ABCMdb

ABCC7 p.Ser912*

ClinVar:	c.2736G>A , p.Ser912= ? , Uncertain significance c.2735C>A , p.Ser912* ? , not provided c.2735C>T , p.Ser912Leu N , Benign
CF databases:	c.2735C>A , p.Ser912* D , CF-causing c.2735C>T , p.Ser912Leu (CFTR1) ? , The nucleotide change C->T at position 2876 in exon 15 results in a replacement of a serine for leucine at position 912.

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Preconceptional identification of cystic fibrosis ... J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22. Coiana A, Faa' V, Carta D, Puddu R, Cao A, Rosatelli MC
Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program.
J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22., [PMID:21429822]

Abstract [show]
BACKGROUND: In Sardinia the mutational spectrum of CFTR gene is well defined. A mutation detection rate of 94% can be achieved by screening for 15 CFTR mutations with a frequency higher than 0.5%. The efficiency of this molecular test suggests that Sardinians may represent a suitable population for a preconceptional screening. METHODS: Five hundred couples of Sardinia descent were screened for 38 mutations using a semi-automated reverse-dot blot and PCR-gel electrophoresis assays. This mutation panel included the 15 most frequent CF alleles in Sardinia. RESULTS: We identified 38 CF carriers, revealing an overall frequency of 1/25 (4%). The most common CF allele was the p.Thr338Ile (T338I) (65%), followed by the p.Phe508del (F508del) (22.5%). We also identified one couple at risk and an asymptomatic female homozygote for the p.Thr338Ile allele. CONCLUSIONS: In spite of the low number of the couples tested, the results herein reported demonstrate the efficacy and efficiency of the preconceptional screening program and the high participation rate of the Sardinian population (99%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 Mutation nomenclaturea Alleles (%) T338I (p.Thr338Ile) 26 (65.0) F508del (p.Phe508del) 9 (22.5) N1303K (p.Asn1303Lys) 1 (2.5) 2183AANG (c.2051_2052delAAinsG) 1 (2.5) 621+1GNT (c.489+1GNT) 1 (2.5) exon 2 del (c.54-5811_164+2187del8108ins182) 1 (2.5) R347P (p.Arg347Pro) 1 (2.5) The 3849+10kbCNT (c.3717+12191CNT), G85E (p.Gly85Glu), 2789+5GNA (c.2657+5GNA), W1282X (p.Trp1282X), G1244E (p.Gly1244Glu), 711+5GNA (c.579+5GNA), 711+1GNT (c.579+1GNA), 4016insT (p.Ser1297PhefsX5), G542X (p.Gly542X), 1717-1GNA (c.1585-1GNA), R553X (p.Arg553X), Q552X (p.Gln552X), G551D (p.Gly551Asp), S549R (ANC) (p.Ser549Arg), I507del (p.Ile507del), F508C (p.Phe508Cys), I502T (p.Ile502Thr), 1706del17 (p.Gln525LeufsX37), 1677delTA (p.Tyr515X), R117H (p.Arg117His), D1152H (p.Asp1152His), L1065P (p.Leu1065Pro), R1066H (p.Arg1066His), L1077P (p.Leu1077Pro), 4382delA (p.Glu1418ArgfsX14), R1162X (p.Arg1162X), R1158X (p.Arg1158X), 1259 insA (p.Gln378AlafsX4), 852del22 (p.Gly241GlufsX13), S912X (p.Ser912X), and 991del5bp (p.Asn287LysfsX19) mutations included in the CF panel were not detected in the population tested. Login to comment

[hide] A microRNA network regulates expression and biosyn... Proc Natl Acad Sci U S A. 2012 Aug 14;109(33):13362-7. doi: 10.1073/pnas.1210906109. Epub 2012 Aug 1. Ramachandran S, Karp PH, Jiang P, Ostedgaard LS, Walz AE, Fisher JT, Keshavjee S, Lennox KA, Jacobi AM, Rose SD, Behlke MA, Welsh MJ, Xing Y, McCray PB Jr
A microRNA network regulates expression and biosynthesis of wild-type and DeltaF508 mutant cystic fibrosis transmembrane conductance regulator.
Proc Natl Acad Sci U S A. 2012 Aug 14;109(33):13362-7. doi: 10.1073/pnas.1210906109. Epub 2012 Aug 1., [PMID:22853952]

Abstract [show]
Production of functional proteins requires multiple steps, including gene transcription and posttranslational processing. MicroRNAs (miRNAs) can regulate individual stages of these processes. Despite the importance of the cystic fibrosis transmembrane conductance regulator (CFTR) channel for epithelial anion transport, how its expression is regulated remains uncertain. We discovered that miRNA-138 regulates CFTR expression through its interactions with the transcriptional regulatory protein SIN3A. Treating airway epithelia with an miR-138 mimic increased CFTR mRNA and also enhanced CFTR abundance and transepithelial Cl(-) permeability independent of elevated mRNA levels. An miR-138 anti-miR had the opposite effects. Importantly, miR-138 altered the expression of many genes encoding proteins that associate with CFTR and may influence its biosynthesis. The most common CFTR mutation, DeltaF508, causes protein misfolding, protein degradation, and cystic fibrosis. Remarkably, manipulating the miR-138 regulatory network also improved biosynthesis of CFTR-DeltaF508 and restored Cl(-) transport to cystic fibrosis airway epithelia. This miRNA-regulated network directs gene expression from the chromosome to the cell membrane, indicating that an individual miRNA can control a cellular process more broadly than recognized previously. This discovery also provides therapeutic avenues for restoring CFTR function to cells affected by the most common cystic fibrosis mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 We also expressed a recombinant CMV promoter-driven CFTR-ΔF508 cDNA in primary human CFTR null airway epithelia (CFTR Q493X/S912X) using an adenovirus (Ad) vector (41). Login to comment
161 (A) (Upper) CFTR protein abundance from airway epithelia (CFTR Q493X/ S912X, 24-1 antibody) after indicated treatments. Login to comment
110 We also expressed a recombinant CMV promoter-driven CFTR-ƊF508 cDNA in primary human CFTR null airway epithelia (CFTR Q493X/S912X) using an adenovirus (Ad) vector (41). Login to comment
159 (A) (Upper) CFTR protein abundance from airway epithelia (CFTR Q493X/ S912X, 24-1 antibody) after indicated treatments. Login to comment

[hide] Two novel mutations in the transmembrane domains o... Hum Mol Genet. 1993 Oct;2(10):1739-40. Saba L, Leoni GB, Meloni A, Faa V, Cao A, Rosatelli MC
Two novel mutations in the transmembrane domains of the CFTR gene in subjects of Sardinian descent.
Hum Mol Genet. 1993 Oct;2(10):1739-40., [PMID:7505693]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 In molecular screening for CF defects in Sardinians, carried out by DGGE analysis of exons 4 - 7 - 1 0 - 1 1 - 14a-15- 17b-20-21, we identified two novel mutations: a C - T transversionat nt 1145 (T338I) and a C-A transversion at nt 2867 (S912X). Login to comment
20 The S912X mutation was found in a single case showing a severe phenotype with pancreatic insufficiency and recurrent respiratory infections. Login to comment
21 The patient was compound heterozygote for the S912X and an unknown mutation. Login to comment
22 The S912X mutation may lead to premature termination of the protein production in the second transmembrane domain. Login to comment
26 GCCF15 : (40GC) CCTATTGATGGTGGATCAGC 10% c-OA G T A T T A T Figure 1. Detection of the S912X mutation in the CFTR gene by DGGE and sequencing analysis. Top Left: schematic representation of the CFTR gene and amplification primers for DGGE. Bottom left: DGGE with a 10-60% gradient. Login to comment
27 Lane 1 - normal subject lane 2 - subject heterozygous for the S912X mutation. Right: Direct sequencing of the PCR products of exon 15 showing a C-A transversion at nt2867. Login to comment

[hide] CFTR gene mutations and asthma in the Norwegian En... Respir Med. 2006 Dec;100(12):2121-8. Epub 2006 May 5. Munthe-Kaas MC, Lodrup Carlsen KC, Carlsen KH, Skinningsrud B, Haland G, Devulapalli CS, Pettersen M, Eiklid K
CFTR gene mutations and asthma in the Norwegian Environment and Childhood Asthma study.
Respir Med. 2006 Dec;100(12):2121-8. Epub 2006 May 5., [PMID:16678395]

Abstract [show]
BACKGROUND: Several candidate genes have been implicated in the etiology of asthma, including the gene coding for the cystic fibrosis transmembrane conductance regulator (CFTR). Mutations in the CFTR gene result in derangements of mucociliary clearance. Homozygotes for CFTR mutations develop cystic fibrosis (CF), a disorder characterized mainly by lung and pancreas disease. OBJECTIVE: To investigate whether there was an increased frequency of CFTR mutations in asthma patients. METHODS: Seven hundred and three subjects aged 10-11 years from the environment and childhood asthma (ECA) study were included in the present study. Possible associations between asthma, reduced lung function, bronchial hyperresponsiveness (BHR), and increased or decreased nitrogen oxide (NO) levels (based on structural parental interview, spirometry, PD20 methacholine challenge test and exhaled NO measurements), and the five most common CFTR mutations in Norway (DeltaF508, R117H, R117C, 4005+2T-->C, 394delTT), the modulating polymorphisms IVS8(TG)mTn and the IVS8-5T were investigated. RESULTS: No association were found between asthma, reduced lung function, BHR or exhaled NO levels and CF heterozygosity. However, the IVS8(TG)11T7 haplotype was associated with normal lung function. CONCLUSIONS: Our results do not support the hypothesis that CFTR mutations or polymorphisms play a role in the pathogenesis of asthma in children. However, the distribution of Tn(TG)m haplotypes differed between individuals with reduced lung function and individuals with normal lung function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 CFTR mutation Alleles (%) F508del 184 (62.2) R117C 12 (4.1) R117H 12 394delTT 11 (3.8) 4005+2T-C 11 G551D 6 (2.0) 3659delC 5 (1.7) E60X 4 (1.4) V232D 4 1525-2A-G 3 (1.0) N1303K 3 G542X 2 (0.7) E279X 2 R75X 2 S912X 2 E116X 1 (0.3) L295Q 1 R347L 1 Q493X 1 I506L 1 I507del 1 R553X 1 G576A 1 621-1G-T 1 2183AA-G 1 S945L 1 R1162X 1 I1234V 1 3849+10 kbC-T 1 W1282X 1 Unknown 18 (6.5) Total alleles 296 (100%) Mutations detected with OLA31 m kit-74%. Login to comment

[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]

Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

[hide] Mutation analysis of PRSS1, SPINK1 and CFTR gene i... Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287. Sisman G, Tugcu M, Ayla K, Sebati O, Senturk H
Mutation analysis of PRSS1, SPINK1 and CFTR gene in patients with alcoholic and idiopathic chronic pancreatitis: A single center study.
Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287., [PMID:25835118]

Abstract [show]
BACKGROUND/AIMS: A relation between some genetic mutations and chronic pancreatitis (CP) has been reported. However, the relation of genetic mutation to alcoholic CP (ACP) and idiopathic CP (ICP) still remains controversial. In this study, we investigated the prevalence of protease serine 1 (PRSS1), serine protease inhibitor, Kazal type 1 (SPINK1) SPINK1 and cystic fibrosis transmembrane conductance regulator (CFTR) mutations in ACP and ICP patients in Turkey. MATERIALS AND METHODS: Forty-one patients with ACP and 38 patients with ICP were enrolled, and 35 healthy individuals served as controls. The PRSS1 and SPINK1 mutations were investigated by the polymerase chain reaction (PCR)-restriction fragment-length polymorphism (RFLP) technique. The CFTR mutation was examined with PCR direct sequencing. RESULTS: The mean ages of the ACP, ICP and healthy control groups were 53.2, 40.4 and 46.3 years, respectively. A CFTR F508 mutation was detected as a heterozygote in one (2.4%) patient with ACP. In the ICP and control populations, PRSS1, SPINK1 and CFTR mutations were not detected. CONCLUSION: This study shows that PRSS1, SPINK1 and CFTR mutations do not play a role in ACP and ICP patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 DNA samples were multiplied by multiplex PCR with a CF 22Mut and CF 14Mut+Tn strip assay kit which has 36 common mutations of the CFTR gene (DF508, DI507, F508C, I502T, 1706del17, 1677del TA, G542X, 1717-1G>A, R553X, Q552X, G551D, S549R(A>C), N1303K, 4016insT, R1162X, R1158X, W1282X, G1244E, 2789+5G>A, 2183AA>G, 711+5G>A, 711+1G>T, G85E, 3849+10kbC>T, 621+1G>T, R117H, D1152H, L1065P, R1066H, L1077P, 4382delA, 1259insA, 852del22, R347P, T338I, S912X and Allele5T-7T-9T). Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
371 [1043T>A;2735C>A] CF-PI M348K nd; S912X CF-causing p. Login to comment