JG, Van Kan JA, Balzi E, De Waard MA
Multidrug resistance in Aspergillus nidulans involves novel ATP-binding cassette transporters.
Mol Gen Genet. 1997 Apr 28;254(4):417-26., [PMID:9180695]

Abstract [show]
Two single-copy genes, designated atrA and atrB (ATP-binding cassette transporter A and B), were cloned from the filamentous fungus Aspergillus nidulans and sequenced. Based on the presence of conserved motifs and on hydropathy analysis, the products encoded by atrA and atrB can be regarded as novel members of the ATP-binding cassette (ABC) superfamily of membrane transporters. Both products share the same topology as the ABC transporters PDR5 and SNQ2 from Saccharomyces cerevisiae and CDR1 from Candida albicans, which are involved in multidrug resistance of these yeasts. Significant homology also occurs between the ATP-binding cassettes of AtrA and AtrB, and those of mammalian ABC transporters (P-glycoproteins). The transcription of atrA and, in particular, atrB in mycelium of A. nidulans is strongly enhanced by treatment with several drugs, including antibiotics, azole fungicides and plant defense toxins. The enhanced transcription is detectable within a few minutes after drug treatment and coincides with the beginning of energy-dependent drug efflux activity, reported previously in the fungus for azole fungicides. Transcription of the atr genes has been studied in a wild-type and in a series of isogenic strains carrying the imaA and/or imaB genes, which confer multidrug resistance to various toxic compounds such as the azole fungicide imazalil. atrB is constitutively transcribed at a low level in the wild-type and in strains carrying imaA or imaB. Imazalil treatment enhances transcription of atrB to a similar extent in all strains tested. atrA, unlike atrB, displays a relatively high level of constitutive expression in mutants carrying imaB. Imazalil enhances transcription of atrA more strongly in imaB mutants, suggesting that the imaB locus regulates atrA. Functional analysis demonstrated that cDNA of atrB can complement the drug hypersensitivity associated with PDR5 deficiency in S. cerevisiae.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
182 The substitution in this motif of the conserved serine (S) by N in the CFTR gene product (S549N) is associated with cystic ®brosis in man (Cutting et al. 1990). Login to comment

[hide] CFTR! Am J Physiol. 1992 Aug;263(2 Pt 1):C267-86. Fuller CM, Benos DJ
CFTR!
Am J Physiol. 1992 Aug;263(2 Pt 1):C267-86., [PMID:1381146]

Abstract [show]
Cystic fibrosis (CF) is a fatal genetic disease primarily affecting Caucasians, although cases have been reported from other ethnic groups. CF has a complex etiology, but it is chiefly a disease of electrolyte transport and is characterized by defects in fluid secretion by several epithelia, including the sweat duct, exocrine pancreas, and the pulmonary airways. The link between CF and a defect in cAMP-mediated Cl- transport in secretory epithelia was established in the early 1980s. Since then, numerous electrophysiological studies have focused on the characterization and regulation of individual Cl- channels underlying the macroscopic Cl- currents of secretory epithelia in the airways, sweat ducts, and gut. In this review the results of these studies in the light of current knowledge of the function of the CF gene product, the CF transmembrane conductance regulator (CFTR) protein, will be analyzed. The CFTR protein is a member of a family of ATP-binding proteins that act as unidirectional solute pumps. These proteins are membrane spanning, are found in both prokaryotic and eukaryotic cells, and have two ATP-binding domains. The family includes the p-glycoproteins that are involved with the expression of multidrug resistance in certain tumor cells. The majority of CF chromosomes (70%) have a single codon deletion that translates to a missing phenylalanine residue at position 508 (delta F508) of the protein. Unique for this family of proteins, the CFTR protein possesses an additional highly charged domain (the R domain) containing several consensus polypeptide sequences for kinase phosphorylation. Although CFTR bears structural resemblance to this family of ATP-dependent pumps, overexpression of the protein in a variety of different cell types is associated with the appearence of a cAMP-sensitive Cl- channel. We critically examine current information concerning the structure-function relationships of the CFTR protein obtained from both electrophysiological and biochemical approaches. We also summarize recent evidence suggesting that the CFTR protein may act as a pump and a channel, a hypothesis in keeping with the multifaceted nature of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
437 CFTR mRNA levels were also reduced in a compound nonsense/missense heterozygote (R553X/ S549N). Login to comment

[hide] CFTR mutation combinations producing frequent comp... Hum Mutat. 2012 Nov;33(11):1557-65. doi: 10.1002/humu.22129. Epub 2012 Jul 2. El-Seedy A, Girodon E, Norez C, Pajaud J, Pasquet MC, de Becdelievre A, Bienvenu T, des Georges M, Cabet F, Lalau G, Bieth E, Blayau M, Becq F, Kitzis A, Fanen P, Ladeveze V
CFTR mutation combinations producing frequent complex alleles with different clinical and functional outcomes.
Hum Mutat. 2012 Nov;33(11):1557-65. doi: 10.1002/humu.22129. Epub 2012 Jul 2., [PMID:22678879]

Abstract [show]
Genotype-phenotype correlations in cystic fibrosis (CF) may be difficult to establish because of phenotype variability, which is associated with certain CF transmembrane conductance regulator (CFTR) gene mutations and the existence of complex alleles. To elucidate the clinical significance of complex alleles involving p.Gly149Arg, p.Asp443Tyr, p.Gly576Ala, and p.Arg668Cys, we performed a collaborative genotype-phenotype correlation study, collected epidemiological data, and investigated structure-function relationships for single and natural complex mutants, p.[Gly576Ala;Arg668Cys], p.[Gly149Arg;Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala;Arg668Cys]. Among 153 patients carrying at least one of these mutations, only three had classical CF and all carried p.Gly149Arg in the triple mutant. Sixty-four had isolated infertility and seven were healthy individuals with a severe mutation in trans, but none had p.Gly149Arg. Functional studies performed on all single and natural complex mutants showed that (1) p.Gly149Arg results in a severe misprocessing defect; (2) p.Asp443Tyr moderately alters CFTR maturation; and (3) p.Gly576Ala, a known splicing mutant, and p.Arg668Cys mildly alter CFTR chloride conductance. Overall, the results consistently show the contribution of p.Gly149Arg to the CF phenotype, and suggest that p.[Arg668Cys], p.[Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala;Arg668Cys] are associated with CFTR-related disorders. The present study emphasizes the importance of comprehensive genotype-phenotype and functional studies in elucidating the impact of mutations on clinical phenotype. Hum Mutat 33:1557-1565, 2012. (c) 2012 Wiley Periodicals, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 [2002C>T;3718-2477C>T] p.Gln689X 2 CSD Nasal polyposis 14 y,16 y NA, 29 p.[Gly576Ala;Arg668Cys] NI 3 IP 35-39 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 IP Bronchitis 49 y NA p.[Gly576Ala;Arg668Cys] p.PheF508del 1 IP 42 y NA p.[Gly576Ala;Arg668Cys] p.Arg668Cys 1 IP NA NA p.[Gly576Ala;Arg668Cys] c.1210_34TG[12]T[5] 4 IP 19-69 y NA p.[Gly576Ala;Arg668Cys] NI 1 Cholestasis 60 y NA p.[Gly576Ala;Arg668Cys] c.1584G>A 33 CBAVD 27-50 y 9-82 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 2 CBAVD 30 y,36 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.2051_2052delAAinsG 1 CBAVD 34 y 72 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Trp1282X 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 CBAVD 35 y 65-66 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Ser549Asn 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.3605delA 1 CBAVD 30 y 41-69 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gln1411X 1 CBAVD 31 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg347His 3 CBAVD 29 y, 34 y, NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gly542X 1 CBAVD 35 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.946delT 1 CBAVD 26 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.4242_4242+1delGGinsT 1 CBAVD 41 y 31 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg117His 1 CBAVD 32 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr338Ile 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Glu379Lys 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Met1137Val 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr1246Ile 2 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 CBAVD 34 NA p.[Gly576Ala;Arg668Cys] p.Asn1303Lys 8 CBAVD 30-42 y NA p.[Gly576Ala;Arg668Cys] NI 1 CBAVD 27 y NA p.Arg668Cys p.Phe508del 1 CBAVD 30 y NA p.Arg668Cys NI 1 CUAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 1 CUAVD NA NA p.[Gly576Ala;Arg668Cys] NI 1 CUAVD Renal agenesis NA NA p.[Gly576Ala;Arg668Cys] NI 1 Hypofertility (not CBAVD) CF carrier`s partner NA NA p.[Gly576Ala;Arg668Cys] p.Asp1152His 1 FBA Mild CF considered possible, 2 older brothers with the same genotype, one with a very mild phenotype, the other being asymptomatic 22 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 FBA TOP for de novo chromosomal translocation; not CF 21 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg31Cys 1 FBA Not CF at birth 28 wg <30 p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Unknown outcome 23 wg NA p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Not CF at birth 21 wg <30 p.[Gly576Ala;Arg668Cys] p.Trp846X (Continued) Table 1. Login to comment

[hide] Hispanic Infants with cystic fibrosis show low CFT... J Genet Couns. 2012 Oct;21(5):671-5. doi: 10.1007/s10897-012-9481-2. Epub 2012 Feb 4. Watts KD, Layne B, Harris A, McColley SA
Hispanic Infants with cystic fibrosis show low CFTR mutation detection rates in the Illinois newborn screening program.
J Genet Couns. 2012 Oct;21(5):671-5. doi: 10.1007/s10897-012-9481-2. Epub 2012 Feb 4., [PMID:22311127]

Abstract [show]
States develop specific protocols for cystic fibrosis (CF) newborn screening to reflect the population served. We hypothesized that mutation distribution and detection rates would differ between Hispanic and non-Hispanic CF patients diagnosed by IL newborn screen with more Hispanic infants carrying mutations not detected by the state panel. Data from CF cases diagnosed via newborn screen in IL between 3/1/2008 and 10/31/2010 were reviewed. More Hispanic infants with CF had one or more undefined mutations after screening, in comparison to non-Hispanic Caucasian patients (40% vs. 9.5%; p < 0.002). The risk of having a positive diagnosis of CF with only one mutation noted by positive newborn screen increases 2-fold in Hispanic Caucasian versus non-Hispanic Caucasian infants (5% vs. 2.4%). Health care providers must be aware of the limitations of CF newborn screening to ensure appropriate counseling and prompt referral for a positive newborn screen, even when zero or one mutations are identified.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Mutation Frequency Table 1 shows the mutations found in Illinois patients diagnosed with CF after a positive NBS and compares these to mutations documented in Hispanic Caucasian Table 1 CFTR mutation frequency detected by Illinois newborn screen Mutation IL Newborn Screen CFF Patient Registry Total alleles Non-Hispanic Caucasian Hispanic Caucasian African American Ethnicity/Race Missing Hispanic Caucasian ΔF508 63.9% 71.6% 36.7% 33.3% 58.3% 44.7% R117H 7.7% 10.1% 3.3% - - 0.3% G542X 1.9% 2.0% - - 4.2% 4.1% 3120+1G>A 1.9% 0.7% 3.3% 33.3% - 0.7% ΔI507 1.4% 0.7% - - 8.3% 1.3% G551D 1.4% 2.0% - - - 0.5% 3659delC 1.4% 1.3% 3.3% - - 0.1% 3849+10 kbC>T 1.4% - 6.7% 16.7% - 1.0% ΔF311 1.4% - 6.7% - 4.2% 0.03% 1288insT 0.5% - 3.3% - - 0% 621+1G>T 0.5% - 3.3% - - 0.4% G85E 1.0% - 3.3% - 4.2% 0.3% 2184delA 0.5% - 3.3% - - 0.2% S549N 0.5% - 3.3% - - 0.7% R334W 1.0% 0.7% - 16.7% - 1.0% N1303K 1.0% - - - 8.3% 1.6% Other 4.4% 6.2%a 0% 0% 0% 12.8%b Unknown 8.2% 4.7% 23.5% 0% 12.5% 15.7% a R347P, 1898+1G>A, 2789+5G>A, 3272-26A>G, 3876delA, CFTRdel2,3, W1282X occurred in non-Hispanic Caucasian patients only with an allele frequency of 0.5% of the entire IL NBS population b In the 2004 CFF Patient Registry 12.8% of alleles are not included in the above table because they occur in less than 1% of the population. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]

Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]

Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

[hide] Ivacaftor potentiation of multiple CFTR channels w... J Cyst Fibros. 2012 May;11(3):237-45. doi: 10.1016/j.jcf.2011.12.005. Epub 2012 Jan 30. Yu H, Burton B, Huang CJ, Worley J, Cao D, Johnson JP Jr, Urrutia A, Joubran J, Seepersaud S, Sussky K, Hoffman BJ, Van Goor F
Ivacaftor potentiation of multiple CFTR channels with gating mutations.
J Cyst Fibros. 2012 May;11(3):237-45. doi: 10.1016/j.jcf.2011.12.005. Epub 2012 Jan 30., [PMID:22293084]

Abstract [show]
BACKGROUND: The investigational CFTR potentiator ivacaftor (VX-770) increased CFTR channel activity and improved lung function in subjects with CF who have the G551D CFTR gating mutation. The aim of this in vitro study was to determine whether ivacaftor potentiates mutant CFTR with gating defects caused by other CFTR gating mutations. METHODS: The effects of ivacaftor on CFTR channel open probability and chloride transport were tested in electrophysiological studies using Fischer rat thyroid (FRT) cells expressing different CFTR gating mutations. RESULTS: Ivacaftor potentiated multiple mutant CFTR forms with defects in CFTR channel gating. These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations. CONCLUSION: These in vitro data suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support investigation of the potential clinical benefit of ivacaftor in CF patients who have CFTR gating mutations beyond G551D.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations. Login to comment
39 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11]. Login to comment
67 The CF-associated CFTR mutations, S549N, S549R, and S1251N, are located in the ABC signature sequence (Fig. 4; LSGGQ; S549N,R in NBD1) and Walker A motif (Fig. 4; S1251N in NBD2), that form the ATP binding sites [14]. Login to comment
68 Immunoblot and Ussing chamber studies indicated that, although the maturation of S549N- and S1251N-CFTR was similar to normal, the baseline level of chloride transport was b10% of normal CFTR (Figs. 1 and 3; Table 2). Login to comment
69 S549R-CFTR showed maturation comparable to 26±2% (n=5) of normal CFTR (Fig. 1D), which did not account for the b1% of normal CFTR function (Fig. 3; Table 2). Login to comment
70 These results indicated that the function of S549N-, S549R-, and S1251N-CFTR at the cell surface was minimal. Login to comment
71 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTRmRNA (%NormalCFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTRMaturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations MatureCFTR (%NormalCFTR) A B D C Mature Immature Fig. 1. Login to comment
82 Taken together, these data suggested that defective channel gating was the predominant defect in S549N-, S549R- and S1251N-CFTR. Login to comment
83 In FRT cells expressing S549N-, S549R-, and S1251N-CFTR, acute addition of 10 μM ivacaftor increased the channel open probability and total chloride transport by N10-fold over baseline levels (Figs. 2 and 3; Tables 1 and 2). Login to comment
91 In addition, we showed that the 3 additional mutations, S549N, S549R, and S1251N also have characteristics consistent with gating defects. Login to comment
96 Taken together, these in vitro results provide a rationale for testing the potential benefit of ivacaftor in individuals with CF who have a CFTR gating mutation other than G551D, including the G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P, and G1349D CFTR gating mutations. Login to comment
97 Evaluation of CF-associated CFTR mutations that were expected to cause protein alterations in the ATP-binding sites formed by the NBDs indicated that S549N- and S1251N-CFTR also shared similar in vitro functional characteristics with G551D-CFTR and could be classified as CFTR gating mutations. Login to comment
98 Unlike S549N-CFTR and S1251N-CFTR, S549R-CFTR exhibited a partial reduction in the level of CFTR maturation compared to normal CFTR (see also Ref. [16]). Login to comment
99 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 µM Ivacaftor * * * * * * * * * * * CFTR Mutation ChannelOpenProbability ChannelOpenProbability (%NormalCFTR) B 1pA 3sec + 10 µM Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2. Login to comment
127 Like G551D, the G551S, G1244E, S1255P, and G1349D CFTR gating mutations, as well as the S549N, S549R, and S1251N CFTR gating mutations identified in the Table 1 Effect of ivacaftor on the channel gating activity of CFTR with gating mutations. Login to comment
128 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 bc;M ivacaftor Baseline With 10 μM ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57±0.03 100 0.63±0.02 111 0.400±0.04 100 0.800±0.04 a 200 G551D 0.46±0.06 81 0.46±0.03 81 0.019±0.01 b 5 0.121±0.035 a 30 G178R 0.59±0.11 103 0.66±0.08 116 0.005±0.001 b 1 0.228±0.022 a 57 S549N 0.55±0.02 97 0.61±0.02 108 0.003±0.010 b 1 0.396±0.119 a 99 S549R 0.45±0.01 b 79 0.55±0.02 a 96 0.004±0.010 b 1 0.143±0.031 a 36 G551S 0.57±0.13 100 0.64±0.02 113 0.010±0.001 b 3 0.337±0.110 a 84 G970R 0.55±0.03 96 0.55±0.03 97 0.001±0.001 b 0 0.245±0.042 a 61 G1244E 0.44±0.11 77 0.54±0.08 94 0.011±0.010 b 3 0.470±0.122 a 118 S1251N 0.54±0.07 95 0.63±0.04 111 0.003±0.010 b 1 0.350±0.03 a 88 S1255P 0.70±0.03 b 122 0.71±0.02 125 0.018±0.016 b 5 0.468±0.168 a 117 G1349D 0.49±0.08 85 0.63±0.06 111 0.019±0.015 b 5 0.315±0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation. Login to comment
130 0 100 200 300 400 -9 -8 -7 -6 -5 -4 G178R G551D G551S 0 S549N S549R Ivacaftor [Log M] 0 100 200 300 400 0 50 100 150 200 -9 -8 -7 -6 -5 -4 G970R G1244E S1255P G1349D 0 S1251N Ivacaftor [Log M] ChlorideTransport (%NormalCFTR) Normal Forskolin G178R G551S G970R G1244E 50 2 1 min S1255P Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 0 50 100 150 200 * * * * * * * * * * * * * CFTR Mutation ChlorideTransport(µA/cm2)ChlorideTransport(µA/cm2) ChlorideTransport(A/cm2) ChlorideTransport (%NormalCFTR) B G1349D G551D A F508del C S549N S549R S1251N Baseline Baseline present study, cause protein alterations in the ATP binding pockets formed by the two NBDs required for normal CFTR channel gating (Fig. 4) [2]. Login to comment
131 The G178R and G970R CFTR gating mutations alter the intracellular cytoplasmic loops that are believed to link the ATP-driven conformational changes in the NBDs to the opening of the CFTR channel pore formed by the membrane spanning domains [27]. Login to comment
144 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D. Login to comment
40 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11]. Login to comment
72 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTR mRNA (% Normal CFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTR Maturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations Mature CFTR (% Normal CFTR) A B D C Mature Immature Fig. 1. Login to comment
92 In addition, we showed that the 3 additional mutations, S549N, S549R, and S1251N also have characteristics consistent with gating defects. Login to comment
100 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 &#b5;M Ivacaftor * * * * * * * * * * * CFTR Mutation Channel Open Probability Channel Open Probability (% Normal CFTR) B 1pA 3sec + 10 &#b5;M Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2. Login to comment
129 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 bc;M ivacaftor Baseline With 10 bc;M ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57&#b1;0.03 100 0.63&#b1;0.02 111 0.400&#b1;0.04 100 0.800&#b1;0.04 a 200 G551D 0.46&#b1;0.06 81 0.46&#b1;0.03 81 0.019&#b1;0.01 b 5 0.121&#b1;0.035 a 30 G178R 0.59&#b1;0.11 103 0.66&#b1;0.08 116 0.005&#b1;0.001 b 1 0.228&#b1;0.022 a 57 S549N 0.55&#b1;0.02 97 0.61&#b1;0.02 108 0.003&#b1;0.010 b 1 0.396&#b1;0.119 a 99 S549R 0.45&#b1;0.01 b 79 0.55&#b1;0.02 a 96 0.004&#b1;0.010 b 1 0.143&#b1;0.031 a 36 G551S 0.57&#b1;0.13 100 0.64&#b1;0.02 113 0.010&#b1;0.001 b 3 0.337&#b1;0.110 a 84 G970R 0.55&#b1;0.03 96 0.55&#b1;0.03 97 0.001&#b1;0.001 b 0 0.245&#b1;0.042 a 61 G1244E 0.44&#b1;0.11 77 0.54&#b1;0.08 94 0.011&#b1;0.010 b 3 0.470&#b1;0.122 a 118 S1251N 0.54&#b1;0.07 95 0.63&#b1;0.04 111 0.003&#b1;0.010 b 1 0.350&#b1;0.03 a 88 S1255P 0.70&#b1;0.03 b 122 0.71&#b1;0.02 125 0.018&#b1;0.016 b 5 0.468&#b1;0.168 a 117 G1349D 0.49&#b1;0.08 85 0.63&#b1;0.06 111 0.019&#b1;0.015 b 5 0.315&#b1;0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation. Login to comment
145 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D. Login to comment

[hide] CFTR, SPINK1, CTRC and PRSS1 variants in chronic p... Gut. 2012 Mar 17. Rosendahl J, Landt O, Bernadova J, Kovacs P, Teich N, Bodeker H, Keim V, Ruffert C, Mossner J, Kage A, Stumvoll M, Groneberg D, Kruger R, Luck W, Treiber M, Becker M, Witt H
CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated?
Gut. 2012 Mar 17., [PMID:22427236]

Abstract [show]
OBJECTIVE: In chronic pancreatitis (CP), alterations in several genes have so far been described, but only small cohorts have been extensively investigated for all predisposing genes. DESIGN: 660 patients with idiopathic or hereditary CP and up to 1758 controls were enrolled. PRSS1, SPINK1 and CTRC were analysed by DNA sequencing, and cystic fibrosis transmembrane conductance regulator (CFTR) by melting curve analysis. RESULTS: Frequencies of CFTR variants p.R75Q, p.I148T, 5T-allele and p.E528E were comparable in patients and controls. We identified 103 CFTR variants, which represents a 2.7-fold risk increase (p<0.0001). Severe cystic fibrosis (CF)-causing variants increased the risk of developing CP 2.9-fold, and mild CF-causing variants 4.5-fold (p<0.0001 for both). Combined CF-causing variants increased CP risk 3.4-fold (p<0.0001), while non-CF-causing variants displayed a 1.5-fold over-representation in patients (p=0.14). CFTR compound heterozygous status with variant classes CF-causing severe and mild represented an OR of 16.1 (p<0.0001). Notably, only 9/660 (1.4%) patients were compound heterozygotes in this category. Trans-heterozygosity increased CP risk, with an OR of 38.7, with 43/660 (6.5%) patients and 3/1667 (0.2%) controls being trans-heterozygous (p<0.0001). CONCLUSIONS: Accumulation of CFTR variants in CP is less pronounced than reported previously, with ORs between 2.7 and 4.5. Only CF-causing variants reached statistical significance. Compound and trans-heterozygosity is an overt risk factor for the development of CP, but the number of CFTR compound heterozygotes in particular is rather low. In summary, the study demonstrates the complexity of genetic interactions in CP and a minor influence of CFTR alterations in CP development.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 The following CFTR variants were analysed with specific FRET probes: p.E60X, p.R75Q, p.G85E, p.R117H, p.I148T, c.621 +1G>T (IVS4+1G>T), c.711+1G>T (IVS5+1G>T), c.1078delT, p.R334W, p.R347P, 9-13TG, 5-9T, p.A455E, p.M470V, p.F508del, c.1716G>A (p.E528E), c.1717-1G>A (IVS10-1G>A), p.G542X, p.S549N, p.R553X, p.R560T, c.1898+1G>A (IVS12 +1G>A), c.2143delT, c.2183AA>G, c.2562T>G, c.2657+5G>A (IVS14B+5G>A), p.L997F, p.I1005R, p.Y1092X, p.D1152H, p.R1162X, c.3659delC, p.S1235R, p.S1251N, p.W1282X, p.N1303K, and c.4389G>A. Login to comment
69 The following CFTR variants were analysed with specific FRET probes: p.E60X, p.R75Q, p.G85E, p.R117H, p.I148T, c.621 +1G>T (IVS4+1G>T), c.711+1G>T (IVS5+1G>T), c.1078delT, p.R334W, p.R347P, 9-13TG, 5-9T, p.A455E, p.M470V, p.F508del, c.1716G>A (p.E528E), c.1717-1G>A (IVS10-1G>A), p.G542X, p.S549N, p.R553X, p.R560T, c.1898+1G>A (IVS12 +1G>A), c.2143delT, c.2183AA>G, c.2562T>G, c.2657+5G>A (IVS14B+5G>A), p.L997F, p.I1005R, p.Y1092X, p.D1152H, p.R1162X, c.3659delC, p.S1235R, p.S1251N, p.W1282X, p.N1303K, and c.4389G>A. Login to comment

[hide] CFTR mutation analysis and haplotype associations ... Mol Genet Metab. 2012 Feb;105(2):249-54. doi: 10.1016/j.ymgme.2011.10.013. Epub 2011 Oct 26. Cordovado SK, Hendrix M, Greene CN, Mochal S, Earley MC, Farrell PM, Kharrazi M, Hannon WH, Mueller PW
CFTR mutation analysis and haplotype associations in CF patients.
Mol Genet Metab. 2012 Feb;105(2):249-54. doi: 10.1016/j.ymgme.2011.10.013. Epub 2011 Oct 26., [PMID:22137130]

Abstract [show]
Most newborn screening (NBS) laboratories use second-tier molecular tests for cystic fibrosis (CF) using dried blood spots (DBS). The Centers for Disease Control and Prevention's NBS Quality Assurance Program offers proficiency testing (PT) in DBS for CF transmembrane conductance regulator (CFTR) gene mutation detection. Extensive molecular characterization on 76 CF patients, family members or screen positive newborns was performed for quality assurance. The coding, regulatory regions and portions of all introns were sequenced and large insertions/deletions were characterized as well as two intronic di-nucleotide microsatellites. For CF patient samples, at least two mutations were identified/verified and four specimens contained three likely CF-associated mutations. Thirty-four sequence variations in 152 chromosomes were identified, five of which were not previously reported. Twenty-seven of these variants were used to predict haplotypes from the major haplotype block defined by HapMap data that spans the promoter through intron 19. Chromosomes containing the F508del (p.Phe508del), G542X (p.Gly542X) and N1303K (p.Asn1303Lys) mutations shared a common haplotype subgroup, consistent with a common ancient European founder. Understanding the haplotype background of CF-associated mutations in the U.S. population provides a framework for future phenotype/genotype studies and will assist in determining a likely cis/trans phase of the mutations without need for parent studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 CFTR mutation 1 Gene location CFTR mutation 2 Gene location CFTR mutation 3 Gene location S549N Ex12 3120+1G→A Intron 18 -102T→A Promoter F508del Ex11 G542X Ex12 185+4A→T Intron1 F508del Ex11 F508del Ex11 I1027T Ex19 F508del Ex11 W1282X Ex23 I1027T Ex19 only by the number of repeats of the IVS8CA microsatellite; 32 chromosomes contained 17 repeats and 29 chromosomes contained 23 repeats. Login to comment

[hide] Lessons learned from 20 years of newborn screening... Med J Aust. 2012 Jan 16;196(1):67-70. Massie RJ, Curnow L, Glazner J, Armstrong DS, Francis I
Lessons learned from 20 years of newborn screening for cystic fibrosis.
Med J Aust. 2012 Jan 16;196(1):67-70., [PMID:22256939]

Abstract [show]
OBJECTIVE: To compare three cystic fibrosis (CF) newborn screening strategies used in Victoria since 1989. DESIGN, SETTING AND PARTICIPANTS: Retrospective review of newborn screening and clinical records for people with CF born in Victoria between 1989 and 2008 to compare screening strategies: repeat immunoreactive trypsinogen (IRT) testing (IRT/IRT, 1989-1990), IRT and p.F508del mutation analysis (IRT/p.F508del, 1991-2006) and IRT with analysis of 12 CFTR mutations (IRT/12 mutations, 2007-2008). MAIN OUTCOME MEASURES: Total number of infants screened, people identified with CF (by screening or clinical diagnosis), number of CF-affected terminations of pregnancy, and number of carriers detected. RESULTS: There were 420 people born with CF (live-birth prevalence, 1/3139; 95% CI, 1/2853-1/3462) and 78 CF-affected pregnancy terminations (overall prevalence, 1/2647; 95% CI, 1/2425-1/2896). Of the babies born with CF, 283 (67.4%) were detected by newborn screening alone, 61 (14.5%) had meconium ileus, 33 (7.9%) had a family history of CF, nine (2.1%) were diagnosed antenatally, and 34 (8.1%) were missed by screening (17 missed because IRT level was < 99th percentile, two with repeat IRT level not elevated, 14 without a screened CFTR mutation, and one with missing data). The sensitivities of the protocols were 86.6% for IRT/IRT, 89.9% for IRT/p.F508del, and 95.8% for IRT/12 mutations. Including 12 mutations in the analysis detected one patient who would otherwise have been missed and, had this protocol been implemented from 1989, it would have detected four others. CONCLUSION: Most babies with CF without meconium ileus, a family history or antenatal diagnosis are detected by newborn screening. Despite improved sensitivity with the 12-mutation analysis, most infants detected would have been diagnosed using the IRT/p.F508del protocol.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Where possible, all patients with a diagnosis of CF had further CFTR mutation analysis performed in an attempt to clarify the genotype (p.A455E, p.S549N, p.R347H, p.R1162X, p.R347P, p.R334W, p.R117H). Login to comment

[hide] First study of the F508del mutation in Malaysian c... J Paediatr Child Health. 2011 Aug;47(8):573-5. doi: 10.1111/j.1440-1754.2011.02149.x. Nathan AM, Thong MK, deBruyne J, Ariffin H
First study of the F508del mutation in Malaysian children diagnosed with cystic fibrosis.
J Paediatr Child Health. 2011 Aug;47(8):573-5. doi: 10.1111/j.1440-1754.2011.02149.x., [PMID:21843195]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Letters to the Editor Journal of Paediatrics and Child Health 47 (2011) 572-575 (c) 2011 The Authors Journal of Paediatrics and Child Health (c) 2011 Paediatrics and Child Health Division (Royal Australasian College of Physicians) Table1Summaryoftheclinicalcharacteristics,sweattestresultsandcysticfibrosistransmembraneconductanceregulatormutationstudiesofthepatientsdiagnosedwithcysticfibrosisinUniversity MalayaMedicalCenterfrom2000to2009 PatientAgeat presentation PresentingsymptomsOtherfindingsConsanguinityRaceSweatconductivity (mmol/l) KS score Mutations Rin3monthsRecurrentpneumoniaandFTTPseudo-Bartter`ssyndromeYesIndian13440†Nonedetected Nes8yearsSeverepersistentasthmaFTTNoIndian12450F508del/unknown Abd4monthsSeverepneumoniaandventilator dependent FTTYesYemeni11730F508del/F508del Ben7yearsCirrhosisoftheliverwithportal hypertension FTTUnknown(adopted)Unknown14080†Nonedetected(7T polymorphism) Sak3monthsRecurrentpneumoniaandFTTNDYesIndian11350F508del/F508del Ngan3yearsPseudo-Bartter`ssyndromeNDNoChinese13790Notdone(parentsrefused) LJH5monthsPseudo-Bartter`ssyndromeRecurrentpneumoniaNoChinese/Indonesian9465F508delnegative Josh5monthsPseudo-Bartter`ssyndromeandFTTNDNoIndian8585†Nonedetected Nur3monthsChronicdiarrhoeaandFTTPseudo-Bartter`ssyndromeNoMalay/Chinese13085‡†R553X/nonedetected Vin4monthsRecurrentpneumoniaandFTTNDNoChinese12260F508delnegative Muh5yearsPoorlycontrolledasthmaNDNoMalay10765F508delnegative Naz3monthsFTTandsteatorrhoeaRecurrentlunginfectionsand pseudo-Bartter`s NoMalay14675F508delnegative Additionalmutationsscreenedinthefourpatients:†F508del,I506/7del,G551D,G542X,R553X,R117C,R117H,621+1G>T,V520F,A455E,N1303K,3849+10kbC>T.‡R334W,R347P,A455E,S549N,R560T, 3659delC,W1282X.FTT,failuretothrive;KS,Schwachman-Kulczycki(KS)score;ND,nodata. Login to comment

[hide] Molecular basis of cystic fibrosis disease: an Ind... Indian J Clin Biochem. 2010 Oct;25(4):335-41. Epub 2010 Nov 19. Prasad R, Sharma H, Kaur G
Molecular basis of cystic fibrosis disease: an Indian perspective.
Indian J Clin Biochem. 2010 Oct;25(4):335-41. Epub 2010 Nov 19., [PMID:21966101]

Abstract [show]
Cystic fibrosis is a common autosomal recessive disorder usually found in population of white Caucasian descent. Now it is well documented the presence of CF disease in India with the advancement of laboratory testing. As once it was thought non existence of this disease in our population. Most of the phenotype of CF disease was in accordance of western population. Genetic analysis of CFTR gene in Indian CF patients revealed that most common mutation was delta F508 mutation. However, it was less than Caucasian population. CFTR mutations are also a causative factor in the pathogenesis of male infertility due to obstructive azoospermia. There are two most common mutation viz. IVS8-T5 and delta F508 which are responsible for congenital absence of vas deferens in male infertility patients. Elevated levels of sweat chloride at two occasions along with the presence of two mutations in CFTR gene was gold standard method for diagnosis of CF disease. It is noteworthy here that due to magnitude of Indian population, the total CF disease load would be more than many European countries. Clinical data demonstrate the prevalence of both classical and genetic form of CF in India.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 25 mutation Table 2 CFTR mutation identified in Indian population with classical CF [25] Genotype No. of subjects Delta F508/Delta F508 5 Delta F508/3849?10kb C-T 1 Delta F508/S549 2 Delta F508/Y138H 1 Delta F508/15251G-A 1 V520F/R117H 2 1530L/1530L 1 876-6del4/876-6del4 1 1792insA/1792insA 1 3986-3987delC/3986-3987delC 1 Delta F508/U 10 1161delC/U 2 L69H/U 1 R117H/U 1 Q493L/U 1 Y517C/U 1 S549N/U 3 G551D/U 1 E1329Q/U 1 N1303K/U 1 Y1381H/U 1 L218X/U 1 R553X/U 1 1525-1G-A/U 3 3120?1G-A/U 2 3849?10kbC-T/U 2 U/U 1 U unidentified panel were detected in our population at a combined frequency of (10%). Login to comment
99 The other seven known but rare mutations (1161delC, Y517C, V520F, S549N, Y1381H, L218X and 1525-1G-A) were identified at a combined frequency of (17%), and eight new mutations (3986delC, 1792InsA, L69H, S158N, Q493L, I530L, E1329Q and 876-8del4) identified in our CF population represented (15%) of the total CF alleles analyzed. Login to comment
100 Substitution mutation, S549N and splice site mutation, 1525-1G-A were the two most common mutations identified with a frequency of (4%) followed by another splice site mutation 3849?10kbC-T (3%). Login to comment

[hide] The use of DHPLC (Denaturing High Performance Liqu... J Prenat Med. 2010 Jul;4(3):45-8. Mesoraca A, Di Natale M, Cima A, Di Giacomo G, Sarti M, Barone MA, Bizzoco D, Cignini P, Mobili L, D'emidio L, Giorlandino C
The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis.
J Prenat Med. 2010 Jul;4(3):45-8., [PMID:22439061]

Abstract [show]
OBJECTIVE: The aim of the study is to evaluate the role of Denaturing High Performance Liquid Chromatography (DHPLC) in the second level screening of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene. METHODS: A 9-month prospective study, between June 2008 and March 2009 at Artemisia Fetal Medical Centre, included 3829 samples of amniotic fluid collected from women undergoing mid-trimester amniocentesis.The genetic diagnosis of CF was based on research of the main mutations of the CFTR gene on fetal DNA extracted from the amniocytes, (first level screening) using different commercial diagnostic systems. A second level screening using DHPLC, on the amniotic fluid and on a blood sample from the couple, was offered in case of fetuses heterozygous at first level screening. RESULTS: Of 3829 fetuses, 134 were found to be positive, 129 heterozygous and 5 affected. Of the 129 couples, following appropriate genetic counselling, 53 requested a second level screening. Through the use of DHPLC, 44 couples were found to be negative, and in nine couples, nine rare mutations were identified. CONCLUSIONS: The first level screening can be useful to evidence up to 75% of the CF mutations. The second level screening can identify a further 10% of mutant alleles. DHPLC was found to be a reliable and specific method for the rapid identification of the rare CFTR mutations which were not revealed in initial first level screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
100 48 Journal of Prenatal Medicine 2010; 4 (3): 45-50 Table III Mutations found with II level screening through DHPLC Mutations of mutated alleles DF508 29 W1282X 3 N1303K 8 1717-1G®A 2 3659delC 1 G85E 1 2789 +5G®A 2 R553X 2 R1162X 1 R117H 1 G542X 3 Total 53Table I Mutations found through I level screeningMutations analysed with I level screening through OLA CFTR Mutations Position on the CFTR gene DF508 Exon 10 3849+10KbC®T Intron 19 R334W Exon 7 W1282X Exon 10 V520F Exon 10 3905insT Exon 20 N1303K Exon 21 3876delA Exon 20 1717-1G®A Exon 11 3659delC Exon 19 DI507 Exon 10 A455E Exon 9 G85E Exon 3 2789 +5G®A Exon 14 / Intron 14 2183AA®G Exon 13 1898+1G®A Exon 12 / Intron 12 R347P Exon 7 R347H Exon 7 R560T Exon 11 1078delT Exon 7 R553X Exon 11 711+1G®T Exon 5 / Intron 5 G551D Exon 11 R1162X Exon 19 S549R Exon 11 R117H Exon 4 S549N Exon 11 621+1G®T Exon 4 G542X Exon 11 394delTT Exon 3 3120+1G®ðA Exon 16/ Intron 16 2184delA Exon 13 Table II Mutations found through I level screening Mutations Positions on CFTR gene R1066C Exon 17 b L1065P Exon 17 b A1006E Exon 19 R75Q Exon 3 D537E Exon 11 W1134X Exon 18 W1145X Exon 18 L1077P Exon 17b C524X Exon 11 Total 9 The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis Journal of Prenatal Medicine 2010; 4 (3): 45-50 49 tion was to provide the couple with adequate counselling in order to better understand the genotype-phenotype correlation in the various associations of mutations. Login to comment

[hide] Cystic fibrosis carrier frequency and estimated pr... J Cyst Fibros. 2008 Sep;7(5):440-3. Epub 2008 Feb 1. Ratbi I, Genin E, Legendre M, Le Floch A, Costa C, Cherkaoui-Deqqaqi S, Goossens M, Sefiani A, Girodon E
Cystic fibrosis carrier frequency and estimated prevalence of the disease in Morocco.
J Cyst Fibros. 2008 Sep;7(5):440-3. Epub 2008 Feb 1., [PMID:18243066]

Abstract [show]
BACKGROUND: The epidemiology of cystic fibrosis (CF) is poorly known in North African populations, in particular in Morocco and the CF carrier frequency in the general Moroccan population has never been evaluated. METHODS: To estimate the prevalence of CF mutations in Morocco, blood samples from 150 healthy Moroccans were tested for frequent CFTR mutations and the intron 8 polyT variant. RESULTS: Two subjects were heterozygous for F508del and eight others for the (T)5 variant. CONCLUSION: These findings indicate that the Moroccan population is at risk for CF and CFTR-related disorders. CF prevalence could be in the range of that found in European populations. Wider studies are necessary to identify the clinical pattern and accurately determine the prevalence and molecular basis of CF in Morocco.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 We screened for 32 CFTR gene mutations (G85E, 394delTT, R117H, 621+1GNT, 711+1GNT, R334W, R347P, R347H, 1078delT, A455E, I507del, F508del, V520F, 1717-1GNA, G542X, G551D, R553X, R560T, S549R(TNG), S549N, 1898+1GNA, 2183AANG, 2184delA, 2789+5GNA, 3120 + 1G NA, R1162X, 3659delC, 3849 + 10kbC NT, W1282X, 3905insT, 3876delA, N1303K) and the (T)5 splicing variant of intron 8, using a commercial kit (CF v3 Genotyping Assay, Abbott, Rungis, France). Login to comment

[hide] Consensus on the use and interpretation of cystic ... J Cyst Fibros. 2008 May;7(3):179-96. Castellani C, Cuppens H, Macek M Jr, Cassiman JJ, Kerem E, Durie P, Tullis E, Assael BM, Bombieri C, Brown A, Casals T, Claustres M, Cutting GR, Dequeker E, Dodge J, Doull I, Farrell P, Ferec C, Girodon E, Johannesson M, Kerem B, Knowles M, Munck A, Pignatti PF, Radojkovic D, Rizzotti P, Schwarz M, Stuhrmann M, Tzetis M, Zielenski J, Elborn JS
Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice.
J Cyst Fibros. 2008 May;7(3):179-96., [PMID:18456578]

Abstract [show]
It is often challenging for the clinician interested in cystic fibrosis (CF) to interpret molecular genetic results, and to integrate them in the diagnostic process. The limitations of genotyping technology, the choice of mutations to be tested, and the clinical context in which the test is administered can all influence how genetic information is interpreted. This paper describes the conclusions of a consensus conference to address the use and interpretation of CF mutation analysis in clinical settings. Although the diagnosis of CF is usually straightforward, care needs to be exercised in the use and interpretation of genetic tests: genotype information is not the final arbiter of a clinical diagnosis of CF or CF transmembrane conductance regulator (CFTR) protein related disorders. The diagnosis of these conditions is primarily based on the clinical presentation, and is supported by evaluation of CFTR function (sweat testing, nasal potential difference) and genetic analysis. None of these features are sufficient on their own to make a diagnosis of CF or CFTR-related disorders. Broad genotype/phenotype associations are useful in epidemiological studies, but CFTR genotype does not accurately predict individual outcome. The use of CFTR genotype for prediction of prognosis in people with CF at the time of their diagnosis is not recommended. The importance of communication between clinicians and medical genetic laboratories is emphasized. The results of testing and their implications should be reported in a manner understandable to the clinicians caring for CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1236 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment
1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment

[hide] Characterisation of mutations and genotype-phenoty... J Cyst Fibros. 2008 Mar;7(2):110-5. Epub 2007 Aug 22. Shastri SS, Kabra M, Kabra SK, Pandey RM, Menon PS
Characterisation of mutations and genotype-phenotype correlation in cystic fibrosis: experience from India.
J Cyst Fibros. 2008 Mar;7(2):110-5. Epub 2007 Aug 22., [PMID:17716958]

Abstract [show]
BACKGROUND: Very little is known about the genetics of cystic fibrosis (CF) from the Indian subcontinent. The aims of the study were to identify the mutations and study the relation of genotype with phenotype in Indian children with CF. METHODS: A total of 100 patients with CF were screened for mutations in the CFTR gene. These included c.1521_1523delCTT (p.F508del) and c.3849+10 kb C>T mutations followed by single strand conformation polymorphism/heteroduplex analysis for mutations in 19 out of 27 exons of the CFTR gene. RESULTS: At least one mutation was identified in 40 patients. The most common mutation identified was p.F508del; 20 patients were homozygous and 13 heterozygous. In addition, c.3849+10 kb C>T, c.1161delC, and p.S549N were identified in two patients each and p.R352Q, p.R1158X and p.R75Q were identified in one patient each. Three novel mutations, viz. c.1002-7_1002-5delTTT, p.G149X and p.L183I were also identified. Majority of patients who were p.F508del positive originated from Pakistan and north-western states of India. The phenotypes of all patients were classical. Genotype-phenotype correlation revealed that p.F508del positive patients had a more severe disease, manifesting at an earlier age. CONCLUSIONS: A strategy for mutation screening for CF in India must involve testing for p.F508del followed by c.1161delC, c.3849+10 kb C>T and p.S549N. There is a need for large multicentric studies using more sensitive techniques for the identification of mutations in Indian CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 In addition, c.3849+10 kb CNT, c.1161delC, and p.S549N were identified in two patients each and p. R352Q, p.R1158X and p.R75Q were identified in one patient each. Login to comment
11 Conclusions: A strategy for mutation screening for CF in India must involve testing for p.F508del followed by c.1161delC, c.3849+10 kb CNT and p.S549N. Login to comment
79 Three other mutations, c.3849+10 kb CNT, c.1161delC and p.S549N were seen in two patients each. Login to comment
82 SSCP/HA SSCP/HA identified at least one mutation in exons 3, 4, 7, 11 and 19 viz. p.R75Q in exon 3, p.G149X in exon 4, c.1161delC, p.R352Q and c.1002-7_1002-5delTTT in exon 7, p.S549N in exon 11 and p.R1158X in exon 19. Login to comment
124 1 p.[S549N]+[?] Login to comment
162 This should be followed by screening for the other three common mutations, p.S549N, c.3849+10 kb CNT and c.1161delC identified in this study. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
73 Genomic DNA Samples Used for Mutation Evaluation on the APEX Array Mutations validated with native DNA CFTRdel 2,3 (21 kb) 394delTT G85E R75X 574delA Y122X R117C R117H 621 ϩ 1GϾT 621 ϩ 3AϾG 711 ϩ 1GϾT I336K R334W R347P IVS8-5T IVS8-7T IVS8-9T A455E ⌬F508 ⌬I507 1677delTA 1717 - 1GϾA G542X G551D R553X R560T S549N 1898 ϩ 1GϾA 1898 ϩ 1GϾC 2183AAϾG 2043delG R668C 2143delT 2184delA 2184insA 2789 ϩ 5GϾA S945L 3120 ϩ 1GϾA I1005R 3272 - 26AϾG R1066C G1069R Y1092X (CϾA) 3500 - 2AϾT R1158X R1162X 3659delC S1235R 3849 ϩ 10 kb CϾT W1282X primer. Login to comment
85 Mutations include several prominent in non-Caucasian backgrounds, including N1303K, 3849 ϩ 10 kb, 2789 ϩ 5GϾA, 3876delA, 406-1GϾA, R75X, 2055delGϾA, and S549N, which are each prevalent in the Hispanic popu- Figure 1. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 Table 1. Continued Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) R1070W 1 0.55 0.19 R1158X 1 0.55 0.19 R1438W 1 0.55 0.19 R334W 2 1.09 0.39 R352W 1 0.55 0.19 R553X 2 1.09 0.39 R668C 2 1.09 0.39 R74W 3 1.64 0.58 R75X 3 1.64 0.58 S1235R 2 1.09 0.39 S492F 2 1.09 0.39 S549N 1 0.55 0.19 S573CS573C 1 0.55 0.19 S945L 1 0.55 0.19 T351S 1 0.55 0.19 T501A 2 1.09 0.39 T604ST604S 1 0.55 0.19 V11I 1 0.55 0.19 V201 mol/L 1 0.55 0.19 V232D 2 1.09 0.39 V754 mol/L 1 0.55 0.19 W1089X 2 1.09 0.39 W1098C 1 0.55 0.19 W1204X 4 2.19 0.78 Y563N 1 0.55 0.19 Y913XY913X 1 0.55 0.19 85 different mutations 183 100.00 35.60 Novel variants are in boldface, mutations on the ACMG/ACOG panel are italicized. Login to comment
171 Mutations R75X, 935delA, S549N, W1204X, and R334W were present at a relative frequency of 1.3%, and 12 additional mutations were each represented at a frequency of 1% of detected mutations (Table 3). Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment
199 The pooled data set demonstrates that the most frequently seen mutations are: ⌬F508, G542X, 406-1GϾA, W1204X, R75X, 2055del9ϾA, 3876delA, ⌬I507, S549N, I148T, N1303K, 935delA, and 3849 ϩ 10kbCϾT. Login to comment
201 Comparison of Relative Frequencies of CFTR Sequence Variants in Comprehensive CFTR Studies in US and Mexican Hispanics This study % Orozco 2000 % US/ Mexican % deltaF508 28.96 54.48 43.72 G542X 3.83 8.28 5.19 406 - 1GϾA 3.28 2.07 2.38 W1204X 2.19 Ͻ1 1.08 R74W 1.64 Ͻ1 R75X 1.64 2.07 1.51 H199Y 1.64 Ͻ1 Ͻ1 L206W 1.64 Ͻ1 L997F 1.64 Ͻ1 I1027T 1.64 Ͻ1 2055del9ϾA 1.64 1.38 1.27 D1270N 1.64 Ͻ1 E116K 1.09 Ͻ1 V232D 1.09 Ͻ1 R334W 1.09 Ͻ1 S492F 1.09 Ͻ1 T501A 1.09 Ͻ1 R553X 1.09 Ͻ1 Ͻ1 E588V 1.09 Ͻ1 R668C 1.09 Ͻ1 Q890X 1.09 Ͻ1 W1089X 1.09 Ͻ1 S1235R 1.09 Ͻ1 D1445N 1.09 Ͻ1 3876delA 1.09 3.24 1717 - 8GϾA 1.09 Ͻ1 3272 - 26AϾG 1.09 Ͻ1 A1009T 1.09 Ͻ1 deltaI507 Ͻ1 3.45 1.30 S549N Ͻ1 3.45 1.95 G567A Ͻ1 Ͻ1 I148T 2.07 1.08 I506T 1.38 Ͻ1 N1303K 2.76 1.08 935delA 1.38 1.30 2183AAϾG 1.38 Ͻ1 3199del6 1.38 Ͻ1 3849 ϩ 10kbCϾT Ͻ1 1.30 ACMG/ACOG italicized. Login to comment
204 Some of the disparity in mutation detection between Caucasians and Hispanics could be alleviated by adding at least seven additional mutations to the currently recommended ACOG/ACMG panel of 25 mutations: 406-1GϾA, W1204X, R75X, 2055del9ϾA, 3876delA, S549N, and 935delA (Table 4). Login to comment
221 For carrier screening of Hispanic patients, inclusion of additional mutations with significant frequency in the Hispanic CF population (especially 406-1GϾA, W1204X, R75X, 2055del9ϾA, 3876delA, S549N, and 935delA) may be helpful to supplement the ACMG/ACOG panel. Login to comment

[hide] Rapid screening for 31 mutations and polymorphisms... Methods Mol Med. 2005;114:147-71. Dunbar SA, Jacobson JW
Rapid screening for 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator gene by Lminex xMAP suspension array.
Methods Mol Med. 2005;114:147-71., [PMID:16156102]

Abstract [show]
A suspension array hybridization assay is described for the detection of 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator (CFTR) gene using Luminex xMAP technology. The Luminex xMAP system allows simultaneous detection of up to 100 different targets in a single multiplexed reaction. Included in the method are the procedures for design of oligonucleotide capture probes and PCR amplification primers, coupling oligonucleotide capture probes to carboxylated microspheres, hybridization of coupled microspheres to oligonucleotide targets, production of targets from DNA samples by multiplexed PCR amplification, and detection of PCR-amplified targets by direct hybridization to probe-coupled microspheres. Mutation screening with the system is rapid, requires relatively few sample manipulations, and provides adequate resolution to reliably genotype the 25 CFTR mutations and 6 CFTR polymorphisms contained in the ACMG/ACOG/NIH-recommended core mutation panel for general population CF carrier screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
119 Coriell Cell Repositories, NA12960 ΔI507/R347P Patient sample G551D/R347P Coriell Cell Repositories, NA12785 621+1G→T/711+1G→T Coriell Cell Repositories, NA11280 621+1G→T/G85E Coriell Cell Repositories, NA11282 3849+10kbC→T/3849+10kbC→T Coriell Cell Repositories, NA11860 A455E/normal Patient sample 621+1G→T/A455E Coriell Cell Repositories, NA11290 R1162X/normal Coriell Cell Repositories, NA12585 ΔF508/3659delC Coriell Cell Repositories, NA11275 2789+5G→A/2789+5G→A Coriell Cell Repositories, NA11859 2184delA/normal Patient sample 1898+1G→A/normal Patient sample 621+1G→T/3120+1G→A Coriell Cell Repositories, NA07441 3120+1G→A/3120+1G→A Patient sample F508C/normal Coriell Cell Repositories, NA13033 I506V/normal Coriell Cell Repositories, NA13032 R347H/normal Patient sample ΔF508/3120G→A Patient sample S549N/normal Patient sample S549R/normal Patient sample CFTR, cystic fibrosis transmembrane conductance regulator gene. Login to comment

[hide] Glucose intolerance in children with cystic fibros... J Pediatr. 2003 Feb;142(2):128-32. Solomon MP, Wilson DC, Corey M, Kalnins D, Zielenski J, Tsui LC, Pencharz P, Durie P, Sweezey NB
Glucose intolerance in children with cystic fibrosis.
J Pediatr. 2003 Feb;142(2):128-32., [PMID:12584532]

Abstract [show]
OBJECTIVE: To evaluate the relations among glucose intolerance, genotype, and exocrine pancreatic status in patients with cystic fibrosis (CF). STUDY DESIGN: Data on 335 patients <18 years of age were from the Toronto CF database. A modified oral glucose tolerance test was given to 94 patients 10 to 18 years of age without recognized CF-related diabetes. CF transmembrane conductance regulator mutations and exocrine pancreatic status were determined for all patients. RESULTS: CF-related diabetes was clinically recognized in 9 of 335 (2.7%) patients <18 years of age, all of whom were pancreatic insufficient, and 8 of 9 had severe (classes I through III) mutations on both alleles. The ninth patient had unidentified mutations. Although all patients given the oral glucose tolerance test were asymptomatic and had normal fasting blood glucose, 16 of 94 (17%) had impaired glucose tolerance and 4 of 94 (4.3%) had CF-related diabetes without fasting hyperglycemia. Abnormal glucose tolerance was associated exclusively with severe mutations and exocrine pancreatic insufficiency. Glycosylated hemoglobin (HbA(1)C) levels did not correlate with glucose tolerance results. CONCLUSIONS: Screening of pancreatic-insufficient, adolescent patients with CF identified more with abnormal oral glucose tolerance than was suspected clinically and is recommended as a routine practice. HbA(1)C was not useful in screening for CF-related glucose intolerance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 of patients with IGT 2 10 2 0 0 1/1 16 No of patients with CFRD without FH 0 4 0 0 0 0 4 *Genotype class based on mutation with ∆F508: Class I, 621+1G→T, G542X, 441delA, R553X, W1282X, 3120+1G→A, 4016insT, 1154insTC, I1027T; Class II, ∆F508; Class III, G551D, G85E, S549N, L1077P, H199R; Class IV, Class V, 3849+10kbC→T, 5T; Unknown, G85E/-, ∆F508/-; Other, G551D/R506T, W1282X/W1282X. Login to comment

[hide] CFTR mutations in three Latin American countries. Am J Med Genet. 2000 Apr 10;91(4):277-9. Restrepo CM, Pineda L, Rojas-Martinez A, Gutierrez CA, Morales A, Gomez Y, Villalobos MC, Borjas L, Delgado W, Myers A, Barrera-Saldana HA
CFTR mutations in three Latin American countries.
Am J Med Genet. 2000 Apr 10;91(4):277-9., [PMID:10766983]

Abstract [show]
We analyzed 192 cystic fibrosis (CF) alleles in three Latin American countries: Mexico, Colombia, and Venezuela. Mutation screening was performed by polymerase chain reaction (PCR) and a reverse dot blot detection kit that enables determination of 16 of the most common CF mutations worldwide. Mutations were detected in 47.9% of the screened CF alleles. The most prevalent CF allele was DeltaF508 (39. 6%). The remaining 16 non-DeltaF508 detectable mutations represented 8.3% of the CF alleles. Among them, the G542X, N1303K, and 3849+10kb C>T were the most common. Although the frequency of DeltaF508 described here is lower than that reported for Caucasian populations, including in Spain, it is remarkable that mutation prevalences found in this study resemble those observed in Spain. Two of these mutations, G542X and 3849+10kb C>T, that were relevant in this analysis, have a particularly high incidence in Spanish communities. The low frequency of DeltaF508 described here may be explained by the Amerindian, Caucasian, and Black admixture that occurred in Latin America after the discovery of the New World, and also by the probable occurrence of mutations contributed by the original natives, which were undetectable in this analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 The isolated DNA from each patient was amplified by polymerase chain reaction (PCR) using a kit for reverse dot blot detection of 16 common CF mutations: ⌬F508, R553X, G542X, G551D, N1303K, W1282X, R117H, R334W, R347P, A455E, ⌬I507, 1717-1 G>A, R560T, 3849+10kb C>T, 621+1 G>T, S549N [Villalobos-Torres et al., 1997]. Login to comment
45 In addition to these alleles, only three other CF mutations were detected: 621+1 G>T, S549N, and W1282X. Login to comment
57 The three additional mutations found (W1282X, 621+1G>T, and S549N) represent only 1.5% of the CF allele occurrence in this analysis. Login to comment
62 Frequencies and (Chromosome Number) of CF Mutations Detected in Three Latin American Countries CF mutation Mexico % (90) Colombia % (48) Venezuela % (54) Total % (192) ⌬F508 47.8 (43) 35.4 (17) 29.6 (16) 39.6 (76) G542X 4.4 (4) 6.3 (3) 3.7 (2) 4.7 (9) N1303K 1.1 (1) 2.1 (1) 0.0 (0) 1.0 (2) 3849 + 10kb C > T 2.2 (2) 0.0 (0) 0.0 (0) 1.0 (2) W1282X 0.0 (0) 2.1 (1) 0.0 (0) 0.5 (1) 621 + 1 G > T 1.1 (1) 0.0 (0) 0.0 (0) 0.5 (1) S549N 1.1 (1) 0.0 (0) 0.0 (0) 0.5 (1) Non-⌬F508a 10.0 (9) 10.4 (5) 3.7 (2) 8.3 (16) Unknown 42.2 (38) 54.2 (26) 66.7 (36) 52.1 (100) a Detected with the 16 CF mutation panel in this study. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 f 306insA, W79X, R117C, P205S, L227R, I336K, 1248+1G>A, 1609delCA, 1717-8G>A, S549R(T>G), S549N, 1812-1G>A, P574H, 2176insC, R709X, E827X, D836Y, 3007delG, L1065P, L1077P, H1085R, M1101K, 4021insT. Login to comment

[hide] A comparison of fluorescent SSCP and denaturing HP... Hum Mutat. 2000;15(6):556-64. Ellis LA, Taylor CF, Taylor GR
A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning.
Hum Mutat. 2000;15(6):556-64., [PMID:10862085]

Abstract [show]
We examined 67 different mutations in 16 different amplicons in a comparison of mutation detection by fluorescent single strand conformation polymorphism (F-SSCP) and by denaturing HPLC (DHPLC). F-SSCP was used to analyze fluorescent amplicons with internal size standards and automated fragment analysis (GeneScan, PE Applied Biosystems, Foster City, CA). In DHPLC, unlabelled amplicons were analyzed by reverse phase HPLC with fragment detection by absorbance at 260nm. Both methods had high sensitivity (95-100%) and specificity (100%). Overall, F-SSCP with external temperature control was the more sensitive method, but DHPLC was particularly useful for the rapid analysis of novel fragments.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE. Login to comment
135 Effect of Amplicon Size on Mutation Detection Rate in ABCC7 Exon 11 SSCP slab gels SSCP 310 DHPLC 49:1, 20°C MDE, 20°C 35°C Exon 11 ABCC7 190bp 490bp 190bp 490bp 190bp 490bp 190bp 490bp 1717-1G>A - - + + + + + + G542X + + + + + - + + S549N + + + + + + - - S549R + + - + + + + - G551D - + + + - - + - R553X + + + + + + + - G551D/R553X + + + + + + + - R560T + - - + - - + + R560K + + + + - - + + 1811+1G>C + + + + + + + + Sensitivity 9/10 8/10 8/10 10/10 7/10 6/10 9/10 5/10 ammonium acetate as an ion-pairing agent has the unintended consequence of modifying the stability of GC and AT base pairs in a similar manner to the effects of tetra-alkyl ammonium salts, tetraethyl ammonium chloride and tetramenthyl ammonium chloride. Login to comment
158 This analysis was carried out for ABCC7 exon 11 (190 bp version) and the mutation which could not be detected (S549N) in our study was undetectable at the temperature predicted by Melt or at 2°C above this temperature. Login to comment

[hide] Cystic fibrosis: a multiple exocrinopathy caused b... Am J Med. 1998 Jun;104(6):576-90. Schwiebert EM, Benos DJ, Fuller CM
Cystic fibrosis: a multiple exocrinopathy caused by dysfunctions in a multifunctional transport protein.
Am J Med. 1998 Jun;104(6):576-90., [PMID:9674722]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
223 They include another deletion mutation at amino acid position 507 (⌬I507), several missense mutations (F508C, G551D, G551S, A455E, R553Q, P574H, S549N, A559T), and some nonsense mutations (G542X, R553X, Q493X). Login to comment

[hide] A mutation in the cystic fibrosis transmembrane co... Hum Mol Genet. 1998 Apr;7(4):729-35. Mickle JE, Macek M Jr, Fulmer-Smentek SB, Egan MM, Schwiebert E, Guggino W, Moss R, Cutting GR
A mutation in the cystic fibrosis transmembrane conductance regulator gene associated with elevated sweat chloride concentrations in the absence of cystic fibrosis.
Hum Mol Genet. 1998 Apr;7(4):729-35., [PMID:9499426]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) have been shown to cause cystic fibrosis (CF) and male infertility due to congenital bilateral absence of the vas deferens. We report the identification of a 6.8 kb deletion (del14a) and a nonsense mutation (S1455X) in the CFTR genes of a mother and her youngest daughter with isolated elevated sweat chloride concentrations. Detailed clinical evaluation of both individuals found no evidence of pulmonary or pancreatic disease characteristic of CF. A second child in this family with classic CF was homozygous for the del14a mutation, indicating that this mutation caused severe CFTR dysfunction. CFTR mRNA transcripts bearing the S1455X mutation were stable in vivo , implying that this allele encoded a truncated version of CFTR missing the last 26 amino acids. Loss of this region did not affect processing of transiently expressed S1455X-CFTR compared with wild-type CFTR. When expressed in CF airway cells, this mutant generated cAMP-activated whole-cell chloride currents similar to wild-type CFTR. Preservation of chloride channel function of S1455X-CFTR was consistent with normal lung and pancreatic function in the mother and her daughter. These data indicate that mutations in CFTR can be associated with elevated sweat chloride concentrations in the absence of the CF phenotype, and suggest a previously unrecognized functional role in the sweat gland for the C-terminus of CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
151 Mutation analysis Total genomic DNA was assayed for 16 common CFTR mutations (R117H, 621+1G→T, R334W, R349P, A455E, 1717-1G→A, ∆I507, ∆F508, G542X, S549N, G551D, R553X, R560T, 3849+10 kb C→T, W1282X, N1303K) by reverse dot-blot hybridization (46). Login to comment
152 Mutation analysis Total genomic DNA was assayed for 16 common CFTR mutations (R117H, 621+1G࢐T, R334W, R349P, A455E, 1717-1G࢐A, ࢞I507, ࢞F508, G542X, S549N, G551D, R553X, R560T, 3849+10 kb C࢐T, W1282X, N1303K) by reverse dot-blot hybridization (46). Login to comment

[hide] Analysis of the CFTR gene in Turkish cystic fibros... Hum Genet. 1998 Feb;102(2):224-30. Onay T, Topaloglu O, Zielenski J, Gokgoz N, Kayserili H, Camcioglu Y, Cokugras H, Akcakaya N, Apak M, Tsui LC, Kirdar B
Analysis of the CFTR gene in Turkish cystic fibrosis patients: identification of three novel mutations (3172delAC, P1013L and M1028I).
Hum Genet. 1998 Feb;102(2):224-30., [PMID:9521595]

Abstract [show]
In order to determine the spectrum of cystic fibrosis (CF) mutations in the Turkish population, a complete coding region of the cystic fibrosis transmembrane conductance regulator (CFTR) gene including exon-intron boundaries, on 122 unrelated CF chromosomes from 73 Turkish CF families was analysed by denaturing gradient gel electrophoresis and multiplex heteroduplex analysis on MDE gel matrix. In addition to 15 previously reported mutations and 12 polymorphisms, three novel mutations, namely 3172delAC, P1013L and M1028I, were detected. DeltaF508 was found to be present on 18.8% of CF chromosomes. The second most common mutation was 1677delTA, with a frequency of 7.3%, followed by G542X and 2183AA-->G mutations, with frequencies of 4.9%. These four most common mutations in Turkish CF population account for approximately 36% of mutations. This study could only detect 52.5% of disease-causing mutations in this population; 47.5% of CF alleles remain to be identified, reflecting the high molecular heterogeneity of the Turkish population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Other frequent mutations, namely G542X, R560T, S549N or S549I and G551D or R553X, were analysed by the multiplex ARMS method combined with restriction enzyme analysis (Dean et al. 1990; Cutting et al. 1990; Ferrie et al. 1992). Login to comment

[hide] Differential stimulation of cytosolic phospholipas... Am J Respir Cell Mol Biol. 1997 Oct;17(4):481-90. Berguerand M, Klapisz E, Thomas G, Humbert L, Jouniaux AM, Olivier JL, Bereziat G, Masliah J
Differential stimulation of cytosolic phospholipase A2 by bradykinin in human cystic fibrosis cell lines.
Am J Respir Cell Mol Biol. 1997 Oct;17(4):481-90., [PMID:9376123]

Abstract [show]
Tracheal epithelial cells and skin fibroblasts from different cystic fibrosis (CF) patients bearing the deltaF508 mutation of cystic fibrosis transmembrane conductance regulator (CFTR) released more arachidonic acid in response to bradykinin than do other CF and normal cells. Immortalized tracheal epithelial cell lines were used as models to study the mechanisms of this dysregulation. An 85 kD cytosolic phospholipase A2 (cPLA2) was found in these cells and bradykinin increased its binding to membranes of deltaF508 cells (CFT-2) but not to those of a double heterozygous CF cells (CFT-1), or of control cells (NT-1). The expression of G alpha(q)/11 protein was also increased in deltaF508 cells, with increased stimulation of phosphatidylinositol diphosphate-specific phospholipase C (PLC) by bradykinin, and an early, transient activation of mitogen-activated protein (MAP) kinase. As the binding of cPLA2 to membranes is Ca2+-dependent, the increased coupling to PLC could cause the hypersensitivity to bradykinin. Comparison of the effects of bradykinin to those observed with thapsigargin, an inhibitor of calcium reuptake, suggests that the increase of intracellular calcium is not the only mechanism involved in arachidonic acid release by bradykinin in deltaF508 cells. The lack of effect of calcium ionophore A23187 or TPA on arachidonic acid release from any of the cell lines suggested that activation needs a PKC-independent cPLA2 phosphorylation step, perhaps via MAP kinase activation. The binding of cPLA2 to membranes after bradykinin stimulation still occurred in CFT2 cells (deltaF508) homogenized in EDTA, suggesting that a membrane component plus increased intracellular calcium influenced cPLA2 anchoring to membranes. The defective processing of deltaF508 CFTR seems to increase cPLA2 stimulation by bradykinin, since the bradykinin-stimulated release of arachidonic acid is reversed by growing cells at 28 degrees C for 48 h. The deltaF508 mutation of CFTR appears to increase the stimulation of cPLA2 by Gq-mediated receptors in a PKC-independent and MAP kinase-dependent manner. Hence normal CFTR, or normally processed deltaF508 CFTR, inhibit cPLA2 stimulation. The greater reactivity of deltaF508 CFTR cells to inflammatory mediators might be part of the increased sensitivity of CF patients to lung inflammation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 Abbreviations: arachidonic acid, AA; cystic fibrosis, CF; cystic fibrosis transmembrane conductance regulator, CFTR; cystic fibrosis cell line presenting two minor mutations S549N and N1303K, CFT-1; cystic fibrosis cell line presenting ⌬F508 mutation, CFT-2; enhanced chemiluminescence, ECL; (1,4,5)-inositol triphosphate, IP3; normal cell line, NT-1; phospholipase A2, PLA2; phospholipase C, PLC; phenylmethylsulfonyl fluoride, PMSF; tetradecanoyl phorbol acetate, TPA. Login to comment
43 We have examined the mechanism by which the ⌬F508 CFTR mutation affects AA release by comparing the coupling of bradykinin receptors to the activation of PLC and PLA2 in a ⌬F508 tracheal epithelial cell line, a double heterozygote cell line (S549N, N1303K), and in a control cell line. Login to comment
68 Three cell lines were studied: a control cell line (NT-1), a CF cell line carrying the homozygous mutation ⌬F508 of CFTR (CFT-2) and a CF cell line carrying a double heterozygous mutation S549N and N1303K (CFT-1). Login to comment
117 Results Cytosolic PLA2 Activity Specific for AA in Epithelial Cystic Fibrosis Cell Lines We have shown that an epithelial ⌬F508 cell line (CFT-2) releases more AA in response to bradykinin than do the control epithelial cell line (NT-1), or a CF epithelial cell line bearing the double heterozygous mutation S549N and N1303K (CFT-1). Login to comment
176 The maximal concentration in ⌬F508 epithelial cells was 3 times greater than in the control cells or in S549N-N1303K CF cells (Figure 5). Login to comment
67 Three cell lines were studied: a control cell line (NT-1), a CF cell line carrying the homozygous mutation DF508 of CFTR (CFT-2) and a CF cell line carrying a double heterozygous mutation S549N and N1303K (CFT-1). Login to comment

[hide] Newborn screening for cystic fibrosis in Wisconsin... Pediatrics. 1997 Jun;99(6):819-24. Gregg RG, Simantel A, Farrell PM, Koscik R, Kosorok MR, Laxova A, Laessig R, Hoffman G, Hassemer D, Mischler EH, Splaingard M
Newborn screening for cystic fibrosis in Wisconsin: comparison of biochemical and molecular methods.
Pediatrics. 1997 Jun;99(6):819-24., [PMID:9164776]

Abstract [show]
OBJECTIVES: To evaluate neonatal screening for cystic fibrosis (CF), including study of the screening procedures and characteristics of false-positive infants, over the past 10 years in Wisconsin. An important objective evolving from the original design has been to compare use of a single-tier immunoreactive trypsinogen (IRT) screening method with that of a two-tier method using IRT and analyses of samples for the most common cystic fibrosis transmembrane regulator (CFTR) (DeltaF508) mutation. We also examined the benefit of including up to 10 additional CFTR mutations in the screening protocol. METHODS: From 1985 to 1994, using either the IRT or IRT/DNA protocol, 220 862 and 104 308 neonates, respectively, were screened for CF. For the IRT protocol, neonates with an IRT >/=180 ng/mL were considered positive, and the standard sweat chloride test was administered to determine CF status. For the IRT/DNA protocol, samples from the original dried-blood specimen on the Guthrie card of neonates with an IRT >/=110 ng/mL were tested for the presence of the DeltaF508 CFTR allele, and if the DNA test revealed one or two DeltaF508 alleles, a sweat test was obtained. RESULTS: Both screening procedures had very high specificity. The sensitivity tended to be higher with the IRT/DNA protocol, but the differences were not statistically significant. The positive predictive value of the IRT/DNA screening protocol was 15.2% compared with 6.4% if the same samples had been screened by the IRT method. Assessment of the false-positive IRT/DNA population revealed that the two-tier method eliminates the disproportionate number of infants with low Apgar scores and also the high prevalence of African-Americans identified previously in our study of newborns with high IRT levels. We found that 55% of DNA-positive CF infants were homozygous for DeltaF508 and 40% had one DeltaF508 allele. Adding analyses for 10 more CFTR mutations has only a small effect on the sensitivity but is likely to add significantly to the cost of screening. CONCLUSIONS: Advantages of the IRT/DNA protocol over IRT analysis include improved positive predictive value, reduction of false-positive infants, and more rapid diagnosis with elimination of recall specimens.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Polyacrylamide gel electrophoresis of PCR-amplified DNA served to identify the ⌬F508 mutation.14 Mutations S549N, R553X, and G551D were screened by PCR amplification of exon 11, followed by restriction enzyme digests that are diagnostic of each mutation. Login to comment
123 Tested) Frequency (%) Theoretical Cumulative Detection† (%) Patients Missed in One Year‡ ⌬F508§ 513/720 71.25 91.74 1.32 G542X 17/162 3.02 93.38 1.05 W1282X 7/102 1.97 94.36 0.90 R117H 6/101 1.71 95.14 0.77 R553X 11/197 1.61 95.82 0.66 G551D 9/195 1.33 96.35 0.58 N1303K 3/100 0.86 96.67 0.53 1717 - 1G 3 A 2/99 0.58 96.88 0.49 R560T 2/106 0.54 97.06 0.47 621 ϩ 1G 3 T 3/163 0.53 97.25 0.44 S549N 0/196 0.0 97.25 0.44 * Chromosomes were analyzed on blood or cheek cell specimens obtained from 360 patients (80% of the total Wisconsin CF population), all of whom had a positive sweat test. Login to comment
152 DNA Analysis of Genotyped CF Patients in the US* n Percent ⌬F508 12701 67.7 G542X 403 2.2 G551D 357 1.9 W1282X 240 1.3 N1303K 223 1.2 R553X 157 0.8 3849 ϩ 10kbC 3 T 102 0.5 621 ϩ 1G 3 T 147 0.8 1717 - 1G 3 A 101 0.5 R117H 101 0.5 R334W 36 0.2 ⌬I507 42 0.2 R347P 37 0.2 R560T 23 0.1 R1162X 44 0.2 2789 ϩ 5G 3 A 25 0.1 A455E 16 0.1 3120 ϩ IG 3 A 14 0.0 S549N 12 0.0 711 ϩ IG 3 T 9 0.0 Other 178 0.9 Unidentified 3814 20.3 Total 18782 99.7† Patient Genotypes Allele 1/Allele 2 n % of Genotype ⌬F508/⌬F508 4573 48.7 ⌬F508/Known 1511 16.1 ⌬F508/Unknown 2044 21.8 Known/unknown 310 3.3 Known/known 223 2.4 Unknown/unknown 730 7.8 Total 9391 100.0 *Data from Cystic Fibrosis Registry, 1995; Annual Report. Login to comment
47 Polyacrylamide gel electrophoresis of PCR-amplified DNA served to identify the DF508 mutation.14 Mutations S549N, R553X, and G551D were screened by PCR amplification of exon 11, followed by restriction enzyme digests that are diagnostic of each mutation. Login to comment
118 Tested) Frequency (%) Theoretical Cumulative Detectionߤ (%) Patients Missed in One Yearߥ DF508&#a7; 513/720 71.25 91.74 1.32 G542X 17/162 3.02 93.38 1.05 W1282X 7/102 1.97 94.36 0.90 R117H 6/101 1.71 95.14 0.77 R553X 11/197 1.61 95.82 0.66 G551D 9/195 1.33 96.35 0.58 N1303K 3/100 0.86 96.67 0.53 1717 2 1G 3 A 2/99 0.58 96.88 0.49 R560T 2/106 0.54 97.06 0.47 621 1 1G 3 T 3/163 0.53 97.25 0.44 S549N 0/196 0.0 97.25 0.44 * Chromosomes were analyzed on blood or cheek cell specimens obtained from 360 patients (80% of the total Wisconsin CF population), all of whom had a positive sweat test. Login to comment
147 DNA Analysis of Genotyped CF Patients in the US* n Percent DF508 12701 67.7 G542X 403 2.2 G551D 357 1.9 W1282X 240 1.3 N1303K 223 1.2 R553X 157 0.8 3849 1 10kbC 3 T 102 0.5 621 1 1G 3 T 147 0.8 1717 2 1G 3 A 101 0.5 R117H 101 0.5 R334W 36 0.2 DI507 42 0.2 R347P 37 0.2 R560T 23 0.1 R1162X 44 0.2 2789 1 5G 3 A 25 0.1 A455E 16 0.1 3120 1 IG 3 A 14 0.0 S549N 12 0.0 711 1 IG 3 T 9 0.0 Other 178 0.9 Unidentified 3814 20.3 Total 18782 99.7ߤ Patient Genotypes Allele 1/Allele 2 n % of Genotype DF508/DF508 4573 48.7 DF508/Known 1511 16.1 DF508/Unknown 2044 21.8 Known/unknown 310 3.3 Known/known 223 2.4 Unknown/unknown 730 7.8 Total 9391 100.0 *Data from Cystic Fibrosis Registry, 1995; Annual Report. Login to comment

[hide] Identification of common cystic fibrosis mutations... Am J Hum Genet. 1997 May;60(5):1122-7. Macek M Jr, Mackova A, Hamosh A, Hilman BC, Selden RF, Lucotte G, Friedman KJ, Knowles MR, Rosenstein BJ, Cutting GR
Identification of common cystic fibrosis mutations in African-Americans with cystic fibrosis increases the detection rate to 75%.
Am J Hum Genet. 1997 May;60(5):1122-7., [PMID:9150159]

Abstract [show]
Cystic fibrosis (CF)--an autosomal recessive disorder caused by mutations in CF transmembrane conductance regulator (CFTR) and characterized by abnormal chloride conduction across epithelial membranes, leading to chronic lung and exocrine pancreatic disease--is less common in African-Americans than in Caucasians. No large-scale studies of mutation identification and screening in African-American CF patients have been reported, to date. In this study, the entire coding and flanking intronic sequence of the CFTR gene was analyzed by denaturing gradient-gel electrophoresis and sequencing in an index group of 82 African-American CF chromosomes to identify mutations. One novel mutation, 3120+1G-->A, occurred with a frequency of 12.3% and was also detected in a native African patient. To establish frequencies, an additional group of 66 African-American CF chromosomes were screened for mutations identified in two or more African-American patients. Screening for 16 "common Caucasian" mutations identified 52% of CF alleles in African-Americans, while screening for 8 "common African" mutations accounted for an additional 23%. The combined detection rate of 75% was comparable to the sensitivity of mutation analysis in Caucasian CF patients. These results indicate that African-Americans have their own set of "common" CF mutations that originate from the native African population. Inclusion of these "common" mutations substantially improves CF mutation detection rates in African-Americans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Mutation Analysis All patients were screened for the AF508 mutation and 15 common Caucasian CF mutations using a reverse dot strip hybridization system (Kawasaki et al. 1993) (R117H, 621+1G--T, R334W, R347P, A455E, A1507, 1717-1G-+A, G542X, S549N, GSS1D, R553X, R560T, 3849+10kbC-+T, W1282X, and N1303K) (Welsh et al. 1995) and a deep intron 11 splice-site mutation, 1811+1.6kbA-+G (Chillon et al. 1995). Login to comment
70 Finally, 13 mutations found in one patient each had been previously reported in Caucasian patients (Q98R, R352Q, V520F, 1812-1G--A, G542X, S549N, and Y913C) (Romey et al. 1995; Welsh et al. 1995) or in African-American patients (444delA, G480C, 1342-2delAG [originally reported as 1342-1G--+C], 2307insA, 3662delA, and W1316X) (Cutting et al. 1990b; White et al. 1991; Zielenski et al. Login to comment
86 The most common muta- Table 2 Distribution of CF Mutations in African-American and U.S.-Caucasian CF Patients African-American U.S. Caucasiana Mutation (n= 148) % (n = 8,714) % Caucasian mutations: AF508 71 48 5,769 66.2 R117H 0 0 47 .5 621+1 G--T 0 0 68 .8 R334W 1 .7 7 .1 R347P 0 0 24 .3 A455E 0 0 5 .1 AI507 1 .7 10 .1 1717-1 G-IA 1 .7 39 .5 G542X 1 .7 204 2.3 S549N 1 .7 4 .1 GS51D 1 .7 173 2.0 R553X (Caucasian)b 0 0 87 1.0 R560T 0 0 16 .2 3849+10kb C-T 0 0 51 .6 W1282X 0 0 235 2.7 N1303K 0 0 116 1.3 Subtotal 77 52 6,855 78.7 African-American mutations: 405+3 A-C 2 1.4 ... ... 444delA 1 .7 ... ... G480C 2 1.4 ... ... R553X (African)b 3 2.0 ... ... A559T 3 2.0 ... ... 2307insA 3 2.0 ... ... 3120+1 GC-A 18 12.2 ... ... S1255X 2 1.4 ... ... Subtotal 34 23 ... ... Total 111 75.0 6,855 78.7 NOTE.-Percentages are rounded. Login to comment
40 Mutation Analysis All patients were screened for the AF508 mutation and 15 common Caucasian CF mutations using a reverse dot strip hybridization system (Kawasaki et al. 1993) (R117H, 621+1G--T, R334W, R347P, A455E, A1507, 1717-1G-+A, G542X, S549N, GSS1D, R553X, R560T, 3849+10kbC-+T, W1282X, and N1303K) (Welsh et al. 1995) and a deep intron 11 splice-site mutation, 1811+1.6kbA-+G (Chillon et al. 1995). Login to comment
71 Finally, 13 mutations found in one patient each had been previously reported in Caucasian patients (Q98R, R352Q, V520F, 1812-1G--A, G542X, S549N, and Y913C) (Romey et al. 1995; Welsh et al. 1995) or in African-American patients (444delA, G480C, 1342-2delAG [originally reported as 1342-1G--+C], 2307insA, 3662delA, and W1316X) (Cutting et al. 1990b; White et al. 1991; Zielenski et al. Login to comment
87 The most common muta- Table 2 Distribution of CF Mutations in African-American and U.S.-Caucasian CF Patients African-American U.S. Caucasiana Mutation (n= 148) % (n = 8,714) % Caucasian mutations: AF508 71 48 5,769 66.2 R117H 0 0 47 .5 621+1 G--T 0 0 68 .8 R334W 1 .7 7 .1 R347P 0 0 24 .3 A455E 0 0 5 .1 AI507 1 .7 10 .1 1717-1 G-IA 1 .7 39 .5 G542X 1 .7 204 2.3 S549N 1 .7 4 .1 GS51D 1 .7 173 2.0 R553X (Caucasian)b 0 0 87 1.0 R560T 0 0 16 .2 3849+10kb C-T 0 0 51 .6 W1282X 0 0 235 2.7 N1303K 0 0 116 1.3 Subtotal 77 52 6,855 78.7 African-American mutations: 405+3 A-C 2 1.4 ... ... 444delA 1 .7 ... ... G480C 2 1.4 ... ... R553X (African)b 3 2.0 ... ... A559T 3 2.0 ... ... 2307insA 3 2.0 ... ... 3120+1 GC-A 18 12.2 ... ... S1255X 2 1.4 ... ... Subtotal 34 23 ... ... Total 111 75.0 6,855 78.7 NOTE.-Percentages are rounded. Login to comment

[hide] Analysis of 16 cystic fibrosis mutations in Mexica... Am J Med Genet. 1997 Apr 14;69(4):380-2. Villalobos-Torres C, Rojas-Martinez A, Villareal-Castellanos E, Cantu JM, Sanchez-Anzaldo FJ, Saiki RK, Barrera-Saldana HA
Analysis of 16 cystic fibrosis mutations in Mexican patients.
Am J Med Genet. 1997 Apr 14;69(4):380-2., [PMID:9098486]

Abstract [show]
We carried out molecular analysis of 80 chromosomes from 40 unrelated Mexican patients with a diagnosis of cystic fibrosis. The study was performed in two PCR steps: a preliminary one to identify mutation delta F508, the most frequent cause of cystic fibrosis worldwide, and the second a reverse dot-blot with allele-specific oligonucleotide probes to detect 15 additional common mutations in the Caucasian population. A frequency of 45% for delta F508 was found, making it the most common in our sample of Mexican patients. Another five mutations (G542X, 3,849 + 10 kb C-->T, N1303K, SN549N, and 621 + 1 G-->T) were detected, and those accounted for 11.25%. The remaining mutations (43.75%) were undetectable with the methodology used.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 Mutations N1303K, S549N and 621 + 1 G→T had same frequency (1.25%) which was the lowest detected in our sample. Login to comment
60 Mutation Frequency Data and Geographic Distribution of the Mutations Found in 80 Chromosomes From Mexican CF Patients Mutation Northeast n ‫ס‬ 54 Central n ‫ס‬ 16 Western n ‫ס‬ 10 Total n ‫ס‬ 80 CFGAC [1994] (%)n (%) n (%) n (%) n (%) ⌬F508 27 (50) 2 (12.5) 7 (70) 36 (45) 66 G542X 2 (3.7) 2 (12.5) 0 4 (5) 2.4 3849 + 10 kb C→T 1 (1.9) 0 1 (10) 2 (2.5) 0.2 N1303K 0 1 (6.25) 0 1 (1.25) 1.3 S549N 0 1 (6.25) 0 1 (1.25) 0.1 621 + 1 G→T 0 0 1 (10) 1 (1.25) 0.7 Othera 24 (44.4) 10 (62.5) 1 (10) 35 (43.7) Detected 30 (55.6) 6 (37.5) 9 (90) 45 (56.3) a Different from W1282X, R117H, R334W, R347P, A455E, ⌬I507, 1717 - 1 G→T, G551D, R553X, and R560T. Login to comment
62 It is interesting that we found one S549N mutant chromosome, which has a frequency of 0.1% worldwide. Login to comment

[hide] Missense mutation R1066C in the second transmembra... Hum Mutat. 1997;10(5):387-92. Casals T, Pacheco P, Barreto C, Gimenez J, Ramos MD, Pereira S, Pinheiro JA, Cobos N, Curvelo A, Vazquez C, Rocha H, Seculi JL, Perez E, Dapena J, Carrilho E, Duarte A, Palacio AM, Nunes V, Lavinha J, Estivill X
Missense mutation R1066C in the second transmembrane domain of CFTR causes a severe cystic fibrosis phenotype: study of 19 heterozygous and 2 homozygous patients.
Hum Mutat. 1997;10(5):387-92., [PMID:9375855]

Abstract [show]
We report the clinical features of 21 unrelated cystic fibrosis (CF) patients from Portugal and Spain, who carry the mutation R1066C in the CFTR gene. The current age of the patients was higher in the R1066C/any mutation group (P < 0.01), as compared to the deltaF508/deltaF508 group. Poor values for lung radiological involvement (Chrispin-Norman) and general status (Shwachman-Kulcycki) were observed in the R1066C/any mutation group (P < 0.005 and P < 0.0004). A slightly, but not significantly worse lung function was found in the R1066C/any mutation group when compared with the deltaF508/deltaF508 patients. No significant differences were detected regarding the age at diagnosis, sweat Cl-values, or percentiles of height and weight between the two groups. Neither were significant differences observed regarding sex, meconium ileus (4.7% vs. 11.1%), dehydration (10.5% vs. 14.7%), or pancreatic insufficiency (PI) (100% vs. 97.8%). The proportion of patients with lung colonization by bacterial pathogens was slightly, but not significantly higher in the R1066C/any mutation group (70.0%), as compared with the deltaF508/deltaF508 group (57.5%). Other clinical complications were significantly more frequent in the R1066C/any mutation patients(P < 0.02) than in the deltaF508/deltaF508 group. The two homozygous R1066C/R1066C patients died at the ages of 3 months and 7 years. The data presented in this study clearly demonstrate that the R1066C mutation is responsible for a severe phenotype similar to that observed in homozygous deltaF508 patients. The poor clinical scores and complications of patients with the R1066C mutation are probably related to their slightly longer survival.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 (Strong et al., 1991), E92K (Nunes et al., 1993), S549N (Curtis et al., 1993), I175V (Romey et al., 1994), A559T (McDowell et al., 1995), and G85E (Vázquez et al., 1996). Login to comment

[hide] SSCP analysis: a blind sensitivity trial. Hum Mutat. 1997;10(1):65-70. Jordanova A, Kalaydjieva L, Savov A, Claustres M, Schwarz M, Estivill X, Angelicheva D, Haworth A, Casals T, Kremensky I
SSCP analysis: a blind sensitivity trial.
Hum Mutat. 1997;10(1):65-70., [PMID:9222762]

Abstract [show]
Studies of the sensitivity of SSCP analysis usually have been performed under conditions contrary to the rules of quality control trials and have produced widely different results. We have performed a blind trial of the sensitivity of SSCP analysis for the detection of mutations in fragments up to 500 bp in length under a fixed single set of electrophoretic conditions. The mutation detection rate was 84%. In addition, we have identified a second mutation in nine samples. All these mutations are polymorphisms, including a novel polymorphism 1248 + 52T/C first reported in the present work.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment

[hide] Sensitivity of the denaturing gradient gel electro... Hum Mutat. 1997;9(2):136-47. Macek M Jr, Mercier B, Mackova A, Miller PW, Hamosh A, Ferec C, Cutting GR
Sensitivity of the denaturing gradient gel electrophoresis technique in detection of known mutations and novel Asian mutations in the CFTR gene.
Hum Mutat. 1997;9(2):136-47., [PMID:9067754]

Abstract [show]
More than 500 mutations have been identified in the CFTR gene, making it an excellent system for testing mutation scanning techniques. To assess the sensitivity of denaturing gradient gel electrophoresis (DGGE), we collected a representative group of 202 CFTR mutations. All mutations analyzed were detected by scanning methods other than the DGGE approach evaluated in this study. DGGE analysis was performed on 24 of the 27 exons and their flanking splice site sequences. After optimization, 201 of the 202 control samples produced an altered migration pattern in the region in which an alteration occurred. The remaining sample was sequenced and found not to have the reported mutation. The ability of DGGE to identify novel mutations was evaluated in three Asian CF patients with four unknown CF alleles. Three novel Asian mutations were detected-K166E, L568X, and 3121-2 A-->G (in homozygosity)-accounting for all CF alleles. These results indicate that an optimized DGGE scanning strategy is highly sensitive and specific and can detect 100% of mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 621 + 1 GÃT, R334W, R347P, A455E, aI507, aF508, 1717-1 GÃA, G542X, S549N, G551D, R553X, R560T, 3849 + 10kb CÃT, W1282X, and N1303K) was performed using the rapid multiplex reverse dot hybridization system, under conditions provided by Roche Molecular Systems (Alameda, CA) (Kawasaki et al., 1993; Welsh et al., 1995). Login to comment

[hide] Heterogeneity of phenotype in two cystic fibrosis ... J Med Genet. 1996 Aug;33(8):711-3. Parad RB
Heterogeneity of phenotype in two cystic fibrosis patients homozygous for the CFTR exon 11 mutation G551D.
J Med Genet. 1996 Aug;33(8):711-3., [PMID:8863168]

Abstract [show]
In the heterozygous state, the cystic fibrosis transmembrane conductance regulator (CFTR) exon 11 mutation G551D has been described as "severe," causing pancreatic insufficiency. Two cystic fibrosis (CF) patients homozygous for this mutation showed a mild rather than severe pancreatic phenotype and a variable pulmonary phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
12 DNA from patient 1 was also assessed for 12 mutations by allele specific oligonucleotide analysis (ASO),4 but S549N was screened in addition, and 3849 + 1Okb was excluded. Login to comment

[hide] Cystic fibrosis heterozygote screening in 5,161 pr... Am J Hum Genet. 1996 Apr;58(4):823-35. Witt DR, Schaefer C, Hallam P, Wi S, Blumberg B, Fishbach A, Holtzman J, Kornfeld S, Lee R, Nemzer L, Palmer R
Cystic fibrosis heterozygote screening in 5,161 pregnant women.
Am J Hum Genet. 1996 Apr;58(4):823-35., [PMID:8644747]

Abstract [show]
A screening program for cystic fibrosis (CF) heterozygotes was conducted in a large HMO prenatal population, to evaluate the level of interest among eligible patients, the effectiveness of prescreening education, attitudes toward the screening process, psychological effects, and utilization of prenatal diagnosis and its outcomes. The heterozygote identification rate and frequency of specific CFTR mutations were also assessed. Identified carriers were offered genetic counseling and testing of male partners. Prenatal diagnosis was offered if both parents were identified as carriers. A total of 5,161 women underwent carrier testing; 947 others completed survey instruments only. The acceptance rate of screening was high (78%), and pretest education by videotape was generally effective. Adverse psychological effects were not reported. Participants generally found screening to be desirable and useful. Screening identified 142 female heterozygotes, 109 couples in which the male partner was not a carrier, and 7 high-risk couples. The incidence of R117H mutations was much higher than expected. The number of identified carriers was much lower in Hispanics than in Caucasians. We conclude that large-scale prenatal screening for CF heterozygotes in the absence of a family history of CF is an acceptable method for identifying couples at risk for affected fetuses. Sufficient pretest education can be accomplished efficiently, test insensitivity is well accepted, adverse psychological events are not observed, and general patient satisfaction is high.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 Lab group A was screened for the 6 most common mutations (F508, G542X, G551D, R553X, W1282X, and N1303K); lab group B was screened for 12 mutations, including the 6 most common and an additional 6 less common alleles (R117H, 621+1, I507, 1717G-A, R560T, and S549N). Login to comment
142 Table 7 CFTR Mutations in Screened Women NUMBER (%) wITH MUTATIONa GROUP ETHNiciTY F508 G542X GS5lD R553X W1282X N1303K R117H 621+1 1507 1717G-A R560T S549N TOTAL A Caucasian 26 (81) 5 (16) 1 (3) NA NA NA NA NA NA 32 Hispanic 2 (100) NA NA NA NA NA NA 2 B Caucasian 63b (65) 4 (4) 2 (3) 1 (1) 2 (2) 4 (4) 16b (16) 4 (4) 1 (1) 97b Hispanic 7 (88) 1 (12) 8 Caucasian/ Hispanic 2 (50) 1 (25) 1 (25) 4 'NA = not applicable. Login to comment

[hide] Methods for screening in cystic fibrosis. Methods Mol Med. 1996;5:99-119. Schwarz M, Malone G
Methods for screening in cystic fibrosis.
Methods Mol Med. 1996;5:99-119., [PMID:21374513]

Abstract [show]
Cystic fibrosis (CF) is the most common lethal autosomal recessive disorder in Whites, with an incidence of approx 1 m 2500 live births and a carrier frequency of approx 1 in 25. Since the discovery of the cystic fibrosis transmembrane conductance regulator (CFTR) gene m 1989 (1-3), molecular genetics laboratories throughout the world have endeavored to identify the mutations present in their population of CF-bearing chromosomes. Since the entire CFTR gene and its intron-exon boundaries have been sequenced, mutation analysis in CF has become relatively simple, although time consuming. Generally, a number of different methods are applied to mutation analysis, but all involve an imtial step of amplification of part of the gene by polymerase chain reaction (PCR) (4), or a derivative of it, such as amplification refractory mutation system (ARMS) (5).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Screening in Cystic Fibrosis 107 Table 5 CF Mutations Detectable by Restriction Endonuclease (RE) Digestion of PCR Products Mutation PCR primers0 RE RE digestion product sizes, bpbJ Normal Mutant G85E 621+ 1 (G`V 1154insTC R334W R347P G551D R553X R560T S549N 3849+ IOkb CC ` T) W1282X 3i5 and 313 4i5 and 4i3 Hinff MseI 105 + 204 33,35,71, 118, 181 7i5 and 7i3 MspI, RsaI 50,68,74 + 21V 715 and 7i3 MspI 192 + 218 7i5 and 7i3 CfoI 151+ 259 1li5 and 1113 Mb01 425 1115 and lli3 HzncII 186 + 239 lli5 and lli3 Mae11 425 lli5 and lli3 DdeI 13, 174 + 238 i19F and i19R HphI 88 + 349 2Oi5 and 2Oi3 Mnfl 185 + 288 309 33,35,54,71, 118, 127 50,68,76 + 21gc 410 410 182+243 425 215 + 210 13 + 412 88,127 + 222 473 'See Table 2 bThe expected digestion product sizes for both normal and mutant sequences are shown CTheseproducts may be d1stmgmshedby PAGE 1.2.3. Login to comment

[hide] CFTR gene transfer corrects defective glycoconjuga... Am J Physiol. 1995 Dec;269(6 Pt 1):L855-64. Mergey M, Lemnaouar M, Veissiere D, Perricaudet M, Gruenert DC, Picard J, Capeau J, Brahimi-Horn MC, Paul A
CFTR gene transfer corrects defective glycoconjugate secretion in human CF epithelial tracheal cells.
Am J Physiol. 1995 Dec;269(6 Pt 1):L855-64., [PMID:8572248]

Abstract [show]
We demonstrate that in immortalized normal human tracheal epithelial cells (NT-1 and 56FHTE8o-) 14C-labeled glycoconjugate secretion may be regulated independently by agonists of the protein kinase A (PKA) and protein kinase C (PKC) signaling pathways. In contrast, in immortalized cystic fibrosis (CF) human tracheal epithelial cells (CFT-1 and CFT-2), regulation is defective for agonists specific for the PKA but not for the PKC pathway. To characterize the involvement of the cystic fibrosis transmembrane conductance regulator (CFTR) in regulated glycoconjugate secretion, we examined the effect of adenovirus-mediated gene transfer of CFTR to CF and control cells. Forty-eight hours after infection, at a multiplicity of infection of 50 plaque-forming units per cell, high levels of CFTR mRNA were detected by reverse transcription-polymerase chain reaction, and de novo synthesis of CFTR protein was demonstrated by immunoblotting. Gene transfer to CF cells restored defective adenosine 3',5'-cyclic monophosphate (cAMP)-dependent secretion not only of chloride but also of glycoconjugates. Taken together, these results argue for a role for CFTR in cAMP-mediated glycoconjugate secretion.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 One was a compound heterozygote with S549N and N1303K mutations (CFT-1); the other was homozygous for the AF508 mutation (CFT-2). Login to comment
51 The CF cell lines used in this study are tracheal epithelial cells from two CF fetuses with different mutations in the CFTR gene: CFT-1 cells are compound heterozygote for S549N and Nl303K mutations; CFT-2 cells are homozygous for the AF508 mutation (23). Login to comment
251 Correction was consistently more marked in the homozygous AF508 cell line CFT-2 than in the compound heterozygote S549N/N1303K cell line CFT-1. Login to comment
291 The recovery was greater for the cells carrying the AF508 deletion than for those with the S549N/Nl303K mutation. Login to comment

[hide] Genetic and clinical features of patients with cys... Thorax. 1995 Dec;50(12):1301-4. Gan KH, Geus WP, Bakker W, Lamers CB, Heijerman HG
Genetic and clinical features of patients with cystic fibrosis diagnosed after the age of 16 years.
Thorax. 1995 Dec;50(12):1301-4., [PMID:8553305]

Abstract [show]
BACKGROUND: Cystic fibrosis is usually diagnosed in childhood, but a number of patients are not diagnosed until adulthood. The aim of this study was to investigate whether patients diagnosed at an older age had a different genetic constitution, manifestations of disease, and prognosis from those diagnosed at an early age. METHODS: Clinical data and results of lung function tests and DNA analysis of 143 adult patients with cystic fibrosis were entered into a computerised database. Patients diagnosed before their 16th birthday (early diagnosis, ED) were compared with those diagnosed at 16 years of age or older (late diagnosis, LD). RESULTS: Mean age of diagnosis of the ED group was 4.6 years compared with 27.7 years for the LD group. Mean (SD) percentage predicted pulmonary function was better for the LD group than for the ED group: forced expiratory volume in one second (FEV1) 72.5 (31.1)% and 52.0 (24.8)%, and forced vital capacity (FVC) 89.8 (25.7)% and 71.9 (23.0)%, respectively. Colonisation with Pseudomonas aeruginosa was present in 70% of the ED group and 24% of the LD group. In the ED group 81% had pancreatic insufficiency compared with only 12% of the LD group. None of the LD group was homozygous for delta F508 compared with 58% of the ED group. In the LD group 72% were compound AF508 heterozygotes and 28% had two non-delta F508 mutations. CONCLUSIONS: Among this group of 143 adult patients with cystic fibrosis late diagnosis is caused mainly by delayed expression and mild progression of clinical symptoms. Late diagnosis is associated with milder pulmonary disease, less pancreatic insufficiency, and different cystic fibrosis mutations. Since mortality in cystic fibrosis depends on the progression of pulmonary disease, patients with a late diagnosis have a better prognosis than those diagnosed early.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 DNA was analysed for the following mutations: E60X, R117H, A455E, AI507, AF508, G542X, S549N, G550X, G551D, R553X, R560T, R1162X, S1251N, W1282X, N1303K, 621 + 1G-+T, 1717-1G--+A. These mutations represent 80% ofthe expected cystic fibrosis mutations in The Netherlands. Login to comment
65 Table 3 CFTR mutations in 278 chromosomes of adult cystic fibrosis patients Early diagnosis Late diagnosis (n= 118) (n=25) n % n % AF508s 175 74-2 18 36-0 A455Em 12 5-1 14 28-0 1717-15 6 2-5 1 2-0 G542X' 4 1-7 - W1282X1 3 1-3 - R553X' 1 04 1 2-0 S1251N 2 0-8 - N1303K' 1 0 4 - E60X 1 0-4 3 6-0 Not identified 31 13-2 13 26-0 Total 236 50 Mutations not found: RI 17H, AI507, S549N, G550X, G551D, R560T, R1162X, 621+1G-+T. Login to comment

[hide] CFTR gene variant for patients with congenital abs... Am J Hum Genet. 1995 Oct;57(4):958-60. Zielenski J, Patrizio P, Corey M, Handelin B, Markiewicz D, Asch R, Tsui LC
CFTR gene variant for patients with congenital absence of vas deferens.
Am J Hum Genet. 1995 Oct;57(4):958-60., [PMID:7573058]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 W1282X Unknown 2 R553X Unknown ............ 20.0 4173delC Unknown1 1 D614G Unknown 1 1716+12T- C Unknown 1 J Unknown Unknown ............ .15 21.4 NOTE.-The known CFTR mutations screened included AF508, G542X, GSS1D, N1303K, R553X, W1282X, AI507, 1717-1G-A, R560T, S549N, 621+1G--T, and R117H. Login to comment

[hide] Screening Young syndrome patients for CFTR mutatio... Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7. Friedman KJ, Teichtahl H, De Kretser DM, Temple-Smith P, Southwick GJ, Silverman LM, Highsmith WE Jr, Boucher RC, Knowles MR
Screening Young syndrome patients for CFTR mutations.
Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7., [PMID:7551394]

Abstract [show]
Young syndrome is characterized by obstructive azoospermia associated with chronic sinobronchial disease of an infectious nature, but normal sweat-gland and pancreatic function as well as normal nasal potential differences. Congenital bilateral absence of the vas deferens (CBAVD) in some patients arises from mutations within the cystic fibrosis (CF) transmembrane regulator (CFTR) gene. Because of some similarities between Young syndrome, CF, and CBAVD, we evaluated 13 patients with Young syndrome, including screening for more than 30 different mutations within the CFTR gene. The mean age of the patients was 43 yr (range, 32 to 50 yr), and all were of northern European extraction. The sweat chloride concentration was normal in all patients (mean = 29 mEq/L; range, 8 to 43 mEq/L). Most had intermittent bronchial and sinus infections, but none was chronically colonized with Staphylococcus aureus or Pseudomonas aeruginosa. The FEV1 was normal or only mildly reduced in most patients (mean = 74%; range, 48 to 100% predicted). Of 26 Young syndrome chromosomes, we identified one with the recognized CF mutation delta F508. The incidence of CFTR mutations (1 in 26) did not differ significantly from the expected carrier frequency in this population. In summary, it is unlikely that the typical Young syndrome patient has a clinical disease associated with CFTR mutation on both alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No. Login to comment

[hide] Search for mutations in pancreatic sufficient cyst... Hum Genet. 1995 Sep;96(3):312-8. Brancolini V, Cremonesi L, Belloni E, Pappalardo E, Bordoni R, Seia M, Russo S, Padoan R, Giunta A, Ferrari M
Search for mutations in pancreatic sufficient cystic fibrosis Italian patients: detection of 90% of molecular defects and identification of three novel mutations.
Hum Genet. 1995 Sep;96(3):312-8., [PMID:7544319]

Abstract [show]
A cohort of 31 cystic fibrosis patients showing pancreatic sufficiency and bearing an unidentified mutation on at least one chromosome was analyzed through denaturing gradient gel electrophoresis of the whole coding region of the cystic fibrosis transmembrane conductance regulator gene, including intron-exon boundaries. Three new and 19 previously described mutations were detected. The combination of these with known mutations detected by other methods, allowed the characterization of mutations on 56/62 (90.3%) chromosomes. Among those identified, 17 can be considered responsible for pancreatic sufficiency, since they were found in patients carrying a severe mutation on the other chromosome. Among these presumed mild mutations, eight were detected more than once, R352Q being the most frequent in this sample (4.83%). Intragenic microsatellite analysis revealed that the six chromosomes still bearing unidentified mutations are associated with five different haplotypes. This may indicate that these chromosomes bear different mutations, rarely occurring among cystic fibrosis patients, further underlying the molecular heterogeneity of the genetic defects present in patients having pancreatic sufficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 (UN yet unidentified mutation) Patient Genotype after Genotype at the end number preliminary screening of the analysis UN/UN M1V/4382delA 1717-1G---~A/UN 1717-1G---~A/R1066H AF508/UN AF508/D579G UN/UN M1V/UN AF508/UN AF508/UN UN/UN T338I/R1158X UN/UN G85E/71 I+5G---~A UN/UN D1152H/UN AF508/UN AF508/UN AF508/UN AF508/3849+ 10kbC---~T UN/UN 711+3A---~G/UN AF508/UN AF508/F1052V UN/UN R352Q/W57G UN/UN 1898+3A----~G/UN AF508/UN AF508/711+5G--~A G542X/UN G542X/DI 152H AF508/UN AF508/E193K 1717-1G---~A/UN 1717-1G---~A/2789+5A---)G AF508/UN AF508/G1349D AF508/UN AF508/G85E AF508/UN AF508/R347P AF508/UN AF508/R352Q AF508/UN AF508/R352Q AF508/UN AF508/S549N G542X/UN G542X/R1066H AF508/UN AF508/T338I AF508/UN AF508/R334W AF508/UN AF508/R334W AF508/UN AF508/S1251N AF508/UN AF508/R1066C AF508/UN AF508/D579G results) while the remaining three haplotypes had been found in association with other rare mutations, which were excluded by DGGE analysis in these patients (Table 3). Login to comment

[hide] Two CF patients, one homozygous for the 621 + 1G >... J Med Genet. 1995 Feb;32(2):158. Cheadle JP, Meredith AL, Millar-Jones L, Goodchild MC
Two CF patients, one homozygous for the 621 + 1G > T splice mutation, the other homozygous for the 1898 + 1G > A splice mutation.
J Med Genet. 1995 Feb;32(2):158., [PMID:7539080]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 To date, investigators have described homozygotes for G542X,2 R553X,3 G85E,4 S549N,5 Rl17H,6 2184delA,7 R1162X,8 and W128X.9 We report here two patients, one homozygous for 621 + 1G>T, the other homozygous for 1898 + 1G>A. Login to comment

[hide] Cystic fibrosis: genotypic and phenotypic variatio... Annu Rev Genet. 1995;29:777-807. Zielenski J, Tsui LC
Cystic fibrosis: genotypic and phenotypic variations.
Annu Rev Genet. 1995;29:777-807., [PMID:8825494]

Abstract [show]
Cystic fibrosis (CF) is a common genetic disorder in the Caucasian population. The gene was identified in 1989 on the basis of its map location on chromosome 7. The encoded gene product, named cystic fibrosis transmembrane conductance regulator (CFTR), corresponds to a cAMP-regulated chloride channel found almost exclusively in the secretory epithelial cells. Although the major mutation that results in a single amino acid deletion (F508) accounts for 70% of the disease alleles, more than 550 additional mutant alleles of different forms have been detected. Many of these mutations can be divided into five general classes in terms of their demonstrated or presumed molecular consequences. In addition, a good correlation has been found between CFTR genotype and one of the clinical variables--pancreatic function status. An unexpected finding, however, is the documentation of CFTR mutations in patients with atypical CF disease presentations, including congenital absence of vas deferens and several pulmonary diseases. Thus, the implication of CFTR mutation is more profound than CF alone.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
552 T 2183AA --.0 3905insT S549N 2184deiA Q359K1T360K MllOlK YI22X 1898 + 50 --. Login to comment
593 Not surprisingly, Rl17H is associated with CF only when the allele also contains Table 2 Examples of complex alleles in the CfTR gene Principal Second site mutationa Location alteration Location Reference R75X exon 3 125G --.. C promoter 57 405 + IG --.. A intron 3 3030G --.. A exon 15 57 R1l7H exon 4 129G --.. C promoter 203 RI17H exon 4 IVS8 : 5T or 7T intron 8 101 R297Q exon 7 IVS8 : 5T or 7T intron 8 60 aF508 exon 10 R553Q exon II 59 aF508 exon 10 1I027T exon I7a 57 8F508 exon 10 deletion of D7S8 500 kb 3' of 186 CfTR S549N exon II R75Q exon 3 205a L619S exon 13 1716G � A exon 10 57 G628R (G � C) exon 13 SI235R exon 19 47 2184insA exon 13 IVS:5T exon 9 J Zielenski, J Bal, 0 Markiewicz, L-C Tsui, unpublished data A800G exon 13 IVS8 : 5T or 7T intran 8 31 S912L exon 15 GI244V exon 20 149 GlO69R exon 17b L88X exon 3 149 3732deiA exon 19 Kl200E exon 19 70 3849 + IOkbC � intron 19 R668C exon 13 57 T SI251N exon 20 F508C exon 10 94 The status of principal mutation may not be clear in every case; e.g. G628R(G --> C) vs S1235R. Login to comment
605 The one patient who showed severe CF disease was found to harbor a known CF mutation (S549N) in the allele carrying R75Q. Login to comment

[hide] Independent origins of cystic fibrosis mutations R... Am J Hum Genet. 1994 Nov;55(5):890-8. Morral N, Llevadot R, Casals T, Gasparini P, Macek M Jr, Dork T, Estivill X
Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene.
Am J Hum Genet. 1994 Nov;55(5):890-8., [PMID:7526685]

Abstract [show]
Microsatellite analysis of chromosomes carrying particular cystic fibrosis mutations has shown different haplotypes in four cases: R334W, R347P, R1162X, and 3849 + 10kbC-->T. To investigate the possibility of recurrence of these mutations, analysis of intra- and extragenic markers flanking these mutations has been performed. Recurrence is the most plausible explanation, as it becomes necessary to postulate either double recombinations or single recombinations in conjunction with slippage at one or more microsatellite loci, to explain the combination of mutations and microsatellites if the mutations arose only once. Also in support of recurrence, mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T involve CpG dinucleotides, which are known to have an increased mutation rate. Although only 15.7% of point mutations in the coding sequence of CFTR have occurred at CpG dinucleotides, approximately half of these CpG sites have mutated at least once. Specific nucleotide positions of the coding region of CFTR, distinct from CpG sequences, also seem to have a higher mutation rate, and so it is possible that the mutations observed are recurrent. G-->A transitions are the most common change found in those positions involved in more than one mutational event in CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 CT................... 3863: G--oA .................. G-.T ................... 3980: G-jA .................. G--)T.................... 4374+1: G-A .................. G--oT.................... L88S L88X L88X G. Malone, personal communication Savov et al. 1994b Macek et al. 1992 406-1G--.C Bonizzato et al. 1992 406-1G- T T. Bienvenu, personal communication E92K Nunes et al. 1993 E92X Will et al. 1994 S549N Cutting et al. 1990 S5491 Kerem et al. 1990 R560K Ferec et al. 1992 R560T Kerem et al. 1990 Y563D A. Hamosh, personal communication Y563N Kerem et al. 1990 1898+1CG-.A Strong et al. 1992 1898+1GC-.C Cuppens et al. 1993 1898+3A-)C W. Lissens, personal communication 1898+3A--4G Cremonesi et al. 1992 G628R G628R 2183AA- G 2184delA 2184insA M1101K M1101R 3667del4 3667ins4 3791delC T12201 G1244E G1244V R1283K R1283M Fanen et al. 1992 Cuppens et al. 1993 Bozon et al. 1994 Dork et al., in press N. Kilin, personal communication Zielenski et al. 1993 Mercier et al. 1993 Chillon et al. 1994a Sangiuolo et al. 1993 M. Macek, Jr., personal communication Ghanem et al. 1994 Devoto et al. 1991 Savov et al. 1994a Chevalier et al., in press Cheadle et al. 1992 4374+1G-*A Fanen et al. 1992 4374+1G--iT Dork et al. 1993 of the most common allele. Login to comment

[hide] High-density multiplex detection of nucleic acid s... Nucleic Acids Res. 1994 Oct 25;22(21):4527-34. Grossman PD, Bloch W, Brinson E, Chang CC, Eggerding FA, Fung S, Iovannisci DM, Woo S, Winn-Deen ES
High-density multiplex detection of nucleic acid sequences: oligonucleotide ligation assay and sequence-coded separation.
Nucleic Acids Res. 1994 Oct 25;22(21):4527-34., [PMID:7526344]

Abstract [show]
We describe a non-isotopic, semi-automated method for large-scale multiplex analysis of nucleic acid sequences, using the cystic fibrosis transmembrane regulator (CFTR) gene as an example. Products of a multiplex oligonucleotide ligation assay (OLA) are resolved electrophoretically from one another and from unligated probes under denaturing conditions with fluorescence detection. One ligation probe for each OLA target carries a fluorescent tag, while the other probe carries an oligomeric non-nucleotide mobility modifier. Each OLA product has a unique electrophoretic mobility determined by the ligated oligonucleotides and the mobility-modifier oligomer arbitrarily assigned (coded) to its target. The mobility range for practical mobility modifiers is much wider than the accessible range from unmodified ligated oligonucleotides of practical length. Each mobility modifier is built from phosphoramidite monomers in a stepwise manner on its associated oligonucleotide using an automated synthesizer. The resulting mobility modifiers lower the probe-target duplex Tm by less than 3 degrees C and retard probe-target annealing by less than 50%, with negligible effect on OLA yield and specificity. This method is especially useful for allelic discrimination in highly polymorphic genes such as CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 Probes for multiplex CF OLA assay CF Locus S549R2-WT S549R2-MUT S549R2-COM S549N WT S549N-MUT S549N-COM G542-WT G542-MUT G542X-COM R553-WT R553X-MUT R553-COM G551-WT G55ID-MUT G55ICOM W1282-WT W1282X-MUT W1282-COM R560T-WT R560T-MUT R560-COM 1717-WT 1717-MUT 1717-COM 3905-WT 39O51NST-MUT 3905-COM Sequence (5'-3') (HEO)2-TTGCTCGTTGACCTCCA (HEO)3-TTGCTCGTTGACCTCCC PO4-CTCAGTGTGATTCCACCT-FAM (HEO)4-TGCTCGTTGACCTCCAC (HEO)5-TGCTCGTTGACCTCCAT PO4-TCAGTGTGATTCCACCTTC-FAM (HEO)6-GTGATTCCACCTTCTCC (HEO)7-GTGATTCCACCTTCTCA PO4-AAGAACTATATTGTCTTTCTCT-FAM (HEO)8-TGCTAAAGAAATTCTTGCTCG (HEO)9-TTGCTAAAGAAATTCTTGCTCA PO4-TTGACCTCCACTCAGTGTGA-FAM (HEO)IO-TAAAGAAATTCTTGCTCGTTGAC (HEO)11-TAAAGAAATTCTTGCTCGTTGAT PO4-CTCCACTCAGTGTGATTCCA-FAM (HEO) 12-TATCACTCCAA AGGCTTTCCTC (HEO) 13-TATCACTCCAAAGGCTTTCCTT PO4-CACTGTTGCAAAGTTATTGAATCC-FAM (HEO)14-TAGACCAATAATTAGTTATTCACC (HEO)15-TAGACCAATAATTAGTTATTCACG PO4-TTGCTAAAGAAATTCTTGCTCG-FAM (HEO) 16-TCTGCAAACTTGG AGATGTCC (HEO) 17-TCTGCAAACTTGGAGATGTCT PO4-TATTACCAAAAATAGAAAATTAGAGA-FAM (HEO) 18-A AGAGTACTTTGTTATCAGCTTTTTT (HEO)19-AAGAGTACTnUTIATCAGCTnTnT PO4-GAGACTACTGAACACTGAAGGAG-FAM Oligonucleotide ligation assay kinetics study For the study of ligation reaction kinetics, probe concentrations were 5 nM, and oligonucleotide target concentration was 0.5 nM. Login to comment
157 Variations in OLA product yield seen in Figure 4 can more likely be attributed to the high degree of overlap of the probes used in the exon 11 mutational hotspot (G542X, S549N, S549R2, G551D, R553X, R560T). Login to comment

[hide] MutS binding protects heteroduplex DNA from exonuc... Nucleic Acids Res. 1994 Jul 11;22(13):2710-1. Ellis LA, Taylor GR, Banks R, Baumberg S
MutS binding protects heteroduplex DNA from exonuclease digestion in vitro: a simple method for detecting mutations.
Nucleic Acids Res. 1994 Jul 11;22(13):2710-1., [PMID:7518920]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 Figures 1-4 illustrate the detection of four different mutations in CFTR exon 11 (1717-1 G-A, R553X, G551D, S549N) by this method. Login to comment
27 Mutation wild type 1717-1 (G-A) R553X (C-T) G551D (G-A) S549N (G-A) Observed fragment size (blue) none 189 269 259 253 Distance from primer to mutation (blue) NA 184 256 250 245 Observed fragment size (green) none 326 246 256 263 Distance from primer to mutation (green) NA 308 236 242 247 *To whom correspondence should be addressed at: DNA Laboratory, Regional Genetics Service, Ashley Wing, St James's University Hospital, Leeds LS9 7TF, UK atUniversityofNorthCarolinaatChapelHillonOctober25,2012http://nar.oxfordjournals.org/Downloadedfrom Nucleic Acids Research, 1994, Vol. 22, No. 13 / 189 326 1. . Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment

[hide] Sensitivity of single-strand conformation polymorp... Hum Mol Genet. 1994 May;3(5):801-7. Ravnik-Glavac M, Glavac D, Dean M
Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene.
Hum Mol Genet. 1994 May;3(5):801-7., [PMID:7521710]

Abstract [show]
The gene responsible for cystic fibrosis (CF) contains 27 coding exons and more than 300 independent mutations have been identified. An efficient and optimized strategy is required to identify additional mutations and/or to screen patient samples for the presence of known mutations. We have tested several different conditions for performing single-stranded conformation polymorphism (SSCP) analysis in order to determine the efficiency of the method and to identify the optimum conditions for mutation detection. Each exon and corresponding exon boundaries were amplified. A panel of 134 known CF mutations were used to test the efficiency of detection of mutations. The SSCP conditions were varied by altering the percentage and cross-linking of the acrylamide, employing MDE (an acrylamide substitute), and by adding sucrose and glycerol. The presence of heteroduplexes could be detected on most gels and in some cases contributed to the ability to distinguish certain mutations. Each analysis condition detected 75-98% of the mutations, and all of the mutations could be detected by at least one condition. Therefore, an optimized SSCP analysis can be used to efficiently screen for mutations in a large gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.). Login to comment

[hide] Nasal epithelial ion transport and genetic analysi... Hum Mol Genet. 1993 Oct;2(10):1605-9. Osborne LR, Lynch M, Middleton PG, Alton EW, Geddes DM, Pryor JP, Hodson ME, Santis GK
Nasal epithelial ion transport and genetic analysis of infertile men with congenital bilateral absence of the vas deferens.
Hum Mol Genet. 1993 Oct;2(10):1605-9., [PMID:7505692]

Abstract [show]
It has been suggested that congenital bilateral absence of the vas deferens (CBAVD), an important cause of male infertility, is a variant of cystic fibrosis (CF). This study describes a defect in chloride conductance across the nasal epithelium of subjects with CBAVD which is dissimilar to that found in patients with CF. It also demonstrates normal sodium transport across the nasal epithelium in these men, in contrast to patients with CF who exhibit increased sodium absorption. The increased frequency of CFTR mutations in these men implicates the CFTR gene in the pathogenesis of this disorder. Genetic analysis of men with CBAVD who were heterozygous for a known CFTR mutation failed to identify a second mutation within any of the exons or introns of the CFTR gene. These results demonstrate that most men presenting with CBAVD are not compound heterozygotes for mutations within the CFTR gene and can be distinguished from individuals with atypical or asymptomatic CF on the basis of the bioelectric properties of their nasal epithelium. We postulate that mutations in the promoter region or at other regulatory sites of the CFTR gene may be responsible for the CBAVD phenotype in a proportion of cases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 Nasal potential difference, sweat sodium concentration and CF genotype in subjects with CBAVD, CF patients and controls CF genotype Control cohort CBAVD cohort CF cohort N/N« AF5O8/R347H SM9N/R1070Q AF508/Other R553X/N*> Unknown/Unknowtf AF 5«/AF5O8 AFjQj/Other AF508/R347P AF50e/G542X AFjQg/RllTH AF5O8/G85E AF5Q8/R553X AFJO8/G551D AF5O8A^520F AFJO8/S549N AF^/DIjQ, N1303K/Other G542X/R117H AFJ08/R334W Other/Other Subjects 50 1 1 1 6 1 16 25 18 3 2 1 1 1 2 1 1 1 3 1 1 3 Mean (range) sweat Na+ concentration (mmol/1) 50 (27-78) 88 N/A 94 57 (47-70) 36 49 (32-76) 126(80-162) 99 (80-128) 108 (99-115) 128 (118-137) 95 107 130 122 (116-128) 90 80 118 96 (92-99) 84 123 108(83-130) Mean (range) nasal potential difference (-mV) 21 (8-30) 31 N/A 34 23 (13-29) -15 20 (-13-28) 45 (32-58) 41 (33-61) 50 (36-77) 43 (33-52) 51 42 39 60 (50-71) 32 37 41 38 (36-40) 32 34 44(31-57) N = non-CF chromosome Other = uncharacterised CF chromosome N/A not available • with CF carrier frequency of 1/20-1/25, it is likely that 2 or 3 of these individuals will be carriers. Login to comment
34 One of these was a British Caucasian whose genotype was AFJ08/R347H and the second, a Pakistani Asian, was heterozygous for the S549N and R1070Q mutations (Table 1). Login to comment

[hide] Direct sequencing of the complete CFTR gene: the m... Hum Mol Genet. 1993 Oct;2(10):1551-6. Cheadle JP, Goodchild MC, Meredith AL
Direct sequencing of the complete CFTR gene: the molecular characterisation of 99.5% of CF chromosomes in Wales.
Hum Mol Genet. 1993 Oct;2(10):1551-6., [PMID:7505689]

Abstract [show]
We have performed an extensive mutation analysis on 184 CF families in Wales. In our previous study, mutations on 329/369 CF chromosomes were identified after screening for delta F508 and sixteen other mutations. To identify the mutations on the remaining 40 uncharacterized CF chromosomes, we have carried out direct DNA sequencing over the complete coding region, intron splice sites, and part of the promoter region of the CFTR gene. During this study we have designed a set of internal sequencing primers which allow clear sequencing through the aforementioned regions. Sequence analysis revealed 15 further mutations (4 of which are novel), and 10 previously described polymorphisms. In total, we have identified 29 mutations, the distribution of which provides further insight into the functional domains of the CFTR protein. We have characterised 99.5% of the CF chromosomes (365/367, one sample degraded). In order to ascertain accurate frequency data for the Welsh population, CF families with at least 3 'Welsh' grandparents were strictly regarded as 'Welsh'. Of these 91 families, delta F508 accounts for 71.6%, 621 + 1G-->T 6.6% and 1898 + 1G-->A 5.5%. The implications for CF population screening in Wales are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 In the three CF chromosomes in which we excluded the site of the mutation from the complete coding regions, the intron splice sites, and part of the promoter region (see above) of the CFTR gene, we screened S549N heterozygote G A T C 1078 delT heterozygote G A T C G T . Login to comment
62 S549N (G-A a: 1778) and S549R (T-G at 1779) were sequenced from 1115', 1078 delT from 7i5\ 3659 deIC from 19e3'b, and 3272-26A-G from 17Bi5'. Login to comment

[hide] Analysis of the 27 exons and flanking regions of t... Hum Mol Genet. 1993 Aug;2(8):1209-13. Claustres M, Laussel M, Desgeorges M, Giansily M, Culard JF, Razakatsara G, Demaille J
Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France.
Hum Mol Genet. 1993 Aug;2(8):1209-13., [PMID:7691344]

Abstract [show]
In order to characterize the non-delta F508 mutations that account for 36% of cystic fibrosis (CF) chromosomes in Southern France in a sample of 137 patients, we have systematically screened the entire coding region and adjacent sequences of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by the single strand conformation polymorphism (SSCP) technique followed by direct sequencing of the mutant DNAs. We identified 13 novel mutations (9 reported in this paper) and 4 novel rare nucleotide sequence variations. Forty different mutations including delta F508, located in 15 exons, account for only 91.2% of mutants in a population originating from Southern France, in contrast with a recent report on the Celtic population of Brittany demonstrating that 90% of mutations can be detected with only three mutations. We present a very large spectrum of different CF mutations identified in a small geographical area.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation? Login to comment

[hide] Cystic fibrosis mutations impair the fertilization... Hum Reprod. 1993 Aug;8(8):1259-63. Patrizio P, Ord T, Silber SJ, Asch RH
Cystic fibrosis mutations impair the fertilization rate of epididymal sperm from men with congenital absence of the vas deferens.
Hum Reprod. 1993 Aug;8(8):1259-63., [PMID:7691870]

Abstract [show]
One of the limiting factors for the successful treatment of male sterility due to congenital absence of the vas deferens (CAVD) is the low (< 20%) and extremely unpredictable rate of in-vitro fertilization of their epididymal spermatozoa. The recent demonstration that CAVD is a mild form of cystic fibrosis (CF) disease, almost exclusively involving the genital tract, has prompted us to investigate the hypothesis of whether there could be an association between particular CF genotype mutations and the in-vitro performance of epididymal sperm. In this study 63 patients with surgically confirmed diagnosis of CAVD undergoing microsurgical epididymal sperm aspiration (MESA) and in-vitro fertilization (IVF) were evaluated. The genetic screening was carried out on DNA extracted from peripheral lymphocytes and amplified by the polymerase chain reaction. A total of 12 mutations in the cystic fibrosis transmembrane regulator gene (CFTR), representing approximately 90% of the total known CF mutations, were tested. The presence or absence of mutations, as well as the type of mutation found, was correlated with the IVF and pregnancy rates. Of the 63 patients examined, 40 (64%) were positive to the CF screening and 23 were negative. In three cases no spermatozoa were found because of rete testis blockage. The difference in fertilization rates between patients testing positive and negative was highly significant (P = 0.000003), 13 versus 23%, respectively. In order to pinpoint which mutation could account for the most deleterious effect on the IVF results, we analysed these by keeping the patients separated by CF mutations.(ABSTRACT TRUNCATED AT 250 WORDS)

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Briefly, genomic DNA extracted from peripheral lymphocytes was amplified by the polymerase chain reaction (PCR) and analysed for 12 mutations in the CFTR gene: Delta F508, G542X, G551D, R553X, W1282X, N1303K, Delta 1507, 1717G-A, R560T, S549N, R117H and 621 + 1. Login to comment

[hide] Multiplex PCR amplification from the CFTR gene usi... Hum Mol Genet. 1993 Feb;2(2):159-63. Richards B, Skoletsky J, Shuber AP, Balfour R, Stern RC, Dorkin HL, Parad RB, Witt D, Klinger KW
Multiplex PCR amplification from the CFTR gene using DNA prepared from buccal brushes/swabs.
Hum Mol Genet. 1993 Feb;2(2):159-63., [PMID:7684637]

Abstract [show]
Traditionally, DNA used for PCR-based diagnostic analysis has originated from white cells fractionated from whole blood. Although this method yields substantial quantities of DNA, there are some drawbacks to the procedure, including the inconvenience of drawing blood, risk of exposure to blood-borne pathogens, liquid sample handling, and the somewhat involved extraction procedure. Alternatively, DNA for genetic diagnosis has been derived from finger stick blood samples, hair roots, cheek scrapings, and urine samples. Oral saline rinses have also been used extensively as a means of collecting buccal epithelial cells as a DNA source. However, this method still requires liquid sample handling. Herein, we present our results involving the rapid extraction of DNA from buccal cells collected on cytology brushes and swabs for use in PCR reactions, specifically the multiplex amplification of 5 exons within the CFTR gene. The quality of DNA isolated from buccal cells, collected in this manner, has been sufficient to reproducibly support multiplex amplification. Cheek cell samples and the DNA prepared from them as described here are highly stable. The success rate of PCR amplification on DNA prepared from buccal cells is 99%. In a blind study comparing the analysis of 12 mutations responsible for cystic fibrosis in multiplex products amplified with DNA from both blood and buccal cell samples from 464 individuals, there was 100% correlation of results for blood and cheek cell DNA, validating the use of DNA extracted from cheek cells collected on cytology brushes for use in genetic testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 All of the mutations except S549N were present in the population tested in this study, and all mutations were efficiently detected by uie assay. Login to comment
108 observed AF5O8 G542X G551D W1282X R553X R560T 1717-1 N1303K 621 + 1 R117H S549N 1507 280 7 16 2 4 2 2 5 6 11 1 •Includes affected individuals and known carriers. Login to comment

[hide] Efficient 12-mutation testing in the CFTR gene: a ... Hum Mol Genet. 1993 Feb;2(2):153-8. Shuber AP, Skoletsky J, Stern R, Handelin BL
Efficient 12-mutation testing in the CFTR gene: a general model for complex mutation analysis.
Hum Mol Genet. 1993 Feb;2(2):153-8., [PMID:7684636]

Abstract [show]
The identification of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has led to the identification of more than 225 presumed disease-causing mutations at the locus. The diagnosis of cystic fibrosis or the carrier state by direct DNA analysis is hindered by this large number. A practical assay must be able to detect enough mutations to achieve clinically significant sensitivity. The use of allele-specific oligonucleotide probes is the most promising of the available methods. However, to date this has generally involved tedious probe-by-probe hybridizations, due to variations in the oligonucleotides' denaturation temperatures caused by differences in their G-C base-pair content. We have developed a rapid, cost-effective assay that simultaneously detects 12 CFTR mutations after multiplex polymerase-chain-reaction amplification of genomic DNA. The test may be readily extended to detect additional mutations at minimal increase in the cost per test or the turnaround time. We improve specificity and avoid the need for individual hybridizations by the use of tetramethylammonium chloride to virtually eliminate the effects of G-C differences. Coupled with non-invasive sample-collection methods, this is an immediately practical assay for cystic fibrosis. More generally, it will serve as a model for the development of diagnostic tests in other genetic disorders involving complex mutation analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Percent GC content of allele-speciik oligonucleotides GC Content/ASO Mutation G542X G551D R553X W1282X N1303K DI507 1717-1 G - A R560T S549N R117H 621 + 1 G - T 40 53 53 47 41 30 41 53 53 47 30 HS«3X W12»2X N1J0JK £507 H117M • 21 SS4tN RSOOT Table 2. Login to comment
53 1) Number of ASOs (N = 12) 2) Mutation Frequencies # ofCF Mutation Chromosomes Frequency A508 G551D G542X W1282X N1303K R553X 621 + 1 G - T R117H 1717-1 G - A R560T AI507 S549N unknown Total 548 15 13 13 12. Login to comment
54 9 9 '3 3 2 1 1 133 764 • Minimal Number of Independent Conclusion (4 hybridizations) Filter # 1 N(A5O8) 2 A5O8 72.0% 2.0% 1.7% 2.0% 1.5% 1.1% 1.1% 0.4% 0.4% 0.3% 0.1% 0.1% 17.0% Hybridizations 3 4 G551D 621 + 1 G - T G542X R117H W1282X 1717-1 G - A N13O3K R560T R553X A507 S549N with the remaining six mutations: 621 + 1 G^T, R117H, 1717-1 G - A , R560T, AI507, and S549N. Login to comment
72 Example of results obtained from hybridizing four identical filters with ASOs specific for N (the normal sequence at position 508), AF508 (a 3 bp deletion at position 508), pool 1 (G542X, G551D, R553X, W1282X, and N13O3K), and pool 2 (AI507, R117H, 621 + 1 G - T , S549N, R560T, 1717-1 G-A). Login to comment
73 Row A contains positive control samples with the following genotypes: 1A (AF508/AF508); 2A (AF508/G542X); 3A (AF5O8/G551D); 4A (N/R553X); 5A (NAV1282X); 6A (AF5O8/N13O3K); 7A (N/AI5O7); 8A (N/R117H); 9A (N/621 + 1 G-T); 10A (AF508/S549N); HA (AF508/R560T); and 12A (N/1717-1 G-A). Login to comment
80 Pool 2: lane 1 (AI507); lane 2 (Rl 17H); lane 3 (621 +1 G-T); lane 4 (S549N); lane 5 (R560T); lane 6 (1717-1 G - A ) . Login to comment
86 Row A contains positive control samples: lane 2 (G542X); lane 3 (G551D); lane 4 (R553X); lane 5 (W1282X); lane 6 (N13O3K); lane 7 (AI507); lane 8 (R117H); lane 9 (621 +1 G-T)); lane 10 (S549N); lane 11 (R560T); lane 12 (1717-1 G-A)). Login to comment
122 For example, no cross-hybridization is seen here between ASOs for S549N, G55 ID, and R553X, which have identical target locations and differ in sequence by only one base pair. Login to comment

[hide] Aetiology of congenital absence of vas deferens: g... Hum Reprod. 1993 Feb;8(2):215-20. Patrizio P, Asch RH, Handelin B, Silber SJ
Aetiology of congenital absence of vas deferens: genetic study of three generations.
Hum Reprod. 1993 Feb;8(2):215-20., [PMID:8473422]

Abstract [show]
Bilateral congenital absence of the vas deferens (CAVD) is a form of male sterility (found in otherwise normal men) of unknown aetiology. Because males with cystic fibrosis (CF) almost invariably have CAVD as well, we investigated the hypothesis that men with isolated CAVD might share a common genetic background with males with CF. Genetic testing for CF was carried out in three generations of subjects: 44 patients with CAVD and their wives, 24 of their parents, and 13 of their offspring generated by microsurgical epididymal sperm aspiration (MESA) and in-vitro fertilization (IVF). DNA extracted from peripheral lymphocytes was amplified by the polymerase chain reaction (PCR) and then analysed for 12 mutations in the cystic fibrosis transmembrane conductance regulatory (CFTR) gene. Among 44 patients tested with CAVD, 26 (59%) were positive for at least one CF mutation, while the carrier frequency for CF mutations in the general population is only 4%. Four patients were found to be compound heterozygotes, three with genotypes Delta F-508/R117H, one with R553X/R117H. Among 24 parents tested, 15 (seven fathers, eight mothers) had sons with CAVD who were positive for CF mutations. Of these, nine (four fathers and five mothers) were found to be carriers for CF mutations. These four fathers, although carriers of CF mutations, were obviously fertile. Of the 13 offspring tested, six (three boys and three girls) had CF positive fathers. Of these, three (two girls and one boy) were found to be carriers for CF mutations. These MESA/IVF children are the first offspring to whom men with CAVD have been able to transmit CF mutations.(ABSTRACT TRUNCATED AT 250 WORDS)

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Exon 4,10,11,20 and 21 were amplified in a multiplex reaction followed by allele specific oligonucleotide (ASO) probe analysis for the mutations Delta F508, G542X, G551D, R553X, W1282X, N13O3K, Delta 1507, 1717G-A, R560T, S549N, R117H and 621 + 1. Login to comment

[hide] Absence of cystic fibrosis mutations in a large As... J Med Genet. 1993 Feb;30(2):164-6. Curtis A, Richardson RJ, Boohene J, Jackson A, Nelson R, Bhattacharya SS
Absence of cystic fibrosis mutations in a large Asian population sample and occurrence of a homozygous S549N mutation in an inbred Pakistani family.
J Med Genet. 1993 Feb;30(2):164-6., [PMID:7680378]

Abstract [show]
The occurrence of cystic fibrosis is very rare in the Asian population. Carriers of the mutations most commonly found in Caucasians were not detected in a large Asian population sample of almost 900 chromosomes. However, an affected Pakistani child born to consanguineous parents was further investigated and shown to be homozygous for the mutation S549N (G-->A). Molecular and clinical data are presented which may improve our understanding of the phenotypic effects of the S549N mutation in the CFTR gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Molecular and clinical data are presented which may improve our understanding of the phenotypic effects of the S549N mutation in the CFTR gene. Login to comment
19 Such homozygotes are likely to be extremely rare, but some useful cases have been identified, such as aG85E homozygotel' and an R553X" homozygote, in addition to the S549N case described here. Login to comment
28 Her lungs have been infected by mucoid strains of Pseudomonas 164 group.bmj.comon October 25, 2012 - Published byjmg.bmj.comDownloaded from Absence of cysticfibrosis mutations in a large Asian population sample and occurrence of a homozygous S549N mutation in an inbred Pakistanifamily aeruginosa since the age of 5 years. Login to comment
48 These show a G to A substitution at cDNA nucleotide position 1778 which creates the S549N (Ser-+Asn) mutation in the CFTR protein previously described by Cutting et al.4 Discussion Cystic fibrosis has rarely been described in subjects from the Asian population. Login to comment
49 No carriers of the commonest Caucasian CF mutation (AF508) or of the less common G551D, R553X, and S549N mutations were detected in an Asian population of 443 unrelated subjects, even though the frequency of 5-8% in our population was slightly greater than expected. Login to comment
52 The affected Pakistani child studied here is homozygous for a rare CF mutation, S549N. Login to comment
54 The detection of this mutation allowed carrier testing for her two unaffected brothers, neither of whom were shown to carry the S549N mutation (figs 1 and 2). Login to comment
29 Her lungs have been infected by mucoid strains of Pseudomonas 164 group.bmj.com on December 5, 2015 - Published by http://jmg.bmj.com/ Downloaded from Absence of cysticfibrosis mutations in a large Asian population sample and occurrence of a homozygous S549N mutation in an inbred Pakistanifamily aeruginosa since the age of 5 years. Login to comment
50 No carriers of the commonest Caucasian CF mutation (AF508) or of the less common G551D, R553X, and S549N mutations were detected in an Asian population of 443 unrelated subjects, even though the frequency of 5-8% in our population was slightly greater than expected. Login to comment
53 The affected Pakistani child studied here is homozygous for a rare CF mutation, S549N. Login to comment
55 The detection of this mutation allowed carrier testing for her two unaffected brothers, neither of whom were shown to carry the S549N mutation (figs 1 and 2). Login to comment

[hide] Ethnic heterogeneity and cystic fibrosis transmemb... Am J Hum Genet. 1992 Dec;51(6):1344-8. Ober C, Lester LA, Mott C, Billstrand C, Lemke A, van der Ven K, Marcus S, Kraut J, Lloyd-Still J, Booth C
Ethnic heterogeneity and cystic fibrosis transmembrane regulator (CFTR) mutation frequencies in Chicago-area CF families.
Am J Hum Genet. 1992 Dec;51(6):1344-8., [PMID:1281385]

Abstract [show]
The identification of a common mutation, delta F508, in the CFTR gene allowed, for the first time, the detection of cystic fibrosis (CF) carriers in the general population. Further genetic studies revealed > 100 additional disease-causing mutations in this gene, few of which occur on > 1% of CF chromosomes in any ethnic group. Prior to establishing counseling guidelines and carrier risk assessments, we sought to establish the frequencies of the CFTR mutations that are present in CF families living in the Chicago area, a region notable for its ethnic heterogeneity. Our sample included 283 unrelated CF carriers, with the following ethnic composition: 78% non-Ashkenazi Caucasians, 5% Ashkenazi, 9% African-American, 3% Mexican, 0.3% Native American, and 5% mixed ancestry. When a panel of 10 mutations (delta F508, delta I507, G542X, G551D, R553X, S549N, R1162X, W1282X, N1303K, and 1717-1G-->A) was used, detection rates ranged from 75% in non-Ashkenazi Caucasians to 40% in African-Americans. These data suggest that the goal of screening for 90%-95% of CF mutations may be unrealistic in this and other, similar U.S. populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 When a panel of 10 mutations (AF508, AI507, G542X, G551D, R553X, S549N, R1162X, W1282X, N1303K, and 1717-1G--A) was used, detection rates ranged from 75% in non-Ashkenazi Caucasians to 40% in African-Americans. Login to comment
36 Mutation Analysis DNA from each subject was screened for the following mutations: AF508 (Kerem et al. 1989a), G542X (Kerem et al. 1990), GS51D (Cutting et al. 1990), R553X (Cutting et al. 1990), S549N (Cutting et al. 1990), R1162X (Gasparini et al. 1991), W1282X (Vidaud et al. 1990), N1303K (Osborne et al. 1991), and 1717-1G- A (Guillermit et al. 1990; Kerem et al. 1990). Login to comment
47 GSS ID, RSS3X, and S549N.-DNA (0.5-1 ig) was subjected to amplification by PCR using primers 11i-5 and 1 i-3, according to published protocol (Kerem et al. 1990). Login to comment

[hide] Screening for five mutations detects 97% of cystic... Am J Hum Genet. 1992 Nov;51(5):951-6. Abeliovich D, Lavon IP, Lerer I, Cohen T, Springer C, Avital A, Cutting GR
Screening for five mutations detects 97% of cystic fibrosis (CF) chromosomes and predicts a carrier frequency of 1:29 in the Jewish Ashkenazi population.
Am J Hum Genet. 1992 Nov;51(5):951-6., [PMID:1384328]

Abstract [show]
To determine the distribution and frequency of cystic fibrosis (CF) mutations in the Israeli population, we have screened 96 patients for 11 relatively common mutations. Five mutations--delta F508, G542X, W1282X, N1303K, and 3849 + 10kb C-->T--were found to account for 97% of the CF alleles in the Ashkenazi Jews. In contrast, of the 11 mutations tested, only delta F508 was detected in Jewish patients of Sephardic or Oriental origin, accounting for 43% of the CF alleles. Four mutations--delta F508, G542X, W1282X, and N1303K--accounted for 55% of the CF alleles in Arab patients. In a pilot screening study, a random sample of 424 Ashkenazi individuals was analyzed for three mutations--delta F508, W1282X, and G542X. Thirteen individuals were detected as heterozygotes (six for delta F508 and seven for W1282X), predicting a heterozygote frequency of 1:29. This is similar to the frequency of carriers in the Caucasian population of northern European ancestry. On the basis of these data, the Ashkenazi population is considered to be a candidate for CF heterozygote screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 The mutations G551D, S549N, S5491, S549R, and 1717-1 G-OA were analyzed according to the method of Kerem et al. Login to comment
56 The mutations 621 + 1 G-oT, 1717-1 G-oA, S549N, S549I, S549R, G551D, and R553Xwere not foundin our patients. Login to comment

[hide] The spectrum of cystic fibrosis mutations. Trends Genet. 1992 Nov;8(11):392-8. Tsui LC
The spectrum of cystic fibrosis mutations.
Trends Genet. 1992 Nov;8(11):392-8., [PMID:1279852]

Abstract [show]
Although the major mutation causing cystic fibrosis accounts for almost 70% of mutant chromosomes screened, almost 300 sequence alterations have been identified in the gene during the past two and a half years. At least 230 of these mutations are probably associated with disease. This rapid accumulation of data is in part due to the highly coordinated effort by members of the Cystic Fibrosis Genetic Analysis Consortium. The information is not only essential to genetic diagnosis, but also will aid in understanding the structure and function of the protein, and possibly in correlating genotype with phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Frequent cystic fibrosis mutations Name Relative freqeenc~ Mutation Con~,~'~luence Ref. Z~508 67.2 G542X 3.4 G551D 2.4 W1282X 2.1 3905insT 2.1 N1303K 1.8 3849+10kbC-+T 1.4 1717-1G-+A 1078delT 2789+5G--+A Deletion of 3 bp between nt 1652 and t655 in exon 10 G-+T at nt 1756 in exon 11 G-+A at nt 1784 in exon 1I G-+A at nt 3978 in exon 20 Insertion of T after nt 3905 in exon 20 C-+G at nt 4041 in exon 21 C-->T in a 6.2 kb EcoRI fragment 10 kb from 5' junction of intron 19 3849+4A-+G 1.0 7tt÷IG--+T 0.9 Rl162X 0.9 1898+lG-+A 0.9 Rll7H 0.8 3659delc 0.8 G85E 0.7 2184delA 0.7 AI5W 0.5 R347P 0.5 R~ 0.4 1,3 C-+T at nt 1"789in exon 11 1.3 G-+T at nt 1 from 5' junction of intron 4 1.1 G--+A at nt 1 from 3' junction of intron 10 1.1 Deletion of T at nt 1078 in exon 7 1.1 G-cA at 5 nt from 5' end of intron 14b A-->G at 4 nt from 5' end of intron 19 G-+T at nt 1 from 5' junction of intron 5 C-+T at nt 3616 in exon 19 G-+A at nt 1 from 5' junction of intron 12 G--)A at nt 482 in exon Deletion of C at nt 3659 in exon 19 G-+A at nt 386 in exon 3 A-->G at nt 2183 and deletion of A at nt 2184 in exon 13 Deletion of 3 bp between nt 1648 and 1653 in exon 10 G-+C at nt 1172 in exon 7 G-~C at nt 1811 in exon 11 A455E 0.4 R334W 0.4 Y122X 0.3 S549R(T-+G) 0.3 Q493X 0.3 V520F 0.2 S549N 0.2 C-+A at nt 1496 in exon 9 C-+T at nt 1132 in exon 7 T-cA at nt ~i98 in exon 4 T--+G at nt 1779 in exon 11 C-+T at nt 1609 in exon 10 G-+T at nt 1690 in exon 10 G-->A at nt I778 in exon !1 Deletion of Phe at codon 508 Gly-+Stop at codon 542 12 Gly-~Asp at codon 551 10 l"rp-->Stop at codon t282 35 Frameshift -~ Asn-+Lys at codon 1303 36 Aberrant splicing -~ Arg~Stop ~ codon 553 Splice mutation 10 37 Splice mutation 12 Frameshift 38 Splice mutation _c Splice mutation? Login to comment

[hide] Milestones in cystic fibrosis. Br Med Bull. 1992 Oct;48(4):717-37. Super M
Milestones in cystic fibrosis.
Br Med Bull. 1992 Oct;48(4):717-37., [PMID:1281032]

Abstract [show]
The study of cystic fibrosis (CF) provides a fascinating insight into developments in medicine in the 20th century. Milestones include the first clear clinical descriptions in the 1930s, discovery of a sweat electrolyte abnormality, establishing the autosomal recessive mode of inheritance and improvements in treatment. Microdissection experiments on sweat glands allowed the main defect to be delineated as one of chloride transport. Location of the gene to chromosome 7 made prenatal diagnosis feasible and carrier detection in siblings. The CF gene--its product being the cystic fibrosis transmembrane conductance regulator (CFTR), and its major mutation Delta F508 was discovered in 1989. World-wide collaboration has resulted in discovery of more than 150 further mutations. Incorporation of CFTR into non-chloride transporting insect cells by conferring chloride transport, proved it a chloride channel. CFTR incorporated into adenovirus results in correction of the chloride transport defect in airway cells, bringing gene therapy closer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
164 Mutations encountered elsewhere in UK but not yet m N-W 1154insTC R347P A455E G458V Q493X C524X S549N R1283M Q1291H 199 (in the north-west group) 199 199 0 0 0 199 199 0 icant alteration in function appears to be worse than no CFTR being formed at all. Login to comment

[hide] Analysis of four diverse population groups indicat... Am J Hum Genet. 1992 Jun;50(6):1185-94. Cutting GR, Curristin SM, Nash E, Rosenstein BJ, Lerer I, Abeliovich D, Hill A, Graham C
Analysis of four diverse population groups indicates that a subset of cystic fibrosis mutations occur in common among Caucasians.
Am J Hum Genet. 1992 Jun;50(6):1185-94., [PMID:1376017]

Abstract [show]
To determine the nature and frequency of non-delta F508 cystic fibrosis (CF) mutations among diverse populations, we have sequenced exons 9-12 and 19-23 of the CF transmembrane conductance regulator (CFTR) gene from 128 CF chromosomes (39 U.S. Caucasian, 27 African-American, 42 Northern Irish, and 20 Israeli chromosomes). These regions were chosen because they encode the two putative ATP-binding folds of CFTR, domains which appear to have functional significance. In addition, CFTR exons 1 and 2 were analyzed in the American patients. Mutations were found on 49 of the 128 CF chromosomes. Nineteen different mutations were observed; six were novel, while the remaining 13 had been reported previously by our group or by other investigators. Six of nine different mutations found in African-American patients were unique to that population. However, the vast majority of the mutations found in U.S. Caucasians (eight of nine), Northern Irish (four of five), and Israelis (three of three) also occurred in other Caucasian groups. The preponderance of previously reported mutations in these three groups suggested that a subset of the non-delta F508 mutations occur in common among Caucasians. A survey of mutation frequencies in other Caucasian groups confirmed this observation. Unfortunately, this subset accounts for less than half of non-delta F508 CF mutations in most groups. These data suggest that screening for delta F508 and this select group of mutations will efficiently and economically maximize the number of CF mutations identified in Caucasian groups. However, it will be difficult to detect more than 90% of mutant CFTR alleles except in ethnically and geographically discrete populations where CF is the result of founder effect.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
96 Two other mutations (S549N and R553X) in African-Americans have been reported to occur in Caucasian CF patients, although R553X is probably a recurrent mutation (Reiss et al. 1991). Login to comment

[hide] Cloning and sequence analysis of rat cystic fibros... Am J Physiol. 1992 Jun;262(6 Pt 1):L779-84. Fiedler MA, Nemecz ZK, Shull GE
Cloning and sequence analysis of rat cystic fibrosis transmembrane conductance regulator.
Am J Physiol. 1992 Jun;262(6 Pt 1):L779-84., [PMID:1377454]

Abstract [show]
A complementary DNA (cDNA) encoding the rat cystic fibrosis transmembrane conductance regulator (CFTR) has been isolated and the tissue distribution of the rat CFTR mRNA has been determined. Northern blot analysis revealed that the highest levels of the 6.3 kilobase (kb) CFTR mRNA were expressed in the colon, with expression also noted in uterus, lung, stomach, and small intestine. A 7.5-kb mRNA was expressed in skeletal muscle, and in testes both the 7.5-kb mRNA and a 6.0-kb mRNA were expressed. Five cDNAs were isolated from a rat colon library, the longest corresponding to codons 684 through the poly A tail. Three other clones, corresponding to codons 213 through 245, 372 through 574, and 656 through 886 were also isolated. Polymerase chain reaction amplification of cDNA prepared from rat colon mRNA was utilized to clone the remainder of the cDNA. The predicted amino acid sequence of the rat CFTR is 79% identical to the human CFTR, with 73% identity noted in the R domain, and 81 and 83% identities noted in nucleotide binding folds 1 and 2, respectively. Thirty-two of the 38 potential phosphorylation sites identified in the human CFTR were also present in the rat CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
487 Cutting et al. (7) identified a cluster of mutations in NBFl (R533stop, S549N, G551D, and A559T), which are associated with the CF phenotype. Login to comment

[hide] Screening for non-delta F508 mutations in five exo... Am J Hum Genet. 1991 Jun;48(6):1127-32. Devoto M, Ronchetto P, Fanen P, Orriols JJ, Romeo G, Goossens M, Ferrari M, Magnani C, Seia M, Cremonesi L
Screening for non-delta F508 mutations in five exons of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in Italy.
Am J Hum Genet. 1991 Jun;48(6):1127-32., [PMID:1709778]

Abstract [show]
Analysis of exons 10, 11, 14a, 15, and 20 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by denaturing-gradient-gel electrophoresis (DGGE) allowed the identification of mutations causing cystic fibrosis (CF) in 25 of 109 non-delta F508 chromosomes, as well as identification of a number of polymorphisms and sequence variations. Direct sequencing of the PCR fragments which showed an altered electrophoretic behavior not attributable to known mutations has led to the characterization of four new mutations, two in exon 11, and one each in exons 15 and 20. Screening for the different mutations thus far identified in our patients by the DGGE analysis and other independent methods should allow detection of about 70% of the molecular defects causing CF in Italy. Mutations located in exons 11 and 20 account for at least 30% of the non-delta F508 mutations present in Italian CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Table 2 Results of Screening for Known Mutations Total No. of No. of Chromosomes Chromosomes Overall Mutation Exon Method With the Mutationa Screenedb Frequencyc Reference R334W......... 7 MspI 2 198 1.01 X. Estivill, personal communication R347P......... 7 HhaI or NcoI 4 183 2.19 Dean et al. 1990 G542X ......... 11 ASO (DGGE) 15 (4) 176 (18) 9.79 Kerem et al. 1990 S549N......... 11 DdeI 1 159 .63 Cutting et al. 1990b G5S1D ......... 11 HincII or MboI 0 186 Cutting et al. 1990b R553X ......... 11 HincIl (DGGE) 5 (1) 186 (13) 3.02 Cutting et al. 1990b 1717-1G-A .... 11 (DGGE) (12) (109) 11.01 Guillermit et al. 1990 S1255X ......... 20 HindIII 0 130 Cutting et al. 1990a W1282X......... 20 MnlI (DGGE) 7 (3) 124 (53) 5.65 Vidaud et al. 1990 a Numbers in parentheses are number of mutations found through DGGE. Login to comment

[hide] Effects of cystic fibrosis and congenital bilatera... Am J Hum Genet. 2000 May;66(5):1485-95. Epub 2000 Apr 4. Mickle JE, Milewski MI, Macek M Jr, Cutting GR
Effects of cystic fibrosis and congenital bilateral absence of the vas deferens-associated mutations on cystic fibrosis transmembrane conductance regulator-mediated regulation of separate channels.
Am J Hum Genet. 2000 May;66(5):1485-95. Epub 2000 Apr 4., [PMID:10762539]

Abstract [show]
The protein defective in cystic fibrosis (CF), the CF transmembrane-conductance regulator (CFTR), functions as an epithelial chloride channel and as a regulator of separate ion channels. Although the consequences that disease-causing mutations have on the chloride-channel function have been studied extensively, little is known about the effects that mutations have on the regulatory function. To address this issue, we transiently expressed CFTR-bearing mutations associated with CF or its milder phenotype, congenital bilateral absence of the vas deferens, and determined whether mutant CFTR could regulate outwardly rectifying chloride channels (ORCCs). CFTR bearing a CF-associated mutation in the first nucleotide-binding domain (NBD1), DeltaF508, functioned as a chloride channel but did not regulate ORCCs. However, CFTR bearing disease-associated mutations in other domains retained both functions, regardless of the associated phenotype. Thus, a relationship between loss of CFTR regulatory function and disease severity is evident for NBD1, a region of CFTR that appears important for regulation of separate channels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 DNA was assayed for 16 common CFTR mutations (R117H, 62111GrT, R334W, R349P, A455E, DI507, DF508, 1717-1GrA, G542X, S549N, G551D, R553X, R560T, 3849110 Kb CrT, W1282X, and N1303K), by reverse dot-blot hybridization (Mickle et al. 1998). Login to comment

[hide] Pancreatic function and extended mutation analysis... J Pediatr. 2000 Aug;137(2):214-20. Massie RJ, Wilcken B, Van Asperen P, Dorney S, Gruca M, Wiley V, Gaskin K
Pancreatic function and extended mutation analysis in DeltaF508 heterozygous infants with an elevated immunoreactive trypsinogen but normal sweat electrolyte levels.
J Pediatr. 2000 Aug;137(2):214-20., [PMID:10931414]

Abstract [show]
BACKGROUND: Newborn screening for cystic fibrosis (CF) with immunoreactive trypsinogen (IRT) and DeltaF508 analysis followed by sweat testing misses some infants with CF and detects more DeltaF508 carriers than expected. Some of the apparent DeltaF508 carriers may be DeltaF508 compound heterozygotes with normal sweat electrolyte levels. METHODS: Infants identified by newborn screening with an elevated IRT level, one DeltaF508 allele, and a sweat chloride level <60 mmol/L underwent CF mutation analysis, pancreatic stimulation testing, and repeat IRT analysis followed by clinical review and repeat sweat test at 12 months. RESULTS: Over a 24-month period we identified 122 DeltaF508 heterozygotes and recruited 57; 4 had borderline sweat chloride levels (40 to 60 mmol/L), 5 (8.8%, 95% CI 1.4, 16.2) had a second CF mutation (R117H), and 11 (20%, 95% CI 10, 30) had the intron 8 5T allele. Three had clinical CF at 12 months (initial sweat chloride levels: 53, 51, and 32 mmol/L). Pancreatic electrolyte secretion in the subjects with a borderline sweat chloride level was similar to that in patients with known CF. CONCLUSION: The excess of DeltaF508 heterozygotes detected by IRT/DNA screening is associated with the presence of a second mutation or the 5T allele in some infants. Screened infants with borderline sweat chloride levels almost certainly have CF, but long-term follow-up of the infants with the genotype DeltaF508/R117H and DeltaF508/5T is required to determine their outcome. In the meantime, newborn screening should be confined to severe mutations associated with classic CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Measurement of Cl levels was done by colorimetry, and measurement of sodium levels was done by flame cytometry.16 Gene Mutation Analysis Blood was taken and DNA extract- ed17 for an extended cystic fibrosis transmembrane conductance regulator protein gene mutation analysis as described previously.18 The following mutations were included: ࢞F508, ࢞I507, R117H, G551D, A455E, G542X, N1303K, W1282X, 1717-1G࢐A, R560T, R347P, R334W, R553X, R1162X, S549N, 3849+10C࢐T, and 621+1G࢐T. Login to comment

[hide] Analysis of 31 CFTR mutations in 55 families from ... Early Hum Dev. 2001 Nov;65 Suppl:S161-4. Gomez-Llorente MA, Suarez A, Gomez-Llorente C, Munoz A, Arauzo M, Antunez A, Navarro M, Gil A, Gomez-Capilla JA
Analysis of 31 CFTR mutations in 55 families from the South of Spain.
Early Hum Dev. 2001 Nov;65 Suppl:S161-4., [PMID:11755047]

Abstract [show]
We carried out a molecular analysis of 350 chromosomes from 55 families originating from the South of Spain (Andalucia) who were diagnosed with cystic fibrosis (CF). We used polymerase chain reaction, followed by an oligonucleotide ligation assay (OLA) and sequence-coded separation using capillary electrophoresis. A frequency of 43.5% for DeltaF508 was found, making it the most common CF mutation in our sample. Seven more mutations (G542X, R334W, R1162X, 2789+5G-->A, R117H, DeltaI507 and W1282X) were detected and accounted for 24.7% of the total. The remaining mutations (31.8%) were undetectable with the methodology used in this study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 T I.5 R553X E.11 1078delT E.7 R560T E.11 R347P E.7 S549R E.11 R347H E.7 S549N E.11 R334W E.7 3849 + 10kbC ! Login to comment

[hide] CFTR gene: molecular analysis in patients from Sou... Mol Genet Metab. 2003 Apr;78(4):259-64. Streit C, Burlamaque-Neto AC, de Abreu e Silva F, Giugliani R, Saraiva Pereira ML
CFTR gene: molecular analysis in patients from South Brazil.
Mol Genet Metab. 2003 Apr;78(4):259-64., [PMID:12706377]

Abstract [show]
Cystic fibrosis (CF) is the most common genetic disease among Caucasians. The CF gene, named cystic fibrosis transmembrane conductance regulator (CFTR), codifies a protein that acts as a channel through the epithelial membrane. The present work aimed (1) to detect sequence alterations in the nucleotide binding regions and at the membrane spanning domain of the CFTR gene and (2) to detect the following frequent mutations R347P, R347H, R334W, and Q359K (located in exon 7), DeltaF508 (located in exon 10), G542X, G551D, R553X, and S549N (located in exon 11), W1282X (located in exon 20), and N1303K (located in exon 21). Seventy-seven unrelated CF patients were analyzed, who were previously diagnosed and currently under treatment at the Pneumology Service of our hospital. Regions of interest were amplified by PCR using specific primers. Each sample was analyzed by a non-radioactive single-stranded conformational polymorphism (SSCP) analysis technique and restriction enzyme digestion. The DeltaF508 mutation was found in 48.7% of the alleles. Frequencies of G542X, R334W, R553X, and W1282X mutations in our population were 3.25, 1.3, 0.65, and 0.65%, respectively. No alleles were found to carry mutations G551D, R334W, R347P, R347H, Q359K, S549N, and N1303K, which were included in the screening protocol. This study allowed the characterization of 84 out of 154 CF mutant alleles (54.5%). The incidence of main CF mutations analyzed was similar to that of the south European population. Mutation data presented here will be useful for designing new DNA testing strategies for CF in South Brazil.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 The present work aimed (1) to detect sequence alterations in the nucleotide binding regions and at the membrane spanning domain of the CFTR gene and (2) to detect the following frequent mutations R347P, R347H, R334W, and Q359K (located in exon 7), DF508 (located in exon 10), G542X, G551D, R553X, and S549N (located in exon 11), W1282X (located in exon 20), and N1303K (located in exon 21). Login to comment
8 No alleles were found to carry mutations G551D, R334W, R347P, R347H, Q359K, S549N, and N1303K, which were included in the screening protocol. Login to comment
59 Restriction fragment length polymorphism Mutations R347P, R347H, R334W, Q359K (located in exon 7), G542X, S549N, G551D, R553X mutations (exon 11), W1282X (exon 20), and N1303K (exon 21) were identified by restriction fragment length polymorphism (RFLP) protocol, using specific restriction endonucleases. Login to comment
76 Screening of four additional mutations (G542X, R553X, R334W, and W1282X) together with DF508 Table 2 Mutations detected in 77 CF patients from south region of Brazil Mutation Location Number of alleles Frequency (%) R334W Exon 7 2 1.3 R347P Exon 7 0 0 R347H Exon 7 0 0 Q359K Exon 7 0 0 DF508 Exon 10 75 48.7 S549N Exon 11 0 0 G542X Exon 11 5 3.2 G551D Exon 11 0 0 R553X Exon 11 1 0.7 W1282X Exon 20 1 0.7 N1303K Exon 21 0 0 ? Login to comment

[hide] Effect of genotype on phenotype and mortality in c... Lancet. 2003 May 17;361(9370):1671-6. McKone EF, Emerson SS, Edwards KL, Aitken ML
Effect of genotype on phenotype and mortality in cystic fibrosis: a retrospective cohort study.
Lancet. 2003 May 17;361(9370):1671-6., [PMID:12767731]

Abstract [show]
BACKGROUND: Over 1000 mutations of the cystic fibrosis transmembrane conductance regulator gene (CFTR) that cause cystic fibrosis have been identified. We examined the effect of CFTR genotype on mortality and disease phenotype. METHODS: Using the US Cystic Fibrosis Foundation National Registry, we did a retrospective cohort study to compare standardised mortality rates for the 11 most common genotypes heterozygous for DeltaF508 with those homozygous for DeltaF508. Of the 28455 patients enrolled in the registry at the time of our analysis, 17853 (63%) were genotyped. We also compared the clinical phenotype, including lung function, age at diagnosis, and nutritional measures, of 22 DeltaF508 heterozygous genotypes. Mortality rates and clinical phenotype were also compared between genotypes classified into six classes on the basis of their functional effect on CFTR production. FINDINGS: Between 1991 and 1999, genetic and clinical data were available for 17853 patients with cystic fibrosis, which was 63% of the total cohort. There were 1547 deaths during the 9 years of follow-up. In the analysis of the 11 most common genotypes, DeltaF508/R117H, DeltaF508/DeltaI507, DeltaF508/3849+10kbC-->T, and DeltaF508/2789+5G-->A had a significantly lower mortality rate (4.7, 8.0, 11.9, and 4.4, respectively) than the genotype homozygous for DeltaF508 (21.8, p=0.0060). DeltaF508/R117H, DeltaF508/DeltaI507, DeltaF508/ 3849+10 kbC-->T, DeltaF508/2789+5G-->A, and DeltaF508/A455E have a milder clinical phenotype. Outcomes for all functional classes were compared with that of class II (containing DeltaF508 homozygotes) and classes IV and V had a significantly lower mortality rate and milder clinical phenotype. INTERPRETATION: Patients with cystic fibrosis have distinct genetic subgroups that are associated with mild clinical manifestations and low mortality. These differences in phenotype are also related to the functional classification of CFTR genotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 ARTICLES 1672 THE LANCET ߦ Vol 361 ߦ May 17, 2003 ߦ www.thelancet.com Panel 1: Frequencies of CFTR mutations* CFTR Allele CFTR Allele mutation frequency (%) mutation frequency èc;F508 69&#b7;4% 2789+5G࢐A 0&#b7;3% Unknown 15&#b7;7% R1162X 0&#b7;3% G542X 2&#b7;3% G85E 0&#b7;3% G551D 2&#b7;2% R560T 0&#b7;2% èc;I507 1&#b7;6% R334W 0&#b7;2% W1282X 1&#b7;4% 3659èc;C 0&#b7;2% N1303K 1&#b7;2% A455E 0&#b7;1% R553X 0&#b7;9% 711+1G࢐T 0&#b7;1% 621+1G࢐T 0&#b7;8% 1898+1G࢐A 0&#b7;1% R117H 0&#b7;7% 2184èc;A 0&#b7;1% 3849+10 kbC࢐T 0&#b7;7% S549N 0&#b7;1% 1717-IG࢐A 0&#b7;5% 1078èc;T 0&#b7;03% R347P 0&#b7;3% *n=17 853. Login to comment
48 Panel 2: Functional classification of CFTR alleles Class Functional effect of Allele mutation I Defective protein G542X, R553X, W1282X, production R1162X, 621-1G࢐T, 1717-1G࢐A, 1078èc;T, 3659èc;C II Defective protein èc;F508, èc;I507, N1303K, processing S549N III Defective protein G551D, R560T regulation IV Defective protein R117H, R334W, G85E, conductance R347P V Reduced amounts of 3849+10KbC࢐T, functioning CFTR protein 2789+5G࢐A, A455E Unknown 711+1G࢐T, 2184DA, 1898+1G࢐A Total cohort Genotyped cohort (n=28 455) (n=17 853) Person-years at risk 152 011 96 870 Sex (% male) 53% 52% Race (% white) 96% 96% Age (years) 11&#b7;9 (11&#b7;1) 10&#b7;9 (11&#b7;2) Age at diagnosis (years) 3&#b7;5 (7&#b7;1) 3&#b7;6 (7&#b7;5) Sweat test (mmol/L) 101 (19) 100 (20) FEV1 (L) 1&#b7;72 (0&#b7;91) 1&#b7;80 (0&#b7;92) FEV1 (% predicted) 69 (29) 72 (28) FVC (L) 2&#b7;41 (1&#b7;18) 2&#b7;50 (1&#b7;21) FVC (% predicted) 81% (28) 84% (24) Height (cm) 121% (41) 117% (41) Weight (kg) 30&#b7;0 (21&#b7;3) 28&#b7;6 (21&#b7;8) Pancreatic insufficiency (%) 90% 87% P aeruginosa colonisation (%) 49% 46% Number of deaths (%) 3548 (12%) 1547 (9%) Data are mean (SD) unless otherwise stated. Login to comment
67 Table 2: Standardised and crude mortality rates (including organ transplantation) by genotype Genotype No of Age at Sweat FEV1 FVC Height Weight Pancreatic P&#b7; aeruginosa Subjects Diagnosis Chloride (% predicted)* (% predicted)* (cms)* (kg)* Insufficiency Colonization (yrs) (mmol) (%)ߤ (%)ߤ èc;F508/èc;F508 6 213 2&#b7;5 &#b1; 0&#b7;1 104 &#b1; 0&#b7;2 77 &#b1; 0&#b7;3 89 &#b1; 0&#b7;3 141 &#b1; 0&#b7;2 37&#b7;0 &#b1; 0&#b7;1 92 (91-92) 60 (59-61) èc;F508/G551D 411 3&#b7;7 &#b1; 0&#b7;3ߥ 108 &#b1; 0&#b7;9ߥ 76 &#b1; 1&#b7;2 89 &#b1; 1&#b7;2 142 &#b1; 0&#b7;7&#a7; 38&#b7;2 &#b1; 0&#b7;6&#a7; 92 (89-94) 59 (54-64) èc;F508/G542X 389 1&#b7;9 &#b1; 0&#b7;2 104 &#b1; 0&#b7;8 79 &#b1; 1&#b7;2 91 &#b1; 1&#b7;2 141 &#b1; 0&#b7;7 37&#b7;3 &#b1; 0&#b7;5 93 (89-95) 57 (52-62) èc;F508/N1303K 213 2&#b7;1 &#b1; 0&#b7;3 106 &#b1; 1&#b7;2 80 &#b1; 1&#b7;8 91 &#b1; 1&#b7;7 141 &#b1; 1&#b7;0 37&#b7;1 &#b1; 0&#b7;6 92 (87-95) 61 (55--68) èc;F508/W1282X 205 1&#b7;6 &#b1; 0&#b7;2 103 &#b1; 1&#b7;2 80 &#b1; 1&#b7;7 92 &#b1; 1&#b7;6 141 &#b1; 0&#b7;9 37&#b7;4 &#b1; 0&#b7;7 94 (90-97) 59 (52-65) èc;F508/R553X 164 2&#b7;5 &#b1; 0&#b7;4 106 &#b1; 1&#b7;4 76 &#b1; 1&#b7;8 89 &#b1; 1&#b7;6 139 &#b1; 0&#b7;9 35&#b7;4 &#b1; 0&#b7;7&#a7; 90 (85-94) 60 (53-67) èc;F508/621-1G 162 2&#b7;5 &#b1; 0&#b7;4 107 &#b1; 1&#b7;3 78 &#b1; 1&#b7;8 89 &#b1; 1&#b7;5 143 &#b1; 1&#b7;0&#a7; 38&#b7;8 &#b1; 0&#b7;8&#a7; 87 (80-91)&#a7; 57 (49-64) èc;F508/èc;I507 149 8&#b7;5 &#b1; 1&#b7;1ߥ 95 &#b1; 1&#b7;9ߥ 86 &#b1; 2&#b7;1ߥ 93 &#b1; 1&#b7;8&#a7; 137 &#b1; 1&#b7;4&#a7; 37&#b7;4 &#b1; 1&#b7;25 84 (78-89)ߥ 39 (31-48)ߥ èc;F508/R117H 123 13&#b7;7 &#b1; 1&#b7;2ߥ 80 &#b1; 1&#b7;9ߥ 91 &#b1; 2&#b7;1ߥ 97 &#b1; 1&#b7;7ߥ 143 &#b1; 1&#b7;8 42&#b7;9 &#b1; 1&#b7;7ߥ 65 (55-73)ߥ 22 (16-29)ߥ èc;F508/3849+10 kB 114 11&#b7;3 &#b1; 0&#b7;9ߥ 72 &#b1; 2&#b7;5ߥ 77 &#b1; 2&#b7;1 87 &#b1; 1&#b7;9 144 &#b1; 1&#b7;4&#a7; 41&#b7;2 &#b1; 1&#b7;2ߥ 66 (57-74)ߥ 69 (59-77) èc;F508/2789+5G 63 13&#b7;4 &#b1; 1&#b7;6ߥ 102 &#b1; 2&#b7;1 88 &#b1; 2&#b7;8ߥ 97 &#b1; 2&#b7;3ߥ 140 &#b1; 2&#b7;5 41&#b7;8 &#b1; 2&#b7;2&#a7; 71 (59-81)ߥ 32 (22-44)ߥ èc;F508/1717-1G 74 1&#b7;3 &#b1; 0&#b7;3 103 &#b1; 2&#b7;0 75 &#b1; 2&#b7;7 86 &#b1; 2&#b7;4 139 &#b1; 1&#b7;5 35&#b7;7 &#b1; 0&#b7;9 96 (88-99) 59 (48-69) èc;F508/R560T 46 1&#b7;7 &#b1; 0&#b7;5 104 &#b1; 2&#b7;0 84 &#b1; 3&#b7;3ߥ 96&#b1; 2&#b7;8&#a7; 142 &#b1; 1&#b7;9 38&#b7;4 &#b1; 1&#b7;4 91 (79-97) 63 (48-75) èc;F508/R347P 44 5&#b7;9 &#b1; 1&#b7;1&#a7; 105 &#b1; 2&#b7;6 76 &#b1; 3&#b7;0 90 &#b1; 2&#b7;9 142 &#b1; 2&#b7;4 38&#b7;7 &#b1; 1&#b7;8 67 (52-79)ߥ 53 (38-68) èc;F508/G85E 43 9&#b7;2 &#b1; 1&#b7;8ߥ 99 &#b1; 2&#b7;3&#a7; 76 &#b1; 2&#b7;5 90 &#b1; 2&#b7;5 142 &#b1; 2&#b7;9 38&#b7;3 &#b1; 2&#b7;2 88 (75-95) 52 (35-68) èc;F508/3659DC 40 1&#b7;1 &#b1; 0&#b7;4 105 &#b1; 2&#b7;1 76 &#b1; 3&#b7;9 88 &#b1; 4&#b7;1 139 &#b1; 1&#b7;9 36&#b7;6 &#b1; 1&#b7;2 92 (77-97) 55 (39-69) èc;F508/A455E 29 14&#b7;3 &#b1; 2&#b7;0ߥ 89 &#b1; 3&#b7;1ߥ 98 &#b1; 4&#b7;0ߥ 104 &#b1; 3&#b7;4ߥ 138 &#b1; 3&#b7;4 42&#b7;1 &#b1; 2&#b7;5&#a7; 60 (41--76)ߥ 17 (8-32)ߥ èc;F508/R334W 28 13&#b7;2 &#b1; 3&#b7;0ߥ 104 &#b1; 3&#b7;2 86 &#b1; 3&#b7;4&#a7; 94 &#b1; 3&#b7;3 138 &#b1; 3&#b7;2 42&#b7;3 &#b1; 3&#b7;5 67 (46-82)ߥ 51 (32--70) èc;F508/R1162X 26 1&#b7;9 &#b1; 1&#b7;1 101 &#b1; 2&#b7;3 77 &#b1; 4&#b7;2 92 &#b1; 4&#b7;6 138 &#b1; 1&#b7;8 36&#b7;5 &#b1; 1&#b7;4 92 (75-98) 65 (47-80) èc;F508/1898+1G 20 1&#b7;2 &#b1; 0&#b7;3 99 &#b1; 2&#b7;8 83 &#b1; 4&#b7;1 94 &#b1; 4&#b7;4 138 &#b1; 3&#b7;3 35&#b7;1 &#b1; 2&#b7;1 85 (61--95) 63 (39-82) èc;F508/2184DA 20 2&#b7;3 &#b1; 0&#b7;9 106 &#b1; 5&#b7;3 82 &#b1; 4&#b7;3 92 &#b1; 4&#b7;4 141 &#b1; 3&#b7;0 36&#b7;5 &#b1; 1&#b7;5 94 (69-99) 60 (38-79) èc;F508/711+1G 17 1&#b7;3 &#b1; 0&#b7;5 108 &#b1; 4&#b7;6 83 &#b1; 4&#b7;2 94 &#b1; 4&#b7;4 137 &#b1; 3&#b7;4 36&#b7;7 &#b1; 2&#b7;9 100 73 (50-88) èc;F508/S549N 11 6&#b7;4 &#b1; 1&#b7;9&#a7; 109 &#b1; 5&#b7;7 67 &#b1; 6&#b7;1 77 &#b1; 7&#b7;2 140 &#b1; 3&#b7;2 36&#b7;7 &#b1; 2&#b7;6 92 (62-99) 71 (40--90) èc;F508/Other 2 262 5&#b7;8 &#b1; 0&#b7;2ߥ 99 &#b1; 0&#b7;4ߥ 80 &#b1; 0&#b7;5ߥ 91 &#b1; 0&#b7;5ߥ 141 &#b1; 0&#b7;3 38&#b7;1 &#b1; 0&#b7;3ߥ 86 (84-87)ߥ 50 (48-52)ߥ Other/Other 1 551 7&#b7;5 &#b1; 0&#b7;3ߥ 93 &#b1; 0&#b7;6ߥ 82 &#b1; 0&#b7;6ߥ 90 &#b1; 0&#b7;6&#a7; 141 &#b1; 0&#b7;4 38&#b7;3 &#b1; 0&#b7;3ߥ 81 (80-84)ߥ 40 (38-43)ߥ Data are mean (SE) unless otherwise indicated. Login to comment

[hide] Simultaneous screening for 11 mutations in the cys... Mol Cell Probes. 1992 Feb;6(1):33-9. Cuppens H, Buyse I, Baens M, Marynen P, Cassiman JJ
Simultaneous screening for 11 mutations in the cystic fibrosis transmembrane conductance regulator gene by multiplex amplification and reverse dot-blot.
Mol Cell Probes. 1992 Feb;6(1):33-9., [PMID:1372093]

Abstract [show]
An assay is described in which 11 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene can be screened simultaneously. Six different exons of the CFTR gene are amplified in a single multiplex amplification. Biotinylated dUTP is incorporated into the different fragments during the amplification process. A sample of this mixture is then hybridized to 21 different poly-dT tailed oligonucleotide probes which are bound to a nylon membrane. In order to screen the different mutations in a single step hybridization, the length of the different oligonucleotides and the amount used in the assay were optimized. The detection is performed by binding avidin-alkaline phosphatase to the biotin, followed by a chemiluminescent reaction. By means of this fast and sensitive assay, about 85% of all the cystic fibrosis mutations in the Belgian population can be detected.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
19 Frequency of 31 mutations in the CFTR gene in 194 Belgian CF chromosomes The 51255X, W1316X ;5 S549N, G551D, R553X, A559T;6 D110H, R117H, R347P;' Q493X, S5491, S549R(T-+G), R560T, Y563N, P574H ;9 W846X, Y913C;10 2556insAT;" R334W;" S549R(A-+C);'6 444delA, 3821deIT;" 621 +1G-*T18 mutations were not present in this random sample of the Belgian CF population . Login to comment

[hide] Cystic fibrosis mutations delta F508 and G542X in ... J Med Genet. 1992 Feb;29(2):131-3. Lerer I, Sagi M, Cutting GR, Abeliovich D
Cystic fibrosis mutations delta F508 and G542X in Jewish patients.
J Med Genet. 1992 Feb;29(2):131-3., [PMID:1377276]

Abstract [show]
We have screened our CF patients for mutations in exons 10 and 11 of the CFTR gene. Two mutations, delta F508 and G542X, have been found in 66 Jewish CF patients. The average frequency of the delta F508 mutation in the Jewish population is 33.8%. The G542X mutation accounts for 13% of the Ashkenazi CF mutations and has been found in three out of seven chromosomes of Jewish patients from Turkey (probably descended from Ashkenazi immigrants). The G542X mutation was not found in any of the other non-Ashkenazi patients. All the G542X bearing chromosomes have the same haplotype. Based on these observations it is concluded that the G542X mutation was introduced into the Jewish people after the split into Ashkenazi and non-Ashkenazi.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 The majority of these are rare mutations observed in single families but some mutations are relatively frequent.3 We have screened CF patients for the AF508 mutation and for G542X, G551D, R553X, and S549N or I, all within exon 11, and for the splice mutation 1717-1G-.A. Login to comment
21 S549N or I eliminates a DdeI site.4 RFLPs were analysed by either Southern blot hybridisation or by PCR. Login to comment

[hide] A 96-well formatted method for exon and exon/intro... Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5. Lucarelli M, Narzi L, Piergentili R, Ferraguti G, Grandoni F, Quattrucci S, Strom R
A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene.
Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5., [PMID:16635477]

Abstract [show]
Full genotypic characterization of subjects affected by cystic fibrosis (CF) is essential for the definition of the genotype-phenotype correlation as well as for the enhancement of the diagnostic and prognostic value of the genetic investigation. High-sensitivity diagnostic methods, capable of full scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, are needed to enhance the significance of these genetic assays. A method for extensive sequencing of the CFTR gene was optimized. This method was applied to subjects clinically positive for CF and to controls from the general population of central Italy as well as to a single subject heterozygous for a mild mutation and with an uncertain diagnosis. Some points that are crucial for the optimization of the method emerged: a 96-well format, primer project and purification, and amplicon purification. The optimized method displayed a high degree of diagnostic sensitivity; we identified a subset of 13 CFTR mutations that greatly enhanced the diagnostic sensitivity of common methods of mutational analysis. A novel G1244R disease causing mutation, leading to a CF phenotype with pancreatic sufficiency but early onset of pulmonary involvement, was detected in the subject with an uncertain diagnosis. Some discrepancies between our results and previously published CFTR sequence were found.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 None of these subjects showed any clinical manifestations of CF, nor were any positive for CFTR mutations when analyzed by means of the PCR/OLA/SCS method (Celera Diagnostics) [21], which searches for the most common worldwide 31 CFTR mutations (G85E, R117H, Y122X, 621+1G->T, 711+1G->T, 1078delT, R347P, R347H, R334W, A455E, DF508, DI507, Q493X, V520F, 1717-1G->A, G542X, G551D, R553X, R560T, S549R(T->G), S549N, 1898+1G->A, 2183AA->G, 2789+5G->A, R1162X, 3659delC, 3849+10kbC->T, 3849+4A->G, W1282X, 3905insT, N1303K), including the 12 most common in Italy [1,22]. Login to comment

[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Some have concentrated in the search of specific mutations that are Table 1 Mutations found in the Latin American CF patients Exon 1 p.L6VÌe; Exon 3 p.W57X, p.R75X, p.G85E Exon 4 p.R117H Exon 6a p.H199Y, p.V201M, p.L206W, p.Q220X, p.V232D, c.846delTÌe; Exon 6b p.Y275XÌe;, c.935delA Exon 7 p.R334W, p.R347P, p.Y362XÌe;, c.1078delT, c.1215delG Exon 8 c.1323_1324insAÌe; Exon 9 c.1460_1461delATÌe;, c.1353_1354insTÌe;,# Exon 10 p.I506T, p.I507del, p.F508del Exon 11 p.G542X, p.S549N, p.S549R, p.G551D, p.G551S, p.R553X, p.L558S, p.A559T, c.1782delA Exon 12 p.S589I Exon 13 p.H609RÌe;, p.P750L, p.V754M, c.1924_1930del, c.2055_2063del, c.2183AA NG;c.2184delA, c.2184delA, c.2185_2186insC, c.2347delG, c.2566_2567insTÌe;, c.2594_2595delGTÌe; Exon 14a p.R851L, c.2686_2687insTÌe; Exon 15 c.2869_2870insG Exon 16 c.3120+1GNA Exon 17a p.I1027T, c.3171delC, c.3199_3204del Exon 17b p.G1061R, p.R1066C, p.W1069X#, p.W1089X, p.Y1092X, p.W1098CÌe; Exon 19 p.R1162X, p.W1204X, p.Q1238X, c.3617_3618delGAÌe;#, c.3659delC Exon 20 p.W1282X, p.R1283M Exon 21 p.N1303K, c.4016_4017insT Exon 22 c.4160_4161insGGGGÌe; 5' flanking c.-834GNT Intron 2 c.297-1GNAÌe;, c.297-2ANG Intron 3 c.406-1GNA Intron 4 c.621+1GNT Intron 5 c.711+1GNT Intron 8 c.IVS8-5T Intron 10 c.1716GNA, c.1717-1GNA Intron 11 c.1811+1.6KbANG, c.1812-1GNA Intron 12 c.1898+1GNA, c.1898+3ANG Intron 14 c.2789+2_2789+3insA, c.2789+5GNA Intron 17a c.3272-26ANG Intron 17b c.3500-2ANGÌe; Intron 19 c.3849+1GNA, c.3849+10KbCNT Intron 20 c.4005+1GNA, c.4005-1GNA# Mutations are listed according to their position in the gene. Login to comment
51 Table 2 p.I507del p.S549N p.S549R p.G551D p.G551S p.R553X p.L558S p.A559T p.S589I p.H609RÌe; p.P750L p.V754M p.R851L p.I1027T p.G1061R p.R1066C p.W1069X# p.W1089X p.Y1092X p.W1098CÌe; p.W1204X 3 0 1 0 1 1 1 1 1 0 4 1 2 3 1 3 0.24 1 0.08 1 0.08 6 0.48 2 0.16 1 0.08 1 0.08 4 0.32 1 0.08 1 4 1 2 1 1 0 0 0 1 0 0 0 1 1 0 1 0 2 0 1 3 0 0 0 0 0 0 1 0.05 1 0.05 1 0.05 10 0.54 1 0.05 2 0.11 3 0.16 3 0 0 0 1 0 1 1 2 0.79 4 1.58 4 1 1 1 1 4 1.83 1 0.46 1 0.46 1 0.46 1 0.46 0 0 0 0 0 0 0 5 5 1 1 1 1 1 1 1 1 1 1 1 5 1.82 6 2.19 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 1.31 1 1.31 1 1.31 10 6 6 6 1 22 1 1 2 1 1 1 1 1 1 6 1 3 5 1 1 0.23 0.14 0.14 0.14 0.02 0.51 0.02 0.02 0.05 0.02 0.02 0.02 0.02 0.02 0.02 0.14 0.02 0.07 0.11 0.02 0.02 (continued on next page) Table 2 Mutation frequencies in Latin American CF patients Country p.Q1238X p.R1283M c.-834GNT c.297-1GNA* c.297-2ANG c.406-1GNA c.621+1GNT c.711+1GNT c.846delT* c.935delA c.1078delT c.1215delG c.1323_1324insA* c.1353_1354insT*# c.1460_1461delAT* Argentina 1 3 1 1 1 1 1 Subtotal and frequency (%) 1 0.08 1 0.08 4 0.32 1 0.08 1 0.08 1 0.08 Brazil 1 1 1 1 0 0 Subtotal and frequency (%) 1 0.05 2 0.11 1 0.05 Chile 0 0 Subtotal and frequency (%) Colombia 1 1 Subtotal and frequency (%) 1 0.46 1 0.46 Costa Rica Frequency (%) 0 Cuba Frequency (%) Ecuador Subtotal and frequency (%) Mexico 1 3 1 2 1 1 Subtotal and frequency (%) 1 0.36 3 1.09 1 0.36 1 0.36 2 0.73 1 0.36 Uruguay Frequency (%) 1 1.31 Venezuela Subtotal and frequency (%) Total 1 1 1 1 1 3 7 2 1 2 1 1 1 1 1 Frequency (%) 0.02 0.02 0.02 0.02 0.02 0.07 0.16 0.05 0.02 0.05 0.02 0.02 0.02 0.02 0.02 (continued ) Table 2 c.1716GNA c.1717-1GNA c.1782delA c.1811+1,6KbANG c.1812-1GNA c.1898+1GNA c.1898+3ANG c.1924_1930del c.2055_2063del c.2183AANG;c.2184delA c.2184delA c.2185_2186insC 5 1 4 1 1 1 0 1 2 2 6 0.48 1 0.08 6 0.48 2 0.16 1 0.08 1 0.08 1 0.08 1 0 6 5 1 3 0 0 0 0 7 0.37 5 0.27 1 0.05 3 0.16 0 0 12 1 12 5.50 1 0.46 0 0 1 1 2 2 1 0.36 1 0.36 2 0.73 2 0.73 1 1.31 1 14 1 18 5 3 1 1 2 6 1 1 0.02 0.32 0.02 0.41 0.11 0.07 0.02 0.02 0.05 0.14 0.02 0.02 (continued on next page) Table 2 Mutation frequencies in Latin American CF patients Country c.2347delG c.2566_2567insT* c.2594_2595delGT* c.2686_2687insT* c.2789+2_2789+3insA c.2789+5GNA c.2869_2870insG c.3120+1GNA c.3171delC c.3199_3204del c.3272-26ANG c.3500-2ANG* Argentina 2 1 2 2 3 3 1 1 2 Subtotal and frequency (%) 2 0.16 1 0.08 2 0.16 2 0.16 6 0.48 1 0.08 1 0.08 2 0.16 Brazil 2 1 1 1 6 0 0 4 0 Subtotal and frequency (%) 2 0.11 1 0.05 1 0.05 10 0.54 1 0.05 Chile Subtotal and frequency (%) Colombia 1 1 1 Subtotal and frequency (%) 1 0.46 1 0.46 1 0.46 Costa Rica Frequency (%) Cuba Frequency (%) Ecuador Subtotal and frequency (%) Mexico 2 Subtotal and frequency (%) 2 0.73 Uruguay Frequency (%) 1 1.31 Venezuela Subtotal and frequency (%) Total 2 2 1 3 2 9 1 12 1 2 2 1 Frequency (%) 0.05 0.05 0.02 0.07 0.05 0.21 0.02 0.28 0.02 0.05 0.05 0.02 (continued ) Table 2 c.3617_3618delGA*,# c.3659delC c.3849+1GNA c.3849+10kbCNT c.4005+1GNA c.4005-1GNA# c.4016_4017insT c.4160_4161insGGGG* c.IVS8-5T Unknown Authors 37 Aulehla-Scholz [17] 2 4 1 2 4 76 Visich [12] 1 78 Iba&#f1;ez [18] 54 Varela 2004 8 Prieto [19] 2 1 1 1 18 Oller-Ramirez 2004 4 0.32 6 0.48 1 0.08 1 0.08 2 0.16 5 0.40 271 21.75 205 Raskin [20] 32 Chiba [21] 1 89 Bernardino [22] 60 Marostica [23] 69 Parizotto [24] 99 Cabello [25,26] 33 Martins [27] 70 Streit [28] 0 5 120 Raskin [15] 0 0 12 Goloni-Bertollo [29] 1 0.05 5 0.27 789 42.46 48 Rios [30] 22 Molina [31] 1 11 Navarro [32] 0 3 34 Repetto [33] 4 1.58 115 45.63 1 67 Keyeux [14] 17 Restrepo [34] 1 0.46 84 38.53 0 25 52.08 Venegas [35] 95 65.97 Collazo [36] 20 Merino [37] 30 Cassiman 2004 15 Paz-y-Mino [38] 65 63.72 1 1 53 Orozco [13] 2 35 Villalobos [39] 3 1.09 1 0.36 88 32.11 11 14.47 Luzardo [40,41] 36 Restrepo [34] 41 Alvarado [42] 77 56.62 1 4 1 18 1 1 2 1 5 1620 0.02 0.09 0.02 0.41 0.02 0.02 0.05 0.02 0.11 37.21 Mutation frequencies in Latin American CF patients most frequently found in Caucasians, by allele specific polymerase chain reaction (AS-PCR), enzymatic digestion, allele specific oligonucleotide hybridization (ASO), or using mainly commercial kits, whereas other studies used a systematic approach to analyse the promoter, coding and exon/ intron boundaries of the CFTR region in the search for any possible mutation. Login to comment
69 As shown in Table 4, 19 of them have overall frequencies of 0.1% to 1% in Latin America and could be considered as rare, but some of them have local elevated frequencies, like c.1811+1.6KbANG in Colombia (from 4.2% to 10.5% in the different geographical regions studied) [14, 46], p.G85E in Ecuador (8.9%) (Ruiz et al., personal communication), Uruguay (3.95%) [41], Brazil (2.33%) [15] and Argentina (2.26%) [18], p.R334W in Brazil (2.6%) [15, 22] and p.I507del (2.58%) and p.S549N (2.5%) in Mexico [13] (Table 2). Login to comment
90 Table 4 Mutations with frequencies between 0.1% and 1% Mutation Frequency Country Number of chromosomes % p.R334W 39 0.90 Argentina, Brazil, Chile, Colombia, Uruguay p.G85E 32 0.73 Argentina, Brazil, Ecuador, Mexico, Uruguay p.R553X 22 0.51 Argentina, Brazil, Chile, Mexico, Uruguay c.1811+1.6KbANG 18 0.41 Argentina, Colombia c.3849+10KbCNT 18 0.41 Argentina, Mexico c.1717-1GNA 14 0.32 Argentina, Brazil, Uruguay c.3120+1GNA 12 0.28 Argentina, Brazil Colombia p.I507del 10 0.23 Brazil, Mexico, Uruguay c.2789+5GNA 9 0.21 Argentina, Brazil, Colombia, Uruguay c.621+1GNT 7 0.16 Argentina, Brazil, Mexico p.S549N 6 0.14 Mexico p.S549R 6 0.14 Argentina, Brazil, Colombia p.G551D 6 0.14 Argentina, Mexico p.R1066C 6 0.14 Argentina, Colombia, Mexico c.2183ANG;c.2184delA 6 0.14 Argentina, Mexico p.Y1092X 5 0.11 Colombia, Mexico c.1812-1GNA 5 0.11 Brazil c.IVS8-5T 5 0.11 Argentina c.3659delC 4 0.09 Argentina Unfortunately, at present not all Latin-American countries have started molecular studies in their patients with a probable Cystic Fibrosis diagnosis. Login to comment
111 As discussed, another way to disclose similarities or differences in the distribution of mutations in the CF patients from Latin Table 6 Screening panel of CFTR mutations Country Total number of mutations Minimum panel Detection power Uruguay 12 6 mutations: p.F508del, p.G542X, p.R1162X, p.N1303K (p.R334W, p.G85E) 78% Argentina 52 7 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.R334W, p.G85E) 71% M&#e9;xico 35 8 mutations: p.F508del, p.G542X, p.N1303K (p.R75X, p.I507del, p.S549N,c.406-1GNA, c.3849+10kbGNA) 58% Colombia 19 7 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.S549R, c.1811+1.6kbANG) 56% Brazil 41 6 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.R334W) 53% The total number of mutations found in each country is indicated in the second column from left. Login to comment

[hide] [Cystic fibrosis in a woman aged seventy]. Ned Tijdschr Geneeskd. 2010;154:A1342. Ras JE, van Velzen E, van Berkhout FT, van den Brand JJ
[Cystic fibrosis in a woman aged seventy].
Ned Tijdschr Geneeskd. 2010;154:A1342., [PMID:20619026]

Abstract [show]
A seventy-year-old woman was admitted to hospital with a Staphylococcus aureus respiratory tract infection. She had a history of extensive bronchiectasis and allergic bronchopulmonary aspergillosis (ABPA). Cystic fibrosis (CF) was suspected and cystic fibrosis transmembrane conductance regulator (CFTR) gene analysis showed F508del and R117H-7T mutations. In these mutations there is residual activity in the chloride channel in the cell membrane coded by the CFTR gene. This results in a much milder disease pattern varying from no disease at all to isolated organ disease. This type of disease is known as non-classical cystic fibrosis. In our patient the diagnosis of cystic fibrosis was made exceptionally late in life.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 TABEL 1 Classificatie van mutaties in het 'cystic fibrosis transmembrane conductance regulator`(CFTR)-gen op chromosoom 7 klasse mechanisme enkele bekende mutaties I geen synthese van het CFTR-eiwit G542X R553X W1282X R1162X 621-1G࢐T 1717-1G࢐A 1078࢞T 3659࢞C II defect in eiwitrijping met voortijdig afbraak ࢞F508 ࢞I507 N1303K S549N III verstoorde regulatie van de CFTR-functie G551D R56OT IV verstoorde conductie van chloride of verstoorde kanaalopening R117H R334W G85E R347P V minder synthese van het CFTR-eiwit 3849+10KbC࢐T 2789+5G࢐A A455E TABEL 2 Diagnostiek van cystische fibrose test testuitslag klassieke CF* niet-klassieke CFߤ zweettest chlorideconcentratie > 60 mmol/l chlorideconcentratie ࣘ 60 mmol/l neuspotentiaalmeting afwijkend niet-afwijkend CFTR-mutatie-analyse 2 mutaties 2 mutaties CF = cystische fibrose; CFTR = 'cystic fibrosis transporter regulator`-gen. Login to comment

[hide] Newborn screening for cystic fibrosis in Alberta: ... Paediatr Child Health. 2010 Nov;15(9):590-4. Lilley M, Christian S, Hume S, Scott P, Montgomery M, Semple L, Zuberbuhler P, Tabak J, Bamforth F, Somerville MJ
Newborn screening for cystic fibrosis in Alberta: Two years of experience.
Paediatr Child Health. 2010 Nov;15(9):590-4., [PMID:22043142]

Abstract [show]
On April 1, 2007, Alberta became the first province in Canada to introduce cystic fibrosis (CF) to its newborn screening program. The Alberta protocol involves a two-tier algorithm involving an immunoreactive trypsinogen measurement followed by molecular analysis using a CF panel for 39 mutations. Positive screens are followed up with sweat chloride testing and an assessment by a CF specialist. Of the 99,408 newborns screened in Alberta during the first two years of the program, 221 had a positive CF newborn screen. The program subsequently identified and initiated treatment in 31 newborns with CF. A relatively high frequency of the R117H mutation and the M1101K mutation was noted. The M1101K mutation is common in the Hutterite population. The presence of the R117H mutation has created both counselling and management dilemmas. The ability to offer CF transmembrane regulator full sequencing may help resolve diagnostic dilemmas. Counselling and management challenges are created when mutations are mild or of unknown clinical significance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 These include the following mutations: delF508, I507del, G542X, G85E, R117H, 621+1G࢐T, 711+1G࢐T, G551D, R334W, R347P, A455E, 1717-1G࢐A, R560T, R553X, N1303K, 1898+1G࢐A, 2184delA, 2789+5G࢐A, 3120+1G࢐A, R1162X, 3659delC, 3849+10kbC࢐T, W1282X, 1078delT, 394delTT, Y122X, R347H, V520F, A559T, S549N, S549R, 1898+5G࢐T, 2183AA࢐G, 2307insA, Y1092X, M1101K, S1255X, 3876delA and 3905insT. Login to comment
84 TAbLe 1 Mutation frequency Mutation name Number of times detected (247 total mutations) Frequency, % expected, % (reference) delF508* 156 63.2 68.6 (1) R117H* 36 14.6 0.7 (1) G551D* 11 4.5 2.1 (1) 3849+10kbC࢐T* 6 2.4 0.7 (1) M1101K 5 2.0 Undetermined (1) G542X* 4 1.6 2.4 (1) 1717-1G࢐A* 4 1.6 0.7 (1) 621+1G࢐T* 3 1.2 0.9 (1) 3120+1G࢐A* 3 1.2 1.5 (1) G85E* 2 0.8 0.3 (1) A455E* 2 0.8 0.2 (1) R553X* 2 0.8 0.9 (1) 2789+5G࢐A* 2 0.8 0.3 (1) ƊI507* 1 0.4 0.3 (1) 711+1G࢐T* 1 0.4 0.1 (1) R334W* 1 0.4 0.2 (1) N1303K* 1 0.4 1.3 (1) 1898+1G࢐A* 1 0.4 Undetermined (1) 2184delA* 1 0.4 0.1 (1) 394delTT 1 0.4 Undetermined (1) R347H 1 0.4 0.2 (4) V520F 1 0.4 0.2 (4) S549N 1 0.4 0.1 (1) 2307insA 1 0.4 0.2 (1) R347P* 0 0 0.2 (1) R560T* 0 0 0.2 (1) R1162X* 0 0 0.2 (1) 3659delC* 0 0 0.2 (1) W1282X* 0 0 1.4 (1) 1078delT 0 0 0.03 (2) Y122X 0 0 Undetermined (3) A559T 0 0 0.2 (1) S549R 0 0 Undetermined (1) 1898+5G࢐T 0 0 Undetermined (1) 2183AA࢐G 0 0 0.1 (1) Y1092X 0 0 Undetermined (1) S1255X 0 0 0.2 (1) 3876delA 0 0 Undetermined (4) 3905insT 0 0 0.12 (1) *American College of Medical Genetics-recommended mutations TAbLe 2 Positive cystic fibrosis newborn screen summary Screen result Unaffected Affected Further follow-up required Lost to follow-up Total Probable screen 0 23 0 0 23 Inconclusive screen One mutation 179 8 2 2 191 Markedly elevated IRT 2 0 0 0 2 R117H/F508del 0 0 5 0 5 Total 181 31 7 2 221 Data presented as n. IRT Immunoreactive trypsinogen TAbLe 3 F508del/R117H cases ID number Mutation status Sweat test result(s), &#b5;mol/L Other clinical information 24827 F508del/R117H 28 None 23726 F508del/R117H 36/insufficient/20 Fecal elastase normal 22578 F508del/R117H 10 None 24500 F508del/R117H 34/insufficient None 18527 F508del/R117H 29 None 23317 F508del/R117H+5T 47/62 Affected sibling 5T 5 thymine There were 23 newborns with probable screens. Login to comment

[hide] [Mucoviscidosis: CFTR mutation-specific therapy: a... Arch Pediatr. 2013 Jan;20(1):63-73. doi: 10.1016/j.arcped.2012.10.018. Epub 2012 Nov 27. Leonard A, Leal T, Lebecque P
[Mucoviscidosis: CFTR mutation-specific therapy: a ray of sunshine in a cloudy sky].
Arch Pediatr. 2013 Jan;20(1):63-73. doi: 10.1016/j.arcped.2012.10.018. Epub 2012 Nov 27., [PMID:23199563]

Abstract [show]
There is a need to find a cure for pulmonary disease in cystic fibrosis (CF), though full benefit of this approach will be restricted to those patients with well-preserved lungs. The most promising route is currently that of a pharmacological mutation-specific approach aiming at correcting the mechanism by which mutations lead to impairment of chloride conductance across respiratory epithelial cells. In the past 14years, 7 candidate drugs (CPX, 4PBA, gentamicin, PTC124, VX-770 or Ivacaftor, VX-809 or Lumacaftor, and Miglustat) have been investigated in CF patients. A postulate of 14 out of the 15 published studies has been that an effective agent had to improve total chloride secretion as assessed in vivo by nasal potential difference measurements. The present review casts a critical look at these studies. Apparent inconsistencies are discussed as well as possible limitations of nasal potential difference measurements as outcome parameters in these trials. Primarily targeting a mutation carried by less than 2% of French CF patients, the 2 Ivacaftor studies could well be a milestone on the long road toward a cure for CF. However, further data on safety and long-term efficacy are obviously needed and the current price of this medication in the US would make it unaffordable for European patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
178 De re &#b4;centes donne &#b4;es in vitro sugge `rent que cette me &#b4;dication soit e &#b4;galement efficace sur 9 autres mutations de la me c6;me classe (G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, G1349D) [50,51]. Login to comment

[hide] Novel CFTR variants identified during the first 3 ... J Mol Diagn. 2013 Sep;15(5):710-22. doi: 10.1016/j.jmoldx.2013.05.006. Epub 2013 Jun 28. Prach L, Koepke R, Kharrazi M, Keiles S, Salinas DB, Reyes MC, Pian M, Opsimos H, Otsuka KN, Hardy KA, Milla CE, Zirbes JM, Chipps B, O'Bra S, Saeed MM, Sudhakar R, Lehto S, Nielson D, Shay GF, Seastrand M, Jhawar S, Nickerson B, Landon C, Thompson A, Nussbaum E, Chin T, Wojtczak H
Novel CFTR variants identified during the first 3 years of cystic fibrosis newborn screening in California.
J Mol Diagn. 2013 Sep;15(5):710-22. doi: 10.1016/j.jmoldx.2013.05.006. Epub 2013 Jun 28., [PMID:23810505]

Abstract [show]
California uses a unique method to screen newborns for cystic fibrosis (CF) that includes gene scanning and DNA sequencing after only one California-40 cystic fibrosis transmembrane conductance regulator (CFTR) panel mutation has been identified in hypertrypsinogenemic specimens. Newborns found by sequencing to have one or more additional mutations or variants (including novel variants) in the CFTR gene are systematically followed, allowing for prospective assessment of the pathogenic potential of these variants. During the first 3 years of screening, 55 novel variants were identified. Six of these novel variants were discovered in five screen-negative participants and three were identified in multiple unrelated participants. Ten novel variants (c.2554_2555insT, p.F1107L, c.-152G>C, p.L323P, p.L32M, c.2883_2886dupGTCA, c.2349_2350insT, p.K114del, c.-602A>T, and c.2822delT) were associated with a CF phenotype (42% of participants were diagnosed at 4 to 25 months of age), whereas 26 were associated with CFTR-related metabolic syndrome to date. Associations with the remaining novel variants were confounded by the presence of other diseases or other mutations in cis or by inadequate follow-up. These findings have implications for how CF newborn screening and follow-up is conducted and will help guide which genotypes should, and which should not, be considered screen positive for CF in California and elsewhere.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Newborns were screened using the California method, which includes i) analysis of serum immunoreactive trypsinogen (IRT) levels using the AutoDELFIA neonatal IRT L kit (PerkinElmer, Waltham, MA) in all newborn blood spot specimens, ii) CFTR mutation panel [29-40 mutations (the mutations on the California panel were selected for the most part according to allelic frequencies found in a comprehensively genotyped group of California CF cases to achieve a 95% race/ethnicity-specific rate of CF case detection in black, white, and Hispanic individuals in California and include c.1585-1G>A, c.1680-1G>A, c.1973-1985del13insAGAAA, c.2175_2176insA, c.164 &#fe; 2T>A (removed on August 12, 2008), c.2988 &#fe; 1G>A, c.3717 &#fe; 12191C>T, c.3744delA, c.274-1G>A, c.489 &#fe; 1G>T, c.579 &#fe; 1G>T, p.A559T, p.F311del, p.F508del, p.I507del, p.G542X, p.G551D, p.G85E, p.H199Y, p.N1303K, p.R1066C, p.R1162X, p.R334W, p.R553X, p.S549N, p.W1089X, p.W1204X (c.3611G>A), p.W1282X, c.1153_1154insAT [added October 4, 2007], c.1923_1931del9insA, c.3140-26A>G, c.531delT, c.803delA, c.54-5940_273 &#fe; 10250del21kb, p.P205S, p.Q98R, p.R75X, p.S492F [added December 12, 2007], c.3659delC, p.G330X, p.W1204X [c.3612G>A] [added August 12, 2008] [Signature CF 2.0 ASR; Asuragen Inc., Austin, TX])] testing of specimens with IRT 62 ng/mL (highest 1.5%), iii) CFTR gene scanning and sequence analysis (Ambry Test: CF; Ambry Genetics, Aliso Viejo, CA) for specimens found to have only one mutation after CFTR mutation panel testing, and iv) referral to 1 of 15 pediatric CF care centers (CFCs) for sweat chloride (SC) testing and follow-up of all newborns with either two CFTR mutations detected during panel testing or one CFTR mutation detected during panel testing and one (or more) additional CFTR mutation and/or variant detected during sequencing. Login to comment

[hide] Genetic testing of sperm donors for cystic fibrosi... Eur J Obstet Gynecol Reprod Biol. 2013 Sep;170(1):183-7. doi: 10.1016/j.ejogrb.2013.06.022. Epub 2013 Jul 15. Landaburu I, Gonzalvo MC, Clavero A, Ramirez JP, Yoldi A, Mozas J, Zamora S, Martinez L, Castilla JA
Genetic testing of sperm donors for cystic fibrosis and spinal muscular atrophy: evaluation of clinical utility.
Eur J Obstet Gynecol Reprod Biol. 2013 Sep;170(1):183-7. doi: 10.1016/j.ejogrb.2013.06.022. Epub 2013 Jul 15., [PMID:23866907]

Abstract [show]
OBJECTIVE: To evaluate the clinical utility of genetic testing for cystic fibrosis (CF) and spinal muscular atrophy (SMA) in sperm donors. STUDY DESIGN: We studied the results of the genetic tests for CF and SMA applied to 372 sperm donor candidates. The CF carrier screening test analysed 32 mutations on the CFTR gene. Regarding SMA, the carrier test studied possible deletions of SMN1/2 by Multiplex Ligation-dependent Probe Amplification (MLPA) methodology. RESULTS: The carrier frequency obtained was greater for SMA than for CF. After adjusting the results obtained for the sensitivity of the tests, and taking into account the prevalence of female carriers in our population, the probability of transmission of the disease to the child from a donor with a negative genetic test was about five times lower in the case of SMA than in CF, although this difference was not statistically significant. The number of donors needed to screen (NNS) to avoid the occurrence of a child being affected by CF and SMA in our population was similar in both cases (1591 vs. 1536). CONCLUSIONS: This study demonstrates the need to include SMA among the diseases for which genetic screening is performed in the process of sperm donor selection. We believe that testing donors for SMA is as important and as useful as doing so for CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The panel of mutations studied was: S549N, S549R, R553X, G551D, V520F, I507del, F508del, 3876delA, 1717-1G->A, G542X, R560T, 3120+1G->A, A455E, R117H, 394delTT, 2183AA- >G, 2184delA, 2789+5G->A, 1898+1G->A, 621+1G->T, 711+1G- >T, G85E, R347P, R347H, W1282X, R334W, 1078delT, 3849+10kbC->T, R1162X, N1303K, 3659delC, 3905insT. Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 These include the most common CFTR gating mutation, G551D, as well as the G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D mutations [12]. Login to comment

[hide] Ivacaftor: a review of its use in patients with cy... Drugs. 2013 Sep;73(14):1595-604. doi: 10.1007/s40265-013-0115-2. Deeks ED
Ivacaftor: a review of its use in patients with cystic fibrosis.
Drugs. 2013 Sep;73(14):1595-604. doi: 10.1007/s40265-013-0115-2., [PMID:24030637]

Abstract [show]
Ivacaftor (Kalydeco) is a potentiator of the cystic fibrosis transmembrane conductance regulator (CFTR) and is the first drug that treats an underlying cause of cystic fibrosis to be licensed for use. Ivacaftor increases the open probability (i.e. gating) of CFTR channels with the G551D mutation, thus enhancing chloride transport, and is indicated in a number of countries for the treatment of cystic fibrosis in patients aged >/=6 years who carry this mutation. This review focuses on pharmacological, clinical efficacy and tolerability data relevant to the use of ivacaftor in this indication. In two 48-week, double-blind, phase III trials in patients aged >/=12 (STRIVE) or 6-11 (ENVISION) years with cystic fibrosis and the G551D mutation, oral ivacaftor 150 mg every 12 h significantly improved lung function relative to placebo, when used in combination with standard care. Significant improvements in pulmonary exacerbation risk (in STRIVE) as well as bodyweight and some aspects of health-related quality of life (both studies) were also seen with the drug versus placebo. Moreover, the beneficial effects of ivacaftor on parameters such as lung function and bodyweight were maintained over up to 96 weeks of treatment in an ongoing open-label extension of these studies. Ivacaftor was generally well tolerated, with headache, oropharyngeal pain, upper respiratory tract infection and nasal congestion being among the most common adverse events. Thus, ivacaftor expands the current treatment options for patients with cystic fibrosis who have the G551D mutation. Its potential for use in patients with other CFTR mutations is also of interest.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 For example, in rodent cells expressing G551D/S, G178R, S549N/R, G970R, G1244E, S1251N, S1255P or G1349D CFTR, ivacaftor increased channel open probability from B5 % of normal at baseline to 30-118 % of normal and increased chloride transport C16- fold (EC50 124-594 nmol/L). Login to comment

[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]

Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 RESULTS The 32-mutation panel is composed of the 23 variants from the ACMG/ACOG screening panel combined with 9 additional mutations, namely, 3876delA, R347H, S549N, 3905insT, 1078delT, V520F, 394delTT, S549R, and 2183AA>G. Login to comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment
99 Several alleles not found on the ACMG/ACOG panel were found at relatively high frequency (Table 2), including D1152H (4.0%), L206W (2.4%), c.3744delA (0.9%), F311del (0.8%), R117C (0.7%), and S549N (0.6%). Login to comment
107 These variants are 3876delA, S549N, 406-1G>A, 3199del6, W1089X, R1158X, R352Q, and 2183AA>G, and they account for 8.1% of the mutations detected in the Hispanic population. Login to comment

[hide] The relative frequency of CFTR mutation classes in... J Cyst Fibros. 2014 Jul;13(4):403-9. doi: 10.1016/j.jcf.2013.12.003. Epub 2014 Jan 16. De Boeck K, Zolin A, Cuppens H, Olesen HV, Viviani L
The relative frequency of CFTR mutation classes in European patients with cystic fibrosis.
J Cyst Fibros. 2014 Jul;13(4):403-9. doi: 10.1016/j.jcf.2013.12.003. Epub 2014 Jan 16., [PMID:24440181]

Abstract [show]
More than 1900 different mutations in the CFTR gene have been reported. These are grouped into classes according to their effect on the synthesis and/or function of the CFTR protein. CFTR repair therapies that are mutation or mutation class specific are under development. To progress efficiently in the clinical phase of drug development, knowledge of the relative frequency of CFTR mutation classes in different populations is useful. Therefore, we describe the mutation class spectrum in 25,394 subjects with CF from 23 European countries. In 18/23 countries, 80% or more of the patients had at least one class II mutation, explained by F508del being by far the most frequent mutation. Overall 16.4% of European patients had at least one class I mutation but this varied from 3 countries with more than 30% to 4 countries with less than 10% of subjects. Overall only respectively 3.9, 3.3 and 3.0% of European subjects had at least one mutation of classes III, IV and V with again great variability: 14% of Irish patients had at least one class III mutation, 7% of Portuguese patients had at least one class IV mutation, and in 6 countries more than 5% of patients had at least one class V mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations Large deletions and insertions 1078delT; 1717-1G࢐A; 3659delC; 621+1G࢐T Class II Defective protein processing G85E, F508del, I507del, R560T, N1303K Class III Defective protein regulation ('gating`) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R117H, R334W, R347P Class V Reduced amount of functioning protein 2789+5G࢐A, 3849+10KbC࢐T, A455E Unclassified All other mutations, including those unknown. Login to comment

[hide] Spectrum and distribution of CFTR gene mutations i... Gene. 2014 Apr 10;539(1):125-31. doi: 10.1016/j.gene.2014.01.022. Epub 2014 Jan 14. Muthuswamy S, Agarwal S, Awasthi S, Singh S, Dixit P, Maurya N, Choudhuri G
Spectrum and distribution of CFTR gene mutations in asthma and chronic pancreatitis cases of North Indian population.
Gene. 2014 Apr 10;539(1):125-31. doi: 10.1016/j.gene.2014.01.022. Epub 2014 Jan 14., [PMID:24440239]

Abstract [show]
BACKGROUND: Cystic fibrosis transmembrane conductance regulator (CFTR) gene accounts for an autosomal recessive condition called cystic fibrosis (CF). In the Indian subcontinent, CF and its related diseases are under-diagnosed by the medical community due to poor knowledge of the disease and its confounding diagnosis, and also due to poor medical facilities available for these patients, thus causing an increased infant mortality rate with a low life expectancy in general. The aim of the study was to document the spectrum and distribution of CFTR mutations in controls, asthma and chronic pancreatitis cases of North India. METHODS: A total of 800 subjects including 400 controls, 250 asthma cases and150 chronic pancreatitis cases were analyzed for 6 mutations (F508del, G542X, G551D, R117H, W1282X, and S549N) and IVS8 Tn polymorphism. RESULTS: Out of 800 subjects, 18% [asthma - 24% (n=250), CP - 29.33% (n=150) cases and controls - 9.3% (n=400)] were positive for heterozygous mutation, 0.8% of the (n=250) asthmatic cases (n=250) were homozygous for IVS8 T5 polymorphism while no subjects were found positive for W1282X mutation. T5 polymorphism was more common in asthmatic cases while F508del mutation in chronic pancreatitis cases. The carrier frequency of F508del, G542X, G551D, R117H, S549N and T5 was 0.015, 0.025, 0.02, 0.005, 0.005, and 0.022 respectively. The cumulative carrier frequency was 0.093. CONCLUSION: CFTR mutations were underestimated in Indian population. The present study will serve in establishment of genetic screening and prenatal setup for Indian population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Methods: A total of 800 subjects including 400 controls, 250 asthma cases and150 chronic pancreatitis cases were analyzed for 6 mutations (F508del, G542X, G551D, R117H, W1282X, and S549N) and IVS8 Tn polymorphism. Login to comment
6 The carrier frequency of F508del, G542X, G551D, R117H, S549N and T5 was 0.015, 0.025, 0.02, 0.005, 0.005, and 0.022 respectively. Login to comment
50 PCR RFLP S549N mutation was analyzed by PCR RFLP (Kerem et al., 1990). Login to comment
63 Mutation Primer Method Amplicon (size in bp) Reference DF508 C GACTTCACTTCTAATGATGATTATGGGAG ARMS Ferrie et al. (1992) N GTATCTATATTCATCATAGGAAACACCAC 160 M GTATCTATATTCATCATAGGAAACACCAT 157 G551D C TAAAATTTCAGCAATGTTGTTTTTGACC N GCTAAAGAAATTCTTGCTCGTTGCC 285 M AGCTAAAGAAATTCTTGCTCGTTGCT 286 G542X C TAAAATTTCAGCAATGTTGTTTTTGACC N ACTCAGTGTGATTCCACCTTCTAC 256 M CACTCAGTGTGATTCCACCTTCTCA 257 R117H C CACATATGGTATGACCCTCTATATAAACT N CCTATGCCTAGATAAATCGCGATAGAAC 237 M CCTATGCCTAGATAAATCGCGATAGAAT 237 S549N For TTCAGCAATGTTGTTTTGACCAAC RFLP (DdeI) N: 13 + 238 + 174 H: 13 + 238 + 174 + 412 M: 13 + 412 Kerem et al. (1990) Rev CACAGATTCTGAGTAACCATAATC IVS8 Tn For1 TAATGGATCATGGGCCATGT Nested PCR (Xmn1) 5T - 84 7T - 86 9T - 88 Chillon et al. (1995) Rev1 ACAGTGTTGAATGTGGTGCA For2 CCGCCGCTGTGTGTGTGTGTGTGTTTTT Rev2 GGATCCAGCAACCGCCAACA 3. Login to comment
71 Controls (n = 400) Minor allele frequency of F508del, G542X, G551D, R117H and S549N observed to be 0.0075, 0.0125, 0.01, 0.0025 and 0.0025 respectively (Table 2). Login to comment
73 We further stratified data as per their prevalence and found G542X to be the most common mutation with the frequency of 2.49%, followed by G551D, F508del, R117H and S549N with 2.00%, 1.50%, 0.50% and 0.50% respectively and 2.24% for 5T allele (Fig. 1A). Login to comment
75 Asthma cases (n = 250) We observed a minor allele frequency of 0.008, 0.022, 0.028, 0.002, 0.01 and 0.058 for F508del, G452X, G551D, R117H, S549N and IVS8 T5 respectively (Table 2). Login to comment
76 The frequency of individuals falling in different mutations were 10%, 5.6%, 4.4%, 2.0%, 1.6% and 0.4% with respect to IVS8 T5, G551D, G542X, S549N, F508del and R117H (Fig. 1B). Login to comment
78 CP cases (n = 150) 300 chromosomes belonging to this subgroup found to have the minor allele frequency of 0.04, 0.03, 0.03, 0.006, 0.013 and 0.02 for F508del, G452X, G551D, R117H, S549N and IVS8 T5 respectively (Table 2). Login to comment
79 The frequency of heterozygous individuals were 8.67%, 6.67%, 6.00%, 2.67%, 1.33% and 4.00% for F508del, G452X, G551D, R117H, S549N and IVS8 T5 respectively (Fig. 1C). Login to comment
98 R117H and S549N mutations The mutation falls in class IV and class III categories respectively. Login to comment
101 Similarly, the genotype frequency of S549N mutation of CP (2.7%/150), asthma (2%/250) and controls (0.5%/400) showed no significance. Login to comment
112 Serial no. Mutation General population (400) Asthma (250) Chronic pancreatitis (150) 1 DF508 0.0075 0.0080 0.0433 2 G542X 0.0125 0.0220 0.0333 3 G551D 0.01 0.0280 0.03 4 R117H 0.0025 0.0020 0.0066 5 S549N 0.0025 0.0100 0.0133 6 IVS8-5T 0.01125 0.0580 0.02 thrive, pancreatic insufficiency, elevated sweat electrolytes, late-stage diabetes and cardiac failure, besides male infertility due to congenital bilateral absence of the vas deferens (CBAVD) (Schrijver et al., 2005). Login to comment
118 A) Among the studied 5 mutation and 1 polymorphism, G542X mutation accounts for 27% (10 out of 37) in controls and the least one is S549N of 5% (2 out of 37). Login to comment
134 Serial No. Mutation General population (n = 400)% Asthma (n = 250)% Chronic pancreatitis (n = 150)% Chi square-testÌe; P value Asth vs ctrl Cp vs ctrl Asth vs CP 1 DF508 1.5 1.6 8.7 NS 0.0002 0.0013 2 G542X 2.5 4.4 6.7 NS 0.03 NS 3 G551D 2.0 5.6 6.0 0.02 0.02 NS 4 R117H 0.5 0.4 1.3 NS NS NS 5 S549N 0.5 2 2.7 NS NS NS 6 IVS8-5T 2.2 10 4.0 b0.0001 NS 0.03 7 Total 9.3 24 29.3 b0.0001 b0.0001 NS Ìe; P b 0.05 is considered significant (Bold values). Login to comment
142 Recently, Shastri and Kabra reported 1161delC, 3849 + 10kbC-T and S549N as other most common mutations in India (Shastri and Kabra 2008), which is in agreement with other reports (Sharma et al., 2009b); however in the control group of the present study 1161delC and 3849+ 10kbC-T mutations were not found (unpublished data) whereas G542X, W1282X, 621 + 1G N T that occur in lesser percentage among Hispanic and non-Hispanic Caucasians (Watson et al., 2004) were not found in earlier studies from India while the present study recorded that G542X mutation is quite common among our controls (2.5%), asthmatic (4.4%) and CP (6.7%) cases in heterozygous nature. Login to comment
145 Based on our data G551D, G542X, F508del, T5, R117H and S549N mutations may be considered for Indian subjects. Login to comment

[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]

Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

[hide] New pharmacological approaches for cystic fibrosis... Pharmacol Ther. 2015 Jan;145:19-34. doi: 10.1016/j.pharmthera.2014.06.005. Epub 2014 Jun 14. Bell SC, De Boeck K, Amaral MD
New pharmacological approaches for cystic fibrosis: promises, progress, pitfalls.
Pharmacol Ther. 2015 Jan;145:19-34. doi: 10.1016/j.pharmthera.2014.06.005. Epub 2014 Jun 14., [PMID:24932877]

Abstract [show]
With the discovery of the CFTR gene in 1989, the search for therapies to improve the basic defects of cystic fibrosis (CF) commenced. Pharmacological manipulation provides the opportunity to enhance CF transmembrane conductance regulator (CFTR) protein synthesis and/or function. CFTR modulators include potentiators to improve channel gating (class III mutations), correctors to improve abnormal CFTR protein folding and trafficking (class II mutations) and stop codon mutation read-through drugs relevant for patients with premature stop codons (most class I mutations). After several successful clinical trials the potentiator, ivacaftor, is now licenced for use in adults and children (>six years), with CF bearing the class III G551D mutation and FDA licence was recently expanded to include 8 additional class III mutations. Alternative approaches for class I and class II mutations are currently being studied. Combination drug treatment with correctors and potentiators appears to be required to restore CFTR function of F508del, the most common CFTR mutation. Alternative therapies such as gene therapy and pharmacological modulation of other ion channels may be advantageous because they are mutation-class independent, however progress is less well advanced. Clinical trials for CFTR modulators have been enthusiastically embraced by patients with CF and health care providers. Whilst novel trial end-points are being evaluated allowing CFTR modulators to be efficiently tested, many challenges related to the complexity of CFTR and the biology of the epithelium still need to be overcome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
547 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations: G542X, R1162X, RW1282X Deletions and insertions: CFTRdele2,3; 1078delT; 1717-1G ࢐ A; 3659delC; 621+1G N T Class II Defective protein processing G85E, F508del, I507del, R560T, A561E, R1066C, N1303K Class III Defective protein regulation (gating) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R334W, R347P, R117H Class V Reduced amount of functioning protein 2789+5G ࢐ A, 3272-26ANG, 3849+10KbC ࢐ T, A455E Class VI Reduced cell surface stability Rescued F508del, c.120del23 Unclassified All other mutations, including those unknown a F508del-CFTR pocket (at NBD1:ICL4 interface) (Farinha et al., 2013). Login to comment

[hide] Heterogeneous spectrum of mutations in CFTR gene f... Mol Hum Reprod. 2014 Sep;20(9):827-35. doi: 10.1093/molehr/gau047. Epub 2014 Jun 23. Sharma H, Mavuduru RS, Singh SK, Prasad R
Heterogeneous spectrum of mutations in CFTR gene from Indian patients with congenital absence of the vas deferens and their association with cystic fibrosis genetic modifiers.
Mol Hum Reprod. 2014 Sep;20(9):827-35. doi: 10.1093/molehr/gau047. Epub 2014 Jun 23., [PMID:24958810]

Abstract [show]
Cystic fibrosis (CF) is usually considered a rare disease in the Indian population. Two studies have reported on the frequency of cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in Indian males with congenital absence of the vas deferens (CAVD), however, data on the spectrum of CFTR gene mutations are still lacking. Therefore, the present study was designed to identify the spectrum of CFTR gene mutations as well as to investigate an association of CF genetic modifiers in the penetrance of CAVD in infertile Indian men. A total of 60 consecutive infertile males with a diagnosis of CAVD were subjected to CFTR gene analysis which revealed 13 different CFTR gene mutations and 1 intronic variant that led to aberrant splicing. p.Phe508del (n = 16) and p.Arg117His (n = 4) were among the most common severe forms of CFTR mutations identified. The IVS8-T5 allele, which is considered as a mild form of CFTR mutation, was found with an allelic frequency of 28.3%. Eight novel mutations were also identified in the CFTR gene from our patient cohort. It is noteworthy that the spectrum of CFTR gene mutation is heterogeneous, with exon 4 and exon 11 as hot spot regions. Moreover, we also found an association of the CF genetic modifiers, viz., transforming growth factor (TGF)-beta1 and endothelial receptor type-A (EDNRA) genes with the CAVD phenotype. The findings are of considerable clinical significance because men suffering from infertility due to CAVD can decide to use artificial reproduction technology. The children of men with CAVD are at risk of carrying CFTR mutations; therefore, genetic counseling is a crucial step for such patients. With special reference to developing countries, such as India, where whole gene sequencing is not feasible, the outcome of our study will make the screening procedure for CFTR gene simpler and more cost-effective as we have identified hot spot regions of the CFTR gene which are more prone to mutation in Indian males with CAVD. Moreover, this is the first study from the Indian population to investigate the association of CF genetic modifiers with penetrance of the CAVD phenotype. The observed association of the genetic modifiers TGF-beta1 and EDNRA in the penetrance of CAVD further supports their involvement in genesis of the vas deferens.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 SSCP analysis and subsequent DNA sequencing further revealed eleven mutations, viz., p.Gly480Ser, p.Ser549Asn, p.Arg518Lys, p.Gly126Cys, p.Ala141Gly, p.His139Gln, p.Ser118Pro, p.Arg170Cys, p.Glu585Gln, p.Met281Arg, p.Arg933Thr and two intronic variants c.1679+24G.T, c.1766+48G.C. Login to comment
95 1679+24G.T 1 ND p.Meth281Arg/U 1 ND p.Arg170Cys/U 1 ND p.Gly126Cys/U 1 ND p.Gly480Ser/U 1 ND p.Ser549Asn/5T 1 ND p.Arg518Lys/U 1 ND p.Ala141Gly/U 1 ND c.1766+48G.C/U 1 ND p.Glu585Gln/5T 1 ND In 11 CAVD patients, no mutation could be detected in either CFTR allele U-unidentified; ND, not detected. Login to comment
100 Mutations Nucleotide change Consequences Exon/Intron Number of alleles T5 Reduction of oligo T tract to 5T, c.1210-12T[5] Aberrant splicing Intron 8 34 p.Phe508del c.1521_1523delCTT or c.1522_1524delTTT Deletion of phenylalanine at amino acid 508 Exon 11 16 p.Gly480Ser c.1438G.A Glycine to Serine at 480 Exon 11 1 p.Arg518Lysa c.1553G.A Arginine to Lysine at 518 Exon 11 1 p.Arg117His c.350G.A Arginine to Histidine at 117 Exon 4 4 p.Gly126Cysa c.376G.T Glycine to Cystine at 126 Exon 4 1 p.Ala141Glya c.422C.G Alanine to Glycine at 141 Exon 4 1 p.His139Glna c.417C.G Histadine to Glutamine at 139 Exon 4 1 p.Ser118Proa c.352T.C Serine to Proline at 118 Exon 4 1 p.Arg170Cys c.508C.T Arginine to Cystine at 170 Exon 5 1 p.Glu585Glna c.1753G.C Glutamate to Glutamine at 585 Exon 13 1 p.Met281Arga c.842T.G Methionine to Arginine at 281 Exon 7 1 p.Arg933Thra c.2798G.C Arginine to Threonine at 933 Exon 17 1 p.Ser549Asn c.1646G.A Serine to Asparagine at 549 Exon 12 1 CTFR, cystic fibrosis transmembrane conductance regulator. Login to comment
121 One patient with a T5/ p.Ser549Asn genotype presented with the symptoms of repeated respiratory infection since childhood. Login to comment
141 Intriguingly, extensive screening of 27 exons of CFTR in Indian CAVD males leads to the identification of eight novel substitutions which are reported only in the Indian population and three mutations, viz., p.Gly480Ser, p.Ser549Asn and p.Arg170Cys, which havebeen reported previously (Curtis et al., 1993; Fere et al., 1994; Kawose et al., 2001). Login to comment

[hide] Function, pharmacological correction and maturatio... J Cyst Fibros. 2015 Jan;14(1):34-41. doi: 10.1016/j.jcf.2014.06.008. Epub 2014 Jul 16. Sharma H, Jollivet Souchet M, Callebaut I, Prasad R, Becq F
Function, pharmacological correction and maturation of new Indian CFTR gene mutations.
J Cyst Fibros. 2015 Jan;14(1):34-41. doi: 10.1016/j.jcf.2014.06.008. Epub 2014 Jul 16., [PMID:25042876]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is rare in India. Most CF mutations identified are not yet functionally characterized. Hence, genetic counseling and adoption of therapeutic approach are particularly difficult. Our aim was to study the function and maturation of a spectrum of eleven Indian CFTR mutations from classical CF and infertile male patients with CBAVD. METHODS: We used Western blot, pharmacology and iodide efflux to study CFTR maturation and chloride transport in BHK cells expressing pEGFP-CFTR constructs for L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F and D1270E. RESULTS: Among these CFTR mutants, only L69H is not processed as a c-band and not functional at 37 degrees C. However, the functions of L69H and S549N and the maturation of L69H are corrected at 27 degrees C and by the investigational drug VX809. CONCLUSION: These data should help in developing counseling and therapeutic approaches in India. We identified L69H as a novel class II CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 Methods: We used Western blot, pharmacology and iodide efflux to study CFTR maturation and chloride transport in BHK cells expressing pEGFP-CFTR constructs for L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F and D1270E. Login to comment
6 However, the functions of L69H and S549N and the maturation of L69H are corrected at 27 &#b0;C and by the investigational drug VX809. Login to comment
10 Keywords: Missense CF mutations; India; L69H-CFTR; S549N-CFTR; Low temperature; VX809 1. Login to comment
33 Because the cellular and functional data on these mutations can improve CF genetic counseling, we examined here the functional and cellular consequences of eleven rare missense mutations, L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F and D1270E present in CFTR gene from both classical CF patients and CBAVD patients, which have been detected during molecular diagnosis of Indian CF patients (Fig. 1). Login to comment
45 The response to agonists of S549N-CFTR mutant was reduced (Fig. 3A) compared to WT-CFTR (Fig. 3B). Login to comment
49 Mutation Nucleotide change Location in CFTR Patient phenotype CFTR dysfunction L69H T to A at 338 N-terminal Patient 1: Pancreatic insufficient, sweat chloride N 60 mEq/L, S. aureus positive; Patient 2: CBAVD Defective CFTR maturation and channel activity, class-II CF mutation F87I T to A at 391 MSD1 CBAVD No dysfunction S118P T to C at 484 MSD1 CBAVD No dysfunction G126S G to A at 508 MSD1 CBAVD No dysfunction H139Q C to G at 549 MSD1 CBAVD No dysfunction F157C T to G at 602 MSD1 CBAVD No dysfunction F494L T to C at 1612 NBD1 CBAVD No dysfunction E543A A to C at 1760 NBD1 CBAVD No dysfunction S549N G to A at 1778 NBD1 Patient 1: Frequent respiratory infection. Login to comment
57 Rescue by low temperature of L69H, F508del and S549N-CFTR mutants F508del protein is temperature sensitive, that is the mutant can be rescued from its abnormal ER location to the plasma membrane by lowering the temperature of the cells from 37 &#b0;C to 27 &#b0;C [10]. Login to comment
58 We studied the effect of low-temperature with cells expressing L69H and S549N compared to F508del-CFTR. Login to comment
66 We also performed Western blot with L69H and F508del in the presence of VX809 but not with S549N because it is already mature (Fig. 2A). Login to comment
70 Discussion The present study investigated the potential deleterious functional consequence of novel rare missense mutations 0 2 4 6 8 0.0 0.1 0.2 0.3 WT F87I S118P H139Q F157C NT Time (min) k (min -1 ) 0 2 4 6 8 0.0 0.1 0.2 0.3 G126S S549N Y852F WT F508del L69H Time (min) k (min -1 ) 0 2 4 6 8 0.0 0.1 0.2 0.3 WT F508del F494L D1270E NT E543A Time (min) k (min -1 ) W T F 8 7 I S 1 1 8 P G 1 2 6 S H 1 3 9 Q F 1 5 7 C F 4 9 4 L E 5 4 3 A Y 8 5 2 F D 1 2 7 0 E S 5 4 9 N L 6 9 H F 5 0 8 d e l 0.0 0.5 1.0 1.5 2.0 ns *** *** *** *** ns (k peak - k basal) mutant / (k peak - k basal) WT A B Fig. 3. Login to comment
72 Iodide efflux experiments in transfected BHK-21 cells, WT-CFTR, L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F and D1270E. Login to comment
80 Functional rescue of L69H, F508del and S549N by low temperature and VX809. Login to comment
82 Iodide efflux experiments with BHK-21 cells transfected with L69H, S549N and F508del-CFTR as indicated. Login to comment
100 In our study, the eleven CFTR mutants i.e. L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F and D1270E produced different results. Login to comment
118 S549N causes reduction in Cl-channel activity classifying it as a class III CF mutation [17]. Login to comment
119 Normal maturation of S549N-CFTR protein was observed in our Western blot analysis as reported by others [17]. Login to comment
120 It is noteworthy here that S549N defective channel activity was nevertheless potentiated after incubating cells at 27 &#b0;C or VX809, a result which on the contrary was not anticipated. Login to comment
129 Patients profile Eleven rare missense mutations i.e. L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F, and D1270E were characterized by using single stranded conformation polymorphism and subsequently by DNA sequencing in Indian infertile CBAVD male patients [7,8]. Login to comment
131 All the detected mutations except S549N are novel, rare mutations identified only from the Indian population, however, the exact frequency is still not known [7,8]. Login to comment
132 Additionally L69H and S549N mutations were also observed in Indian patients diagnosed with classical CF [7]. Login to comment
135 Moreover S549N missense mutation was also observed in two patients. Login to comment

[hide] CFTR Modulators for the Treatment of Cystic Fibros... P T. 2014 Jul;39(7):500-11. Pettit RS, Fellner C
CFTR Modulators for the Treatment of Cystic Fibrosis.
P T. 2014 Jul;39(7):500-11., [PMID:25083129]

Abstract [show]
Defects in a single gene lead to the defective proteins that cause cystic fibrosis, making the disease an ideal candidate for mutation-targeted therapy. Although ivacaftor is currently the only FDA-approved CFTR modifier, others are in development.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 At 48 weeks, 67% of patients in the ivacaftor group had not had a pulmonary exacerbation compared with 41% in the Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Ramsey(2011)30 STRIVE: Randomized, double-blind, placebo-controlled G551D Age 12-53 years N = 161 FEV1 40-90% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Percent change in FEV1 from baseline to 24 wks (P < 0.001): IVA, 10.4%; PBO, -0.2% ߦ Percent change in FEV1 from baseline to 48 wks compared with PBO (P < 0.001): IVA, 10.5% ߦ Percent of patients pulmonary exacerbation-free at 48 wks: IVA, 67%; PBO, 41% ߦ Change in body weight from baseline to 48 wks: IVA, 3.1 kg; PBO, 0.4 kg ߦ Sweat chloride change from baseline to 48 wks compared with PBO (P < 0.001): IVA, -48.1 mmol/L ߦ Change in CFQ-R respiratory domain from baseline to 48 wks (P < 0.001): IVA, 5.9 pts; PBO, -2.7 pts Davies (2013)29 ENVISION: Randomized, double-blind, placebo-controlled G551D Age 6-11 years N = 52 FEV1 40-105% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Absolute change in FEV1 percentage from baseline at 48 wks compared with PBO (P < 0.001): IVA, 10% ߦ Absolute change in FEV1 percentage from baseline at 24 wks (P < 0.001): IVA, 12.6%; PBO, 0.1% ߦ Mean change in sweat chloride from baseline to 48 wks compared with PBO (P < 0.001): IVA, -54.3 mmol/L ߦ Body weight change from baseline to 48 wks compared with PBO (P < 0.001): IVA, 2.8 kg ߦ Absolute CFQ-R change from baseline to 24 wks compared with PBO (P = 0.109): IVA, 6.1 pts McKone (2013)31 PERSIST: Open-label extension G551D Age ࣙ 6 years Patients had completed 48 wks of either ENVISION or STRIVE IVA 150 mg b.i.d. 96 wks (patients received 96 wks or 144 wks of IVA depending on ENVISION or STRIVE randomization) ߦ Absolute change in percent predicted FEV1: &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 9.4 &#b1; 8.3 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 9.4 &#b1; 10.8 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: -1.2 &#b1; 7.8 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 9.5 &#b1; 11.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 10.2 &#b1; 15.7 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 10.3 &#b1; 12.4 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: -0.6 &#b1; 10.1 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.5 &#b1; 11.5 ߦ Absolute change in weight (kg): &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 3.4 &#b1; 4.9 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 4.1 &#b1; 7.1 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: 0.3 &#b1; 2.2 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 3 &#b1; 4.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 6.1 &#b1; 2.9 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 14.8 &#b1; 5.7 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: 2.9 &#b1; 1.8 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.1 &#b1; 4.1 ߦ Absolute change in CFQ-R respiratory domain: &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 6.4 &#b1; 16.8 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 6.8 &#b1; 19.6 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: -3.6 &#b1; 14.1 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 9.8 &#b1; 16.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 7.4 &#b1; 17.4 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 10.6 &#b1; 18.9 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: 0.8 &#b1; 18.4 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.8 &#b1; 12.8 CFTR Modulators for the Treatment of Cystic Fibrosis Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Davies (2013)32 Placebo-controlled, double-blind, crossover study G551D Age > 6 years N = 17 FEV1 > 90% LCI > 7.4 Sequence 1: PBO ࢐ WO ࢐ IVA 150 mg b.i.d. Sequence 2: IVA 150 mg b.i.d. ࢐ WO ࢐ PBO 28-day treatment and WO periods ߦ Average change in LCI from baseline compared with PBO (P < 0.0001): IVA, -2.16 (95% CI, -2.88 to -1.44) ߦ Average change in FEV1 from baseline compared with PBO (P = 0.0103): IVA, 8.67 (95% CI, 2.36 to 14.97) ߦ Average change in FEF25-75 from baseline compared with PBO (P = 0.0237): IVA, 16.56 (95% CI, 2.30 to 27.71) Barry (2013)34 Retrospective review G551D Age 20-31 in IVA group N = 21 FEV1 < 40% IVA 150 mg b.i.d. (n = 21); matched controls (n = 35) Median duration, 237 days ߦ Absolute FEV1 change from baseline (P = 0.0075): IVA, 0.125 L; CON, 0.01 L ߦ Percent predicted FEV1 change from baseline (P = 0.0092): IVA, 12.7%, CON, 2.2% ߦ Median weight increase from baseline: IVA, 1.8 kg; CON, 0.1 kg ߦ Median inpatient days per year decreased from 23 days to 0 days in the IVA group (P = 0.001) ߦ Median total intravenous antibiotic days per year decreased from 74 days to 38 days in the IVA group (P = 0.002) De Boeck (2013)37 KONNECTION: Randomized, double-blind, crossover, placebo-controlled Non-G551D gating mutations G178R, G551S, S549N, S549R, G970R, G1244E, S1251N, S1255P, G1349D Age ࣙ 6 years N = 39 FEV1 ࣙ 40% Treatment sequence 1: IVA 150 mg b.i.d. ࢐ WO ࢐ PBO ࢐ open-label Treatment sequence 2: PBO ࢐ WO ࢐ IVA 150 mg b.i.d. ࢐ open-label 8 wks of IVA or PBO; 4-8 wks WO period; 16 wks open label ߦ Absolute change from baseline percent predicted FEV1 (P < 0.0001): IVA, 7.49%; PBO, -3.19% ߦ Absolute change from baseline BMI (P < 0.0001): IVA, 0.68; PBO, 0.02 ߦ Absolute change from baseline in CFQ-R respiratory domain (P = 0.0004): IVA, 8.94 pts; PBO, -0.67 pts ߦ Absolute change from baseline in sweat chloride (mmol/L): IVA, -52.28; PBO, -3.11 Flume (2011)35 Randomized, double-blind, placebo-controlled, parallel group with open-label extension Homozygous F508del Age ࣙ 12 years Part 1: N = 140 Part 2: N = 33 42 patients were eligible for part 2 if change in FEV1 ࣙ 10% or sweat chloride decreased by at least 15 mmol/L at day 15 and week 8 Part 1: IVA 150 mg b.i.d. or PBO 16 wks Part 2: Open label IVA 150 mg b.i.d. Login to comment
56 These promising results led to an FDA label expansion to include CF patients with the following eight mutations in addition to G551D: G178R, S549R, S549N, G551S, G1244E, S1251N, S1255P, and G1349D.38 Clinical Considerations Ivacaftor was well tolerated in clinical trials. Login to comment

[hide] A cocktail drug therapy for patients with cystic f... J Cyst Fibros. 2014 Sep;13(5):489-90. doi: 10.1016/j.jcf.2014.07.002. Epub 2014 Jul 24. Chen JH
A cocktail drug therapy for patients with cystic fibrosis?
J Cyst Fibros. 2014 Sep;13(5):489-90. doi: 10.1016/j.jcf.2014.07.002. Epub 2014 Jul 24., [PMID:25088968]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 More recently, VX-770 has been approved by the FDA (NDA 203188, www.fda.gov) and recommended by the EMA (EMA/CHMP/365663/2014) for use with an additional eight CF gating (class III) mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D), although, including G551D, these mutations still just occur in ~5% of CF patients worldwide. Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
359 Third, at the level of the NBD1:NBD2 heterodimer, CF-causing mutations are concentrated within the canonical ATP-binding site (S549N, S549R, G551D/G551S, G1244E, S1251N, and S1255P) (Fig. 7d). Login to comment

[hide] Preliminary study of haplotypes linked to the rare... Acta Physiol Hung. 2015 Mar;102(1):86-93. doi: 10.1556/APhysiol.101.2014.013. Oueslati S, Hadj Fredj S, Belhaj R, Siala H, Bibi A, Messaoud T
Preliminary study of haplotypes linked to the rare cystic fibrosis E1104X mutation.
Acta Physiol Hung. 2015 Mar;102(1):86-93. doi: 10.1556/APhysiol.101.2014.013., [PMID:25481366]

Abstract [show]
The analysis of some extra- and intragenic markers within or closely linked to the cystic fibrosis transmembrane regulator (CFTR) gene is useful as a molecular method in clinical linkage analysis. Indeed, knowing that the molecular basis of cystic fibrosis (CF) is highly heterogeneous in our population, the study of haplotype association with normal and CF chromosomes could be very helpful in cases where one or both mutations remain unidentified. In this study, we analysed with PCR-RFLP and capillary electrophoresis some extra (pJ3.11, KM19 and XV2C) and intragenic (IVS8CA, IVS17bTA and IVS17bCA) polymorphic markers in 50 normal and 10 Tunisian patients carrying the rare E1104X mutation in order to determine the haplotype associated with this mutation. For the extragenic markers, 8 haplotypes were identified. The most frequent of them are the 221 and 112 accounting for 80% of total haplotypes. For the intragenic markers, five haplotypes were present on the E1104X chromosomes. One of them 16-31-13 accounted for 50%. To our knowledge, this is the first work to be interested to the haplotypes linked to the E1104X mutation. This preliminary study of haplotypes could be a helpful method to determine the molecular lesions responsible of this pathology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 The 16-31-13 haplotype found in 50% of E1104X chromosomes was also described linked to 2 rare mutations, the E60X mutation in UK (12) and S549N mutation in the "Grande bri&#e9;re" population (3). Login to comment

[hide] Functional reconstitution and channel activity mea... J Vis Exp. 2015 Mar 9;(97). doi: 10.3791/52427. Eckford PD, Li C, Bear CE
Functional reconstitution and channel activity measurements of purified wildtype and mutant CFTR protein.
J Vis Exp. 2015 Mar 9;(97). doi: 10.3791/52427., [PMID:25867140]

Abstract [show]
The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of transporters. The phosphorylation and nucleotide dependent chloride channel activity of CFTR has been frequently studied in whole cell systems and as single channels in excised membrane patches. Many Cystic Fibrosis-causing mutations have been shown to alter this activity. While a small number of purification protocols have been published, a fast reconstitution method that retains channel activity and a suitable method for studying population channel activity in a purified system have been lacking. Here rapid methods are described for purification and functional reconstitution of the full-length CFTR protein into proteoliposomes of defined lipid composition that retains activity as a regulated halide channel. This reconstitution method together with a novel flux-based assay of channel activity is a suitable system for studying the population channel properties of wild type CFTR and the disease-causing mutants F508del- and G551D-CFTR. Specifically, the method has utility in studying the direct effects of phosphorylation, nucleotides and small molecules such as potentiators and inhibitors on CFTR channel activity. The methods are also amenable to the study of other membrane channels/transporters for anionic substrates.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 While the correctors VX-809 and VX-661 (are not yet approved for use in patients, the potentiator Kalydeco (ivacaftor; VX-770) is being used at 150 mg every 12 hr in CF patients >6 years with at least one G551D-CFTR mutation, and more recently for patients with one of G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
381 [Glu479*;Val754Met] F508del c.1521_1523delCTT CF-PI CF-causing p.Phe508del 1717-8G>A c.1585-8G>A CF-PI CF-causing 1717-1G>A c.1585-1G>A CF-PI CF-causing D529N c.1585G>A CF-PI nd p.Asp529Asn G542X c.1624G>T CF-PI CF-causing p.Gly542* S549R(A>C) c.1645A>C CF-PI CF-causing p.Ser549Arg S549N c.1646G>A CF-PI CF-causing p.Ser549Asn S549R(T>G) c.1647T>G CF-PI CF-causing p.Ser549Arg G551D c.1652G>A CF-PI CF-causing p.Gly551Asp Q552X c.1654C>T CF-PI CF-causing p.Gln552* R553X c.1657C>T CF-PI CF-causing p.Arg553* L558S c.1673T>C CF-PI unknown significance p.Leu558Ser Y569D c.1705T>G CFTR-RD,CBAVD unknown significance p.Tyr569Asp Continued on next page 2 0 | L U C A R E L L I E T A L . Login to comment

[hide] Translating the genetics of cystic fibrosis to per... Transl Res. 2015 Apr 15. pii: S1931-5244(15)00131-0. doi: 10.1016/j.trsl.2015.04.008. Corvol H, Thompson KE, Tabary O, le Rouzic P, Guillot L
Translating the genetics of cystic fibrosis to personalized medicine.
Transl Res. 2015 Apr 15. pii: S1931-5244(15)00131-0. doi: 10.1016/j.trsl.2015.04.008., [PMID:25940043]

Abstract [show]
Cystic fibrosis (CF) is the most common life-threatening recessive genetic disease in the Caucasian population. This multiorgan disease is caused by mutations in the gene encoding the CF transmembrane conductance regulator (CFTR) protein, a chloride channel recognized as regulating several apical ion channels. The gene mutations result either in the lack of the protein at the apical surface or in an improperly functioning protein. Morbidity and mortality because of the mutation of CFTR are mainly attributable to lung disease resulting from chronic infection and inflammation. Since its discovery as the causative gene in 1989, much progress has been achieved not only in clinical genetics but also in basic science studies. Recently, combinations of these efforts have been successfully translated into development and availability for patients of new therapies targeting specific CFTR mutations to correct the CFTR at the protein level. Current technologies such as next gene sequencing and novel genomic editing tools may offer new strategies to identify new CFTR variants and modifier genes, and to correct CFTR to pursue personalized medicine, which is already developed in some patient subsets. Personalized medicine or P4 medicine ("personalized," "predictive," "preventive," and "participatory") is currently booming for CF. The various current and future challenges of personalized medicine as they apply to the issues faced in CF are discussed in this review.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
155 Furthermore, Kalydeco has been tested in patients carrying other class III mutations, or targeted class IVand V mutations (sharing functional similarities with the class III).58 The new trials led to an extension of the FDA and European Medical Agency approval to 8 additional gating mutations: p.Gly178Arg (p.G178R), p.Ser549Asn (p.S549N), p.Ser549Arg (p.S549R), p.Gly551Ser (p.G551S), p.Gly1244Glu (p.G1244E), p.Ser1251Asn (p.S1251N), p.Ser1255Pro (pS1255P), and p.Gly1349Asp (p.G1349D).59 Recently, ivacaftor has also been shown to benefit patients carrying the c.350G . Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment

[hide] [Challenges of personalized medicine for cystic fi... Arch Pediatr. 2015 Jul;22(7):778-86. doi: 10.1016/j.arcped.2015.04.015. Epub 2015 May 26. Corvol H, Taytard J, Tabary O, Le Rouzic P, Guillot L, Clement A
[Challenges of personalized medicine for cystic fibrosis].
Arch Pediatr. 2015 Jul;22(7):778-86. doi: 10.1016/j.arcped.2015.04.015. Epub 2015 May 26., [PMID:26021452]

Abstract [show]
Personalized medicine, or P4 medicine for "Personalized", "Predictive", "Preventive" and "Participatory", is currently booming for cystic fibrosis, with the development of therapies targeting specific CFTR mutations. The various challenges of personalized medicine applied to cystic fibrosis issues are discussed in this paper.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
135 Compte tenu de l`efficacite &#b4; de KalydecoW chez ces patients, le laboratoire VertexW a ensuite teste &#b4;, puis de &#b4;montre &#b4; son efficacite &#b4; chez des patients porteurs d`autres mutations de classe III, ce qui a permis cette anne &#b4;e une extension d`autorisation de mise sur le marche &#b4; (AMM) pour 8 mutations supple &#b4;mentaires : G1244E, G1349D, G178R, G551S, S1251N, S1255P, S549N et S549R [37]. Login to comment

[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]

Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 Using the US and Italian data, we calculated equally low MIP scores for G178R (0.09, n = 22), S549N (0.12, n = 39), S1251N (0.07, n = 14), and G1244E (0.0, n = 3), but not for S549R (0.21, n = 14) (Supplementary Table S1 online). Login to comment
105 MIP scores were significantly different between the mutations F508del and G551D, which is in agreement with early studies of smaller numbers of patients with CF that reported a lower MI incidence in patients carrying F508del/G551D when compared with patients with CF with F508del/ F508del.28,29 We demonstrated equally low MIP scores for other class III CFTR mutations (G178R, S549N, G1244E, S1251N), further supporting the idea that class III CFTR mutations are not as severe as F508del, at least with respect to gastrointestinal development. Login to comment

[hide] Targeting ion channels in cystic fibrosis. J Cyst Fibros. 2015 Sep;14(5):561-70. doi: 10.1016/j.jcf.2015.06.002. Epub 2015 Jun 23. Mall MA, Galietta LJ
Targeting ion channels in cystic fibrosis.
J Cyst Fibros. 2015 Sep;14(5):561-70. doi: 10.1016/j.jcf.2015.06.002. Epub 2015 Jun 23., [PMID:26115565]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause a characteristic defect in epithelial ion transport that plays a central role in the pathogenesis of cystic fibrosis (CF). Hence, pharmacological correction of this ion transport defect by targeting of mutant CFTR, or alternative ion channels that may compensate for CFTR dysfunction, has long been considered as an attractive approach to a causal therapy of this life-limiting disease. The recent introduction of the CFTR potentiator ivacaftor into the therapy of a subgroup of patients with specific CFTR mutations was a major milestone and enormous stimulus for seeking effective ion transport modulators for all patients with CF. In this review, we discuss recent breakthroughs and setbacks with CFTR modulators designed to rescue mutant CFTR including the common mutation F508del. Further, we examine the alternative chloride channels TMEM16A and SLC26A9, as well as the epithelial sodium channel ENaC as alternative targets in CF lung disease, which remains the major cause of morbidity and mortality in patients with CF. Finally, we will focus on the hurdles that still need to be overcome to make effective ion transport modulation therapies available for all patients with CF irrespective of their CFTR genotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
604 When tested in clinical trials, the potentiator ivacaftor (also known as VX-770) showed a marked clinical benefit, with substantial improvement of lung function, reduction of pulmonary exacerbations, and increase in body weight in CF patients with G551D and 8 additional Class III mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D) [32-35]. Login to comment

[hide] Concentration of fractional excretion of nitric ox... J Cyst Fibros. 2015 Nov;14(6):733-40. doi: 10.1016/j.jcf.2015.07.002. Epub 2015 Jul 22. Kotha K, Szczesniak RD, Naren AP, Fenchel MC, Duan LL, McPhail GL, Clancy JP
Concentration of fractional excretion of nitric oxide (FENO): A potential airway biomarker of restored CFTR function.
J Cyst Fibros. 2015 Nov;14(6):733-40. doi: 10.1016/j.jcf.2015.07.002. Epub 2015 Jul 22., [PMID:26210165]

Abstract [show]
BACKGROUND: Lower airway biomarkers of restored cystic fibrosis transmembrane conductance regulator (CFTR) function are limited. We hypothesized that fractional excretion of nitric oxide (FENO), typically low in CF patients, would demonstrate reproducibility during CFTR-independent therapies, and increase during CFTR-specific intervention (ivacaftor) in patients with CFTR gating mutations. METHODS: Repeated FENO and spirometry measurements in children with CF (Cohort 1; n=29) were performed during hospital admission for acute pulmonary exacerbations and routine outpatient care. FENO measurements before and after one month of ivacaftor treatment (150mg every 12h) were completed in CF patients with CFTR gating mutations (Cohort 2; n=5). RESULTS: Cohort 1: Mean forced expiratory volume in 1s (FEV1 % predicted) at enrollment was 72.3% (range 25%-102%). Mean FENO measurements varied minimally over the two inpatient and two outpatient measurements (9.8-10.9ppb). There were no clear changes related to treatment of pulmonary exacerbations, gender, genotype or microbiology, and weak correlation with inhaled corticosteroid use (P<0.05). Between the two inpatient measurements, FEV1 % predicted increased by 7.3% (P<0.03) and FENO did not change. In Cohort 2, mean FENO increased from 6.6ppb (SD=2.19) to 11.8ppb (SD=4.97) during ivacaftor treatment. Mean sweat chloride dropped by 58mM and mean FEV1 % predicted increased by 10.2%. CONCLUSIONS: Repeated FENO measurements were stable in CF patients, whereas FENO increased in all patients with CFTR gating mutations treated with ivacaftor. Acute changes in FENO may serve as a biomarker of restored CFTR function in the CF lower airway during CFTR modulator treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Patients enrolled in Cohort 2 (Fig. 1B) included five CF patients with rare CFTR gating mutations (S549N/S549N in three subjects, G178R/F508del in one subject, and S549R/ F508del in one subject) who were candidates for ivacaftor therapy. Login to comment
154 Genotypes of the five individual subjects were S549N/S549N (CF01-03), S549R/F508del (CF04), and G178R/F508del (CF05). Login to comment

[hide] Hallmarks of therapeutic management of the cystic ... J Cyst Fibros. 2015 Nov;14(6):687-99. doi: 10.1016/j.jcf.2015.09.006. Epub 2015 Oct 29. Amaral MD, Balch WE
Hallmarks of therapeutic management of the cystic fibrosis functional landscape.
J Cyst Fibros. 2015 Nov;14(6):687-99. doi: 10.1016/j.jcf.2015.09.006. Epub 2015 Oct 29., [PMID:26526359]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) protein does not operate in isolation, rather in a dynamic network of interacting components that impact its synthesis, folding, stability, intracellular location and function, referred to herein as the 'CFTR Functional Landscape (CFFL)'. For the prominent F508del mutation, many of these interactors are deeply connected to a protein fold management system, the proteostasis network (PN). However, CF encompasses an additional 2000 CFTR variants distributed along its entire coding sequence (referred to as CFTR2), and each variant contributes a differential liability to PN management of CFTR and to a protein 'social network' (SN) that directs the probability of the (patho)physiologic events that impact ion transport in each cell, tissue and patient in health and disease. Recognition of the importance of the PN and SN in driving the unique patient CFFL leading to disease highlights the importance of precision medicine in therapeutic management of disease progression. We take the view herein that it is not CFTR, rather the PN/SN, and their impact on the CFFL, that are the key physiologic forces driving onset and clinical progression of CF. We posit that a deep understanding of each patients PN/SN gained by merging genomic, proteomic (mass spectrometry (MS)), and high-content microscopy (HCM) technologies in the context of novel network learning algorithms will lead to a paradigm shift in CF clinical management. This should allow for generation of new classes of patient specific PN/SN directed therapeutics for personalized management of the CFFL in the clinic.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
656 The FDA approval of Ivacaftor for multiple G551D like phenotypic variants including G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D [159,160] found at the cell surface with gating defects [161,162], and the FDA-approval of a combination of Lumacaftor and Ivacaftor for treatment of F508del [156] are examples of successful application of these technologies. Login to comment

[hide] Newborn Screening for Cystic Fibrosis in Californi... Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16. Kharrazi M, Yang J, Bishop T, Lessing S, Young S, Graham S, Pearl M, Chow H, Ho T, Currier R, Gaffney L, Feuchtbaum L
Newborn Screening for Cystic Fibrosis in California.
Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16., [PMID:26574590]

Abstract [show]
OBJECTIVES: This article describes the methods used and the program performance results for the first 5 years of newborn screening for cystic fibrosis (CF) in California. METHODS: From July 16, 2007, to June 30, 2012, a total of 2 573 293 newborns were screened for CF by using a 3-step model: (1) measuring immunoreactive trypsinogen in all dried blood spot specimens; (2) testing 28 to 40 selected cystic fibrosis transmembrane conductance regulator (CFTR) mutations in specimens with immunoreactive trypsinogen values >/=62 ng/mL (top 1.6%); and (3) performing DNA sequencing on specimens found to have only 1 mutation in step 2. Infants with >/=2 mutations/variants were referred to CF care centers for diagnostic evaluation and follow-up. Infants with 1 mutation were considered carriers and their parents offered telephone genetic counseling. RESULTS: Overall, 345 CF cases, 533 CFTR-related metabolic syndrome cases, and 1617 carriers were detected; 28 cases of CF were missed. Of the 345 CF cases, 20 (5.8%) infants were initially assessed as having CFTR-related metabolic syndrome, and their CF diagnosis occurred after age 6 months (median follow-up: 4.5 years). Program sensitivity was 92%, and the positive predictive value was 34%. CF prevalence was 1 in 6899 births. A total of 303 CFTR mutations were identified, including 78 novel variants. The median age at referral to a CF care center was 34 days (18 and 37 days for step 2 and 3 screening test-positive infants, respectively). CONCLUSIONS: The 3-step model had high detection and low false-positive levels in this diverse population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 July 16, 2007 c.164+2T.A (296+2T.A) 28 c.254G.A (G85E) c.274-1G.A (406-1G.A) c.489+1G.T (621+1G.T) c.579+1G.T (711+1G.T) c.595C.T (H199Y) c.933_935delCTT (F311del) c.1000C.T (R334W) c.1519_1521delATC (I507del) c.1521_1523delCTT (F508del) c.1585-1G.A (1717-1G.A) c.1624G.T (G5423) c.1646G.A (S549N) c.1652G.A (G551D) c.1657C.T (R5533) c.1675G.A (A559T) c.1680-1G.A (1812-1G.A) c.1973-1985del13insAGAAA (2105-2117del13insAGAAA) c.2175_2176insA (2307insA) c.2988+1G.A (3120+1G.A) c.3196C.T (R1066C) c.3266G.A (W10893) c.3485G.T (R11623) c.3611G.A (W12043 [3743G.A]) c.3717+12191C.T (3849+10kbC.T) c.3744delA (3876delA) c.3846G.A (W12823) c.3909C.G (N1303K) October 4, 2007 c.1153_1154insAT (1288insTA) 29 December 12, 2007 c.54-5940_273+10250del21kb (CFTRdele2,3(21kb)) 38 c.531delT (663delT) c.613C.T (P205S) c.803delA (935delA) c.1475C.T (S492F) c.1923_1931del9insA (2055del9.A) c.223C.T (R753) c.293A.G (Q98R) c.3140-26A.G (3272-26A.G) August 12, 2008 c.988G.T (G3303) 40 c.3612G.A (W12043 [3744G.A]) c.3659delC (3791delC) c.164+2T.A (296+2T.A), removed cDNA, complementary DNA. Login to comment

[hide] Delta F508 genotype does not predict disease sever... Pediatrics. 1994 Jan;93(1):114-8. Lester LA, Kraut J, Lloyd-Still J, Karrison T, Mott C, Billstrand C, Lemke A, Ober C
Delta F508 genotype does not predict disease severity in an ethnically diverse cystic fibrosis population.
Pediatrics. 1994 Jan;93(1):114-8., [PMID:7505422]

Abstract [show]
OBJECTIVE: As part of a study to determine population-based frequencies of CFTR mutations in an ethnically diverse, midwestern cystic fibrosis (CF) population, clinical histories were studied in 119 CF patients. METHODOLOGY: We sought to examine the association between genotype as characterized by the delta F508 and 11 other commonly occurring mutations and clinical parameters including age at diagnosis, clinical presentation, sweat chloride level, chest roentgenogram score, clinical scores, pulmonary function test results, percent weight for height, and presence of associated CF complications. RESULTS: Age at diagnosis of CF was significantly associated with homozygosity for delta F508 (mean age at diagnosis +/- SE: 1.7 +/- 0.3 years for delta F508/delta F508 vs 3.9 +/- 0.9 years for delta F508/other and other/other; P = .03). No other age-adjusted clinical parameter was significantly associated with delta F508 or any other genotype. CONCLUSION: These data suggest that in this sample of CF patients, delta F508 genotype is not predictive of disease severity. The lack of association between disease severity and genotype in this ethnically diverse sample may reflect the presence of more severe undetected mutations in our sample, or the effects of modifying genes at other, non-CF loci.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 CFTR Mutation Analysis All persons were tested for the following mutations: SF508, G542X, G551D, G553X, W1282X, N1303K, 621 +IG-*T, R117H, S549N, 3849+lOkbC-T, l6O9delCA, and R1162X. Login to comment
59 Frequencies of 12 CF With Cystic Fibrosis TR Mutations in 119 Patients Mutation Frequency SF508 0.559 G542X 0.092 G5SID 0.029 R553X 0.004 W1282X 0.012 N1303K 0.021 621 + IG -p 0.012 RII7H 0.004 R1162.X 0.008 3849 + lOkbC T 0.008 S549N 0 l6O9delCA 0 Unidentified 0.248 groups were not significantly different with respect to current age, presence of pancreatic insufficiency, clinical presentation, or associated complications common in CF patients. Login to comment

[hide] [Male infertility caused by bilateral agenesis of ... Rev Med Interne. 1997;18(2):114-8. Durieu I, Bey-Omar F, Rollet J, Boggio D, Bellon G, Morel Y, Vital Durand D
[Male infertility caused by bilateral agenesis of the vas deferens: a new clinical form of cystic fibrosis?].
Rev Med Interne. 1997;18(2):114-8., [PMID:9092029]

Abstract [show]
Congenital bilateral absence of vas deferens causes male excretory infertility and represents 1 to 2% of male infertility. Because of a genotypic similarity with cystic fibrosis, the possible in vitro fertilization with epididymal sperm requires careful genetic counselling. We studied genotype, sweat chloride concentration, respiratory function tests, sinus abnormalities, pancreatic and hepatic functions in 22 subjects with congenital bilateral absence of vas deferens. Among them, four were compound heterozygotus, all of them with the R117H mutation. Ten had a positive sweat test, one of them also being compound heterozygotus. Congenital bilateral absence of vas deferens and double mutation or positive sweat test led to high probable cystic fibrosis diagnosis in 13 subjects. Six subjects were heterozygotus for one cystic fibrosis mutation, criterium which is not sufficient for cystic fibrosis diagnosis; five of them had sinus abnormalities, present in 11 of the 22 subjects. Only three patients had no mutation nor sweat chloride abnormalities. This work confirms the high frequency of cystic fibrosis mutations in males with congenital bilateral absence of vas deferens, with a higher frequency of positive sweat test than in other publications, and a high frequency of sinus abnormalities. This monosymptomatic phenotype of cystic fibrosis suggests new hypotheses for a relationship between genotype and phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Vingt-deux mutations du gene CFTR ont Cte recher- chtes : les cinq plus frequentes (AF508, G542X, N1303K, 1717-G--A, G85E) et les 17 suivantes : R117H, 556delA, R334W, R347H, R347P, S549N, S5491, S549R, G551D, R553X,R560T,G1244E3,S1255X,W1282X,R1283K,3898 ins C, D1270N. Login to comment