ABCC7 p.Ser549Arg
| Admin's notes: | Class II-III (maturation defect, gating defect) Veit et al. |
| ClinVar: |
c.1647T>G
,
p.Ser549Arg
D
, Pathogenic
c.1645A>C , p.Ser549Arg D , Pathogenic c.1646G>T , p.Ser549Ile D , Pathogenic |
| CF databases: |
c.1646G>A
,
p.Ser549Asn
D
, CF-causing ; CFTR1:
c.1645A>C or c.1647T>G , p.Ser549Arg D , CF-causing ; CFTR1: ; CFTR1: The CF chromosome with this mutation is carried by a non-Ashkenazic Jewish patient in Morocco. The chromosome also has the B haplotype. Detection of this mutation may be achieved by ASO hybridization or allele-specific PCR. c.1646G>T , p.Ser549Ile (CFTR1) ? , This mutation destroys a Ddel site, similar to G549N, and therefore one cannot distinguish the two by Ddel digestion. |
| Predicted by SNAP2: | A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (59%), K: D (95%), L: D (95%), M: D (95%), N: N (72%), P: D (95%), Q: D (95%), R: N (57%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
[hide] Proportion of cystic fibrosis gene mutations not d... JAMA. 1999 Jun 16;281(23):2217-24. Mak V, Zielenski J, Tsui LC, Durie P, Zini A, Martin S, Longley TB, Jarvi KA
Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia.
JAMA. 1999 Jun 16;281(23):2217-24., 1999-06-16 [PMID:10376575]
Abstract [show]
CONTEXT: Infertile men with obstructive azoospermia may have mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, many of which are rare in classic cystic fibrosis and not evaluated in most routine mutation screening. OBJECTIVE: To assess how often CFTR mutations or sequence alterations undetected by routine screening are detected with more extensive screening in obstructive azoospermia. DESIGN: Routine screening for the 31 most common CFTR mutations associated with the CF phenotype in white populations, testing for the 5-thymidine variant of the polythymidine tract of intron 8 (IVS8-5T) by allele-specific oligonucleotide hybridization, and screening of all exons through multiplex heteroduplex shift analysis followed by direct DNA sequencing. SETTING: Male infertility clinic of a Canadian university-affiliated hospital. SUBJECTS: Of 198 men with obstructive (n = 149) or nonobstructive (n = 49; control group) azoospermia, 64 had congenital bilateral absence of the vas deferens (CBAVD), 10 had congenital unilateral absence of the vas deferens (CUAVD), and 75 had epididymal obstruction (56/75 were idiopathic). MAIN OUTCOME MEASURE: Frequency of mutations found by routine and nonroutine tests in men with obstructive vs nonobstructive azoospermia. RESULTS: Frequency of mutations and the IVS8-5T variant in the nonobstructive azoospermia group (controls) (2% and 5.1% allele frequency, respectively) did not differ significantly from that in the general population (2% and 5.2%, respectively). In the CBAVD group, 72 mutations were found by DNA sequencing and IVS8-5T testing (47 and 25, respectively; P<.001 and P = .002 vs controls) vs 39 by the routine panel (P<.001 vs controls). In the idiopathic epididymal obstruction group, 24 mutations were found by DNA sequencing and IVS8-5T testing (12 each; P=.01 and P=.14 vs controls) vs 5 by the routine panel (P=.33 vs controls). In the CUAVD group, 2 mutations were found by routine testing (P=.07 vs controls) vs 4 (2 each, respectively; P=.07 and P=.40 vs controls) by DNA sequencing and IVS8-5T testing. The routine panel did not identify 33 (46%) of 72, 2 (50%) of 4, and 19 (79%) of 24 detectable CFTR mutations and IVS8-5T in the CBAVD, CUAVD, and idiopathic epididymal obstruction groups, respectively. CONCLUSIONS: Routine testing for CFTR mutations may miss mild or rare gene alterations. The barrier to conception for men with obstructive infertility has been overcome by assisted reproductive technologies, thus raising the concern of iatrogenically transmitting pathogenic CFTR mutations to the progeny.
Comments [show]
None has been submitted yet.
No. Sentence Comment
28 Analysis for 31 of the most common CFTR mutations found within the white CF population,60 consisting of ⌬F508, W1282X, G542X, G551D, N1303K, R553X, G85E, R117H, S549N, V520F, R334W, A455E, R347P, R1162X, Y122X, S549R, 621+1G→T, ⌬I507, R560T, R347H, 3659delC, Q493X, 1898+1G→T, 711+1G→T, 3849+10C→T, 1717-1G→A, 3849+4A→G, 3905insT, 1078delT, 2183AA→G, and 2789+5G→A. Briefly, the technique involved amplification by polymerase chain reaction61 of the relevant exons, followed by digestion with appropriate restriction endonucleases and acrylamide gel electrophoresis with ethidium bromide staining.
X
ABCC7 p.Ser549Arg 10376575:28:218
status: NEW45 (%) Men With 2 Mutations ⌬F508/IVS8-5T 7 (11) ⌬F508/IVS8-5T 1 (10) ⌬F508/IVS8-5T 1 (1.8) ⌬F508/R117H 6 (9) W1282X/IVS8-5T 1 (1.8) ⌬F508/L206W 1 (1.6) G544S/IVS8-5T 1 (1.8) ⌬F508/M952T 1 (1.6) V754M/-741T→G 1 (1.8) ⌬F508/P67L 1 (1.6) R75Q/R258G 1 (1.8) ⌬F508/S549R 1 (1.6) R334W/R334W 1 (1.6) R117H/R117H 1 (1.6) R117H/IVS8-5T 1 (1.6) R347P/IVS8-5T 1 (1.6) N1303K/IVS8-5T 1 (1.6) 1677delTA/IVS8-5T 1 (1.6) R117L/IVS8-5T 1 (1.6) D979A/IVS8-5T 1 (1.6) IVS8-5T/IVS8-5T 1 (1.6) Men With 1 Mutation IVS8-5T/N 10 (16) ⌬F508/N 1 (10) IVS8-5T/N 9 (16) ⌬F508/N 1 (2) ⌬F508/N 6 (9) IVS8-5T/N 1 (10) ⌬F508/N 1 (1.8) G542X/N 1 (2) W1282X/N 2 (3) R75Q/N 1 (1.8) IVS8-5T/N 5 (10) L206W/N 1 (1.6) W1282X/N 1 (1.8) 4016insT/N 1 (1.6) R117H/N 1 (1.8) 2423delG/N 1 (1.8) Men With No Mutations 18 (28) 7 (70) 37 (66) 42 (86) *N indicates that no CFTR mutations or variants were detected.
X
ABCC7 p.Ser549Arg 10376575:45:321
status: NEW47 tion panel included W1282X (2 alleles), R334W (2 alleles), S549R (1 allele), R347P (1 allele), and N1303K (1 allele).
X
ABCC7 p.Ser549Arg 10376575:47:59
status: NEW58 (%) 31 Mutation panel† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1 (1) R117H 9 (7) W1282X 2 (1.8) G542X 1 (1) W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) Extensive screen† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1Mutations included in R117H 9 (7) W1282X 2 (1.8) G542X 131 mutation panel W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) L206W 2 (1.6)‡ R75Q 2 (1.8)‡Mutations not included in P67L 1 (0.8)‡ G544S 1 (0.9)‡31 mutation panel 1677delTA 1 (0.8)‡ 2423delG 1 (0.9)‡ R117L 1 (0.8)‡ V754M 1 (0.9)‡ 4016insT 1 (0.8)‡ -741T→G 1 (0.9)‡ D979A 1 (0.8)§ R258G 1 (0.9)§ M952T 1 (0.8)¶ IVS8-5T 25 (20)# 2 (10) 12 (11) 5 (5) Detectable mutations 72 (56)# 4 (20) 24 (21)# 7 (7) Detectable mutations missed by 31 mutation panel 33 (46) 2 (50) 19 (79) Detectable non-IVS8-5T mutations missed by 31 mutation panel 8 (17) 0 (0) 7 (58) *Percentages indicate allele frequency.
X
ABCC7 p.Ser549Arg 10376575:58:193
status: NEWX
ABCC7 p.Ser549Arg 10376575:58:454
status: NEW83 These severe CFTR gene mutations are associated with pancreatic insufficiency and are generally class 1 through 3 mutations: ⌬F508, W1282X, N1303K, S549R, 1677delTA, R117L, 4016insT, G544S, 2423delG, V754M, and 741T→G.
X
ABCC7 p.Ser549Arg 10376575:83:155
status: NEW90 Except for 1 subject who had the ⌬F508/ S549R genotype, all 32 (25%) of 130 men with 2 mutant CFTR alleles carried at least 1 mild class 4 or 5 mutation.
X
ABCC7 p.Ser549Arg 10376575:90:47
status: NEW[hide] Radiological analysis of children with cystic fibr... J Trop Pediatr. 1999 Jun;45(3):158-60. Frossard PM, Bakalinova D, Hertecant J, Bossaert Y, Dawson KP
Radiological analysis of children with cystic fibrosis who are homozygous for cystic fibrosis transmembrane conductance regulator mutation S549R (T-->G).
J Trop Pediatr. 1999 Jun;45(3):158-60., [PMID:10401194]
Abstract [show]
Genotype-phenotype analyses in cystic fibrosis (CF) have shown that cystic fibrosis transmembrane conductance regulator (CFTR) genotypes can predict pancreatic status but that correlations with pulmonary status remain elusive. We investigated the extent and severity of lung disease associated with CFTR mutation S549R (T-->G). This mutation is localized in intron 11 (nucleotide-binding fold 1 of the CFTR protein) and had so far been described as a private mutation only. It is associated with an extremely severe overall CF phenotypic expression. Detailed radiological analyses were performed by a single observer in 12 children with CF from the United Arab Emirates who were homozygous for CFTR mutation S549R (T-->G). A diversity of pulmonary changes included marked hyperinflation in early infancy in conjunction with inflammation of the interstitium. After 2 years of age, signs of central airway involvement occurred in association with early signs of pulmonary hypertension. In conclusion, although there is some diversity in the radiological findings of these CF patients, R549 is a very severe allele associated with extreme lung disease and rapid pulmonary decline.
Comments [show]
None has been submitted yet.
No. Sentence Comment
2 We investigated the extent and severity of lung disease associated with CFTR mutation S549R (T !
X
ABCC7 p.Ser549Arg 10401194:2:86
status: NEW6 Detailed radiological analyses were performed by a single observer in 12 children with CF from the United Arab Emirates who were homozygous for CFTR mutation S549R (T !
X
ABCC7 p.Ser549Arg 10401194:6:158
status: NEW15 Genotype±phenotype correlations have been established with pancreatic status, while lung involvement is not clearly related to the CFTR genotype.6±9 We have reported previously that a very severe form of cystic ®brosis amongst nationals from the UAE is due to mutation S549R (T !
X
ABCC7 p.Ser549Arg 10401194:15:284
status: NEW29 CFTR S549R mutation analysis DNA samples from the 12 CF patients were extracted from leukocytes isolated from 2 ml of venous blood collected in ethylene diamine tetraacetic acid (EDTA) tubes according to standard protocols.11 The determination of presence of mutation S549R in both alleles was done routinely by DraIII restriction endonuclease analysis of exon 11 polymerase chain reaction (PCR) products, and con®rmed by sequencing analysis according to protocols and conditions that have been described elsewhere.11 Clinical investigations Detailed radiological analyses were carried out in the 12 patients by a single observer in order to evaluate both the severity and the extent of lung disease.
X
ABCC7 p.Ser549Arg 10401194:29:5
status: NEWX
ABCC7 p.Ser549Arg 10401194:29:268
status: NEW65 We sought to determine the degree of homogeneity in the pulmonary phenotypic expression of mutation S549R (T !
X
ABCC7 p.Ser549Arg 10401194:65:100
status: NEW67 P. M. FROSSARD ET AL. Journal of Tropical Pediatrics Vol. 45 June 1999 We have previously shown that, amongst UAE nationals who are of Bedouin origin, CF is due to mutation S549R (T !
X
ABCC7 p.Ser549Arg 10401194:67:175
status: NEW69 As the two NBFs have key regulatory roles in CFTR function, S549R (T !
X
ABCC7 p.Ser549Arg 10401194:69:60
status: NEW82 These combined ®ndings clearly indicate that the phenotypic expression of lung disease due to CFTR mutation S549R (T !
X
ABCC7 p.Ser549Arg 10401194:82:113
status: NEW84 In this respect, the pulmonary phenotype expression of mutation S549R (T !
X
ABCC7 p.Ser549Arg 10401194:84:64
status: NEW[hide] Analysis of 31 CFTR mutations by polymerase chain ... J Med Screen. 1999;6(2):67-9. Gasparini P, Arbustini E, Restagno G, Zelante L, Stanziale P, Gatta L, Sbaiz L, Sedita AM, Banchieri N, Sapone L, Fiorucci GC, Brinson E, Shulse E, Rappaport E, Fortina P
Analysis of 31 CFTR mutations by polymerase chain reaction/oligonucleotide ligation assay in a pilot screening of 4476 newborns for cystic fibrosis.
J Med Screen. 1999;6(2):67-9., [PMID:10444722]
Abstract [show]
OBJECTIVES: Molecular biological testing for genetic diseases has grown rapidly, but speed, accuracy, specificity, sensitivity, throughput, and cost become more important as large scale screening is considered. This is a pilot study of an assay for the simultaneous detection of up to 31 cystic fibrosis mutations in a multicentre population based screening of 4476 Italian newborns. METHODS: The assay is a polymerase chain reaction, followed by an oligonucleotide ligation assay (PCR/OLA) and finally a sequence coded separation. It allows the detection of up to 31 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Guthrie spots were used as a source of template DNA. RESULTS: 144 carriers were detected during the analysis of 4476 samples, which translates into a carrier frequency of 1/31.1. Forty two carriers were detected from 1341 samples in Pavia (1/31.9), 53 from 1574 in Turin (1/29.7), and 49 from 1561 in San Giovanni Rotondo (1/31.8). Fifteen different mutations were detected, the most common being delta F508 (0.625). Other common mutations included G542X (16 of 144), which was particularly common in southern Italy (14 of 49), N1303K (8 of 144), and R117H (8 of 144), detected only in the northern centres. CONCLUSIONS: PCR/OLA is a robust, accurate, user friendly method for cystic fibrosis screening of newborns using blood spots in a semiautomated way at a low cost per mutation (0.8 Euro).
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 Table 1 Mutations analysed in the CFTR gene using polymerase chain reaction/oligonucleotide litigation assay/sequence coded separation Mutation Location Nucleotide Result F508 Exon 10 3 bp deletion Deletion of Phe-508 I507 Exon 10 3 bp deletion Deletion of Ile-507 (or -506) Q493X Exon 10 C-1609 →→ T Gln-493 → Stop V520F Exon 10 G-1690 → T Val-520 → Phe 1717-1G → A Intron 10 G-1717-1 → A 3`-splice site mutation G542X Exon 11 G-1756 → T Gly-542 → Stop G551D Exon 11 G-1784 → A Gly-551 → Asp R553X Exon 11 C-1789 → T Arg-553 → Stop R560T Exon 11 G-1811 → C Arg-560 → Thr S549R Exon 11 T-1779 → G Ser-549 → Arg S549N Exon 11 G-1778 → A Ser-549 → Asn 3849+10 kb C → T Intron 19 C-3849+10 kb → T Splice mutation 3849+4A → G Intron 19 A-3849+4 → G Splice mutation R1162X Exon 19 C-3616 → T Arg-1162 → Stop 3659delC Exon 19 1 bp deletion Frameshift W1282X Exon 20 G-3978 → A Trp-1282 → Stop 3905insT Exon 20 1 bp insertion Frameshift N1303K Exon 21 C-4041 → G Asn-1303 → Lys G85E Exon 3 G-386 → A Gly-85 → Glu 621+1G → T Intron 4 G-621+1 → T 5`-splice site mutation R117H Exon 4 G-482 → A Arg-117 → His Y122X Exon 4 T-498 → A Tyr-122 → Stop 711+1G → T Intron 5 G-711+1 → T 5`-splice site mutation 1078delT Exon 7 1 bp deletion Frameshift R347P Exon 7 G-1172 → C Arg-347 → Pro R347H Exon 7 G-1172 → A Arg-347 → His R334W Exon 7 C-1132 → T Arg-334 → Trp A455E Exon 9 C-1496 → A Ala-455 → Glu 1898+1G → A Intron 12 G-1898+1 → A 5`-splice site mutation 2184delA Exon 13 Deletion A-2184; A-2183 → G Frameshift 2789+5G → A Intron 14B G-2789+5 → A Splice mutation Table 2 Summary of cystic fibrosis screening results No of samples analysed Normal subjects Carriers Carrier frequency Turin 1574 1521 53 1/29.7 Pavia 1341 1299 42 1/31.9 San Giovanni Rotondo 1561 1512 49 1/31.8 Total 4476 4332 144 1/31.1 Table 3 Detailed list of mutations detected in the Italian population Centre F508 G542X R347P 2183-AG N1303K 711+1GT 1717-1A R347H R117H 1898+1G 2789+5G W1282X R1162X I507 Other TO 33 2 1 1 5 1 1 2 3 2 2 - - - PV 27 - - 1 2 - 1 - 5 - 1 2 1 1 SGR 30 14 2 1 1 1 - - - - - - - - TO, Dipartimento di Patologia Clinica, Ospedale Infantile "Regina Margherita, Torino; PV, Istituto di Anatomia Patologica, Sezione di Anatomia Patologica, Università di Pavia, Pavia; SGR, Servizio di Genetica Medica and Divisione di Neonatologia, IRCCS Casa Sollievo della SoVerenza, San Giovanni Rotondo, Foggia.
X
ABCC7 p.Ser549Arg 10444722:46:677
status: NEW[hide] Determination of the prevalence of cystic fibrosis... Clin Genet. 1999 Jun;55(6):496-7. Frossard PM, Lestringant G, Girodon E, Goossens M, Dawson KP
Determination of the prevalence of cystic fibrosis in the United Arab Emirates by genetic carrier screening.
Clin Genet. 1999 Jun;55(6):496-7., [PMID:10450871]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
9 Mutation S549R is localized in exon 11 (TG at nucleotide 1779) and alters a DraIII restriction site.
X
ABCC7 p.Ser549Arg 10450871:9:9
status: NEW25 This analysis was carried out on DNA samples of a UAE national family in which CF alleles harbour mutation S549R (TG).
X
ABCC7 p.Ser549Arg 10450871:25:107
status: NEW[hide] Complex allele [-102T>A+S549R(T>G)] is associated ... Hum Genet. 1999 Jul-Aug;105(1-2):145-50. Romey MC, Guittard C, Chazalette JP, Frossard P, Dawson KP, Patton MA, Casals T, Bazarbachi T, Girodon E, Rault G, Bozon D, Seguret F, Demaille J, Claustres M
Complex allele [-102T>A+S549R(T>G)] is associated with milder forms of cystic fibrosis than allele S549R(T>G) alone.
Hum Genet. 1999 Jul-Aug;105(1-2):145-50., [PMID:10480369]
Abstract [show]
We recently reported a novel complex allele in the cystic fibrosis transmembrane regulator (CFTR) gene, combining a sequence change in the minimal CFTR promoter (-102T>A) and a missense mutation in exon 11 [S549R(T>G)]. Here we compare the main clinical features of six patients with cystic fibrosis (CF) carrying the complex allele [-102T>A+S549R(T>G)] with those of 16 CF patients homozygous for mutation S549R(T>G) alone. Age at diagnosis was higher, and current age was significantly higher (P=0.0032) in the group with the complex allele, compared with the S549R/S549R group. Although the proportion of patients with lung colonization was similar in both groups, the age at onset was significantly higher in the group with the complex allele (P=0.0022). Patients with the complex allele also had significantly lower sweat test chloride values (P=0.0028) and better overall clinical scores (P=0.004). None of the 22 patients reported in this study had meconium ileus. All 16 patients homozygous for S549R(T>G), however, were pancreatic insufficient, as compared with 50% of patients carrying the complex allele (P=0.013). Moreover, the unique patient homozygous for [-102T>A+S549R(T>G)] presented with a mild disease at 34 years of age. These observations strongly suggest that the sequence change (-102T>A) in the CFTR minimal promoter could attenuate the severe clinical phenotype associated with mutation S549R(T>G).
Comments [show]
None has been submitted yet.
No. Sentence Comment
2 Age at diagnosis was higher, and current age was significantly higher (P = 0.0032) in the group with the complex allele, compared with the S549R/S549R group.
X
ABCC7 p.Ser549Arg 10480369:2:139
status: NEWX
ABCC7 p.Ser549Arg 10480369:2:145
status: NEW23 In order to better understand the discrepancy between the phenotypes presented by patients carrying mutation S549R, we have conducted a collaborative study aimed at comparing ethnic, clinical, and genetic data from patients with this mutation.
X
ABCC7 p.Ser549Arg 10480369:23:109
status: NEW49 Almost all patients carrying the double mutant allele, who have been investigated so far, have a mild to moder- 146 Table 1 Clinical characteristics of 16 patients homozygous for the S549R(T>G) mutation (UAE United Arab Emirates, ND no data) Characteristic Patient D1 D2 D3 D4 D5 D6 D7 D8 D9 D10 D11 D12 D13 D14 D15 D16 Genotype S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R Geographic background Oman UAE UAE UAE UAE UAE UAE UAE UAE UAE UAE UAE UAE UAE UAE UAE Ethnic background Arab Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Gender F F M F F F F M M F M F F F M M Current age (years) - 4 9 - 12 8.5 5 3 7 2 10 5 3 2 - 2 Age at death 5 months - - 6.5 years - - - - - - - - - - 5 months - Age at diagnosis 3 months 6 months 2 years 1 year 4 months 8 months 8 months 3 months 3.5 years 3 months 3 years 1 year 3 months 3 months 1 month 1 month Sweat Cl- (mmol/l) 70 120 123 155 133 100 150 120 150 100 120 90 90 120 ND ND Height (percentile) ND 10 5 5 5 25 25 ND ND ND ND ND ND ND ND ND Weight (percentile) >3 5 5 5 5 10 25 ND ND ND ND ND ND ND ND ND Shwachman- ND 60 55 45 50 55 40 55 45 55 45 60 55 45 35 50 Kulczycki score Lung colonization Yes No Yes Yes Yes Yes Yes No No Yes Yes Yes Yes Yes Yes Yes Pseudomonas aerug.
X
ABCC7 p.Ser549Arg 10480369:49:330
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:336
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:342
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:348
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:354
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:360
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:366
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:372
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:378
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:384
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:390
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:396
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:402
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:408
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:414
status: NEWX
ABCC7 p.Ser549Arg 10480369:49:420
status: NEW67 Discussion Mutation S549R is a serine to arginine change resulting from a T to G substitution at nucleotide 1779, a site included in a six-amino acid region defined as "C consensus", which appears to be a unique feature of the ABC transporter superfamily (reviewed by Ko and Pedersen 1997).
X
ABCC7 p.Ser549Arg 10480369:67:20
status: NEW70 S549R was originally considered as a "severe" mutation with respect to PI.
X
ABCC7 p.Ser549Arg 10480369:70:0
status: NEW[hide] Geographic distribution of cystic fibrosis transme... Ann Trop Paediatr. 1999 Mar;19(1):69-73. Banjar H, Kambouris M, Meyer BF, al-Mehaidib A, Mogarri I
Geographic distribution of cystic fibrosis transmembrane regulator gene mutations in Saudi Arabia.
Ann Trop Paediatr. 1999 Mar;19(1):69-73., [PMID:10605524]
Abstract [show]
A descriptive study was undertaken to characterize the cystic fibrosis transmembrane regulator gene mutations (CFTR) in the Saudi Arabian cystic fibrosis (CF) population in relation to clinical presentation and demographic and ethnic origin. During the period October 1992 to September 1997, 70 patients from 46 families were diagnosed as having CF, based on a typical clinical picture and sweat chloride levels > 60 mmol/l and were screened for CFTR mutations. Twelve mutations were identified in 34 families, which constitutes 70% of the CF alleles in the study group. Pancreatic insufficiency (PI) was found in the following mutations: 1548delG in exon 10 (15%) which occurred mainly in native Saudi patients in the central province; 3120 + 1G-->A in intron 16 (10%) and H139L in exon 4 (7%), found mainly in native Saudis from the eastern province; delta F508 mutation (13%) which occurred mainly in expatriates of Middle Eastern origin from different provinces; L117X in exon 19 (2%); G115X in exon 4 (2%); 711 + 1G-->A in intron 5 (2%); N 1303K in exon 21 (2%) and 425del42 in exon 4 (1%); I1234V in exon 19 (13%) with a predominance of nasal polyps and a variable degree of PI and lung disease; R553X in exon 11 (1%), with electrolyte imbalance; and S549R in 11 (2%) with pancreatic sufficiency and minimal pulmonary disease. The clinical picture did not differ significantly between patients of different ethnic origins with the same CFTR mutation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
4 Pancreatic insuf® ciency (PI) was found in the following mutations: 1548delG in exon 10 (15%) which occurred mainly in native Saudi patients in the central province; 3120 1 1G ® A in intron 16 (10%) and H139L in exon 4 (7%), found mainly in native Saudis from the eastern province; D F508 mutation (13%) which occurred mainly in expatriates of Middle Eastern origin from different provinces; L117X in exon 19 (2%); G115X in exon 4 (2%); 7111 1G ® A in intron 5 (2%); N 1303K in exon 21(2%) and 425del42 in exon 4 (1%); I1234V in exon 19 (13%) with a predominance of nasal polyps and a variable degree of PI and lung disease; R553X in exon 11 (1%), with electrolyte imbalance; and S549R in 11 (2%) with pancreatic suf® ciency and minimal pulmonary disease.
X
ABCC7 p.Ser549Arg 10605524:4:695
status: NEW30 1 Sa E 1 1 8 Total 14 Total 15 Total Exon 19 L1177X 1 NonSa W 2 2 PI, PU Exon 10 D F508 2 Sa C 4 4 PI, PU 1/1/1 NonSa W/E/C 2/2/2 2/2/2 5 Total 10 Total 10% Total Exon 11 S549R 1 Sa E 2 2 PS Exon 11 553X/31201 1G ® A* 1 NonSa W 1 1 EL Intron 16 31201 1G ® A 3 Sa E 6 7 PI, PU 31201 1G ® A/?
X
ABCC7 p.Ser549Arg 10605524:30:171
status: NEW44 S549R was found in one family with pancreatic suf® ciency (PS) and minimal chest symptoms.
X
ABCC7 p.Ser549Arg 10605524:44:0
status: NEW[hide] Cystic fibrosis mutations lead to carboxyl-termina... J Biol Chem. 2000 Jun 30;275(26):19577-84. Van Oene M, Lukacs GL, Rommens JM
Cystic fibrosis mutations lead to carboxyl-terminal fragments that highlight an early biogenesis step of the cystic fibrosis transmembrane conductance regulator.
J Biol Chem. 2000 Jun 30;275(26):19577-84., 2000-06-30 [PMID:10764788]
Abstract [show]
Inefficient delivery of the cystic fibrosis transmembrane conductance regulator (CFTR) to the surface of cells contributes to disease in the majority of cystic fibrosis patients. Analysis of cystic fibrosis-associated missense mutations in the first nucleotide binding domain (NBD1), including A455E, S549R, Y563N, and P574H, revealed reduced levels of mature CFTR with elevated levels of carboxyl-terminal polypeptide fragments of 105 and 90 kDa. These fragments appear early in biogenesis and degrade rapidly in four distinct cell types tested including the bronchial epithelial IB3-1 cell line. They were detected at highest levels with CFTRA455E where the 105-kDa fragment accounted for 40% of newly synthesized polypeptide but for only 20 and 7% of nascent wild type and mutant DeltaF508 proteins, respectively. The bands represent core- and unglycosylated forms of the same CFTR fragment supporting that precursor forms are correctly inserted into the membrane of the endoplasmic reticulum. Proteolytic cleavage would be predicted to occur on the cytosolic face of the endoplasmic reticulum within the NBD1-R domain segment, but pharmacological testing did not support involvement of the 26 S proteasome. The examined missense mutations in NBD1 manifest differently than the major mutant, DeltaF508, and highlight a critical conformational aspect of biogenesis of CFTR.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 Analysis of cystic fibrosis-associated missense mutations in the first nucleotide binding domain (NBD1), including A455E, S549R, Y563N, and P574H, revealed reduced levels of mature CFTR with elevated levels of carboxyl-terminal polypeptide fragments of 105 and 90 kDa.
X
ABCC7 p.Ser549Arg 10764788:1:122
status: NEW41 EXPERIMENTAL PROCEDURES Construction of CFTR Expression Plasmids-The CFTR mutants A455E, S549R, P574H, and Y563N were generated from pBQ6.2 (34) as described previously (35).
X
ABCC7 p.Ser549Arg 10764788:41:89
status: NEW84 Analysis of the S549R mutant showed measurable but intermediate levels of band C, whereas A455E, Y563N, and P574H mutants showed markedly reduced levels using both tagged and untagged CFTR.
X
ABCC7 p.Ser549Arg 10764788:84:16
status: NEW90 Consistent with the observed steady state glycosylation pattern, CHA-S549R shows both cell surface and ER-like staining.
X
ABCC7 p.Ser549Arg 10764788:90:69
status: NEW92 Identification of Carboxyl CFTR Derivatives-In addition to full-length CFTR forms, both the M3A7 and the anti-HA antibodies revealed products with relative molecular masses of 105 and 90 kDa that were most prominent in detergent extracts of HEK293 cells expressing the A455E and S549R mutants (Fig. 1, B and C, lanes 4 and 5).
X
ABCC7 p.Ser549Arg 10764788:92:279
status: NEW105 Representative COS-7 cells transfected with (A) CHA-CFTRwt, (B) CHA-⌬F508, (C) CHA-A455E, and (D) CHA-S549R are shown.
X
ABCC7 p.Ser549Arg 10764788:105:109
status: NEW107 CHA-S549R also shows obvious cell surface staining consistent with the mature protein identified in immunoblot analyses.
X
ABCC7 p.Ser549Arg 10764788:107:4
status: NEW157 Results with CHA-S549R at steady state expression are shown (Fig. 6) as the 105-and 90-kDa intermediates as well as both core-and complex-glycosylated full-length protein forms are detectable.
X
ABCC7 p.Ser549Arg 10764788:157:17
status: NEW158 The treatment of CHA-S549R with N-glycosidase F (left panel) shifted both complex-glycosylated (band C) and core-glycosylated (band B) CFTR to the unglycosylated form (band A), as expected.
X
ABCC7 p.Ser549Arg 10764788:158:21
status: NEW159 Digestion with endoglycosidase H (right panel) removed only the high mannose-type asparagine-linked glycans from the band B form of CHA-S549R with minimal effect on band C forms of the protein (18, 46).
X
ABCC7 p.Ser549Arg 10764788:159:136
status: NEW181 It is imposed on the wt protein but is more prominent in the presence of missense mutations such as A455E or S549R.
X
ABCC7 p.Ser549Arg 10764788:181:109
status: NEW193 RIPA soluble protein extracts of CHA-S549R were treated with N-glycosidase F (N-Glyc F) and endoglycosidase H (Endo H).
X
ABCC7 p.Ser549Arg 10764788:193:37
status: NEW209 It would therefore be interesting to closely examine its interaction with the S549R and A455E CFTR mutants.
X
ABCC7 p.Ser549Arg 10764788:209:78
status: NEW228 The proximity of the amino acid deletion to a proteolytic site may account for this; however, analysis of cells expressing CFTR versions with both the ⌬F508 mutation and either S549R or A455E mutations retain the formation of prominent levels of the carboxyl-terminal fragments (data not shown).
X
ABCC7 p.Ser549Arg 10764788:228:184
status: NEW235 In attempting to correlate the abundance of the carboxyl degradation bands with the formation of band C, it was evident from the S549R mutation that moderate levels of complex-glycosylated CFTR can be generated even though the production of 90- and 105-kDa products is prominent.
X
ABCC7 p.Ser549Arg 10764788:235:129
status: NEW[hide] Identification of cystic fibrosis mutations in Oma... Clin Genet. 2000 Mar;57(3):235-6. Frossard PM, Dawson KP, Das SJ, Alexander PC, Girodon E, Goossens M
Identification of cystic fibrosis mutations in Oman.
Clin Genet. 2000 Mar;57(3):235-6., [PMID:10782933]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
23 Distribution by ethnicity and by ethnic origins of CF patients and families that were recruited for this study on the population of Oman, and number of alleles carrying either of the two mutations, S549R (TG) and DF508 Ethnic origin No. of families No. of patients No. of CF allelesMutation Bedouin descent 1312 22/26S549R(TG) DF508 4/633Baluch origin have other CFTR mutations that have not yet been identified; their sweat chlorides, however, were lower (90-117 mmol/l) and their ages ranged between 3 and 8 years.
X
ABCC7 p.Ser549Arg 10782933:23:198
status: NEW[hide] Identification of novel mutations in Arabs with cy... Eur J Pediatr. 2000 May;159(5):303-9. Kambouris M, Banjar H, Moggari I, Nazer H, Al-Hamed M, Meyer BF
Identification of novel mutations in Arabs with cystic fibrosis and their impact on the cystic fibrosis transmembrane regulator mutation detection rate in Arab populations.
Eur J Pediatr. 2000 May;159(5):303-9., [PMID:10834512]
Abstract [show]
The cystic fibrosis transmembrane regulator (CFTR) gene in Arab patients with cystic fibrosis (CF) (sweat chloride > 60 mmol/l) from 61 unrelated families was screened for mutations in exons 3, 4, 5, 7, 10, 11, 16 and 19 and for mutations W1282X, N1303K and 3,849 + 10kbC --> T. Eight novel mutations were identified. These are: in exon 4: a) 425del42 (an in-frame 42 bp deletion that removes 14 amino acids and causes Gln98 --> His at the point of deletion), b) 475G --> T (Glu115 --> Stop) and c) 548A --> T (His139 --> Leu); in intron 5,711 + 1G --> A (splice site mutation); in exon 10, 1548delG (deletion of a "G" nucleotide causing a frameshift mutation that alters the amino acid sequence at residue 473 and results in translation termination at residue 526); in exon 11, a) 1729T --> C (Ph533E --> Leu) and b) 1,811 + 2 (splice site mutation) and finally in exon 19,3361A --> T (Lys1177 --> Stop). All mutations were detected by heteroduplex analysis and identified by sequencing. Of more than 850 known CFTR mutations, only 9 were encountered. The comparative frequencies of the most common mutations are: 1548delG> 1123V = deltaF508 = 3,120 + 1G --> A > H139L. Screening for these five mutations identifies 60% of the CF alleles in Arab populations. The novel mutation 1548delG is the most frequent (17%) among Arabs. CONCLUSION: Novel Arab-specific mutations were identified in the CFTR gene underlying cystic fibrosis. As a result of this study, the CFTR mutation detection rate among Arabs with cystic fibrosis is now comparable to that of other populations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
63 Of more than 850 known CFTR mutations (http:// www.genet.sickkids.on.ca/cftr-cgi-bin/Mutation Table), only 9 were encountered in this study: R75X, A141D, 1249G ® A, DF508, S549R, R553X, 3120 + 1G ® A, I1234V and N1303K.
X
ABCC7 p.Ser549Arg 10834512:63:177
status: NEW109 1 (private mutation) 475G ® T G115X ± protein truncation 1 2 1a [I1234V] 1 Total: 2 2.5% 536C ® T A141D 1 2 (private mutation) 548A ® T H139L 3 6 1a [S549R] 1 Total: 4 6% Exon 5 711 + 1G ® A Splice site 1 2 1a [?]
X
ABCC7 p.Ser549Arg 10834512:109:170
status: NEW114 1 (private mutation) 1779T ® G S549R 1 2 1a [H139L] 1 Total: 2 2.5% 1789C ® T R553X ± protein truncation 1a [3120 + 1G ® A] 1 (private mutation) 1811 + 2T ® C Splice site 1a [1548delG] 1 (private mutation) Exon 16 3120 + 1G ® A Splice site 5 10 1a [R533X] 1 1a [N1303K] 1 1a [?]
X
ABCC7 p.Ser549Arg 10834512:114:36
status: NEW[hide] Genotype-phenotype correlations in cystic fibrosis... Eur Respir J. 1999 Jan;13(1):100-2. Frossard PM, Hertecant J, Bossaert Y, Dawson KP
Genotype-phenotype correlations in cystic fibrosis: clinical severity of mutation S549R(T-->G).
Eur Respir J. 1999 Jan;13(1):100-2., [PMID:10836331]
Abstract [show]
With a view to assessing genotype-to-phenotype correlations in cystic fibrosis (CF), the clinical presentation of CF children from the United Arab Emirates (UAE) who were homozygous for cystic fibrosis transmembrane conductance regulator (CFTR) mutation S549R(T-->G was investigated. This mutation is localized in intron 11 (nucleotide binding domain 1 of the CFTR protein) and had so far been described as a private mutation only. The associations between the R549/R549 genotype and 20 outcome variables, including age at diagnosis, sweat chloride concentrations, growth percentiles, meconium ileus, pancreatic sufficiency, pulmonary disease, associated complications and micro-organism colonization were examined in a group of 15 CF children (9 females and 6 males). Mean current age and age at diagnosis were both low (5.4+/-3.5 and 1.0+/-1.1 yrs, respectively). Although none of the 15 CF patients had presented with meconium ileus at birth, all were pancreatic insufficient and had very severe lung disease, with a high rate of Pseudomonas aeruginosa and Staphylococcus aureus. Two patients died during the course of this investigation (one was 5 months and the other, 6 yrs old). The clinical presentation associated with S549R(T-->G) homozygosity in the United Arab Emirates is quite homogeneous and shows an extreme degree and course of cystic fibrosis severity.
Comments [show]
None has been submitted yet.
No. Sentence Comment
21 In this report, the clinical characteristics that are associated with this mutation in a group of 15 CF patients who are homozygous for S549R are presented.
X
ABCC7 p.Ser549Arg 10836331:21:136
status: NEW38 CFTR S549R mutation analysis Deoxyribonucleic acid (DNA) was extracted from leukocytes isolated from 2±5 mL of the subject's venous blood collected in ethylenediaminetetraacetic acid (EDTA) tubes according to standard protocols [17].
X
ABCC7 p.Ser549Arg 10836331:38:5
status: NEW39 The detection of mutation S549R localized in exon 11 (T?G at nucleotide 1779) was performed routinely by DraIII restriction endonuclease analysis of exon 11 polymerase chain reaction (PCR) products, and the mutation was confirmed by sequencing analysis according to protocols and conditions that have been described elsewhere [14].
X
ABCC7 p.Ser549Arg 10836331:39:26
status: NEW40 Results The clinical presentation of 15 CF children (6 males and 9 females) who were homozygous for mutation S549R wasdetermined.Theclinicaldescriptionofthepooledgroup of patients is presented in table 1.
X
ABCC7 p.Ser549Arg 10836331:40:109
status: NEW49 Discussion S549R is a missense mutation that was first reported in 1989 by KEREM et al.
X
ABCC7 p.Ser549Arg 10836331:49:11
status: NEW50 [18] in a Moroccan Jewish individual who was a compound heterozygote S549R/DF508.
X
ABCC7 p.Ser549Arg 10836331:50:69
status: NEW53 [19] screened 105 mutations in 600 CF patients from France and identified one S549R homozygote.
X
ABCC7 p.Ser549Arg 10836331:53:78
status: NEW63 Previous work [14] by the authors indicated that all CF patients of Bedouin origin that have been investigated so far were homozygous for S549R (T?G), which led to the hypothesis that the mutation is the result of a founder effect that occurred in an ancestral Bedouin tribe.
X
ABCC7 p.Ser549Arg 10836331:63:138
status: NEW64 Although S549R has been described elsewhere as a private mutation only, the uniquely high number of homozygotes in the UAE allowed us to evaluate the overall clinical presentation that is associated with S549R.
X
ABCC7 p.Ser549Arg 10836331:64:9
status: NEWX
ABCC7 p.Ser549Arg 10836331:64:204
status: NEW65 This data indicates that S549R is a very severe mutational allele.
X
ABCC7 p.Ser549Arg 10836331:65:25
status: NEW70 Sweat chloride concentrations associated with S549R homozygosity were high, even at very young ages (mean sweat chloride levels in the group of 15 patients were 12021 mEq.L-1 ).
X
ABCC7 p.Ser549Arg 10836331:70:46
status: NEW75 An interesting feature of the clinical presentation associated with S549R in the UAE is that none of the 15 homozygous patients had presented with meconium ileus at birth.
X
ABCC7 p.Ser549Arg 10836331:75:68
status: NEW88 Detection of the S549R mutation is thus imperative in these cystic fibrosis children, as aggressive treatment and management modalities should be instigated as soon as possible in order to increase the patient's chances of survival.
X
ABCC7 p.Ser549Arg 10836331:88:17
status: NEW[hide] Heterogeneity for mutations in the CFTR gene and c... Hum Reprod. 2000 Jul;15(7):1476-83. Casals T, Bassas L, Egozcue S, Ramos MD, Gimenez J, Segura A, Garcia F, Carrera M, Larriba S, Sarquella J, Estivill X
Heterogeneity for mutations in the CFTR gene and clinical correlations in patients with congenital absence of the vas deferens.
Hum Reprod. 2000 Jul;15(7):1476-83., [PMID:10875853]
Abstract [show]
Congenital absence of the vas deferens (CAVD) is a heterogeneous disorder, largely due to mutations in the cystic fibrosis (CFTR) gene. Patients with unilateral absence of the vas deferens (CUAVD) and patients with CAVD in association with renal agenesis appear to have a different aetiology to those with isolated CAVD. We have studied 134 Spanish CAVD patients [110 congenital bilateral absence of the vas deferens (CBAVD) and 24 CUAVD], 16 of whom (six CBAVD, 10 CUAVD) had additional renal anomalies. Forty-two different CFTR mutations were identified, seven of them being novel. Some 45% of the CFTR mutations were specific to CAVD, and were not found in patients with cystic fibrosis or in the general Spanish population. CFTR mutations were detected in 85% of CBAVD patients and in 38% of those with CUAVD. Among those patients with renal anomalies, 31% carried one CFTR mutation. Anomalies in seminal vesicles and ejaculatory ducts were common in patients with CAVD. The prevalence of cryptorchidism and inguinal hernia appeared to be increased in CAVD patients, as well as nasal pathology and frequent respiratory infections. This study confirms the molecular heterogeneity of CFTR mutations in CAVD, and emphasizes the importance of an extensive CFTR analysis in these patients. In contrast with previous studies, this report suggests that CFTR might have a role in urogenital anomalies.
Comments [show]
None has been submitted yet.
No. Sentence Comment
98 Vasograms performed in six patients with CUAVD E92K/- 5T/7T 1 not only confirmed ultrasonographic findings, but also showed 711ϩ1G→T/- 5T/7T 1 additional abnormalities at various levels of the seminal tract.R334W/- 5T/7T 1 S549R/- 5T/7T 1 The volume and consistency of testes was normal, except in 1949del84/- 5T/7T 1 patients with other concomitant pathologies, such as crypt- K1060T/- 5T/7T 1 orchidism (n ϭ 6), trauma (n ϭ 2), orchitis (n ϭ 2) orR1162X/- 5T/7T 1 S1235R/- 5T/7T 1 tumour (n ϭ 1).
X
ABCC7 p.Ser549Arg 10875853:98:236
status: NEW[hide] Prenatal detection by real-time quantitative PCR a... Clin Chem. 2000 Sep;46(9):1417-20. Costes B, Girodon E, Vidaud D, Flori E, Ardalan A, Conteville P, Fanen P, Niel F, Vidaud M, Goossens M
Prenatal detection by real-time quantitative PCR and characterization of a new CFTR deletion, 3600+15kbdel5.3kb (or CFTRdele19).
Clin Chem. 2000 Sep;46(9):1417-20., [PMID:10973878]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 The mutations tested were S549N, S549R, R553X, G551D, V520F, ⌬I507, ⌬F508, Q493X, 1717-1G3A, G542X, R560T, R347P, R347H, 3849ϩ4A3G, W1282X, R334W, 1078delT, 3849ϩ10kbC3T, R1162X, N1303K, 3659delC, 3905insT, A455E, R117H, Y122X, 2183AA3G, 2789ϩ5G3A, 1898ϩ1G3A, 621ϩ1G3T, 711ϩ1G3T, and G85E.
X
ABCC7 p.Ser549Arg 10973878:51:33
status: NEW[hide] Mild clinical phenotype associated with R1158X/S54... Clin Genet. 2000 Aug;58(2):147-9. Frossard PM, Abdelaziz SA, Hertecant J, Girodon E, Goossens M, Dawson KP
Mild clinical phenotype associated with R1158X/S549R(T-->G) CFTR genotype.
Clin Genet. 2000 Aug;58(2):147-9., [PMID:11005149]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
8 Moreover, the clinical presentation associated with S549R homozygosity is quite homogeneous and shows an extreme degree and course of CF severity - at least as much as those associated with DF508 (5, 6).
X
ABCC7 p.Ser549Arg 11005149:8:52
status: NEW9 We report here the identification of the first compound heterozygote patient in the UAE, who harbours mutations S549R/R1158X in his CFTR gene.
X
ABCC7 p.Ser549Arg 11005149:9:112
status: NEW[hide] Unilateral renal agenesis associated with congenit... Hum Reprod. 2001 Feb;16(2):282-8. McCallum T, Milunsky J, Munarriz R, Carson R, Sadeghi-Nejad H, Oates R
Unilateral renal agenesis associated with congenital bilateral absence of the vas deferens: phenotypic findings and genetic considerations.
Hum Reprod. 2001 Feb;16(2):282-8., [PMID:11157821]
Abstract [show]
An association between congenital bilateral absence of the vas deferens (CBAVD), normal renal anatomy and cystic fibrosis (CF) gene mutations is well established (CF/CBAVD). We postulate that unilateral renal agenesis (URA) and CBAVD (URA/CBAVD) may have a non-CF mutation-mediated genetic basis that leads to abnormal development of the entire mesonephric duct at a very early stage in embryo development (< or =7 weeks). The physical, laboratory and radiographic findings of men with URA/CBAVD (n = 17) and CF/CBAVD (n = 97) were compared; the fertilization and pregnancy rates in the URA/CBAVD population calculated, and the incidence of renal agenesis in immediate family members and offspring of men with URA/CBAVD analysed. No statistical differences could be identified within any of the above comparisons. The fertilization rate for the URA/CBAVD group was 58.2 +/- 26.3%. Eight infants and two fetuses had normal renal anatomy, while one terminated male fetus had bilateral renal and vasal agenesis. Thirty first-order relatives had normal renal units. Anatomical expression of the reproductive ductal derivatives in men with URA/CBAVD and CF/CBAVD was similar, but the phenotypic outcome of the renal portion of the mesonephric duct was different. The potential for transmission of this fatal anomaly reinforces the need for prenatal ultrasounds with all pregnancies involving URA/CBAVD men.
Comments [show]
None has been submitted yet.
No. Sentence Comment
61 ThereW1282X; ∆F508; R553X; N1303K; 3849ϩ10 kb C-T; R117L; I506; R553G; R560K; 1811ϩ1G-C; 1774delCT; S549R; S549I; R1283K; were no significant correlations with ethnic origin.
X
ABCC7 p.Ser549Arg 11157821:61:119
status: NEW[hide] Prevalence of cystic fibrosis mutations in Israeli... Genet Test. 2001 Spring;5(1):47-52. Orgad S, Neumann S, Loewenthal R, Netanelov-Shapira I, Gazit E
Prevalence of cystic fibrosis mutations in Israeli Jews.
Genet Test. 2001 Spring;5(1):47-52., [PMID:11336401]
Abstract [show]
The aim of this study was to evaluate the screening policies of cystic fibrosis (CF) in the Jewish population. The prevalence of mutations that account for CF in Israel have been defined in the past by determining the frequency of CF mutations in affected individuals. This study is a population-based study and is, therefore, different from previous patient-based studies. We found that the CF mutations D1152H, W1089X, and 405 + IG-->A were present in some ethnic groups in which no CF patients carrying these mutations were reported. These facts necessitate a reevaluation of the screening policy regarding the ethnic groups in Israel. We studied 9,430 healthy Jewish Israeli individuals of 36 countries of origin. The prevalence of CF mutations was 1:19, 1:19, 1:28, and 1:42 for the Ashkenazi, Sephardi, North African, and Eastern Jews, respectively. CF mutations were identified in 374 (4.0%) individuals. These included 173 (46.3%) carriers of the W1282X mutation; 110 (29.4%) found to carry delF508; 23 (6.1%) who carried G542X; 22 (5.9%) who carried 3849 + 10Kb (C-->T; 20 (5.3%) who carried D1152H; 10 (2.7%) who carried N1303K; 11 (2.9%) who carried 405 + IG-->A; 4 (1.1%) who carried W1089X; and one (0.3%) who carried S549R. No carriers were detected for the 1717-1G-->A, G85E, and T360K mutations, which were tested for in 7,383, 1,558, and 41 individuals, respectively.
Comments [show]
None has been submitted yet.
No. Sentence Comment
33 These were: delF508 (Kerem et al., 1989), W1282X (Vidaud et al., 1990), G542X, 1717-1G R A, S549R (Kerem et al., 1990), N1303K (Osborn et al., 1991), 3849 1 10Kb C R T (Highsmith et al., 1994), T359K/Q360K (Shoshani et al., 1992), G85E (Zielenski et al., 1991), 405 1 1G R A (Dork et al., 1993), W1089X (Shosani et al., 1994), and D1152H (Highsmith et al., 1993).
X
ABCC7 p.Ser549Arg 11336401:33:92
status: NEW40 THE CONSENSUS POLICY OF SCREENING OF CF MUTATIONS IN ETHNIC GROUPS OF ISRAELI JEWSa Buchara and Iran Georgia Libya Morocco Tunis Turkey Egypt Sephardi W1089X 1 1 1 G85E 1 1 405-1 G® A 1 1 1 S549R 1 1 D1152H 1 1 1 1 T360K 1 Individuals of all ethnic groups were screened for the mutations W1282X, delF508, G5429X, N1303K, 3849110Kb C® T and 1717-1G® A.
X
ABCC7 p.Ser549Arg 11336401:40:195
status: NEW45 There were 173 (46.3%) carriers of the W1282X mutation; 110 (29.4%) carriers of delF508; 23 (6.1%) carriers of G542X; 10 (2.7%) carriers of N1303K; and 22 (5.9%) carriers of 3849 1 10KbC R T. Twenty (5.3%) were found to carry D1152H; 11 (2.9%) carried 405 1 1G R A; 4 (1.1%) carried W1089X; and 1 (0.3%) carried S549R. No carriers were detected for the mutations 1717-1G R A, G85E, and T360K, which were tested for in 7,383, 1,436, and 41 individuals, respectively.
X
ABCC7 p.Ser549Arg 11336401:45:312
status: NEW52 Mutations tested for all individuals in the cohort North Total Ashkenazi Sephardi Africa Eastern number of Mutation no. 6850 no. 933 no. 1146 no. 468 carriers W1282X 142 17 8 6 173 delF508 86 12.25 11.5 0.25 110 G542X 20.25 0.5 1.75 0.5 23 N1303K 7.5 1.5 0.25 0.75 10 3849110Kb 17 2 2 1 22 C® T B. Mutations tested for individuals of non-Ashkenazi origin, mixed origin, and of spouses of carriers Type of Total number mutation Number tested Ashkenazi Sephardi North Africa Eastern of carriers D1152H Number tested 1,305 458.25 722.75 280 Carriers 11.5 4.5 3.5 0.5 20 405 Number tested 425.75 372 633.5 119 11G® A Carriers 0.5 1 9.5 0 11 W1089X Number tested 539.25 345 638.5 135 Carriers 2 0.5 1 0.5 4 S549R Number tested 534.5 385.5 686 110 Carriers 0 1 0 0 1 a Ethnic origin was classified according to the country of origin of the four grandparents of each individual. Each grandparent was calculated as contributing a quarter of his/her gene pool and these were summed up for each ethnic origin.
X
ABCC7 p.Ser549Arg 11336401:52:712
status: NEW91 One might reconsider the cost effectiveness of testing for infrequent mutations such as 1717-1G R A, W1089X, S549R, and G85E when screening the general Jewish population.
X
ABCC7 p.Ser549Arg 11336401:91:109
status: NEW[hide] The S549R (T-->G) cystic fibrosis gene mutation. J Trop Pediatr. 2001 Aug;47(4):196-8. Dawson KP, Frossard PM
The S549R (T-->G) cystic fibrosis gene mutation.
J Trop Pediatr. 2001 Aug;47(4):196-8., [PMID:11523757]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
2 Among the several mutations that have been described in exon 11 of the CFTR is S549R (T➝G).
X
ABCC7 p.Ser549Arg 11523757:2:79
status: NEW5 Serine is a highly conserved amino acid in this important binding domain and its replacement by an arginine residue is expected to result in a severe chloride dysfunction and hence severe clinical disease.4 S549R is defined as a Class II mutation.5-8 These are associated with defective protein processing.
X
ABCC7 p.Ser549Arg 11523757:5:207
status: NEW12 The existence of the mutation S549R (T➝G), was first reported to the Cystic Fibrosis Genetic Analysis Consortium on 9th February 1990 by Kerem and Tsui.2 The individual who carried the CF chromosome was a non-Ashkenazi Jewish patient from Morocco who also carried the ∆F508 mutation on the other allele.4 Further reference to this and one other Moroccan patient was made by Kerem, et al.9 who studied cystic fibrosis mutations in Jewish communities.
X
ABCC7 p.Ser549Arg 11523757:12:30
status: NEW14 S549R was found only in these two patients from Morocco and it thus accounted for 6 per cent of the identified Jewish CF patients from that country.
X
ABCC7 p.Ser549Arg 11523757:14:0
status: NEW15 There have been four separate mutations described in codon 549, namely S549R (A➝C), S549I, S549R (T➝G), and S549N2 (codons = triplet codes for each amino acid).
X
ABCC7 p.Ser549Arg 11523757:15:71
status: NEWX
ABCC7 p.Ser549Arg 11523757:15:98
status: NEW16 A study of 27 177 CF chromosomes from 29 European and three north African countries showed that of the 272 mutations examined, S549R occurred on 12 occasions (0.04 per cent) and the S549N on 16 occasions (0.059 per cent).
X
ABCC7 p.Ser549Arg 11523757:16:127
status: NEW17 Interestingly, despite its general rarity, the S549R mutation accounted for 2.6 per cent of all mutations in Algeria.3 However, a recent detailed study of 10 Algerian CF families revealed no patients with a mutation on exon 11.10 Another important report in the literature regarding the S549R mutation is from Saudi Arabia.
X
ABCC7 p.Ser549Arg 11523757:17:47
status: NEWX
ABCC7 p.Ser549Arg 11523757:17:287
status: NEW21 However, El-Harith, et al.13 investigated 15 Arab children from 12 Occasional Review The S549R (T➝G) Cystic Fibrosis Gene Mutation by K. P. Dawson and P. M. Frossard Departments of Paediatrics and Pathology, Faculty of Medicine and Health Sciences, UAE University,Al Ain, United Arab Emirates Correspondence: Professor K. P. Dawson, Chairman, Department of Paediatrics, Faculty of Medicine and Health Sciences, PO Box 17666, Al Ain, United Arab Emirates.
X
ABCC7 p.Ser549Arg 11523757:21:89
status: NEW26 No examples of S549R were detected and it is of significance that the families studied were all from the eastern region from where the one previous Saudi patient with S549R had been identified.
X
ABCC7 p.Ser549Arg 11523757:26:15
status: NEWX
ABCC7 p.Ser549Arg 11523757:26:167
status: NEW27 While studying patients with CF in the United Arab Emirates (UAE), it became apparent that the otherwise common CF mutation, ∆F508, was mostly found in those belonging to the minority Baluch ethnic group, while it was absent in the majority Bedouin population.14 Overall in the UAE, those who are homozygous for the mutation S549R (T➝G) account for over 90 per cent of all patients with CF.
X
ABCC7 p.Ser549Arg 11523757:27:332
status: NEW28 Only one example of a heterozygote has been encountered and this patient had a mild phenotype and a genotype R1158X/S549R (T➝G).
X
ABCC7 p.Ser549Arg 11523757:28:116
status: NEW30 The study of 15 Bedouin families with CF revealed that they were all homozygous for the S549R (T➝G) mutation.14 In a genotype-phenotype correlation with assessment based upon 20 outcome variables, it was apparent that in the homozygous state this mutation leads to a severe disease presentation with pancreatic insufficiency, early severe lung disease, and early colonization with Pseudomonas aeruginosa.15 Further radiological assessment of this group confirmed the association of extreme lung disease and rapid pulmonary decline in those patients homozygous for the mutation.16 To establish the carrier rate of the S549R (T➝G) mutation in the UAE, a sample of 400 unrelated UAE nationals was examined.
X
ABCC7 p.Ser549Arg 11523757:30:88
status: NEWX
ABCC7 p.Ser549Arg 11523757:30:624
status: NEW31 The estimated frequency of carriers of S549R (T➝G) was determined as 1:100.17 The question then arose as to whether this was a unique finding in the UAE or whether the mutation was to be found commonly in the neighbouring Arab countries.
X
ABCC7 p.Ser549Arg 11523757:31:39
status: NEW35 The debate then arises as to the comparative severity associated with S549R (T➝G) and the ∆F508 mutation.
X
ABCC7 p.Ser549Arg 11523757:35:70
status: NEW37 We concluded that the clinical severity of S549R (T➝G) at least equates to that of homozygous ∆F508 individuals in a UAE setting (unpublished observation).
X
ABCC7 p.Ser549Arg 11523757:37:43
status: NEW39 Thus, the data from eastern Arabia points to S549R (T➝G) being a mutation causing severe clinical disease and probably as severe as found in CF.
X
ABCC7 p.Ser549Arg 11523757:39:45
status: NEW47 The -102T➝A mutation was found on the same allele with the mutation S549R (T➝G) in a compound heterozygote situation with ∆F508 in one female patient.
X
ABCC7 p.Ser549Arg 11523757:47:75
status: NEW48 A male patient had a compound heterozygote S549R (T➝G)/S945L with -102T➝A promoter mutation.
X
ABCC7 p.Ser549Arg 11523757:48:43
status: NEW50 This contrasted with the prior report that S549R was associated with severe disease.1 The French patients were not, however, homozygous for S549R, but one had a severe mutation, ∆F508, in a compound heterozygote situation.
X
ABCC7 p.Ser549Arg 11523757:50:43
status: NEWX
ABCC7 p.Ser549Arg 11523757:50:140
status: NEW[hide] Mutations of the cystic fibrosis gene in patients ... Am J Gastroenterol. 2001 Sep;96(9):2657-61. Truninger K, Malik N, Ammann RW, Muellhaupt B, Seifert B, Muller HJ, Blum HE
Mutations of the cystic fibrosis gene in patients with chronic pancreatitis.
Am J Gastroenterol. 2001 Sep;96(9):2657-61., [PMID:11569691]
Abstract [show]
OBJECTIVE: Several studies have reported an increased frequency of cystic fibrosis gene mutations in idiopathic but not in alcoholic chronic pancreatitis. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis has not been analyzed. The aim of our study was to determine the frequency of cystic fibrosis gene mutations in patients with chronic pancreatitis with long-term follow-up and to see whether patients with mutations have a clinically different natural course compared to those without mutations. METHODS: Eighty two patients with chronic pancreatitis and 11 patients with recurrent acute pancreatitis of our well defined pancreatitis cohort were screened for the 31 most common cystic fibrosis gene mutations. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis was assessed. RESULTS: A cystic fibrosis gene mutation was detected in five of 49 patients with alcoholic chronic pancreatitis (10.2%; 2.3 times the expected frequency) and in three of 14 patients with idiopathic-juvenile chronic pancreatitis (21.4%; 4.8 times the expected frequency). No mutations were found in the remaining patients with chronic pancreatitis of rare causes, hereditary pancreatitis, and recurrent acute pancreatitis. The frequency of pancreatic calcifications was significantly higher in patients with alcoholic chronic pancreatitis without mutations. This result was not confirmed in patients with idiopathic-juvenile chronic pancreatitis. The duration of pain and the frequency of exocrine and endocrine insufficiency was comparable in both subgroups irrespective of the mutation status. CONCLUSION: Our data indicate a significantly increased frequency of cystic fibrosis gene mutations both in patients with alcoholic and idiopathic-juvenile chronic pancreatitis. The natural course was similar in patients with mutations compared to those without mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
56 Using multiplex PCR, 15 genomic fragments were amplified which contain the following mutations: ⌬F508, ⌬I507, Q493X, V520F, 1717-1G3A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ϩ 10kbC3T, 3849 ϩ 4A3G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 ϩ 1G3T, R117H, Y122X, 711 ϩ 1G3T; 1078delT, R347P, R347H, R334W, A455E, 1898 ϩ 1G3A, 2183AA3G, 2789 ϩ 5G3A.
X
ABCC7 p.Ser549Arg 11569691:56:177
status: NEW[hide] Cystic fibrosis phenotype evaluation and paternity... Hum Reprod. 2001 Oct;16(10):2093-7. Josserand RN, Bey-Omar F, Rollet J, Lejeune H, Boggio D, Durand DV, Durieu I
Cystic fibrosis phenotype evaluation and paternity outcome in 50 males with congenital bilateral absence of vas deferens.
Hum Reprod. 2001 Oct;16(10):2093-7., [PMID:11574497]
Abstract [show]
BACKGROUND: Most infertile males with congenital bilateral absence of vas deferens (CBAVD) carry mutations on the cystic fibrosis transmembrane conductance regulator gene and may express mild cystic fibrosis (CF) symptoms. Barriers to paternity for these men can now be overcome by assisted reproduction. Our aims were to investigate the CF-related phenotype and clinical outcome for 50 patients with CBAVD seen at a CF adult centre between 1992 and 1999. METHODS AND RESULTS: The investigation of the patients included screening for 22 CF mutations and identification of the poly-T variant of intron 8, sweat testing, clinical investigation for CF-related extra-genital manifestations, and genetic counselling. CFTR mutations were detected on 56 alleles of the 50 patients. A total of 15 (30%) was compound heterozygote and 26 (52%) heterozygote. In all, 38% of the patients had a positive sweat test. Four patients were diagnosed with typical CF not detected previously. Twenty-one patients became fathers following ICSI (eight cases), artificial insemination by donor or IVF with sperm donor (seven cases) or through adoption (six cases). A mail survey allowed the identification of CF-related clinical symptoms. Information on the occurrence of CF-related symptoms was obtained for 58.5% of patients: in the absence of initial symptoms, no new clinical signs were reported. CONCLUSION: Patients diagnosed with CBAVD need genetic counselling before assisted reproduction. Even when no wish for paternity is expressed, CF gene screening should be associated with at least a sweat test and clinical evaluation because of possible mild forms of CF disease. Medical follow-up did not reveal any new symptoms.
Comments [show]
None has been submitted yet.
No. Sentence Comment
30 Leukocytes samples were analysed for a series of 22 CF mutations including the five most frequently encountered in our region (The CF Genotype Consortium, 1994): ∆F508, G542X, N1303K, 1717-G-A, 885E; and 17 others: R117H, R334W, R347H, R347P, 556delA, S549N, S549I, S549R, G551D, R553X, R560T, G1244E, S1255X, W1282X, R1283K, 3898ins C, D1270N.
X
ABCC7 p.Ser549Arg 11574497:30:273
status: NEW[hide] ATB(0)/SLC1A5 gene. Fine localisation and exclusio... Eur J Hum Genet. 2001 Nov;9(11):860-6. Larriba S, Sumoy L, Ramos MD, Gimenez J, Estivill X, Casals T, Nunes V
ATB(0)/SLC1A5 gene. Fine localisation and exclusion of association with the intestinal phenotype of cystic fibrosis.
Eur J Hum Genet. 2001 Nov;9(11):860-6., [PMID:11781704]
Abstract [show]
The Na+-dependent amino acid transporter named ATB(0) was previously found to be located in 19q13.3 by fluorescence in situ hybridisation. Genetic heterogeneity in the 19q13.2-13.4 region, syntenic to the Cystic Fibrosis Modulator Locus 1 (CFM1) in mouse, seemed to be associated to the intestinal phenotypic variation of cystic fibrosis (CF). We performed fine chromosomal mapping of ATB(0) on radiation hybrid (RH) panels G3 and TNG. Based on the most accurate location results from TNG-RH panel, mapping analysis evidenced that ATB(0) is localised between STS SHGC-13875 (D19S995) and STS SHGC-6138 in 19q13.3, that corresponds with the immediately telomeric/distal segment of the strongest linkage region within the human CFM1 (hCFM1) syntenic region. Regarding to the genomic structure and exon organisation, our results show that the ATB(0) gene is organised into eight exons. The knowledge of the genomic structure allowed us to perform an exhaustive mutational analysis of the gene. Evaluation of the possible implication of ATB(0) in the intestinal phenotype of CF was performed on the basis of the functional characteristics of the encoded protein, its apparent relevance to meconium ileus (MI) and position in relation to the hCFM1 syntenic region. We have analysed this gene in samples from CF patients with and without MI. Several sequence variations in the ATB(0) gene were identified, although none of them seemed to be related to the intestinal phenotype of CF. Even though no particular allele or haplotype in ATB(0) appears to be associated to CF-MI disease, new SNPs identified should be useful in segregation and linkage disequilibrium analyses in families affected by other disorders caused by the impairment of neutral amino acid transport.
Comments [show]
None has been submitted yet.
No. Sentence Comment
151 Statistical analysis showed that the higher incidence for P17A and the lower incidence for V512L observed in the general population Table 3 CFTR mutations of the CF patients under study with and without meconium ileus (MI) CF-non MI CF-MI CFTR mutations n CFTR mutations n F508del/R117H 2 F508del/F508del 7 F508del/R334W 3 F508del/L365P 1 F508del/R347P 1 F508del/G542X 1 F508del/621+1G4Ta 1 F508del/621+IG4Ta 1 F508del/M1101K 1 F508del/R1066C 1 F508del/1609delCAa 1 F508del/W1089X 1 F508del/2789+5G4Aa 3 F508del/R1162X 1 F508del/3849+10kbC4T 1 F508del/1609delCAa 1 G542X/G85E 1 F508del/Q1281X 1 G542X/V232D 1 F508del/1811+1.6kbA4G 1 G542X/1811+1.6kb A4Ga 1 F508del/2789+5G4Aa 1 G542X/2789+5G4A 1 F508del/2869insG 1 Q890X/L206W 1 F508del/unknown 1 1811+1.6kbA4G/P205S 1 I507del/I507del 1 R1162X/3272-26A4G 1 G542X/1078delT 1 N1303K/R347H 1 G542X/1811+1.6kbA4Ga 1 N1303K/A1006E+5T 1 S549R/CFTR50kbdel 1 2789+5G4A/405+1G4A 1 R1066C/R1066C 1 W1282X/712-1G4T 1 a CF patient with a sibling presenting identical CFTR genotype and discordance of intestinal phenotype.
X
ABCC7 p.Ser549Arg 11781704:151:881
status: NEW[hide] Genetic and clinical features of false-negative in... Acta Paediatr. 2002;91(1):82-7. Padoan R, Genoni S, Moretti E, Seia M, Giunta A, Corbetta C
Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis.
Acta Paediatr. 2002;91(1):82-7., [PMID:11883825]
Abstract [show]
A study was performed on the delayed diagnosis of cystic fibrosis (CF) in infants who had false-negative results in a neonatal screening programme. The genetic and clinical features of false-negative infants in this screening programme were assessed together with the efficiency of the screening procedure in the Lombardia region. In total, 774,687 newborns were screened using a two-step immunoreactive trypsinogen (IRT) (in the years 1990-1992), IRT/IRT + delF508 (1993-1998) or IRT/IRT + polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) protocol (1998-1999). Out of 196 CF children born in the 10 y period 15 were false negative on screening (7.6%) and molecular analysis showed a high variability in the genotypes. The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E. In three patients no mutation was identified after denaturing gradient gel electrophoresis of the majority of CFTR gene exons. Conclusion: The clinical phenotypes of CF children diagnosed by their symptoms at different ages were very mild. None of them presented with a severe lung disease. The majority of them did not seem to have been damaged by the delayed diagnosis. The combination of IRT assay plus genotype analysis (1998-1999) appears to be a more reliable method of detecting CF than IRT measurement alone or combined with only the delF508 mutation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
34 It was initially performed by polyacrylamide gel electrophoretic (PAGE) analysis for the delF508 mutation, and later by polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) (31 mutations: G85E, 621 ‡ 1G ® T, R117H, Y122X, 711 ‡ 1G ® T, 1078delT, R347P, R347H, R334W, A455E, 1898 ‡ 1G ® A, 2183-AA ® G, 2789 ‡ 5G ® A, DelF508, I507del, Q493X, V520F, 1717-1G ® A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ‡ 10kbC ® T, 3849 ‡ 4A ® G, R1162X, 3659delC, W1282X, 3905insT, N1303K) (14).
X
ABCC7 p.Ser549Arg 11883825:34:468
status: NEW[hide] Complete screening of the CFTR gene in Argentine c... Clin Genet. 2002 Mar;61(3):207-13. Visich A, Zielenski J, Castanos C, Diez G, Grenoville M, Segal E, Barreiro C, Tsui LC, Chertkoff L
Complete screening of the CFTR gene in Argentine cystic fibrosis patients.
Clin Genet. 2002 Mar;61(3):207-13., [PMID:12000363]
Abstract [show]
In order to establish the nature and the distribution of mutations causing cystic fibrosis (CF) in 220 unrelated Argentine families, the present authors conducted an extensive molecular analysis of the CF transmembrane regulator (CFTR) gene. First, a direct mutation analysis of 13 common mutations was done, enabling the detection of 319 out of 440 CF alleles (72.52%). Then an exhaustive screening of the entire coding region and the adjacent sequences of the CFTR gene was performed in all patients carrying at least one unidentified CF allele using the multiplex heteroduplex analysis assay followed by direct DNA sequencing. Thirty-nine different CF mutations, including five previously undescribed mutations (i.e. L6V, Y362X, 1353insT, 2594delGT and 2686insT) and two novel polymorphisms (i.e. 1170G/C and 3315A/C) were identified. As a result, the overall detection rate increased by up to 83.45%. Besides DeltaF508, only five mutations showed frequencies higher than 1%. In addition, a total of 49% of the mutations were rare because they were found in only one CF family. This wide spectrum of CF mutations is in agreement with the heterogeneous ethnic origin of the Argentine population. The data obtained here may have important consequences for the development of adequate strategies for the molecular diagnosis of CF in Argentina.
Comments [show]
None has been submitted yet.
No. Sentence Comment
56 Frequency of cystic fibrosis transmembrane regulator mutations in the Argentine population: 440 chromosomes analysed Mutation Localization Chromosome Number Percentage DF508 Exon 10 258 58.64 G542X Exon 11 18 4.10 W1282X Exon 20 12 2.73 N1303K Exon 21 12 2.73 R334W Exon 7 5 1.14 1717-1G»A Intron 10 5 1.14 3849π10KbC»T Intron 19 4 0.91 1811π1.6KbA»G Intron 11 4 0.91 IVS8-5T Intron 8 4 0.91 G85E Exon 3 3 0.68 621π1G»T Intron 4 3 0.68 2789π5G»A Intron 14b 3 0.68 DI507 Exon 10 3 0.68 2184delA Exon 13 2 0.45 2566insT Exon 13 2 0.45 2686insT Exon 14a 2 0.45 3659delC Exon 19 2 0.45 R1162X Exon 19 2 0.45 4016insT Exon 21 2 0.45 2789π2insA Intron 14b 2 0.45 L6V Exon 1 1 0.23 297π2A»G Intron 2 1 0.23 W57X Exon 3 1 0.23 R75Q Exon 3 1 0.23 Q220X Exon 6a 1 0.23 Y362X Exon 7 1 0.23 D426C Exon 9 1 0.23 1460delAT Exon 9 1 0.23 1353insT Exon 9 1 0.23 1782delA Exon 11 1 0.23 R553X Exon 11 1 0.23 S549R Exon 11 1 0.23 1898π3A»G Intron 12 1 0.23 2594delGT Exon 13 1 0.23 2183AA»G Exon 13 1 0.23 I1027T Exon 17a 1 0.23 R1066C Exon 17b 1 0.23 G1061R Exon 17b 1 0.23 4005-1G»A Intron 20 1 0.23 Total 367 83.45 209 nificant differences were observed among the compared populations (Table2).
X
ABCC7 p.Ser549Arg 12000363:56:957
status: NEW[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]
Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL.
X
ABCC7 p.Ser549Arg 12007216:111:4173
status: NEW112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL.
X
ABCC7 p.Ser549Arg 12007216:112:1131
status: NEWX
ABCC7 p.Ser549Arg 12007216:112:2306
status: NEW213 Ideal Recommended CFTR Mutation Screening Panel for 2001 Neonatal Screening in the USA* Location Estimated Mutation in CFTRa percentageb Reason for inclusion DF508 Exon 10 68.6% CFF registry, >1%, Pan-European G542X Exon 11 2.4% CFF registry, >1%, Mediterranean G551D Exon 11 2.1% CFF registry, >1%, Celtic W1282X Exon 20 1.4% CFF registry, >1%, Ashkenazi Jew N1303K Exon 21 1.3% CFF registry, >1%, Mediterranean R553X Exon 11 0.9% CFF registry, >0.5%, Hispanic 621+1G®T Intron 4 0.9% CFF registry, >0.5%, multi-ethnic 1717-1G®A Intron 10 0.7% CFF registry, >0.5%, Italian 3849+10KbC®T Intron 19 0.7% CFF registry, >0.5%, Hispanic R117Hc Exon 4 0.7% CFF registry, >0.5% 1898+1G→T Intron 12 0.4% CFF registry, >0.1%, East Asian DI507 Exon 10 0.3% CFF registry, >0.1%, Hispanic 2789+5G®A Intron 14b 0.3% CFF registry, >0.1% G85E Exon 3 0.3% CFF registry, >0.1% R347P Exon 7 0.2% CFF registry, >0.1% R334W Exon 7 0.2% CFF registry, >0.1%, multi-ethnic R1162X Exon 19 0.2% CFF registry, >0.1%, multi-ethnic R560T Exon 11 0.2% CFF registry, >0.1% 3659delC Exon 19 0.2% CFF registry, >0.1% A455E Exon 9 0.2% CFF registry, >0.1% 2184delA Exon 13 0.1% CFF registry, >0.1% S549N Exon 11 0.1% CFF registry, >0.1%, multi-ethnic 711+1G®T Intron 5 0.1% CFF registry, >0.1% R75X Exon 3 0.2% Hispanic 406-1G→A Intron 3 0.2% Hispanic I148T Exon 4 0.2% Hispanic, French 2055del9→A Exon 13 0.1% Hispanic 935delA Exon 6b 0.1% Hispanic I506T Exon 10 0.1% Hispanic 3199del6 Exon 17a 0.1% Hispanic 2183AA→G Exon 13 0.1% Hispanic 3120+1G®A Intron 16 1.5% African American, Arabian 2307insA Exon 13 0.2% African American A559T Exon 11 0.2% African American ∆F311 Exon 7 0.2% African American G480C Exon 10 0.2% African American 405+3A→C Intron 3 0.2% African American S1255X Exon 20 0.2% African American L1093P Exon 17b Undetermined Native American D648V Exon 13 Undetermined Native American I1234V Exon 19 Undetermined Arabian linkage S549R Exon 11 Undetermined Arabian linkage 1898+5G→T Intron 12 Undetermined East Asian linkage CFTRdele2,3 Exons 2,3 Undetermined Eastern European linkage (Slavic) Y1092X Exon 17b Undetermined French linkage 394delTT Exon 3 Undetermined Nordic linkage Y569D Exon 12 Undetermined Pakistani linkage 3905insT Exon 20 Undetermined Swiss linkage (also: Amish, Acadian, Mennonite) 1898+1G®A Intron 12 Undetermined Welsh linkage M1101k Exon 17b Undetermined Hutterite ancestry *This table presents the top 50 mutations in the USA based on the Cystic Fibrosis Foundation CF Registry data from 1997 [Cystic Fibrosis Foundation, 1998], and data generated during our investigation.
X
ABCC7 p.Ser549Arg 12007216:213:1985
status: NEW[hide] A novel natural product compound enhances cAMP-reg... Mol Med. 2002 Feb;8(2):75-87. deCarvalho AC, Ndi CP, Tsopmo A, Tane P, Ayafor J, Connolly JD, Teem JL
A novel natural product compound enhances cAMP-regulated chloride conductance of cells expressing CFTR[delta]F508.
Mol Med. 2002 Feb;8(2):75-87., [PMID:12080183]
Abstract [show]
BACKGROUND: Cystic fibrosis (CF) results from mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes a chloride channel localized at the plasma membrane of diverse epithelia. The most common mutation leading to CF, Delta F508, occurs in the first nucleotide-binding domain (NBD1) of CFTR. The Delta F508 mutation disrupts protein processing, leading to a decreased level of mutant channels at the plasma membrane and reduced transepithelial chloride permeability. Partial correction of the Delta F508 molecular defect in vitro is achieved by incubation of cells with several classes of chemical chaperones, indicating that further investigation of novel small molecules is warranted as a means for producing new therapies for CF. MATERIALS AND METHODS: The yeast two-hybrid assay was used to study the effect of CF-causing mutations on the ability of NBD1 to self-associate and form dimers. A yeast strain demonstrating defective growth as a result of impaired NBD1 dimerization due to Delta F508 was used as a drug discovery bioassay for the identification of plant natural product compounds restoring mutant NBD1 interaction. Active compounds were purified and the chemical structures determined. The purified compounds were tested in epithelial cells expressing CFTR Delta F508 and the resulting effect on transepithelial chloride permeability was assessed using short-circuit chloride current measurements. RESULTS: Wild-type NBD1 of CFTR forms homodimers in a yeast two-hybrid assay. CF-causing mutations within NBD1 that result in defective processing of CFTR (Delta F508, Delta I507, and S549R) disrupted NBD1 interaction in yeast. In contrast, a CF-causing mutation that does not impair CFTR processing (G551D) had no effect on NBD1 dimerization. Using the yeast-based assay, we identified a novel limonoid compound (TS3) that corrected the Delta F508 NBD1 dimerization defect in yeast and also increased the chloride permeability of Fisher Rat Thyroid (FRT) cells stably expressing CFTR Delta F508. CONCLUSION: The establishment of a phenotype for the Delta F508 mutation in the yeast two-hybrid system yielded a simple assay for the identification of small molecules that interact with the mutant NBD1 and restore dimerization. The natural product compound identified using the system (TS3) was found to increase chloride conductance in epithelial cells to an extent comparable to genistein, a known CFTR activator. The yeast system will thus be useful for further identification of compounds with potential for CF drug therapy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
9 CF-causing mutations within NBD1 that result in defective processing of CFTR (⌬F508, ⌬I507, and S549R) disrupted NBD1 interaction in yeast.
X
ABCC7 p.Ser549Arg 12080183:9:110
status: NEW37 Plasmids identical to pBDNBD1 and pADNBD1, but containing CF-causing mutations (⌬F508, ⌬I507, S549R, and G551D) were similarly constructed (producing pBD⌬F, pAD⌬F, pBD⌬I507, pAD⌬I507, pBDS549R, pADS549R, pBDG551D, pADG551D).
X
ABCC7 p.Ser549Arg 12080183:37:108
status: NEW109 To assess the effect of CF-causing mutations on NBD1 homodimerization, ⌬I507, ⌬F508, S549R, and G551D were each introduced into NBD1 in both pADNBD1 and pBDNBD1.
X
ABCC7 p.Ser549Arg 12080183:109:99
status: NEW110 As shown in Figure 1B, the mutations ⌬F508, ⌬I507, and S549R, resulted in a HIS- phenotype, indicating defective NBD1 dimerization.
X
ABCC7 p.Ser549Arg 12080183:110:69
status: NEW214 CF mutations affecting CFTR processing (⌬F508, ⌬I507, and S549R) resulted in defective CFTR NBD1 dimer formation in yeast.
X
ABCC7 p.Ser549Arg 12080183:214:72
status: NEW[hide] Mutations in the nucleotide binding domain 1 signa... J Biol Chem. 2002 Sep 27;277(39):35896-905. Epub 2002 Jul 10. DeCarvalho AC, Gansheroff LJ, Teem JL
Mutations in the nucleotide binding domain 1 signature motif region rescue processing and functional defects of cystic fibrosis transmembrane conductance regulator delta f508.
J Biol Chem. 2002 Sep 27;277(39):35896-905. Epub 2002 Jul 10., 2002-09-27 [PMID:12110684]
Abstract [show]
The gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR), an ATP binding cassette (ABC) transporter that functions as a phosphorylation- and nucleotide-regulated chloride channel, is mutated in cystic fibrosis (CF) patients. Deletion of a phenylalanine at amino acid position 508 (DeltaF508) in the first nucleotide binding domain (NBD1) is the most prevalent CF-causing mutation and results in defective protein processing and reduced CFTR function, leading to chloride impermeability in CF epithelia and heterologous systems. Using a STE6/CFTRDeltaF508 chimera system in yeast, we isolated two novel DeltaF508 revertant mutations, I539T and G550E, proximal to and within the conserved ABC signature motif of NBD1, respectively. Western blot and functional analysis in mammalian cells indicate that mutations I539T and G550E each partially rescue the CFTRDeltaF508 defect. Furthermore, a combination of both revertant mutations resulted in a 38-fold increase in CFTRDeltaF508-mediated chloride current, representing 29% of wild type channel activity. The G550E mutation increased the sensitivity of CFTRDeltaF508 and wild type CFTR to activation by cAMP agonists and blocked the enhancement of CFTRDeltaF508 channel activity by 2 mm 3-isobutyl-1-methylxanthine. The data show that the DeltaF508 defect can be significantly rescued by second-site mutations in the nucleotide binding domain 1 region, that includes the LSGGQ consensus motif.
Comments [show]
None has been submitted yet.
No. Sentence Comment
36 Interestingly, the site of this mutation is flanked by two residues where CF-causing mutations have been identified that impair folding/trafficking of CFTR (S549R) or ATP-dependent channel gating (G551D) (37-41).
X
ABCC7 p.Ser549Arg 12110684:36:157
status: NEW167 CFTR variant Isc n % of CFTR wt CFTR S549R 1.70 Ϯ 0.11 4 CFTR G551D 1.17 Ϯ 0.12 4 CFTR ⌬F508 0.76 Ϯ 0.07 17 CFTR ⌬F/G550E 9.30 Ϯ 0.55 14 (*) CFTR ⌬F/G550D 6.06 Ϯ 0.63 12 (*) CFTR ⌬F/G550H 4.17 Ϯ 0.40 8 (*) Mutations in the ABC Signature Motif Region Rescue CFTR⌬F50835900 CFTR⌬F/G550E relative to FRT-CFTR ⌬F508 (Fig. 4B), although the mature band C was barely detectable, and the steady-state levels of band B were decreased for the revertant (Fig. 4A).
X
ABCC7 p.Ser549Arg 12110684:167:37
status: NEW206 CFTR variants bearing CF-causing mutations within the NBD1 signature motif, G551D and S549R, were included in the experiment and produced low Isc, as expected.
X
ABCC7 p.Ser549Arg 12110684:206:86
status: NEW[hide] Predicting the risk of cystic fibrosis with abnorm... Am J Med Genet. 2002 Jun 15;110(2):109-15. Muller F, Simon-Bouy B, Girodon E, Monnier N, Malinge MC, Serre JL
Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases.
Am J Med Genet. 2002 Jun 15;110(2):109-15., 2002-06-15 [PMID:12116247]
Abstract [show]
Hyperechogenic fetal bowel is prenatally detected by ultrasound during the second trimester of pregnancy in 0.1-1.8% of fetuses. It has been described as a normal variant but has often been associated with severe diseases, notably cystic fibrosis (CF). The aim of our study was to determine the risk of CF in a prospective study of 641 fetuses with ultrasonographically abnormal fetal bowel and the residual risk when only one mutation is detected in the fetus. Fetal cells and/or parental blood cells were screened for CFTR mutations. Two screening steps were used, the first covering the mutations most frequently observed in French CF patients (mutation detection rate of 70-90%) and, when a CF mutation was detected, a DGGE-sequencing strategy. We observed a 3.1% risk of CF when a digestive tract anomaly was prenatally observed at routine ultrasound examination. The risk was higher when hyperechogenicity was associated with bowel dilatation (5/29; 17%) or with the absence of gall bladder (2/8; 25%). The residual risk of CF was 11% when only one CF mutation was detected by the first screening step, thereby justifying in-depth screening. Mutations associated with severe CF (DeltaF508 mutation) were more frequently observed in these ultrasonographically and prenatally detected CF cases. However, the frequency of heterozygous cases was that observed in the normal population, which demonstrates that heterozygous carriers of CF mutations are not at increased risk for hyperechogenic bowel. In conclusion, fetal bowel anomalies indicate a risk of severe cystic fibrosis and justify careful CFTR molecular analysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
48 A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 þ 10kbC !
X
ABCC7 p.Ser549Arg 12116247:48:31
status: NEW[hide] Screening for cystic fibrosis in newborn infants: ... J Med Screen. 2002;9(2):60-3. Corbetta C, Seia M, Bassotti A, Ambrosioni A, Giunta A, Padoan R
Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population.
J Med Screen. 2002;9(2):60-3., [PMID:12133923]
Abstract [show]
OBJECTIVE: To assess the performance of a two tier neonatal screening programme (IRT/DNA/IRT) for cystic fibrosis, based on immunoreactive trypsinogen (IRT) followed by direct cystic fibrosis transmembrane conductance regulator (CFTR) gene analysis (based on a panel of up to 31 mutations) in hypertrypsinaemic newborn infants and to compare it with a previous screening protocol. SETTING: The study comprised all the newborn infants in the period 1 October 1998 to 31 December 1999 in the Lombardia region, north western Italy. METHODS: The screening strategy consisted of an immunoreactive trypsinogen assay from dried blood spots, a polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (PCR-OLA), and a sequence code separation. RESULTS: 104 609 newborn infants were screened. 1457 hypertrypsinaemic infants (1.39%) were analysed with the PCR-OLA assay. 18 newborn homozygotes or compound heterozygotes for CFTR mutations were identified and referred to the cystic fibrosis (CF) centre at a mean age of 3 weeks. 125 infants presenting only one mutation were recalled for a sweat test: a diagnosis of CF was made in 13 infants, and parents of 112 neonates identified as carriers (1:13) received genetic counselling. The remaining 1314 hypertrypsinaemic newborn infants were recalled for IRT retesting and 177 were referred for a sweat test because the second IRT measurement was above the cut off value. Among this group a further two infants were diagnosed with CF (1.1%) leading to a CF prevalence of 1:3170. CONCLUSIONS: This strategy resulted in an early and accurate diagnosis of CF. The IRT/DNA/IRT protocol with an OLA assay was shown to be useful in an Italian population with a genetic heterogeneity, leading to the identification of 94% of infants with CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
266 Mutations identified by the assay are G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183-AA→G, 2789+5G→A, delF508, I507del, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, and N1303K.
X
ABCC7 p.Ser549Arg 12133923:266:262
status: NEW[hide] Urogenital abnormalities in male children with cys... Arch Dis Child. 2002 Aug;87(2):135-8. Blau H, Freud E, Mussaffi H, Werner M, Konen O, Rathaus V
Urogenital abnormalities in male children with cystic fibrosis.
Arch Dis Child. 2002 Aug;87(2):135-8., [PMID:12138064]
Abstract [show]
BACKGROUND: Congenital bilateral absence of the vas deferens (CBAVD) is presumed to occur prenatally and is present in over 99% of adult males with cystic fibrosis (CF). AIMS: To describe ultrasonic features in male children with CF. We aimed to describe urogenital anomalies, comparing pancreatic sufficient and insufficient CF patients. METHODS: Pelvic and scrotal ultrasonography were performed in 12 boys with CF aged 2-12 years and 16 age matched healthy controls. RESULTS: Nine patients had pancreatic insufficiency (PI): seven had two severe mutations and two had unknown mutations. Three boys were pancreatic sufficient (PS), two with splicing mutations (5T and 3849+10kb C-T respectively) and borderline sweat tests. Seminal vesicles were visualised in 5/12 patients and 8/16 controls, compared to non-visualisation reported in all adults with CBAVD. Testicular microlithiasis was found in 4/18 PI, 0/6 PS, and 0/32 control testes, compared to 0.6-1.4% in healthy males and 15% in CF adults; 7/18 PI, 4/6 PS, and 0/32 control testes were smaller than predicted for age. The epididymal head was non-homogeneous with cysts, hypo-, or hyper-echogenicity in 5/18 PI, 1/6 PS, and 0/32 control testes. CONCLUSIONS: Genital abnormalities may occur early in CF, but are less common than described in adults. They are found more often in pancreatic insufficient than in pancreatic sufficient CF patients. However, a positive finding, if present, may aid in the diagnosis of the latter. A larger longitudinal study is recommended to better define the onset and progression of urogenital abnormalities.
Comments [show]
None has been submitted yet.
No. Sentence Comment
264 Seven of these were homozygous or compound heterozygotes for the genotypes ∆F508, W1282X, G542X, S549R, and 405+1G→A.
X
ABCC7 p.Ser549Arg 12138064:264:104
status: NEW294 The vas deferens appeared similar to Table 1 Genotype and clinical features in pancreatic insufficient boys Pt no. Age (y) Sweat chloride CFTR mutations FEV1 Wt Ht Sh. score 1 2 69 W1282X/405+1G→A - 3 3 77 2 3 100 W1282X/W1282X 98% 50 75 92 3 5 78 Unknown 94% 50 10 92 4 6 75 Unknown 86% 50 25 85 5 7 76 W1282X/G542X 105% 95 40 90 6 8 99 W1282X/∆F508 112% 85 50 98 7 9 90 S549R/S549R 77% 25 10 70 8 10 84 W1282X/∆F508 102% 25 20 89 9 10 97 W1282X/∆F508 87% 50 50 98 FEV1, forced expiratory volume in 1 second; Wt , weight, percentile for age; Ht, height, percentile for age; Sh. score, Shwachman score.
X
ABCC7 p.Ser549Arg 12138064:294:386
status: NEWX
ABCC7 p.Ser549Arg 12138064:294:392
status: NEW[hide] Standards and guidelines for CFTR mutation testing... Genet Med. 2002 Sep-Oct;4(5):379-91. Richards CS, Bradley LA, Amos J, Allitto B, Grody WW, Maddalena A, McGinnis MJ, Prior TW, Popovich BW, Watson MS, Palomaki GE
Standards and guidelines for CFTR mutation testing.
Genet Med. 2002 Sep-Oct;4(5):379-91., [PMID:12394352]
Abstract [show]
One mission of the ACMG Laboratory Quality Assurance (QA) Committee is to develop standards and guidelines for clinical genetics laboratories, including cytogenetics, biochemical, and molecular genetics specialties. This document was developed under the auspices of the Molecular Subcommittee of the Laboratory QA Committee by the Cystic Fibrosis (CF) Working Group. It was placed on the "fast track" to address the preanalytical, analytical, and postanalytical quality assurance practices of laboratories currently providing testing for CF. Due to the anticipated impact of the ACMG recommendation statement endorsing carrier testing of reproductive couples, it was viewed that CF testing would increase in volume and that the number of laboratories offering CF testing would also likely increase. Therefore, this document was drafted with the premise of providing useful information gained by experienced laboratory directors who have provided such testing for many years. In many instances, "tips" are given. However, these guidelines are not to be interpreted as restrictive or the only approach but to provide a helpful guide. Certainly, appropriately trained and credentialed laboratory directors have flexibility to utilize various testing platforms and design testing strategies with considerable latitude. We felt that it was essential to include technique-specific guidelines of several current technologies commonly used in laboratories providing CF testing, since three of the four technologies discussed are available commercially and are widely utilized. We take the view that these technologies will change, and thus this document will change with future review.
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 A recent report by Orgad et al.11 indicated that additional mutations were found in Jewish Israeli populations, including D1152H, 405 ϩ 1GϾA, W1089X, and S549R.
X
ABCC7 p.Ser549Arg 12394352:51:166
status: NEW[hide] Analysis of cystic fibrosis transmembrane conducta... Am J Med Genet A. 2003 Jul 1;120A(1):72-6. Timmreck LS, Gray MR, Handelin B, Allito B, Rohlfs E, Davis AJ, Gidwani G, Reindollar RH
Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina.
Am J Med Genet A. 2003 Jul 1;120A(1):72-6., 2003-07-01 [PMID:12794695]
Abstract [show]
The relationship between cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations and congenital absence of the uterus and vagina (CAUV) was examined. CFTR mutations have previously been associated with congenital bilateral absence of the vas deferens (CBAVD). CBAVD is caused by a disruption in the vas deferens, a Wolffian duct derivative. Because the embryologic development of the Mullerian ducts directly depends on the prior normal development of the Wolffian ducts, the same gene products may be necessary for normal embryologic development of both ductal systems. This study evaluated the role of CFTR mutations in the development of CAUV. DNA samples from 25 patients with CAUV were tested for the presence of 33 of the most common CFTR mutations. Protein-coding DNA fragments from the CFTR gene were amplified in vitro by the polymerase chain reaction (PCR) and analyzed for mutations using allele-specific oligonucleotide (ASO) probes. Two patients were heterozygous for CFTR mutations. One was heterozygous for the W1282X mutation and the other was heterozygous for the DeltaF508 mutation. The incidence of the 33 CFTR mutations found in the patients with CAUV (8%) was twice that found in the general population (4%), but much less than the incidence of CFTR mutations in men with CBAVD (80%). This data suggests that it is unlikely for CFTR mutations to cause CAUV in females as they cause CBAVD in some males. Furthermore, the data suggest that CAUV in females may be the same disorder as CBAVD in males who do not have CFTR mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
82 CFTR Gene Mutations Tested DF508 R334W Y1092X 5T variant Y122X R347H G542X S549R 3,849 þ 4 G551D 3,849 þ 10 kb 2,789 þ 5 W1282X R553X 711 þ 1 3,905 þ T 621 þ 1 1,898 þ 1 N1303K 1,717À1 R1162X R117H 1078dT A455E D1507 Q493X 218dA R347P V520F G85E R560T S549N 3659dC Wolffian duct must occur at a time when the Mu¨llerian duct is no longer dependent on the Wolffian duct for development.
X
ABCC7 p.Ser549Arg 12794695:82:75
status: NEW[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]
Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.
Comments [show]
None has been submitted yet.
No. Sentence Comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering.
X
ABCC7 p.Ser549Arg 12815607:64:1106
status: NEW[hide] Mutation analysis of the cystic fibrosis transmemb... Eur J Hum Genet. 2003 Sep;11(9):687-92. Perri F, Piepoli A, Stanziale P, Merla A, Zelante L, Andriulli A
Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis.
Eur J Hum Genet. 2003 Sep;11(9):687-92., [PMID:12939655]
Abstract [show]
Susceptibility to alcoholic chronic pancreatitis (ACP) could be genetically determined. Mutations in cationic trypsinogen (PRSS1), cystic fibrosis transmembrane conductance regulator (CFTR), and serine protease inhibitor, Kazal type 1 (SPINK1) genes have been variably associated with both the hereditary and the idiopathic form of chronic pancreatitis (CP). Our aim was to analyze the three genes in ACP patients. Mutational screening was performed in 45 unrelated ACP patients and 34 patients with alcoholic liver disease (ALD). No mutation of PRSS1 was found in ACP and ALD patients. Three mutations of CFTR were detected in four ACP patients with a prevalence (8.9%) not significantly different from that observed (3.0%) in ALD patients and from that expected (3.2%) in our geographical area. Neither compound heterozygotes for CFTR nor trans-heterozygotes for CFTR/SPINK1 were found. One ACP patient (2.2%) was found to carry the most common mutation (N34S) of SPINK1 compared to none of the ALD patients (P=NS). In five other patients (two with ACP and three with ALD) other rare variants, including P55S, were found. In contrast with the hereditary and the idiopathic forms of CP, in which mutations of PRSS1, CFTR, and SPINK1 genes may occur, ACP is still a "gene(s)-orphan" disease. The supposed genetic susceptibility to ACP relies on other yet unknown gene(s) which could affect the alcohol metabolism or modulate the pancreatic inflammatory response to alcohol abuse.
Comments [show]
None has been submitted yet.
No. Sentence Comment
33 Mutation screening of the CFTR gene The 31 most frequent mutations (F508del, I507del, G551D, G542X, N1303K, 1717-1G4A, W1282X, R553X, R347P, R347H, R334W, 3849+10kb C4T, R117H, 621+1G4T, A455E, S549N, R560T, S549R, V520F, Q493X, 3849+ 4A4G, 1078delT, R1162X, 3659delC, 3905insT, Y122X, 2183delAA4G, 2789+5G4A, 1898+1G4A, 711+1G4T, and G85E) were examined with the polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (OLA, Applied Biosystems, Foster City, CA, USA) and finally a sequence-coded separation.
X
ABCC7 p.Ser549Arg 12939655:33:208
status: NEW[hide] The phenotypic consequences of CFTR mutations. Ann Hum Genet. 2003 Sep;67(Pt 5):471-85. Rowntree RK, Harris A
The phenotypic consequences of CFTR mutations.
Ann Hum Genet. 2003 Sep;67(Pt 5):471-85., [PMID:12940920]
Abstract [show]
Cystic fibrosis is a common autosomal recessive disorder that primarily affects the epithelial cells in the intestine, respiratory system, pancreas, gall bladder and sweat glands. Over one thousand mutations have currently been identified in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene that are associated with CF disease. There have been many studies on the correlation of the CFTR genotype and CF disease phenotype; however, this relationship is still not well understood. A connection between CFTR genotype and disease manifested in the pancreas has been well described, but pulmonary disease appears to be highly variable even between individuals with the same genotype. This review describes the current classification of CFTR mutation classes and resulting CF disease phenotypes. Complex disease alleles and modifier genes are discussed along with alternative disorders, such as disseminated bronchiectasis and pancreatitis, which are also thought to result from CFTR mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
176 The promoter mutation -102T → A has been found in association with S549R (T → G) (Romey et al. 1999).
X
ABCC7 p.Ser549Arg 12940920:176:74
status: NEW178 As the S549R mutation has previously been described as a 'severe` allele, associated with pancreatic insufficiency, it appears that cis- mutations can modulate the clinical phenotype.
X
ABCC7 p.Ser549Arg 12940920:178:7
status: NEW[hide] High allelic heterogeneity between Afro-Brazilians... Genet Test. 2003 Fall;7(3):213-8. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, Phillips JA 3rd, Allito B, Heim RA, Sugarman EA, Probst CM, Faucz F, Culpi L
High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing.
Genet Test. 2003 Fall;7(3):213-8., [PMID:14641997]
Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by at least 1,000 different mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR). To determine the frequency of 70 common worldwide CFTR mutations in 155 Euro-Brazilian CF patients and in 38 Afro-Brazilian CF patients, we used direct PCR amplification of DNA from a total of 386 chromosomes from CF patients born in three different states of Brazil. The results show that screening for seventy mutations accounts for 81% of the CF alleles in Euro-Brazilians, but only 21% in the Afro-Brazilian group. We found 21 different mutations in Euro-Brazilians and only 7 mutations in Afro-Brazilians. The frequency of mutations and the number of different mutations detected in Euro-Brazilians are different from Northern European and North American populations, but similar to Southern European populations; in Afro-Brazilians, the mix of CF-mutations is different from those reported in Afro-American CF patients. We also found significant differences in detection rates between Euro-Brazilian (75%) and Afro-Brazilian CF patients (21%) living in the same state, Minas Gerais. These results, therefore, have implications for the use of DNA-based tests for risk assessment in heterogeneous populations like the Brazilians. Further studies are needed to identify the remaining CF mutations in the different populations and regions of Brazil.
Comments [show]
None has been submitted yet.
No. Sentence Comment
63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes.
X
ABCC7 p.Ser549Arg 14641997:63:1706
status: NEW[hide] Structure of nucleotide-binding domain 1 of the cy... EMBO J. 2004 Jan 28;23(2):282-93. Epub 2003 Dec 18. Lewis HA, Buchanan SG, Burley SK, Conners K, Dickey M, Dorwart M, Fowler R, Gao X, Guggino WB, Hendrickson WA, Hunt JF, Kearins MC, Lorimer D, Maloney PC, Post KW, Rajashankar KR, Rutter ME, Sauder JM, Shriver S, Thibodeau PH, Thomas PJ, Zhang M, Zhao X, Emtage S
Structure of nucleotide-binding domain 1 of the cystic fibrosis transmembrane conductance regulator.
EMBO J. 2004 Jan 28;23(2):282-93. Epub 2003 Dec 18., 2004-01-28 [PMID:14685259]
Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) is an ATP-binding cassette (ABC) transporter that functions as a chloride channel. Nucleotide-binding domain 1 (NBD1), one of two ABC domains in CFTR, also contains sites for the predominant CF-causing mutation and, potentially, for regulatory phosphorylation. We have determined crystal structures for mouse NBD1 in unliganded, ADP- and ATP-bound states, with and without phosphorylation. This NBD1 differs from typical ABC domains in having added regulatory segments, a foreshortened subdomain interconnection, and an unusual nucleotide conformation. Moreover, isolated NBD1 has undetectable ATPase activity and its structure is essentially the same independent of ligand state. Phe508, which is commonly deleted in CF, is exposed at a putative NBD1-transmembrane interface. Our results are consistent with a CFTR mechanism, whereby channel gating occurs through ATP binding in an NBD1-NBD2 nucleotide sandwich that forms upon displacement of NBD1 regulatory segments.
Comments [show]
None has been submitted yet.
No. Sentence Comment
216 CF mutations in NBD1 The majority of sites of CF-causing missense mutations occur in NBD1, primarily in its a-subdomain, and the locations in the mNBD1 structure of the most common of these (A455E, G480C, I506T, DI507, DF508, S549N, S549R, G551D, A559T, R560T, Y569D, and D648V; Bobadilla et al, 2002) are shown in Figure 3D.
X
ABCC7 p.Ser549Arg 14685259:216:233
status: NEW[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]
Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).
Comments [show]
None has been submitted yet.
No. Sentence Comment
55 These mutations included S4X (143 C to A), exon 1; S42F (257 C to T), exon 2; R117L (482 G to T), exon 4; S549R (1779 T to G), exon 11; 3667ins4, exon 19; A1006E (3149 C to A), exon17a; L1065P (3326 T to C), R1066C (3328 C to T), L1077P (3362 T to C), exon 17b.
X
ABCC7 p.Ser549Arg 15084222:55:106
status: NEW77 Finally, in a single CF patient, we detected two different mutations [G542X (1756 G to T) and S549R (1779 T to G)] in the same exon 11-derived DNA amplicon, which showed a peculiar DHPLC pattern, different from that observed when only one of these mutations was present (data not show).
X
ABCC7 p.Ser549Arg 15084222:77:94
status: NEW89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency.
X
ABCC7 p.Ser549Arg 15084222:89:649
status: NEW[hide] Population-based newborn screening for genetic dis... Pediatrics. 2004 Jun;113(6):1573-81. Comeau AM, Parad RB, Dorkin HL, Dovey M, Gerstle R, Haver K, Lapey A, O'Sullivan BP, Waltz DA, Zwerdling RG, Eaton RB
Population-based newborn screening for genetic disorders when multiple mutation DNA testing is incorporated: a cystic fibrosis newborn screening model demonstrating increased sensitivity but more carrier detections.
Pediatrics. 2004 Jun;113(6):1573-81., [PMID:15173476]
Abstract [show]
OBJECTIVES: Newborn screening for cystic fibrosis (CF) provides a model to investigate the implications of applying multiple-mutation DNA testing in screening for any disorder in a pediatric population-based setting, where detection of affected infants is desired and identification of unaffected carriers is not. Widely applied 2-tiered CF newborn screening strategies first test for elevated immunoreactive trypsinogen (IRT) with subsequent analysis for a single CFTR mutation (DeltaF508), systematically missing CF-affected infants with any of the >1000 less common or population-specific mutations. Comparison of CF newborn screening algorithms that incorporate single- and multiple-mutation testing may offer insights into strategies that maximize the public health value of screening for CF and other genetic disorders. The objective of this study was to evaluate technical feasibility and practical implications of 2-tiered CF newborn screening that uses testing for multiple mutations (multiple-CFTR-mutation testing). METHODS: We implemented statewide CF newborn screening using a 2-tiered algorithm: all specimens were assayed for IRT; those with elevated IRT then had multiple-CFTR-mutation testing. Infants who screened positive by detection of 1 or 2 mutations or extremely elevated IRT (>99.8%; failsafe protocol) were then referred for definitive diagnosis by sweat testing. We compared the number of sweat-test referrals using single- with multiple-CFTR-mutation testing. Initial physician assessments and diagnostic outcomes of these screened-positive infants and any affected infants missed by the screen were analyzed. We evaluated compliance with our screening and follow-up protocols. All Massachusetts delivery units, the Newborn Screening Program, pediatric health care providers who evaluate and refer screened-positive infants, and the 5 Massachusetts CF Centers and their affiliated genetic services participated. A 4-year cohort of 323 506 infants who were born in Massachusetts between February 1, 1999, and February 1, 2003, and screened for CF at approximately 2 days of age was studied. RESULTS: A total of 110 of 112 CF-affected infants screened (negative predictive value: 99.99%) were detected with IRT/multiple-CFTR-mutation screening; 2 false-negative screens did not show elevated IRT. A total of 107 (97%) of the 110 had 1 or 2 mutations detected by the multiple- CFTR-mutation screen, and 3 had positive screens on the basis of the failsafe protocol. In contrast, had we used single-mutation testing, only 96 (87%) of the 110 would have had 1 or 2 mutations detectable by single-mutation screen, 8 would have had positive screens on the basis of the failsafe protocol, and an additional 6 infants would have had false-negative screens. Among 110 CF-affected screened-positive infants, a likely "genetic diagnosis" was made by the multiple-CFTR-mutation screen in 82 (75%) versus 55 (50%) with DeltaF508 alone. Increased sensitivity from multiple-CFTR-mutation testing yielded 274 (26%) more referrals for sweat testing and carrier identifications than testing with DeltaF508 alone. CONCLUSIONS: Use of multiple-CFTR-mutation testing improved sensitivity and postscreening prediction of CF at the cost of increased referrals and carrier identification.
Comments [show]
None has been submitted yet.
No. Sentence Comment
159 Genotypes and Frequencies Observed in 112 CF-Affected Infants First Mutation Second Mutation N ⌬F508 ⌬F508 55 ⌬F508 R117H 7* ⌬F508 G551D 4 ⌬F508 N1303K 3 ⌬F508 W1282X 3 ⌬F508 G542X 2 ⌬F508 1898 ϩ 1 G Ͼ A 2 G85E R117C 2 ⌬F508 1717-GϾA 1 ⌬F508 3849 ϩ 10kbC Ͼ T 1 ⌬F508 R1066C 1 ⌬F508 Y1092X 1 ⌬F508 L206W 1 ⌬F508 R560T 1 ⌬F508 1152H 1 ⌬F508 621 ϩ 1G Ͼ T 1 R117H G551D 1 R117H G85E 1 G551D 2789 ϩ 5GϾA 1 G551D R117C 1 G85E 711 ϩ 1GϾT 1 W1282X 3849 ϩ 10kbCϾT 1 R553X 2183AAϾG 1 A455E S549R 1 ⌬F508 Unknown† 13 N1303K Unknown 2 G542X Unknown 1 Unknown Unknown 2 * Includes 1 of the false-negative screens.
X
ABCC7 p.Ser549Arg 15173476:159:676
status: NEW171 Presumed second CFTR mutation: 2183AAϾG, R117C (2), S549R, and "not present in additional mutation analysis and yet to be identified" (2).
X
ABCC7 p.Ser549Arg 15173476:171:66
status: NEW[hide] Familial concordance of phenotype and microbial va... Pediatr Pulmonol. 2004 Oct;38(4):292-7. Picard E, Aviram M, Yahav Y, Rivlin J, Blau H, Bentur L, Avital A, Villa Y, Schwartz S, Kerem B, Kerem E
Familial concordance of phenotype and microbial variation among siblings with CF.
Pediatr Pulmonol. 2004 Oct;38(4):292-7., [PMID:15334505]
Abstract [show]
The clinical spectrum of cystic fibrosis (CF) is influenced by the cystic fibrosis transmembrane conductance regulator (CFTR) genotype. However, variable courses of the disease were demonstrated among patients with identical genotypes. Since siblings share identical CFTR mutations and environmental factors, they can serve as a model to assess the effect of modifier genes on disease expression, and also to evaluate cross-infection. The aim of this study was to compare disease expression among siblings with CF. All sibling pairs treated at 7 CF centers in Israel were included in the study. Data were collected from patients' medical charts. Fifty families with at least 2 siblings were identified. As expected, the second-born sibling was diagnosed at an earlier age compared to the first-born. The mode of CF presentation at diagnosis showed significant familial concordance. In the families where the first sibling presented with gastrointestinal manifestations, 79% of the second siblings also presented with gastrointestinal manifestations. When gastrointestinal manifestations were absent in the first sibling, only 12% of the second siblings presented with gastrointestinal manifestations (P < 0.0001). Likewise, when the first sibling presented with respiratory symptoms, 60% of the second siblings presented with the similar symptoms. However, when the first sibling presented without respiratory symptoms, only 12% of the second siblings presented with respiratory symptoms (P < 0.001). Meconium ileus (MI) was present in 20 patients (21%). In 10 families where the first-born sibling had MI, 8 (80%) of the subsequent siblings had MI. On the other hand, in the 39 families where the first-born sibling did not have MI, only 2 (5%) subsequent siblings had MI (P < 0.001). Pancreatic insufficiency (PI) also had high familial concordance (P < 0.0001). Percentile growth for weights and heights and lung function (FVC, FEV(1), and FEF(25-75)) at ages 7 and 10 years were similar between siblings. P. aeruginosa grew from sputum in 89% of our study patients. When P. aeruginosa was isolated from the first-born patient, 91% of the second siblings were also positive for P. aeruginosa, whereas when the initial sibling was not a carrier of P. aeruginosa, only 50% of subsequent siblings were positive (P < 0.0001). This familial concordance was not observed for S. aureus. By contrast, the age of first isolation of P. aeruginosa and S. aureus was significantly earlier in the second sibling than in the first for the two bacteria: 10.3 +/- 5.1 vs. 7.3 +/- 5.2 years (P < 0.05) for P. aeruginosa, and 11.5 +/- 5.4 years vs. 6.8 +/- 5.1 years (P < 0.05) for S. aureus. CF siblings tend to share similar phenotypes that are not mutation-dependent. The lack of variability between siblings in mode of initial CF presentation, rates of MI, pulmonary function, and nutritional status supports the role of modifier genes in the determination of these factors.
Comments [show]
None has been submitted yet.
No. Sentence Comment
71 A (1), S549R/S549R (1), Q359K/Q360K (1), DF508/Unknown (4), W1282X/Unknown (3), G542X/Unknown (2), G85E/Unknown (1), and Q359K/ Unknown (1).
X
ABCC7 p.Ser549Arg 15334505:71:7
status: NEWX
ABCC7 p.Ser549Arg 15334505:71:13
status: NEW[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]
Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.
Comments [show]
None has been submitted yet.
No. Sentence Comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene.
X
ABCC7 p.Ser549Arg 15371903:35:421
status: NEW[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]
Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively.
X
ABCC7 p.Ser549Arg 15371908:77:421
status: NEW[hide] Comprehensive cystic fibrosis mutation epidemiolog... Ann Hum Genet. 2005 Jan;69(Pt 1):15-24. Castaldo G, Polizzi A, Tomaiuolo R, Cazeneuve C, Girodon E, Santostasi T, Salvatore D, Raia V, Rigillo N, Goossens M, Salvatore F
Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population.
Ann Hum Genet. 2005 Jan;69(Pt 1):15-24., [PMID:15638824]
Abstract [show]
We screened the whole coding region of the cystic fibrosis transmembrane regulator (CFTR) gene in 371 unrelated cystic fibrosis (CF) patients from three regions of southern Italy. Forty-three mutations detected 91.5% of CF mutated chromosomes by denaturing gradient gel electrophoresis analysis, and three intragenic CFTR polymorphisms predicted a myriad of rare mutations in uncharacterized CF chromosomes. Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711 + 1G > T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Several mutations frequently found in northern Italy (e.g., R1162X, 711 + 5G > T) and northern Europe (e.g., G551D, I507del and 621 + 1G > T) are absent from the studied population. The I148T-3195del6 complex allele was present in two CF chromosomes, whereas I148T was present in both alleles (as a single mutation) in another CF patient and in five CF carriers; this could result from crossover events. The haplotype analysis of three intragenic polymorphisms (IVS8CA, IVS17bTA and IVS17bCA) compared with data from other studies revealed that several mutations (3849 + 10kbC > T, 1717-1G > A, E585X, 3272-26G > A, L558S, 2184insA and R347P) originated from multiple events, whereas others (R1158X and S549R) could be associated with one or more intragenic recombinant events. Given the large population migration from southern Italy, knowledge of the CF molecular epidemiology in this area is an important contribution to diagnosis, counselling and interlaboratory quality control for molecular laboratories worldwide.
Comments [show]
None has been submitted yet.
No. Sentence Comment
5 The haplotype analysis of three intragenic polymorphisms (IVS8CA, IVS17bTA and IVS17bCA) compared with data from other studies revealed that several mutations (3849+10kbC>T, 1717-1G>A, E585X, 3272-26G>A, L558S, 2184insA and R347P) originated from multiple events, whereas others (R1158X and S549R) could be associated with one or more intragenic recombinant events.
X
ABCC7 p.Ser549Arg 15638824:5:291
status: NEW62 A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n.
X
ABCC7 p.Ser549Arg 15638824:62:1138
status: NEW109 Genetists Table 4 Mutations linked to different haplotypes due to recombinant or recurrent events, characteryzed at the level of three CFTR intragenic loci (IVS8CA, IVS17bTA, IVS17bCA) Present study Other studies Cases Haplotype Cases Haplotype (n) (n. of repeats) (n) (n. of repeats) references* I148T and 3195del6 2/2 23-7-17 3 23-7-17 2,3 (in cis) I148T 1/1 23-32-13 S549R (A>C) 1/1 23-33-13 1 16-33-13 2 1717-1G>A 13/13 16-7-17 23 16-7-17 1,2,3 2 16-30-13 1 1 16-32-13 1 R1158X 6/6 16-7-17 1/2 16-7-17 2 1/2 6-45-13 2 1/1 16-31-13 3 1/1 16-45-13 3 3849 +10kbC>T 5/5 23-31-13 2 23-31-13 1 1 16-14-31 4 1 16-7-17 1 3 16-46-13 2 1 16-17-19 2 1 17-31-13 2 E585X 2/2 16-7-17 1 16-32-13 2 1 17-31-13 2 1 16-7-16 see 2 3272-26G>A 1/1 15-7-17 1 16-32-13 1 4 16-7-17 5 L558S 1/1 16-32-13 1 16-32-13 1 1 15-7-17 1 2184 ins A 1/1 16-29-13 1 16-45-13 1 1 16-7-17 1 1 16-24-13 3 * References 1: Morral et al. 1996b.
X
ABCC7 p.Ser549Arg 15638824:109:372
status: NEW[hide] Systemic inflammatory mediators and cystic fibrosi... Clin Exp Med. 2004 Oct;4(2):99-102. Augarten A, Paret G, Avneri I, Akons H, Aviram M, Bentur L, Blau H, Efrati O, Szeinberg A, Barak A, Kerem E, Yahav J
Systemic inflammatory mediators and cystic fibrosis genotype.
Clin Exp Med. 2004 Oct;4(2):99-102., [PMID:15672947]
Abstract [show]
Morbidity and mortality in cystic fibrosis patients is mainly attributed to pulmonary infection and inflammation. Chemokines play a pivotal role in the inflammatory process. Although genotype-phenotype correlation in cystic fibrosis patients has been defined, a clear relationship between the defect in the cystic fibrosis transmembrane regulator (CFTR) gene and pulmonary inflammation has not been established. The aim of this study was to assess whether serum chemokines levels in cystic fibrosis patients correlate with genotype and pulmonary function tests, as well as with other clinical characteristics. Serum levels of interleukin-8, RANTES, and monocyte chemoattractant protein-1 were measured in 36 cystic fibrosis patients grouped according to their genotype. Group A included 25 patients who carried two mutations associated with a pathological sweat test and pancreatic insufficiency (deltaF508, W1282X, G542X, N1303K, S549R). Group B included 11 compound heterozygote patients who carried one mutation known to cause mild disease with borderline or normal sweat test and pancreatic sufficiency (3849+10kb C to T, 5T). Associations between chemokine levels, genotype, pulmonary function, Pseudomonas aeruginosa colonization, age, sweat chloride level, and pancreatic and nutritional status were examined. Mean interleukin-8 and monocyte chemoattractant protein-1 levels were significantly higher in group A than group B (11.4 +/- 2.1 pg/ml vs. 5 +/- 0.9 pg/ml and 157 +/- 16 pg/ml vs. 88.8 +/- 16.4 pg/ml, respectively) (P < 0.01). No difference in RANTES levels were found between groups. interleukin-8 levels were inversely related to forced expiratory volume in 1 s (r = -0.37, P < 0.02), while there was no association between the latter and RANTES and monocyte chemoattractant protein-1 levels. The Pseudomonas colonization rate was higher among group A patients than group B (88% vs. 40%, P < 0.01). No relationship was found between measured chemokines and age, sweat chloride levels, and pancreatic and nutritional status. Our study demonstrates an association between interleukin-8, forced expiratory volume, and cystic fibrosis genotype. Hence, elevated interleukin-8 serum levels could serve as an indicator of an early inflammatory process and encourage the initiation of anti-inflammatory treatment.
Comments [show]
None has been submitted yet.
No. Sentence Comment
5 Group A included 25 patients who carried two mutations associated with a pathological sweat test and pancreatic insufficiency (∆F508, W1282X, G542X, N1303K, S549R).
X
ABCC7 p.Ser549Arg 15672947:5:164
status: NEW28 Group A included 25 patients who carried two mutations associated with a pathological sweat test and pancreatic insufficiency (∆F508, W1282X, G542X, N1303K, S549R) [2].
X
ABCC7 p.Ser549Arg 15672947:28:164
status: NEW67 : Systemic inflammatory mediators and cystic fibrosis genotype 101 Table 1 Clinical characteristics of cystic fibrosis (CF) patients Group Aa (n=25) Group Bb (n=11) P Age (years) 16.9±7.2 17.7±9.1 NS Pancreatic sufficiency 0% 0/25 36.3% 4/11 <0.01 Sweat chloride (mmol/l) 105±28 92±18.6 NS Weight percentiles 19±19.8 57.2±25.2 <0.01 Sputum Pseudomonas 88% 22/24 40% 4/10 <0.01 a Group A CF patients carrying two mutations associated with severe disease presentation (∆F508, W1282X, G542X, N1303K, S549R) b Group B CF patients carrying mutations associated with mild disease presentation (3849+10kb CǞT, 5T) Table 2 Comparison of serum chemokine levels between groups (IL-8 interleukin-8, MCPI monocyte chemoattractant protein-1) Chemokine Group Aa Group Bb P IL-8 (pg/ml) 11.4±2.1 5.0±0.9 0.01 MCP1(pg/ml) 157±16 88.8+16.4 0.01 RANTES (pg/ml) 323±48 287.5±93 NS a Group A CF patients carrying two mutations associated with severe disease presentation (∆F508, W1282X, G542X, N1303K, S549R) b Group B CF patients carrying mutations associated with mild disease presentation (3849+10kb CÞT, 5T) Fig. 1 Relationship between interleukin-8 (IL-8) levels and forced expiratory volume in 1 s (FEV1) values defective protein production; class II, defective protein processing; class III, defective chloride channel regulation; and class IV, defective chloride channel conduction.
X
ABCC7 p.Ser549Arg 15672947:67:534
status: NEWX
ABCC7 p.Ser549Arg 15672947:67:1057
status: NEW[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]
Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.
Comments [show]
None has been submitted yet.
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C !
X
ABCC7 p.Ser549Arg 15880796:58:23
status: NEWX
ABCC7 p.Ser549Arg 15880796:58:41
status: NEW[hide] Mutation spectrum in Jewish cystic fibrosis patien... Am J Med Genet A. 2005 Jul 30;136(3):246-8. Quint A, Lerer I, Sagi M, Abeliovich D
Mutation spectrum in Jewish cystic fibrosis patients in Israel: implication to carrier screening.
Am J Med Genet A. 2005 Jul 30;136(3):246-8., 2005-07-30 [PMID:15948195]
Abstract [show]
We have tested 144 unrelated Jewish patients suffering from the classical form of cystic fibrosis. The patients were screened for a panel of 12 mutations including the six Ashkenazi founder mutations (DeltaF508, W1282X, N1303K, G542X, 3849 + 10 kb C-->T, 1717-1G > A) and six mutations that were found in non-Ashkenazi Jewish patients (S549R (T-->G), G85E, 405 + 1G-->A, W1089X, Y1092, and D1152H). Patients of Georgian origin were tested also for the Q359K/T360K mutation. In addition, all the patients were tested for the IVS-8 variant (9T/7T/5T). Of all the cystic fibrosis (CF)-bearing chromosomes, 94% (264/281) were accounted for by one of the known mutations, and none of the patients had the 5T allele of the IVS-8 variant. Single strand conformation polymorphism (SSCP) analysis of the coding sequence of the CFTR gene followed by sequencing showed eight mutations on ten CF chromosomes, leaving seven chromosomes (2.5%) with unknown mutations. We identified three mutations in two or more CF chromosomes, 2571 + 1insT in Jews from Iraq, 3121-1G > A in patients from Kurdistan and I1234V in Yemenite Jewish patients. The other five mutations appeared on a single allele and are considered "private mutations." In this study we have identified 99% of CF alleles in Ashkenazi Jewish patients, 91% in Jews of North African origin and 75% in Jewish patients from Iraq. The significance of these findings to the population screening in Israel is discussed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
25 MUTATION ANALYSIS The following mutations are routinely tested in Jewish patients: the Ashkenazi founder mutations, DF508, W1282X, N1303K, G542X, 3849 þ 10 kb C!T, 1717-1G > A [Abeliovich et al., 1992], mutations commonly found in non-Ashkenazi patients, S549R (T!G), G85E, 405 þ 1G!A, W1089X, Y1092X, D1152H.
X
ABCC7 p.Ser549Arg 15948195:25:260
status: NEW58 Mutations in the CF Bearing Alleles in the Jewish Patients According to the Ethnic Origin Country of origin Ashkenazi Morocco Tunisia Balkan Iraq Iran/ Kurdistan Georgia Yemen Total Number of alleles (%) 193 (69.0) 34 (12.1) 12 (4.3) 21 (7.5) 8 (2.8) 3 (0.7) 8 (2.8) 2 (0.7) 281 W1282X (%) 83 (42.8) 1 (8.3) 4 (19.0) 88 (31.3) DF508 (%) 65 (33.5) 24 (70.6) 3 (25.0) 7 (33.3) 1 100 (35.6) N1303K (%) 10 (5.2) 10 (3.6) G542X (%) 19 (10.3) 4 (19.0) 24 (8.5) 3849-10 kbC!T (%) 10 (5.1) 1 (2.9) 2 (9.5) 13 (4.6) 1717-1G!A (%) 2 (1.0) 2 (0.7) D1152H (%) 1 (0.5) 1 (0.4) S549R (T!G) (%) 4 (11.8) 4 (1.4) G85E (%) 2 (9.5) 2 (0.7) 405 þ 1G!A (%) 8 (66.7) 8 (2.8) Y1092X (%) 3 (37.5) 3 (1.1) W1089X (%) 2 (9.5) 2 (0.7) Q359K/T360K (%) 8 (100) 8 (2.8) I1234V (%) 2 (100) 2 (0.7) 2751 þ 1insT (%) 2 (25.0) 2 (0.7) 3121-1G > A (%) 1 1 (0.4) M952I (%) 1 (12.5) 1 (0.4) L165S (%) 1 (0.5) 1 (0.4) A455E (%) 1 (0.5) 1 (0.4) L997F (%) 1 (2.9) 1 (0.4) G1244E (%) 1 (2.9) 1 (0.4) Unkown (%) 1 (0.5) 3 (8.8) 2 (25.0) 1 7 (2.5) Mutation Spectrum in Jewish CF Patients [Wahab, 2003].
X
ABCC7 p.Ser549Arg 15948195:58:564
status: NEW69 We suggest that 15 mutations that were found on two or more CF chromosomes from unrelated patients (DF508, W1282X, N1303K, G542X, 3849 þ 10 kb C!T, 1717-1 G!A, S549R (T!G), G85E, 405 þ 1G!A, W1089X, Y1092X, 2751 þ 1insT, 3121-1G!A, Q359K/T360K, I1234V) be tested in the CF screening of all Jewish individuals regardless of their origin.
X
ABCC7 p.Ser549Arg 15948195:69:165
status: NEW[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2003 Dec;24(6):629-38. Gallati S
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2003 Dec;24(6):629-38., [PMID:16088579]
Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene, which encodes a protein expressed in the apical membrane of exocrine epithelial cells. CFTR functions principally as a cyclic adenosine monophosphate (cAMP)-induced chloride channel and appears capable of regulating other ion channels. Mutations affect CFTR through a variety of molecular mechanisms, which can produce little or no functional gene product at the apical membrane. More than 1000 different disease-causing mutations within the CFTR gene have been described. The potential of a mutation to contribute to the phenotype depends on its type, localization in the gene, and the molecular mechanism as well as on interactions with secondary modifying factors. Genetic testing can confirm a clinical diagnosis of CF and can be used for infants with meconium ileus, for carrier detection in individuals with positive family history and partners of proven CF carriers, and for prenatal diagnostic testing if both parents are carriers. Studies of clinical phenotype in correlation with CFTR genotype have revealed a very complex relationship demonstrating that some phenotypic features are closely determined by the underlying mutations, whereas others are modulated by modifier genes, epigenetic mechanisms, and environment.
Comments [show]
None has been submitted yet.
No. Sentence Comment
67 SSCP analysis is one of the most popular methods for the detection of sequence variants in polymerase chain reaction (PCR) amplified DNA fragments.29 The princi- Table 3 Cystic Fibrosis Mutations Detected by Commercial Kits INNO-LiPA Mutations CF2 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K CFTR12 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K, S1251N, R560T, 3905insT, Q552X CFTR17+Tn 394delTT, G85E, 621+1G→T, R117H, 1078delT, R347P, R334W, E60X, 2183AA→G, 2184delA, 711+5G→A, 2789+5G→A, R1162X, 3659delC, 3849+10kbC→T, 2143delT, A455E, (5T/7T/9T) Elucigene CF4 ⌬F508, G542X, G551D, 621+1G→T CF12 ⌬F508, G542X, G551D, N1303K, W1282X, 1717-1G→A, R553X, 621+1G→T, R117H, R1162X, 3849+10kbC→T, R334W CF20 1717-1G→A, G542X, W1282X, N1303K, ⌬F508, 3849+10kbC→T, 621+1G→T, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA→G, 3659delC, 1078delT, ⌬I507, R345P, S1251N, E60X CF Poly-T 5T/7T/9T OLA CF OLA assay ⌬F508, F508C, ⌬I507, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183AA→G, 2789+5G→A b Figure 2 Mutation screening of exon 19 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene using polymerase chain reaction (PCR) followed by single-strand conformation polymorphism/heteroduplex (SSCP/HD) analysis on a silver-stained polyacrylamide gel.
X
ABCC7 p.Ser549Arg 16088579:67:1196
status: NEW[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]
Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.
Comments [show]
None has been submitted yet.
No. Sentence Comment
47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T.
X
ABCC7 p.Ser549Arg 16126774:47:373
status: NEW[hide] Nucleotide binding domains of human CFTR: a struct... Cell Mol Life Sci. 2005 Sep;62(18):2112-23. Eudes R, Lehn P, Ferec C, Mornon JP, Callebaut I
Nucleotide binding domains of human CFTR: a structural classification of critical residues and disease-causing mutations.
Cell Mol Life Sci. 2005 Sep;62(18):2112-23., [PMID:16132229]
Abstract [show]
Defective function of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) causes CF, the most frequent lethal inherited disease among the Caucasian population. The structure of this chloride ion channel includes two nucleotide-binding domains (NBDs), whose ATPase activity controls channel gating. Recently, the experimental structures of mouse and human CFTR NBD1 and our model of the human CFTR NBD1/NBD2 heterodimer have provided new insights into specific structural features of the CFTR NBD dimer. In the present work, we provide a structural classification of CF-causing mutations which may complement the existing functional classification. Our analysis also identified amino acid residues which may play a critical role in interdomain interaction and are located at the NBD1-NBD2 interface or on the surface of the dimer. In particular, a cluster of aromatic amino acids, which includes F508 and straddles the two NBDs, might be directly involved in the interaction of the NBD1/NBD2 heterodimer with the channel-forming membrane-spanning domains.
Comments [show]
None has been submitted yet.
No. Sentence Comment
165 However, S549R (labeled M in fig. 2), which also involves a residue of the NBD1 ABC signature participating in the binding of the ATP γ-phosphate in the conventional site B, was identified as a class II mutation (fig. 1).
X
ABCC7 p.Ser549Arg 16132229:165:9
status: NEW[hide] Detection of F508del mutation in cystic fibrosis t... Singapore Med J. 2006 Feb;47(2):129-33. Zilfalil BA, Sarina S, Liza-Sharmini AT, Oldfield NJ, Stenhouse SA
Detection of F508del mutation in cystic fibrosis transmembrane conductance regulator gene mutation among Malays.
Singapore Med J. 2006 Feb;47(2):129-33., [PMID:16435054]
Abstract [show]
INTRODUCTION: Cystic fibrosis (CF) is one of the common genetic disorders in the western world. It has been reported to be very rare in Asian populations. According to the Cystic Fibrosis Genetic Analysis Consortium, more than 1,000 mutations of the CF gene have been identified. The CF gene, named the cystic fibrosis transmembrane conductance regulator (CFTR), is located on chromosome 7 and composed of 27 exons. This study aims to detect possible CFTR gene mutations in Malays. METHODS: We analysed 50 blood samples from healthy Malays with no symptoms of CF. DNA was extracted from blood using commercially available extraction kits (Eppendorf, Germany). Identification of CFTR gene mutation was performed using the CF OLA (Oligonucleotide Ligation Assay) kit (Applied Biosystems, USA). The PCR-ligation products were electrophoresed on eight percent sequagel using an ABI PRISM 377 genetic analyser (Applied Biosystems, USA). Electrophoresis data was analysed using the Genotyper software and a report of the CF genotype for all loci tested was created using the CF Genotyper Template software. Out of 50, one sample (two percent) was detected to have the F508del mutation (3bp deletion at exon 10), which is one of the most common CFTR gene mutations in Caucasians. RESULTS: The F508del mutation allele was detected in one subject. This indicates that she was a CF carrier. CONCLUSION: We report the finding of a carrier of the F508del mutation of the CFTR gene in the Malay population. Our finding revealed that CF could also affect the Malay population. Larger studies are necessary to determine the exact gene frequency of this population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
55 MUTATIONS R553X G551D 1507 del F508 del 1717-1 G>A G542X R560T R347P W1282X R334W 1078 Del T 3849 + 10KB C>T R1162X N1303K 3659 Del C A455E R117H 2183 AA>G 2789+5 G>A 1898 +1 G>A 621+1 G>T 711+1 G>T G85E S549N S549R V520F Q493X R347H 3849 +4 A>G 3905 INS T Y122X 4 software before running the gel electrophoresis in 1X TBE using ABI PRISM® 377 Genetic Analyzer (Applied Biosystems, USA) for 45 minutes.
X
ABCC7 p.Ser549Arg 16435054:55:210
status: NEW[hide] CFTR 5T variant has a low penetrance in females th... Genet Med. 2006 Jun;8(6):339-45. Sun W, Anderson B, Redman J, Milunsky A, Buller A, McGinniss MJ, Quan F, Anguiano A, Huang S, Hantash F, Strom C
CFTR 5T variant has a low penetrance in females that is partially attributable to its haplotype.
Genet Med. 2006 Jun;8(6):339-45., [PMID:16778595]
Abstract [show]
PURPOSE: The study's purpose was to understand the molecular basis for different clinical phenotypes of the 5T variant, a tract of 5 thymidines in intron 8 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which disrupts processing of CFTR mRNA and reduces synthesis from the corresponding CFTR alleles. METHOD: We analyzed the polymorphic TG dinucleotide repeat adjacent to the 5T variant in intron 8 and the codon 470 in exon 10. Patients selected for this study were positive for both the 5T variant and the major cystic fibrosis mutation, Delta F508. Almost all Delta F508 mutation alleles occur in a 10TG-9T-470M haplotype. Therefore, it is possible to determine the haplotype of the 5T variant in trans. RESULTS: Of the 74 samples analyzed, 41 (55%) were 11TG-5T-470M, 31 (42%) were 12TG-5T-470V, and 2 (3%) were 13TG-5T-470M. Of the 49 cases for which we had clinical information, 17.6% of females (6/34) and 66.7% of males (10/15) showed symptoms resembling atypical cystic fibrosis. The haplotype with the highest penetrance in females (42% or 5/12) and more than 80% (5/6) in males is 12TG-5T-470V. We also evaluated 12 males affected with congenital bilateral absence of vas deferens and positive for the 5T variant; 10 of 12 had the 12TG-5T-470V haplotype. CONCLUSION: Overall, the 5T variant has a milder clinical consequence than previously estimated in females. The clinical presentations of the 5T variant are associated with the 5T-12TG-470M haplotype.
Comments [show]
None has been submitted yet.
No. Sentence Comment
55 These mutations include R347H, S549N, S549R, 3876delA, 394delT, 3905insT, and V520F, in addition to the 25-mutation core panel recommended by ACMG/ACOG for population-based CF screening.
X
ABCC7 p.Ser549Arg 16778595:55:38
status: NEW[hide] Polymorphic markers suggest a gene flow of CFTR ge... J Hered. 2006 Jul-Aug;97(4):313-7. Epub 2006 Jul 12. Cabello GM, Cabello PH, Llerena JC Jr, Fernandes O
Polymorphic markers suggest a gene flow of CFTR gene from Sub-Saharan/Arabian and Mediterranean to Brazilian Population.
J Hered. 2006 Jul-Aug;97(4):313-7. Epub 2006 Jul 12., [PMID:16837565]
Abstract [show]
The analysis of 2 diallelic loci (M470V and T854T) and a microsatellite IVS8(T)n of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has shown different haplotype distribution in Brazilian cystic fibrosis (CF) chromosomes carrying different CF mutations. The DeltaF508 mutation was in absolute linkage disequilibrium with 1-1 haplotype (M470V-T854T). Most of DeltaF508 chromosomes (84%) were found to carry the IVS8-9T. The most frequent haplotypes IVS8-7T and 2-1 (M470V-T854T) were found associated with Non-DeltaF508 mutations. Although there is a remarkable linkage disequilibrium between these markers with CFTR locus, the mutations R334W (7T-1-2 and 7T-2-1) and the 3120 + 1G --> A (7T-1-2 and 9T-1-2) are associated with two different haplotypes probably introduced in the Brazilian population by migration. These findings suggest that recombination events from the original haplotype and gene flow among different ethnic groups (sub-Saharan and Mediterranean) might have resulted in CF mutations associated with different haplotypes by independent introductions.
Comments [show]
None has been submitted yet.
No. Sentence Comment
23 A previous screening of the whole coding region and flanking intronic sequences from the 23 exons of the CFTR gene in 190 chromosomes allowed us to identify 11 different mutations: DF508 (28.4%), G85E (4.7%), 3120 þ 1G / A (3.7%), R334W (2.6%), G542X (2.1%), P205S (1.0%), G551D (0.5%), R1162X (0.5%), Y1092X (0.5%), S549R (0.5%), and S4X (0.5%) (Cabello GMK, Cabello PH, Otsuki, and others 2005).
X
ABCC7 p.Ser549Arg 16837565:23:322
status: NEW[hide] Mutations in the cystic fibrosis transmembrane reg... Am J Respir Crit Care Med. 2006 Oct 1;174(7):787-94. Epub 2006 Jul 13. Wilschanski M, Dupuis A, Ellis L, Jarvi K, Zielenski J, Tullis E, Martin S, Corey M, Tsui LC, Durie P
Mutations in the cystic fibrosis transmembrane regulator gene and in vivo transepithelial potentials.
Am J Respir Crit Care Med. 2006 Oct 1;174(7):787-94. Epub 2006 Jul 13., 2006-10-01 [PMID:16840743]
Abstract [show]
AIM: To examine the relationship between cystic fibrosis transmembrane regulator gene mutations (CFTR) and in vivo transepithelial potentials. METHODS: We prospectively evaluated 162 men including 31 healthy subjects, 21 obligate heterozygotes, 60 with congenital bilateral absence of the vas deferens (CBAVD) and 50 with CF by extensive CFTR genotyping, sweat chloride and nasal potential difference testing. RESULTS: Six (10%) men with CBAVD carried no CFTR mutations, 18 (30%) carried one mutation, including the 5T variant, and 36 (60%) carried mutations on both alleles, for a significantly higher rate carrying one or more mutations than healthy controls (90% versus 19%, p < 0.001). There was an overlapping spectrum of ion channel measurements among the men with CBAVD, ranging from values in the control and obligate heterozygote range at one extreme, to values in the CF range at the other. All pancreatic-sufficient patients with CF and 34 of 36 patients with CBAVD with mutations on both alleles carried at least one mild mutation. However, the distribution of mild mutations in the two groups differed greatly. Genotyping, sweat chloride and nasal potential difference (alone or in combination) excluded CF in all CBAVD men with no mutations. CF was confirmed in 56% and 67% of CBAVD men carrying 1 and 2 CFTR mutations, respectively. CONCLUSION: Abnormalities of CFTR transepithelial function correlate with the number and severity of CFTR gene mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
68 One exception, a man in the CBAVD-2 group, carried ⌬F508 with a rare missense mutation (S549R), which has been observed in a CF-PI patient (35).
X
ABCC7 p.Ser549Arg 16840743:68:95
status: NEW[hide] One multiplex control for 29 cystic fibrosis mutat... Genet Test. 2007 Fall;11(3):256-68. Lebo RV, Bixler M, Galehouse D
One multiplex control for 29 cystic fibrosis mutations.
Genet Test. 2007 Fall;11(3):256-68., [PMID:17949287]
Abstract [show]
A simple approach is described to synthesize and clone an inexhaustible supply of any homozygous and/or heterozygous controls diluted with yeast genomic DNA to mimic human genome equivalents for use throughout the entire multiplex mutation assay. As a proof of principle, the 25 cystic fibrosis mutation panel selected by the American College of Medical Genetics and four additional mutant sequences were prepared as a single control mixture. The 29 CFTR mutations were incorporated into 17 gene fragments by PCR amplification of targeted sequences using mutagenic primers on normal human genomic DNA template. Flanking primers selected to bind beyond all published PCR primer sites amplified controls for most assay platforms. The 17 synthesized 433-933-bp CFTR fragments each with one to four homozygous mutant sequences were cloned into nine plasmid vectors at the multiple cloning site and bidirectionally sequenced. Miniplasmid preps from these nine clones were mixed and diluted with genomic yeast DNA to mimic the final nucleotide molar ratio of two CFTR genes in 6 x 10(9) bp total human genomic DNA. This mixture was added to control PCR reactions prior to amplification as the only positive control sample. In this fashion >200 multiplex clinical PCR analyses of >4,000 clinical patient samples have been controlled simultaneously for PCR amplification and substrate specificity for 29 tested mutations without cross contamination. This clinically validated multiplex cystic fibrosis control can be modified readily for different test formats and provides a robust means to control for all mutations instead of rotating human genomic controls each with a fraction of the mutations. This approach allows scores of additional mutation controls from any gene loci to be added to the same mixture annually.
Comments [show]
None has been submitted yet.
No. Sentence Comment
229 The nine normal sequences detected at other tested mutation sites (3876delA; S1255X; 2307insA; 1898ϩ5G Ǟ T; S549R; S549N; V520F; Y122X; and 394delTT) reflected the correct sequence in this mixture of nine cloned sequences.
X
ABCC7 p.Ser549Arg 17949287:229:120
status: NEW[hide] The changing face of the exocrine pancreas in cyst... Eur J Gastroenterol Hepatol. 2008 Mar;20(3):164-8. Augarten A, Ben Tov A, Madgar I, Barak A, Akons H, Laufer J, Efrati O, Aviram M, Bentur L, Blau H, Paret G, Wilschanski M, Kerem BS, Yahav Y
The changing face of the exocrine pancreas in cystic fibrosis: the correlation between pancreatic status, pancreatitis and cystic fibrosis genotype.
Eur J Gastroenterol Hepatol. 2008 Mar;20(3):164-8., [PMID:18301294]
Abstract [show]
OBJECTIVES: The aims of this study were to determine the current pancreatic status of the entire cystic fibrosis (CF) population of Israel, to analyze the clinical characteristics of the pancreatic sufficient (PS) patients, and to characterize the correlation between pancreatic status, pancreatitis, and CF genotype. METHODS: The Israeli CF database includes 505 patients. These patients were defined as being PS or insufficient according to their fecal pancreatic elastase level or by coefficient fat absorption findings. Mutations were categorized as severe (DeltaF508, W1282X, G542X, S549R, N1303K, Q359K/T360K, 405+1G, and 1717) or mild/variable (3849+10 kb, D1152H, G85E, I1234V, R334W, and 5T) based on disease severity in patients carrying these mutations. Age at diagnosis, presenting symptoms, sweat-chloride concentrations, occurrence of pancreatitis, presence of diabetes, and liver disease were recorded. RESULTS: One hundred and thirty-nine (27.5%) of the CF patients were PS. None carried two mutations associated with severe disease. Over one third (34%) had normal or borderline sweat tests; 20 of these 139 patients had pancreatitis (14.3%) but none of the 366 pancreatic insufficient patients had it. Four initially PS patients became pancreatic insufficient: conversion followed several events of pancreatitis in three of them. Nasal potential differences were all pathological in 35 tested PS patients. None had either diabetes or liver disease. CONCLUSIONS: A substantial number of CF patients are PS. All of them carry at least one mild mutation enabling production of a sufficient amount of normal mRNA to maintain exocrine pancreatic function. Pancreatitis occurs only in CF patients who are PS. These patients are at risk of progressing to pancreatic insufficiency.
Comments [show]
None has been submitted yet.
No. Sentence Comment
23 The mutations DF508, W1282X, G542X, S549R, Q359K/T360K, 405 + 1G, 1717, and N1303K were defined as severe and the mutations 3849 + 10 kb, D1152H, G85E, I1234V, R334W, and 5T were defined as mild/variable.
X
ABCC7 p.Ser549Arg 18301294:23:36
status: NEW46 of patients W1282X/3849 + 10 kb 15 W1282X/5T 15 DF508/5T 7 DF508/D1152H 6 DF508/3849 + 10 kb 5 W1282X/D1152H 5 W1282X/I1234V 2 3849 + 10 kb/405 + 1G- > A 2 R334W/R334W 2 5T/5T 2 D1152H/D1152H 1 D1152H/5T 1 D1152H/3849 + 10 kb 1 DF508/UKN 13 W1282X/UKN 11 5T/UKN 7 D1152H/UKN 3 1717/UNK 1 G85E/UKN 1 Q359K/T360K/UKN 1 S549R/UKN 1 3849 + 10 kb/UKN 1 UKN/UKN 36 CF, cystic fibrosis; CFTR, cystic fibrosis transmembrane regulator.
X
ABCC7 p.Ser549Arg 18301294:46:317
status: NEW[hide] Cystic fibrosis: defining a disease under-diagnose... Trop Med Int Health. 2009 May;14(5):542-5. Shah U, Frossard P, Moatter T
Cystic fibrosis: defining a disease under-diagnosed in Pakistan.
Trop Med Int Health. 2009 May;14(5):542-5., [PMID:19645745]
Abstract [show]
OBJECTIVE: Cystic fibrosis is frequently missed in the Pakistani population due to lack of appropriate diagnostic tools. Thus our aim was to define unknown disease-causing mutations to help create suitable diagnostic tests and improve understanding of what appears to be an aggressive and under-diagnosed disease in this population. METHODS: Patients with elevated sweat chloride values and clinically suspected CF were recruited from Aga Khan University, Pakistan. Mutations DF508, S549R, S549N, Y569D, 296 + 12(T>C), G553X, G551D and G551X were screened for by allele specific polymerase chain reactions. CFTR exons 10, 11 and 12 were sequenced by direct DNA sequencing. RESULTS: Of 150 patients tested by PCR, 26 (17.3%) were positive for DeltaF508. One patient was a F508/S549N compound heterozygote. Eighty-three of 87 patients sequenced for mutations in exon 10 were normal; 42/43 for exon 11 and 29 for exon 12 were normal. CONCLUSION: This first step in defining mutations involved in Pakistani CF suggests that DeltaF508 is uncommon and S549 was the only additional mutation identified in CFTR exons 10, 11 and 12. Identification of the remaining mutations and their frequency is required to design appropriate tests and improve understanding and management of the disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
29 For example, S549N (G>A) homozygosity previously reported from a Pakistani family has also been associated with significant disease, while in contrast another patient with a compound heterozygote mutation, S549R / R1158X gene, presented with a mild form of CF (Frossard et al. 1999; Romey et al. 1999).
X
ABCC7 p.Ser549Arg 19645745:29:206
status: NEW51 Common mutations such as DF508, S549R, S549N, Y569D, 296 + 12(T>C), R553X, G551D and G551X were screened by allele-specific polymerase chain reaction using published oligonucleotide sequences as template primers (Kerem et al. 1989; Riordan et al. 1989; Rommens et al. 1989; : Collins 1992b).
X
ABCC7 p.Ser549Arg 19645745:51:32
status: NEW60 The remaining 150 samples were tested by PCR for DF508, S549N, S549R, Y569D, 296 + 12(T>C), R553X, G551D, G551X (Table 1).
X
ABCC7 p.Ser549Arg 19645745:60:63
status: NEW81 These mutations were S549N, S549R, Y569D, 296 + 12(T>C), R553X, G551D and G551X.
X
ABCC7 p.Ser549Arg 19645745:81:28
status: NEW84 Some of the common mutations detected on PCR in our study, such as the S549N and S549R, were not confirmed by sequencing. We did confirm the results of one patient who was a compound heterozygote for the DF508 / S549N Table 1 Frequencies of mutations identified by allele specific PCR Mutations Homozygous Heterozygous delF508 12 14 S549N 0 1 S549R 1 19 Y569D 0 0 296 + 12(T>C) 0 0 R553X 0 0 G551D 0 0 G551X 0 0 Table 2 Mutations identified by sequencing Exon Sequenced (n) Mutations identified (n) Exon 10 87 4 Exon 11 43 1 Exon 12 29 0 Tropical Medicine and International Health volume 14 no 5 pp 542-545 may 2009 U. Shah et al. Cystic fibrosis in Pakistan ª 2009 Blackwell Publishing Ltd mutation and had very aggressive disease.
X
ABCC7 p.Ser549Arg 19645745:84:81
status: NEWX
ABCC7 p.Ser549Arg 19645745:84:343
status: NEW[hide] Independent contribution of common CFTR variants t... Pancreas. 2010 Mar;39(2):209-15. de Cid R, Ramos MD, Aparisi L, Garcia C, Mora J, Estivill X, Farre A, Casals T
Independent contribution of common CFTR variants to chronic pancreatitis.
Pancreas. 2010 Mar;39(2):209-15., [PMID:19812525]
Abstract [show]
OBJECTIVE: We have assessed whether CFTR gene has a major impact on chronic pancreatitis (CP) pathogenesis than that provided by the CFTR mutations. For this aim, we have evaluated clinical parameters, CFTR mutations, and 3 potential regulatory CFTR variants (coding single-nucleotide polymorphisms): c.1540A>G, c.2694T>G, and c.4521G>A. METHODS: CFTR gene analysis was performed in a cohort of 136 CP patients and 93 controls from Spanish population using current scanning techniques (single-strand conformation polymorphism/heteroduplex, denaturing gradient gel electrophoresis, and denaturing high-performance liquid chromatography) and direct sequencing. RESULTS: A higher frequency of CFTR mutations were observed in patients (39%) than in controls (15%; P < or = 0.001), differences being mostly attributable to the prevalence of the cystic fibrosis (CF)-causing mutations (P = 0.009). The analysis of variants has shown statistically significant differences between patients and controls for c.4521G>A (Pcorrected = 0.036). Furthermore, the multi-marker analysis revealed that the 1540A;2694G;4521A (AGA) haplotype was more prevalent in CP than controls (Pcorrected = 0.042). Remarkably, this association was unrelated to CF-causing mutations (P = 0.006). CONCLUSIONS: Our results corroborate the higher susceptibility of CF carriers to CP and, furthermore, suggest that the AGA haplotype could contribute to an increased risk in the development of CP irrespective of other CF-causing mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
38 Scanning Methodology Applied in CFTR Gene Analysis Amplicon Name Fragment Size, bp Control Set (n = 93) Patient Set 1 (n = 68) Patient Set 2 (n = 68) Control Sequence Exon 1 192 SSCP/HD SSCP/HD dHPLC 125G9C Exon 2 334 SSCP/HD SSCP/HD dHPLC 296+3insT Exon 3 309 DGGE DGGE dHPLC G85V Exon 4 436 SSCP/HD SSCP/HD dHPLC R117H Exon 5 466 DGGE DGGE dHPLC R170H Exon 6a 345 SSCP/HD SSCP/HD dHPLC L206W Exon 6b 331 SSCP/HD SSCP/HD SSCP/HD TTGA 6/7 Exon 7 410 SSCP/HD SSCP/HD dHPLC R334W Exon 8 328 DGGE DGGE dHPLC 1341+28C9T Exon 9 375 DGGE DGGE DGGE 7T/9T Exon 10 493 SSCP/HD SSCP/HD SSCP/HD F508del; 1540A/A Exon 11 322 DGGE DGGE dHPLC S549R Exon 12 426 DGGE DGGE dHPLC G576A Exon 13a 532 SSCP/HD SSCP/HD dHPLC R668C Exon 13b 498 SSCP/HD SSCP/HD dHPLC I807M Exon 14a 284 DGGE DGGE DGGE 2694T9G Exon 14b 211 DGGE DGGE dHPLC 2789+5G9A Exon 15 487 DGGE DGGE dHPLC D924N Exon 16 294 SSCP/HD SSCP/HD dHPLC 3041-71G9C Exon 17a 294 SSCP/HD SSCP/HD dHPLC L997F Exon 17b 463 DGGE DGGE dHPLC 3272-26A9G Exon 18 451 DGGE DGGE dHPLC N1148K Exon 19 588 SSCP/HD SSCP/HD SSCP/HD 3601-65C9A Exon 20 471 DGGE DGGE dHPLC W1282X Exon 21 477 DGGE DGGE DGGE 4029G9A Exon 22 339 SSCP/HD SSCP/HD dHPLC Q1352H Exon 23 249 DGGE DGGE dHPLC 4374+13A9G Exon 24 362 SSCP/HD SSCP/HD SSCP/HD 4521G9A Control set, general population series analyzed; patient set 1, previous patient series reported in 2004; and patient set 2, new patient series analyzed in this study.
X
ABCC7 p.Ser549Arg 19812525:38:629
status: NEW[hide] Non-classic cystic fibrosis associated with D1152H... Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15. Burgel PR, Fajac I, Hubert D, Grenet D, Stremler N, Roussey M, Siret D, Languepin J, Mely L, Fanton A, Labbe A, Domblides P, Vic P, Dagorne M, Reynaud-Gaubert M, Counil F, Varaigne F, Bienvenu T, Bellis G, Dusser D
Non-classic cystic fibrosis associated with D1152H CFTR mutation.
Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15., [PMID:19843100]
Abstract [show]
BACKGROUND: Limited knowledge exists on phenotypes associated with the D1152H cystic fibrosis transmembrane conductance regulator (CFTR) mutation. METHODS: Subjects with a D1152H allele in trans with another CFTR mutation were identified using the French Cystic Fibrosis Registry. Phenotypic characteristics were compared with those of pancreatic insufficient (PI) and pancreatic sufficient (PS) cystic fibrosis (CF) subjects in the Registry (CF cohort). RESULTS: Forty-two subjects with D1152H alleles were identified. Features leading to diagnosis included chronic sinopulmonary disease (n = 25), congenital absence of the vas deferens (n = 11), systematic neonatal screening (n = 4), and genetic counseling (n = 2). Median age at diagnosis was 33 [interquartile range (IQR, 24-41)] years in D1152H subjects. Median sweat chloride concentrations were 43.5 (39-63) mmol/l in D1152H subjects and were markedly lower than in PI and PS CF subjects (p < 0.05). Bronchiectasis was present in 67% of D1152H subjects, but Pseudomonas aeruginosa colonization and pancreatic insufficiency were present in <30% of subjects. Estimated rates of decline in forced expiratory volume in 1 s (FEV(1)) were lower in D1152H subjects vs PI CF subjects (p < 0.05). None of the D1152H subjects identified since 1999 had died or required lung transplantation. CONCLUSIONS: When present in trans with a CF-causing mutation, D1152H causes significant pulmonary disease, but all subjects had prolonged survival.
Comments [show]
None has been submitted yet.
No. Sentence Comment
42 The CF genetic analysis panel used in France seeks for 32 mutations: G85E, 394delTT, 621+1G>T, 711+1G>T, R334W, R347P, R347H, 1078delT, 5T/7T/9T, A455E, F508del, I507del, V520F, 1717-1G>A, G542X, G551D, R553X, R560T, S549R (T>G), S549N, 1898+1G>A, 2183AA>G, 2184delA, 2789+5G>A, 3120+1G>A, R1162X, 3659delC, 3849+10kbC>T, W1282X, 3905insT, 3876delA, N1303K.
X
ABCC7 p.Ser549Arg 19843100:42:217
status: NEW[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]
Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.
Comments [show]
None has been submitted yet.
No. Sentence Comment
48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT.
X
ABCC7 p.Ser549Arg 19897426:48:275
status: NEW[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]
Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.
Comments [show]
None has been submitted yet.
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure).
X
ABCC7 p.Ser549Arg 20059485:64:215
status: NEW[hide] Incidence, prevalence, etiology, and prognosis of ... Dig Dis Sci. 2010 Oct;55(10):2988-98. Epub 2010 Jan 28. Joergensen M, Brusgaard K, Cruger DG, Gerdes AM, de Muckadell OB
Incidence, prevalence, etiology, and prognosis of first-time chronic pancreatitis in young patients: a nationwide cohort study.
Dig Dis Sci. 2010 Oct;55(10):2988-98. Epub 2010 Jan 28., [PMID:20108119]
Abstract [show]
BACKGROUND/AIMS: Publications on etiology of chronic pancreatitis (CP) are infrequent. Etiologies today encompass genetic disorders. We wanted to describe etiologies of today and identify patients with genetic disorders like hereditary pancreatitis (HP), mutations in Serine Protease Inhibitor Kazal type1 (SPINK1), and the Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR) among patients formerly considered to have idiopathic CP. METHODS: Data on patients diagnosed with first-time CP < 30 years of age in Denmark identified in the Danish National Registry of Patients were retrieved. Patients previously considered to have idiopathic pancreatitis were offered genetic counseling and evaluation for HP, SPINK1, and CFTR mutations. RESULTS: In the period 1980-2004, 580 patients < 30 years of age presented with CP, the standardized prevalence ratio of CP increased from 11.7 per 100,000 person years in 1980-1984 to 17.0 per 100,000 in 2000-2004 (p < 0.001). The odds ratio (OR) having gallstone-related CP increased in the latter time period, especially in women, that of alcohol-induced CP decreased over time. OR having idiopathic CP increased in the latter period; 50% of patients with idiopathic pancreatitis accepted genetic reevaluation; 28 patients had a genetic mutation that totally or partly could explain their pancreatitis, nine of these had two, and 11 patients had HP. CONCLUSION: The prevalence of CP, especially in women, increased over time. Genetic causes that partly or totally could explain the CP were found in 54.90% (95% CI (40.45-68.62)) of those with idiopathic CP, as a minimum estimation 1.9% (95% CI (1.00-3.47)) of the total cohort had HP.
Comments [show]
None has been submitted yet.
No. Sentence Comment
49 1G [ T, F508del, S549 N, I507del, S549R, 2184delA, G551D, G85E, N1303 K, R560T, R117H, R347H, R347P, R334 W, 2789 ?
X
ABCC7 p.Ser549Arg 20108119:49:34
status: NEW[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]
Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function.
X
ABCC7 p.Ser549Arg 20932301:74:668
status: NEW[hide] Low abundance of sweat duct Cl- channel CFTR in bo... Am J Physiol Regul Integr Comp Physiol. 2011 Mar;300(3):R605-15. Epub 2011 Jan 12. Brown MB, Haack KK, Pollack BP, Millard-Stafford M, McCarty NA
Low abundance of sweat duct Cl- channel CFTR in both healthy and cystic fibrosis athletes with exceptionally salty sweat during exercise.
Am J Physiol Regul Integr Comp Physiol. 2011 Mar;300(3):R605-15. Epub 2011 Jan 12., [PMID:21228336]
Abstract [show]
To understand potential mechanisms explaining interindividual variability observed in human sweat sodium concentration ([Na(+)]), we investigated the relationship among [Na(+)] of thermoregulatory sweat, plasma membrane expression of Na(+) and Cl(-) transport proteins in biopsied human eccrine sweat ducts, and basal levels of vasopressin (AVP) and aldosterone. Lower ductal luminal membrane expression of the Cl(-) channel cystic fibrosis transmembrane conductance regulator (CFTR) was observed in immunofluorescent staining of sweat glands from healthy young adults identified as exceptionally "salty sweaters" (SS) (n = 6, P < 0.05) and from patients with cystic fibrosis (CF) (n = 6, P < 0.005) compared with ducts from healthy young adults with "typical" sweat [Na(+)] (control, n = 6). Genetic testing of healthy subjects did not reveal any heterozygotes ("carriers") for any of the 39 most common disease-causing CFTR mutations in the United States. SS had higher baseline plasma [AVP] compared with control (P = 0.029). Immunostaining to investigate a potential relationship between higher plasma [AVP] (and sweat [Na(+)]) and ductal membrane aquaporin-5 revealed for all groups a relatively sparse and location-dependent ductal expression of the water channel with localization primarily to the secretory coil. Availability of CFTR for NaCl transport across the ductal membrane appears related to the significant physiological variability observed in sweat salt concentration in apparently healthy humans. At present, a heritable link between healthy salty sweaters and the most prevalent disease-causing CFTR mutations cannot be established.
Comments [show]
None has been submitted yet.
No. Sentence Comment
114 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X.
X
ABCC7 p.Ser549Arg 21228336:114:317
status: NEW119 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X.
X
ABCC7 p.Ser549Arg 21228336:119:317
status: NEW[hide] Preconceptional identification of cystic fibrosis ... J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22. Coiana A, Faa' V, Carta D, Puddu R, Cao A, Rosatelli MC
Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program.
J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22., [PMID:21429822]
Abstract [show]
BACKGROUND: In Sardinia the mutational spectrum of CFTR gene is well defined. A mutation detection rate of 94% can be achieved by screening for 15 CFTR mutations with a frequency higher than 0.5%. The efficiency of this molecular test suggests that Sardinians may represent a suitable population for a preconceptional screening. METHODS: Five hundred couples of Sardinia descent were screened for 38 mutations using a semi-automated reverse-dot blot and PCR-gel electrophoresis assays. This mutation panel included the 15 most frequent CF alleles in Sardinia. RESULTS: We identified 38 CF carriers, revealing an overall frequency of 1/25 (4%). The most common CF allele was the p.Thr338Ile (T338I) (65%), followed by the p.Phe508del (F508del) (22.5%). We also identified one couple at risk and an asymptomatic female homozygote for the p.Thr338Ile allele. CONCLUSIONS: In spite of the low number of the couples tested, the results herein reported demonstrate the efficacy and efficiency of the preconceptional screening program and the high participation rate of the Sardinian population (99%).
Comments [show]
None has been submitted yet.
No. Sentence Comment
88 Mutation nomenclaturea Alleles (%) T338I (p.Thr338Ile) 26 (65.0) F508del (p.Phe508del) 9 (22.5) N1303K (p.Asn1303Lys) 1 (2.5) 2183AANG (c.2051_2052delAAinsG) 1 (2.5) 621+1GNT (c.489+1GNT) 1 (2.5) exon 2 del (c.54-5811_164+2187del8108ins182) 1 (2.5) R347P (p.Arg347Pro) 1 (2.5) The 3849+10kbCNT (c.3717+12191CNT), G85E (p.Gly85Glu), 2789+5GNA (c.2657+5GNA), W1282X (p.Trp1282X), G1244E (p.Gly1244Glu), 711+5GNA (c.579+5GNA), 711+1GNT (c.579+1GNA), 4016insT (p.Ser1297PhefsX5), G542X (p.Gly542X), 1717-1GNA (c.1585-1GNA), R553X (p.Arg553X), Q552X (p.Gln552X), G551D (p.Gly551Asp), S549R (ANC) (p.Ser549Arg), I507del (p.Ile507del), F508C (p.Phe508Cys), I502T (p.Ile502Thr), 1706del17 (p.Gln525LeufsX37), 1677delTA (p.Tyr515X), R117H (p.Arg117His), D1152H (p.Asp1152His), L1065P (p.Leu1065Pro), R1066H (p.Arg1066His), L1077P (p.Leu1077Pro), 4382delA (p.Glu1418ArgfsX14), R1162X (p.Arg1162X), R1158X (p.Arg1158X), 1259 insA (p.Gln378AlafsX4), 852del22 (p.Gly241GlufsX13), S912X (p.Ser912X), and 991del5bp (p.Asn287LysfsX19) mutations included in the CF panel were not detected in the population tested.
X
ABCC7 p.Ser549Arg 21429822:88:579
status: NEWX
ABCC7 p.Ser549Arg 21429822:88:594
status: NEW[hide] Cystic fibrosis carrier testing in an ethnically d... Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7. Rohlfs EM, Zhou Z, Heim RA, Nagan N, Rosenblum LS, Flynn K, Scholl T, Akmaev VR, Sirko-Osadsa DA, Allitto BA, Sugarman EA
Cystic fibrosis carrier testing in an ethnically diverse US population.
Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7., [PMID:21474639]
Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) and the frequency of specific disease-causing mutations vary among populations. Affected individuals experience a range of serious clinical consequences, notably lung and pancreatic disease, which are only partially dependent on genotype. METHODS: An allele-specific primer-extension reaction, liquid-phase hybridization to a bead array, and subsequent fluorescence detection were used in testing for carriers of 98 CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations among 364 890 referred individuals with no family history of CF. RESULTS: One in 38 individuals carried one of the 98 CFTR mutations included in this panel. Of the 87 different mutations detected, 18 were limited to a single ethnic group. African American, Hispanic, and Asian individuals accounted for 33% of the individuals tested. The mutation frequency distribution of Caucasians was significantly different from that of each of these ethnic groups (P < 1 x 10(1)). CONCLUSIONS: Carrier testing using a broad mutation panel detects differences in the distribution of mutations among ethnic groups in the US.
Comments [show]
None has been submitted yet.
No. Sentence Comment
127 Eighteen different mutations were identified in Ashkenazi Jewish individuals; 5 non-ACMG mutations (p.D1152H, c.54-5940_273ϩ10250del21kb, p.S549R, p.W1089X, p.
X
ABCC7 p.Ser549Arg 21474639:127:146
status: NEW[hide] Clinical outcomes in infants with cystic fibrosis ... Pediatr Pulmonol. 2011 Apr 29. doi: 10.1002/ppul.21475. Ren CL, Desai H, Platt M, Dixon M
Clinical outcomes in infants with cystic fibrosis transmembrane conductance regulator (CFTR) related metabolic syndrome.
Pediatr Pulmonol. 2011 Apr 29. doi: 10.1002/ppul.21475., 2011-04-29 [PMID:21538969]
Abstract [show]
An unavoidable outcome of cystic fibrosis newborn screening (CF NBS) programs is the detection of infants with an indeterminate diagnosis. The United States CF Foundation recently proposed the term cystic fibrosis transmembrane conductance regulator related metabolic syndrome (CRMS) to describe infants with elevated immunoreactive trypsinogen (IRT) on NBS who do not meet diagnostic criteria for CF. The objective of this study was to describe the clinical outcomes of infants with CRMS identified through an IRT/DNA algorithm. We reviewed the records of all infants with CRMS diagnosed at our CF Center from 2002 to 2010. We identified 12 infants, and compared them to 27 infants diagnosed with CF by NBS. Compared to CF patients, CRMS patients were more likely to be pancreatic sufficient as assessed by fecal elastase measurement (100% vs. 8%, P < 0.01). Their weight for age percentile was normal from birth. A positive oropharyngeal (OP) culture for Pseudomonas aeruginosa (Pa) was found in 25% of CRMS patients. One patient with the F508del/R117H/7T genotype was reassigned the diagnosis of CF after he had a positive OP culture for Pa, and his follow up sweat Cl at 1 year of life was 73 mmol/L. CF patients were more likely to receive oral antibiotics and be hospitalized for pulmonary symptoms. Our results indicate that CRMS patients can develop signs of CF disease, but have a milder clinical course than CF infants. Close initial monitoring of these patients is warranted. Pediatr. Pulmonol. (c) 2011 Wiley-Liss, Inc.
Comments [show]
None has been submitted yet.
No. Sentence Comment
60 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1-CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected.
X
ABCC7 p.Ser549Arg 21538969:60:473
status: NEW61 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1- CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected.
X
ABCC7 p.Ser549Arg 21538969:61:474
status: NEW[hide] Subject Review: Pancreatic Ductal Adenocarcinoma i... J Gastrointest Surg. 2011 Aug 2. Rittenhouse DW, Talbott VA, Anklesaria Z, Brody JR, Witkiewicz AK, Yeo CJ
Subject Review: Pancreatic Ductal Adenocarcinoma in the Setting of Mutations in the Cystic Fibrosis Transmembrane Conductance Regulator Gene: Case Report and Review of the Literature.
J Gastrointest Surg. 2011 Aug 2., 2011-08-02 [PMID:21809164]
Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most commonly inherited lethal autosomal recessive genetic disease amongst Caucasians. CF results from mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Patients with homozygous or compound heterozygous CFTR mutations have a risk of pancreatitis, but typically do not live long enough to develop pancreatic ductal adenocarcinoma (PDA), a disease that has an average age at diagnosis of 65 years. Little is known about the risk of the development of PDA in people who are heterozygous for mutations in the CFTR gene. PATIENTS AND METHODS: We report a case of a patient with PDA who underwent resection, who is a carrier for the W1282X nonsense mutation in the CFTR gene. The patient is of Ashkenazi Jewish ethnicity and has a family history of CF, but no family history of PDA. We reviewed the English language literature for the prevalence of PDA in CF patients (and CFTR mutations in the setting of PDA) and their significance in terms of screening, and the use of this mutation as a biomarker for an increased risk of the development of PDA. CONCLUSION: We conclude that patients with CFTR mutations, who also have other risks for the development of PDA such as a family history of the disease, should undergo screening and be educated about their risks.
Comments [show]
None has been submitted yet.
No. Sentence Comment
84 Klapman et al. suggested screening those patients that have two or more first degree relatives with PDA as Year Author Number of patients Average age (years) Pathology Genotype 2001 Malats 9 66.5 PDA 3 ΔF508 6 5T Allele 2003 Pezzilli 1 73.8 PDA 5T Allele 2003 Matsubayashi 42 Not reported PDA 6 ΔF508 36 5T Allele 2006 Piepoli 3 63 PDA 3 ΔF508 2010 Rebours 1 52 IPMN with PanIN-2 2789+G>A/5T Allele 2010 McWilliams 50 67 PDA 35 ΔF508 5 R117H 5 W1282X G551D N1303K R347 P S549R Δ1507 2011 Present Study 1 77 PDA W1282X Table 2 Patients with pancreatic tumors and heterozygous mutations in the CFTR gene CFTR cystic fibrosis transmembrane regulator, PDA pancreatic ductal adenocarcinoma, ΔF508 Delta F508, IPMN intraductal papillary mucinous neoplasm, PanIN-2 pancreatic intraepithelial neoplasia-2 well as those with a family history of any of the known hereditary pancreatic cancer syndromes such as familial adenomatous polyposis, hereditary nonpolyposis colorectal cancer syndrome, hereditary pancreatitis, hereditary breast/ ovarian cancer syndrome, Peutz-Jeghers syndrome, and familial atypical multiple mole and melanoma syndrome.24 It might be worthwhile for those patients with a family history of CF and who have other risk factors such as smoking and obesity, who are known carriers of any of the more disease-associated mutations (i.e., ΔF508, W1282X) to be screened for PDA.
X
ABCC7 p.Ser549Arg 21809164:84:495
status: NEW[hide] Evaluation of CFTR gene mutation testing methods i... Eur J Hum Genet. 1998 Mar-Apr;6(2):165-75. Dequeker E, Cassiman JJ
Evaluation of CFTR gene mutation testing methods in 136 diagnostic laboratories: report of a large European external quality assessment.
Eur J Hum Genet. 1998 Mar-Apr;6(2):165-75., [PMID:9781062]
Abstract [show]
Within the framework of the European Concerted Action on Cystic Fibrosis (Biomed-2, BMH4-CT96-0462) a quality assessment was set up for 135 European and one Australian laboratory. Six DNA samples were sent to the various laboratories. These samples carried the following CFTR genotypes: dF508/N1303K; dI507/wild; dF508/G551D; dF508/621 + 1 GtoT; R553X/wild and 1717-1 GtoA/wild. Each laboratory was asked to process the samples as they routinely do, whether they checked for all mutations or not. More than 75% of the laboratories screened for at least six of these mutations. Heteroduplex analysis was the most frequently used primary testing method (47%), in many instances followed by restriction enzyme digestion. Only a minority of the laboratories made use of a commercial CFTR mutation detection kit. On average, 91% of the laboratories correctly typed both alleles of a given DNA sample. However, 35% of the laboratories incorrectly typed one or more alleles from a total of 12 alleles included in the trial. One laboratory even failed to identify four of the different alleles correctly. The genotyping error frequency tended to be lower in laboratories which perform more than 200 CFTR mutation analyses per year. The results of this quality control trial suggest that there are many laboratories (35%) which have a percentage of errors unacceptable in a routine testing setting. The development of a consensus testing strategy for routine diagnostic laboratories and centralised mutation analysis facilities for rare or country-specific mutations in a limited number of expert centres, in combination with regular training sessions and quality assessments, should further improve genotyping.
Comments [show]
None has been submitted yet.
No. Sentence Comment
144 A fifth laboratory reported the presence of S549R instead of 1717-1 GtoA, based on the results of DGGE with GC-clamps, and confirmation by sequencing.
X
ABCC7 p.Ser549Arg 9781062:144:44
status: NEW155 Table 6 Detailed genotyping results of the DNA samples included in the quality control trial No. of Sample Allele 1 Allele 2 laboratories Method used CF96-1 dF508 N1303K 119 dF508/N1303K dF508 - 13 dF508 or dI507 N1303K 1 dF508 or dI507 - 1 dF508 wild 1 Inno-Lipa CF2 dF508 dF508 1 Heteroduplex Analysis/ARMS CF96-2 dI507 wild 93 dI507/wild - wild 17 dI507 or dF508 wild 3 dF508 wild 17 13 ´ Heteroduplex analysis 1 ´ allele specific PCR 1 ´ GeneScan analysis 1 ´ ASO reverse dot blot wild wild 1 administration error (Inno-Lipa CF2) dI507 N1303K 1 home-made line probe assay dI507 dF508 4 3 ´ Inno-Lipa CF2 1 ´ method not specified CF96-3 dF508 G551D 120 dF508/G551D dF508 - 7 dF508 G551D or R553X 1 dF508/dI507 G551D 2 broken tube 1 dF580 R553X 2 Restriction enzyme analysis dF508 R553X and G551D 2 1 ´ Restriction enzyme analysis 1 ´ RFLP dF508 2183AAtoG 1 ASO dot blot CF96-4 dF508 621+1 GtoT 53 dF508/621+1GtoT dF508 - 73 dF508 or dI507 621+1 GtoT 1 dF508 or dI507 - 1 wild 621+1 GtoT 1 dF508 wild 4 1 ´ SSCP 1 ´ RFLP 1 ´ home-made reverse dot blot 1 ´ Restriction enzyme analysis dF508 R553X 2 1 ´ SSCP 1 ´ Reverse dot blot dF508 R553X/3849+4 AtoG 1 1 ´ Restriction/enzyme analysis CF96-5 R553X wild 115 R553X/wild - wild 8 R553X or G551D wild 2 No amplification 5 G553X wild 2 administration error wild wild 2 1 ´ ARMS 1 ´ Restriction enzyme analysis R553X 621+1 GtoT 1 RFLP R553X 3849+10kb LtoT 1 Restriction enzyme analysis/ sequencing CF96-6 1717-1 GtoA wild 99 1717-1 GtoA/wild - wild 30 1717-1 GtoA 1717-1 GtoA 3 3 ´ Inno-Lipa CF2 W1717 wild 1 SSCP wild wild 1 Restriction enzyme analysis S549R wild 1 DGGE 1717+1 GtoA wild 1 ARMS administration error almost half of all laboratories.
X
ABCC7 p.Ser549Arg 9781062:155:1691
status: NEW[hide] Clinical and genetic risk factors for cystic fibro... Pediatrics. 1999 Jan;103(1):52-7. Wilschanski M, Rivlin J, Cohen S, Augarten A, Blau H, Aviram M, Bentur L, Springer C, Vila Y, Branski D, Kerem B, Kerem E
Clinical and genetic risk factors for cystic fibrosis-related liver disease.
Pediatrics. 1999 Jan;103(1):52-7., [PMID:9917439]
Abstract [show]
OBJECTIVE: The aim of this study was to define the role of possible risk factors for the development of cystic fibrosis (CF)-related liver disease and to analyze the association between liver disease and the different genotypes present in the Israeli CF patient population. PATIENTS AND METHODS: All patients followed at the seven CF centers in Israel were included in this study. Liver disease was determined by persistently elevated serum liver enzymes and/or bilirubin, and/or significant ultrasonographic changes suggestive of chronic liver disease. The following clinical parameters were evaluated: ethnic origin, age at assessment of liver function, sex, history of meconium ileus, pancreatic function, history of distal intestinal obstruction syndrome, pulmonary function, and cystic fibrosis transmembrane conductance regulator mutation analysis. RESULTS: Of the 288 patients screened, 80 (28%) had liver disease. Of the 256 patients with pancreatic insufficiency, 80 (31%) had liver disease compared with none of the 32 patients with pancreatic sufficiency. Genotype-phenotype correlation was performed on 207 patients carrying identified mutations that were previously classified according to phenotype severity. Liver disease was found in 56 (32%) of 173 patients carrying mutations associated with a severe phenotype and in 6 (38%) of 16 patients carrying at least one mutation associated with a variable genotype (G85E and/or 5T allele). None of the 18 patients carrying the 3849+10kb C->T mutation had liver disease. Prevalence of liver disease increased with age. No correlation was found between liver disease and severity of lung disease, nutritional status, history of meconium ileus, or distal intestinal obstruction syndrome. CONCLUSION: CF patients who have pancreatic insufficiency and carry mutations associated with a severe or a variable genotype are at increased risk to develop liver disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
117 Classification of Identified Genotype According to Severity of Disease Severe n Milder n Variable n Unclassified n ⌬F508/⌬F508 52 3849 ϩ 10kbC 3 T/⌬F508 7 ⌬F508/G85E 1 S549R/S549R 1 W1282X/W1282X 30 3849 ϩ 10kbC 3 T/405 ϩ 1G3A 3 G85E/G85E 5 S549R/G542X 2 ⌬F508/W1282X 39 3849 ϩ 10 kbC 3 T/W1282X 7 G85E/5T 1 S549R/W1282X 1 ⌬F508/G542X 10 3849 ϩ 10kbC 3 T/G85E 1 ⌬F508/5T 1 ⌬F508/W1089X 1 W1282X/G542X 12 W1282X/5T 2 Y1092X/Y1092X 1 W1282X/N1303K 7 W1282X/5T 1 Q359K-T360K/?
X
ABCC7 p.Ser549Arg 9917439:117:202
status: NEWX
ABCC7 p.Ser549Arg 9917439:117:208
status: NEWX
ABCC7 p.Ser549Arg 9917439:117:287
status: NEWX
ABCC7 p.Ser549Arg 9917439:117:367
status: NEW[hide] Cystic fibrosis-type mutational analysis in the AT... J Biol Chem. 1994 Aug 12;269(32):20575-83. Hoof T, Demmer A, Hadam MR, Riordan JR, Tummler B
Cystic fibrosis-type mutational analysis in the ATP-binding cassette transporter signature of human P-glycoprotein MDR1.
J Biol Chem. 1994 Aug 12;269(32):20575-83., 1994-08-12 [PMID:7914197]
Abstract [show]
Members of the ATP-binding cassette transporter superfamily such as the P-glycoproteins (MDR) and the cystic fibrosis transmembrane conductance regulator (CFTR) share conserved sequence motifs in their nucleotide binding fold that are the major targets for CFTR mutations in patients with cystic fibrosis. Cystic fibrosis-type mutations were introduced at analogous positions into the human MDR1 gene. Heterologous expression of wild-type or mutated MDR1 revealed similar mRNA transcript levels in Chinese hamster ovary K1 recipients, but the subsequent processing was defective for all mutations that give rise to severe cystic fibrosis in the case of CFTR. Functional multidrug transporter MDR1, however, was obtained when amino acid substitutions were introduced into a less conserved position of the ATP-binding cassette transporter signature (codon 536 in MDR1). The profile of cross-resistance and chemosensitization was modulated in these codon 536 variants, which suggests that this region is involved in the drug transport function of P-glycoprotein.
Comments [show]
None has been submitted yet.
No. Sentence Comment
25 Besides the major mutationAF508, a cluster of missense mutations resides in the linker peptide(Fig. 1).AF508, S549R (Keremet al., 1990; Sangiuloet al.,19911,and G551D (Cuttingetal., 1990;Hamosh et al., 1992)were identified in patients withtypical pulmonary andgastrointestinalmanifestations of CFdiseasewhereas R553Q has been foundon the complex allele AF508-R553Qin a Cystic Fibrosis GeneticAnalysis Consortium,personal communication.
X
ABCC7 p.Ser549Arg 7914197:25:110
status: NEW163 CFTR S549R and G551D are severe CF mutations(Kerem et al., 1990;Sanguiolo et al., 1991; Hamosh et al., 1992).
X
ABCC7 p.Ser549Arg 7914197:163:5
status: NEW[hide] CFTR mutations in patients from Colombia: implicat... Hum Mutat. 2003 Sep;22(3):259. Keyeux G, Rodas C, Bienvenu T, Garavito P, Vidaud D, Sanchez D, Kaplan JC, Aristizabal G
CFTR mutations in patients from Colombia: implications for local and regional molecular diagnosis programs.
Hum Mutat. 2003 Sep;22(3):259., [PMID:12938099]
Abstract [show]
Cystic Fibrosis is a worldwide distributed hereditary disease. The incidence of the main (p.F508del) and other frequent mutations has been determined in a great number of countries and ethnic groups, but its incidence in most Latin American countries has remained unknown until recently. It is now beginning to be recognized as a frequent cause of infant mortality, and some countries report the incidence of their mutations. Colombia started several years ago a concerted program of molecular study of patients which were clinically diagnosed as probable cystic fibrosis. We screened the whole CFTR (ABCC7) coding sequence in 92 patients from 6 different geographic regions, using conventional PAGE analyses and DGGE followed by sequencing. Additionally, we established the frequency of the p.F508del mutation in 130 unrelated healthy controls. The results of this pilot study in Colombian patients from various ethnic admixture show six main mutations: p.F508del (41.8%), c.1811+1.6kbA>G (6.5%), p.G542X (3.8%), p.S549R (2.2%), p.W1282X (1.1%) and p.R1162X (1.1%). Thirteen other rare mutations, including three novel, were detected, accounting for a total of 63.6% known mutations. There is a great variability between the geographic regions, both in the frequency of the p.F508del mutation and non-p.F508del CF chromosomes. Our results point to a varied origin of the disease genes. These results also show that careful scrutiny of the mutations is needed in each part of Latin America in order to establish priority-screening protocols adapted to each country and region.
Comments [show]
None has been submitted yet.
No. Sentence Comment
8 The results of this pilot study in Colombian patients from various ethnic admixture show six main mutations: p.F508del (41.8%), c.1811+1.6kbA>G (6.5%), p.G542X (3.8%), p.S549R (2.2%), p.W1282X (1.1%) and p.R1162X (1.1%).
X
ABCC7 p.Ser549Arg 12938099:8:170
status: NEW43 The fourth mutation is p.S549R (T to G at position 1779), present on 4 chromosomes (2.2%).
X
ABCC7 p.Ser549Arg 12938099:43:25
status: NEW50 CFTR Mutation Frequencies in Colombian Cystic Fibrosis Patients MUTATION ANTIOQUIA BOGOTA BOLIVAR CALDAS VALLE OTHER COLOMBIA n=34 n=76 n=20 n=10 n=24 n=20 n=184 N (%) N (%) N (%) N (%) N (%) N (%) N (%) p.F508del 16 (47.1) 31 (40.8) 5 (25) 6 (60.0) 10 (41.7) 9 (45.0) 77 (41.8) c.1811+1.6KbA>G 0 8 (10.5) 2 (10.0) 0 1 (4.2) 1 (5.0) 12 (6.5) p.G542X 0 4 (5.3) 0 0 2 (8.3) 1 (5.0) 7 (3.8) p.S549R 1 (2.9) 3 (3.9) 0 0 0 0 4 (2.2) p.W1282X 0 1 (1.3) 0 0 1 (4.2) 0 2 (1.1) p.R1162X 0 0 2 (10.0) 0 0 0 2 (1.1) p.A559T 1 (2.9) 0 0 0 0 0 1 (0.5) p.Y1092X 0 0 1 (5.0) 0 0 0 1 (0.5) p.R334W 0 0 0 0 1 (4.2) 0 1 (0.5) c.1215delG 0 1 (1.3) 0 0 0 0 1 (0.5) c.2185_2186insC 0 0 0 0 0 1 (5.0) 1 (0.5) c.2789+5G>A 0 0 0 0 1 (4.2) 0 1 (0.5) c.3120+1G>A 0 0 1 (5.0) 0 0 0 1 (0.5) c.3849+1G>A 0 1 (1.3) 0 0 0 0 1 (0.5) p.R1066C 0 1 (1.3) 0 0 0 0 1 (0.5) p.N1303K 1 (2.9) 0 0 0 0 0 1 (0.5) c.3500-2A>G* 1 (2.9) 0 0 0 0 0 1 (0.5) c.1323_1324insA* 0 0 1 (5.0) 0 0 0 1 (0.5) p.H609R* 0 0 0 0 0 1 (5.0) 1 (0.5) Unidentified 14 (41.2) 26 (34.2) 8 (40.0) 4 (40.0) 8 (33.3) 7 (35) 67 (36.4) The regions of the country where few patients were studied are grouped as other.
X
ABCC7 p.Ser549Arg 12938099:50:390
status: NEW69 Comparison of the Spectrum of CFTR Mutations in Colombia and Other Ibero-American Countries COLOMBIA1 SPAIN2 MEXICO3 ARGENTINA4 BRAZIL5 MUTATION n=92 n=1356 n=194 n=228 n=272 % % % % % p.F508del 41.8 54.42 40.72 57 45.6 p.G542X 3.8 7.7 6.18 3.94 6.6 p.W1282X 1.1 0.5 0 3.07 2.2 p.R1162X 1.1 1.3 0 0.43 4.4 p.N1303K 0.5 2.5 2.06 1.75 2.9 c.1811+1.6KbA>G 6.5 1.5 0 0.43 0 p.S549R 2.2 0.07 0 0 0 p.A559T 0.5 0 0 0 0 p.Y1092X 0.5 0.01 0.51 0 0 p.R334W 0.5 0.9 0 0 2.9 c.1215delG 0.5 0 0 0 0 c.2185_2186insC 0.5 0 0 0 0 c.2789+5G>A 0.5 0.7 0 0.43 0 c.3120+1G>A 0.5 0 0 0 0 c.3849+1G>A 0.5 0 0 0 0 p.R1066C 0.5 0.7 0 0.43 0 c.3500-2A>G (novel) 0.5 0 0 0 0 c.1323_1324insA (novel) 0.5 0 0 0 0 p.H609R (novel) 0.5 0 0 0 0 Other a (# mutations) - (32) 1.8 (30) 5.28 (9) 4.89 (8) 6.98 Unknown 36.4 17.9 25.25 27.63 28.3 a The frequencies of the other rare mutations found in Spain, Mexico, Argentina and Brazil are pooled together, and the number of different mutations is given in parenthesis.
X
ABCC7 p.Ser549Arg 12938099:69:372
status: NEW[hide] A neutral variant involved in a complex CFTR allel... Hum Genet. 2005 May;116(6):454-60. Epub 2005 Mar 3. Clain J, Lehmann-Che J, Girodon E, Lipecka J, Edelman A, Goossens M, Fanen P
A neutral variant involved in a complex CFTR allele contributes to a severe cystic fibrosis phenotype.
Hum Genet. 2005 May;116(6):454-60. Epub 2005 Mar 3., [PMID:15744523]
Abstract [show]
In order to further elucidate the contribution of complex alleles to the wide phenotypic variability of cystic fibrosis (CF), we investigated the structure-function relationships of a severe CF-associated complex allele [p.S912L;p.G1244V]. To evaluate the contribution of each mutation to the phenotype, cystic fibrosis transmembrane conductance regulator (CFTR) mutants were expressed in HeLa cells and analysed for protein processing and Cl- channel activity. Both p.G1244V and [p.S912L;p.G1244V] mutants had normal protein processing but markedly decreased Cl- channel activity compared with wild-type. Notably, the double mutant displayed a dramatic decrease in Cl- channel activity compared with p.G1244V (P<0.001). p.S912L had normal protein processing and no detectable impact on CFTR function. In other respects, the p.S912L variation was identified in compound heterozygosity with p.R709X in a healthy fertile man. Together, these data strongly support the view that p.S912L in isolation should be considered as a neutral variant but one that might significantly impair CFTR function when inherited in cis with another CFTR mutation. Our data also further document the contribution of complex alleles to the wide phenotypic variability of CF. The results of functional studies of such complex alleles in other genetic diseases are discussed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
105 The sequence change À102T fi A attenuates the effects of the severe p.S549R (T fi G) missense mutation by causing a significant increase in CFTR expression in vitro.
X
ABCC7 p.Ser549Arg 15744523:105:75
status: NEW106 This explains the striking differences in genotype-phenotype correlations between patients carrying mutation p.S549R alone, who presented severe disease, and patients carrying the complex allele [À102T fi A; p.S549R], who exhibit milder forms of CF (Romey et al. 2000).
X
ABCC7 p.Ser549Arg 15744523:106:111
status: NEWX
ABCC7 p.Ser549Arg 15744523:106:215
status: NEW[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]
Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4.
X
ABCC7 p.Ser549Arg 17331079:52:75
status: NEW67 Seven other complex alleles were observed: [c.296 + 3insT; p.V754M], [p.F508del; p.I1027T], [p.S549R; -102T > A], [p.G576A; p.R668C], [p.R1070W; p.R668C], [p.D1270N; p.R74W] and [p.T1299I; p.I148T].
X
ABCC7 p.Ser549Arg 17331079:67:95
status: NEW105 Our impression is that Table 3 Common CF mutations identified in this study and in several Latin American populations Mutation This study Hispanic1 Mexico2 Colombia3 Brazil4 Argentina5 Chile6 p.F508del 51.7 51.6 40.7 41.8 48.4 58.6 45.0 p.G542X 7.7 4.0 6.2 3.8 8.8 4.1 7.0 p.N1303K 2.9 0.8 2.0 0.5 2.5 2.7 - c.1811 + 1,6kbA > G 1.8 - - 6.5 - 0.9 - p.R334W 1.8 1.6 - 0.5 2.5 1.1 2.0 p.L206W 1.6 - - - 0.6 - - c.711 + 1G > T 1.6 - - - - - - p.Q890X 1.4 - - - - - - p.R1162X 1.3 0.8 - 1.1 2.5 0.4 2.0 c.2789 + 5G > A 1.2 - - 0.5 0.3 0.7 - p.R1066C 1.2 1.6 - 0.5 - 0.2 - p.I507del 1.0 - 2.6 - - 0.7 - c.2183AA > G 0.8 - 1.0 - 0.2 - p.G85E 0.7 0.8 0.5 - 1.3 0.7 - p.W1282X 0.7 0.8 - 1.1 1.3 2.7 5.0 c.3849 + 10kbC > T 0.4 4.0 0.5 - - 0.9 3.0 p.S549N - 2.4 2.6 - - - - c.3120 + 1G > A - 1.6 - 0.5 - - - c.3876delA - 5.6 - - - - - c.406-1G > A - 1.6 1.5 - - - - c.935delA - 1.6 1.0 - - - - p.R75X - 0.8 1.5 - - - - c.2055del9 - - 1.0 - - - - p.I506T - - 1.0 - - - - c.3199del6 - - 1.0 - - - - p.S549R 0.4 - - 2.2 - 0.2 - c.1717-1G > A 0.2 - - - 0.3 1.1 - p.G551D 0.2 0.8 0.5 - - - 1.0 p.R553X 0.4 - 0.5 - 0.6 0.2 1.0 No.
X
ABCC7 p.Ser549Arg 17331079:105:991
status: NEW[hide] Genetic, epidemiological, and clinical aspects of ... Am J Gastroenterol. 2010 Aug;105(8):1876-83. Epub 2010 May 25. Joergensen MT, Brusgaard K, Cruger DG, Gerdes AM, Schaffalitzky de Muckadell OB
Genetic, epidemiological, and clinical aspects of hereditary pancreatitis: a population-based cohort study in Denmark.
Am J Gastroenterol. 2010 Aug;105(8):1876-83. Epub 2010 May 25., [PMID:20502448]
Abstract [show]
OBJECTIVES: In a population-based, well-defined group of patients first regarded as having pancreatitis of unknown origin (PUO), we identified, described, and compared the clinical and genetic aspects of patients with hereditary pancreatitis (HP) and with cystic fibrosis transmembrane conductance regulator gene (CFTR) and serine protease inhibitor Kazal type 1 gene (SPINK1) mutations with patients who retained the diagnosis of true idiopathic pancreatitis (tIP) after genetic testing for HP, SPINK1, and CFTR mutations. METHODS: Patients with PUO were identified in the Danish National Registry of Patients or were referred by clinicians. DNA from blood was analyzed for cationic trypsinogen (PRSS1), SPINK1, and CFTR mutations. Considering the diagnosis of HP, a pedigree was drawn for each patient. RESULTS: A genetic mutation was found in 40% of 122 patients with PUO. After testing first-degree relatives of the 18 initially identified HP patients, 38 HP patients in total were identified, and 28 patients had SPINK1-CFTR mutations. Among HP patients, no p.N29I mutations were found and the p.A16V mutation was more frequent than previously reported, 45 and 32% had exocrine and endocrine insufficiency, respectively, and among tIP patients 9 and 12%, respectively. Pancreatic cancer was diagnosed in 5% of the HP families. CONCLUSIONS: The genotype of the Danish population with HP differs from that of previously described cohorts. The occurrence of exocrine and endocrine insufficiency is higher among patients with HP than in patients with SPINK1-CFTR mutations and tIP, and more HP families develop pancreatic cancer. Genetic testing thus helps to predict the prognosis of the pancreatitis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
57 The samples were also tested for 33 CFTR mutations, and all 6 classeswererepresented:394delTT,p.R553X,621+1G>T,p.R1162X, 1717-1G>A,3659delC,p.G542X,2183AA>G,p.W1282X,1078delT, 711+1G>T, F508del, p.S549N, I507del, p.S549R, 2184delA, p.G551D, p.G85E, p.N1303K, p.R560T, p.R117H, p.R347H, p.R347P, p.R334W, 2789+5G>A, 3849+10kbC>T, p.A445E, 3120+1G>A, p.V520F,1898+1G>A,3876delA,3905insT,andIVS8-5T.DNAwas amplified by multiplex PCR (Hybaid 4 A62, Middlesex, UK).
X
ABCC7 p.Ser549Arg 20502448:57:215
status: NEW[hide] Cystic fibrosis in Chilean patients: Analysis of 3... J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30. Lay-Son G, Puga A, Astudillo P, Repetto GM
Cystic fibrosis in Chilean patients: Analysis of 36 common CFTR gene mutations.
J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30., [PMID:21036675]
Abstract [show]
BACKGROUND: CFTR gene mutations have worldwide differences in prevalence and data on Chilean patients is scarce. METHODS: We studied 36 of the most common CFTR mutations in Chilean patients from the CF National Program [Programa Nacional de Fibrosis Quistica (PNFQ)] of the Ministry of Health of Chile. RESULTS: Two hundred and eighty-nine patients were studied. Fourteen different mutations were identified with an overall allele detection rate of 42.0%. Mutations with frequencies greater than 1% were p.F508del (30.3% of alleles), p.R334W (3.3%), p.G542X (2.4%), c.3849+10Kb C>T (1.7%), and p.R553X (1.2%). A north to south geographical gradient was observed in the overall rate of detection. CONCLUSIONS: Southern European CFTR mutations predominate in the Chilean population, but a high percentage of alleles remain unknown. Geographical heterogeneity could be explained in part by admixture. Complementary analyses are necessary to allow for effective genetic counselling and improve cost-effectiveness of screening and diagnostic tests.
Comments [show]
None has been submitted yet.
No. Sentence Comment
81 Mutation This study Rios et al. [4] Molina et al. [5] Repetto et al. [6] Perez et al. [13] CFGAC [2] (n=578) (%) (n=72) (%) (n=36) (%) (n=100) (%) (n=4102) (%) (n=43,849) (%) Chile Chile Chile Chile Latin-Americaa Worldwide Unknown 58.0 66.6 61.1 34.0 36.7 22.7 p.F508del 30.6 29.2 30.6 45.0 47.1 66.0 p.R334W 3.1 - - 2.0 0.8 0.1 p.G542X 2.4 0 8.3 7.0 5.0 2.4 c.3849+10Kb CNT 1.7 - - 3.0 0.3 0.2 p.R553X 1.2 4.2 0 1.0 0.4 0.7 p.R1162X 0.9 - - 2.0 1.0 0.3 p.1078delT 0.5 - - 0 b0.1 0.1 p.G85E 0.5 - - - 0.8 0.2 p.W1282X 0.2 - - 5.0 1.0 1.2 c.3120+1 GNA 0.2 - - - 0.3 - c.711+1 GNT 0.2 - - - 0.1 0.1 p.R117H 0.2 - - 0 b0.1 0.3 p.A455E 0.2 - - 0 0 0.1 p.I148T 0.2 - - - - - p.G551D 0 0 0 1.0 0.1 1.6 p.N1303K 0 0 0 0 1.8 1.3 c.621+1 GNT 0 - - 0 0.2 0.7 c.1717-1 GNA 0 - - 0 0.3 0.6 p.I507del 0 - - 0 0.2 0.2 p.R347P 0 - - 0 0 0.2 c.2789+5 GNA 0 - - - 0.2 0.1 c.1898+1 GNA 0 - - - 0.1 0.1 c.2184delA 0 - - - b0.1 0.1 p.S549N 0 - 0 - 0.1 0.1 c.3659delC 0 - - 0 0.1 0.1 p.R560T 0 - - - 0 0.1 c.1811+1.6Kb ANG 0 - - - 0.4 - c.2183AANG 0 - - 0 0.1 - p.S549R 0 - - - 0.1 - c.3272-26 ANG 0 - - - 0.1 - c.3199del6 0 - - - b0.1 - p.E60X 0 - - 0 0 - c.3905insT 0 - - - 0 - p.S1251N 0 - - 0 - - CFTRdele2,3 0 - - - - - p.R347H 0 - - - - - p.V520F 0 - - - - - p.Q552X 0 - - - - - c.394delTT 0 - - - - - c.711+1 GNA 0 - - - - - c.2143delT 0 - - - - - c.3876delA 0 - - - - - a Data from Chilean patients published in Rios et al., Molina et al., and Repetto et al. [4-6] included in this publication were excluded in this table to avoid repetition.
X
ABCC7 p.Ser549Arg 21036675:81:1044
status: NEW[hide] Functional insertion of the SV40 large T oncogene ... J Biol Chem. 1991 Nov 5;266(31):21239-46. Chastre E, Di Gioia Y, Barbry P, Simon-Bouy B, Mornet E, Fanen P, Champigny G, Emami S, Gespach C
Functional insertion of the SV40 large T oncogene in cystic fibrosis intestinal epithelium. Characterization of CFI-3 cells.
J Biol Chem. 1991 Nov 5;266(31):21239-46., [PMID:1718974]
Abstract [show]
Intestinal epithelial cells were isolated from a fetus with cystic fibrosis (CF) and transfected with a plasmid vector recombined with the ori- mutant of SV40. A population of proliferative cells was then subcloned and designated as CFI-3. These cells had a doubling time of 24 h and were maintained in culture for up to 25 passages. At passage 8, CFI-3 cells did not produce any tumors in nude mice. Northern blot and immunofluorescence studies indicated that the extended lifespan of CFI-3 cells results in genomic insertion of SV40 LT. Intestinal CFI-3 cells are epithelial, according to the expression of the human cytokeratin 18 gene and poorly differentiated by phase-contrast and electron microscopy. Functional membrane receptors activated by vasoactive intestinal peptide (VIP), its natural analogue pituitary adenylate cyclase activating peptide (PACAP-38), and isoproterenol were observed in CFI-3 cells. Restriction fragment length polymorphism analysis of the PstI KM19 site revealed that the cftr locus was identical in the chorionic villi and in CFI-3 cells. The manifestation of CF in this family was not related to the common mutation delta F508, since this fetus was heterozygous for the substitutions S549N and N1303K. Chloride transport, assessed by the 125I efflux, was induced in CFI-3 cells by the calcium inophore ionomycin, but not by the adenylate cyclase activator forskolin, and was inhibited by the chloride channel blocker 5-nitro-2-(3-phenylpropylamino)benzoic acid. These results were confirmed in patch clamp studies in which the cpt cAMP analogue failed to stimulate membrane currents, while the calcium ionophore ionomycin stimulated inward currents. We conclude that intestinal CFI-3 cells retain the CF phenotype relating to defective regulation of Cl- channels, and therefore constitute a suitable model, 1) for elucidating the function of CFTR protein, 2) developing new therapeutic agents, and 3) correcting the CF defect by gene replacement therapy in vitro.
Comments [show]
None has been submitted yet.
No. Sentence Comment
208 Preliminary data from a studyof the Jewish population in Israel and Arabic patients with CF indicatedthat other mutationsat the same position were relatively abundant, such as the S549R and S5491substitutions, both expressing a severe manifestation of the disease (21).
X
ABCC7 p.Ser549Arg 1718974:208:180
status: NEW[hide] Mutations in the linker domain of NBD2 of SUR inhi... EMBO J. 2002 Aug 15;21(16):4250-8. Matsuo M, Dabrowski M, Ueda K, Ashcroft FM
Mutations in the linker domain of NBD2 of SUR inhibit transduction but not nucleotide binding.
EMBO J. 2002 Aug 15;21(16):4250-8., [PMID:12169627]
Abstract [show]
ATP-sensitive potassium (K(ATP)) channels are composed of an ATP-binding cassette (ABC) protein (SUR1, SUR2A or SUR2B) and an inwardly rectifying K(+) channel (Kir6.1 or Kir6.2). Like other ABC proteins, the nucleotide binding domains (NBDs) of SUR contain a highly conserved "signature sequence" (the linker, LSGGQ) whose function is unclear. Mutation of the conserved serine to arginine in the linker of NBD1 (S1R) or NBD2 (S2R) did not alter the ability of ATP or ADP (100 microM) to displace 8-azido-[(32)P]ATP binding to SUR1, or abolish ATP hydrolysis at NBD2. We co-expressed Kir6.2 with wild-type or mutant SUR in Xenopus oocytes and recorded the resulting currents in inside-out macropatches. The S1R mutation in SUR1, SUR2A or SUR2B reduced K(ATP) current activation by 100 microM MgADP, whereas the S2R mutation in SUR1 or SUR2B (but not SUR2A) abolished MgADP activation completely. The linker mutations also reduced (S1R) or abolished (S2R) MgATP-dependent activation of Kir6.2-R50G co-expressed with SUR1 or SUR2B. These results suggest that the linker serines are not required for nucleotide binding but may be involved in transducing nucleotide binding into channel activation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
30 Likewise, the CFTR linker mutations G551D and S549R did not change the ATP-binding af®nity of puri®ed NBD1 (Qu et al., 1997), whereas G551D reduced the ATPase activity (Li et al., 1996).
X
ABCC7 p.Ser549Arg 12169627:30:46
status: NEW[hide] Molecular analysis of ABCD1 gene in Indian patient... Clin Chim Acta. 2011 Nov 20;412(23-24):2289-95. Epub 2011 Aug 26. Shukla P, Gupta N, Gulati S, Ghosh M, Vasisht S, Sharma R, Gupta AK, Kalra V, Kabra M
Molecular analysis of ABCD1 gene in Indian patients with X-linked adrenoleukodystrophy.
Clin Chim Acta. 2011 Nov 20;412(23-24):2289-95. Epub 2011 Aug 26., [PMID:21889498]
Abstract [show]
BACKGROUND: X-linked Adrenoleukodystrophy (X-ALD), with an incidence of 1:14,000 is the most frequent monogenic demyelinating disorder worldwide. The principal biochemical abnormality in X-ALD is the increased levels of saturated, unbranched very long chain fatty acids (VLCFA). It is caused by mutations in ABCD1 gene. No molecular data on X-ALD is available in India and mutational spectrum in Indian patients is not known. METHODS: We standardized conformation sensitive gel electrophoresis (CSGE) method to detect mutations in ABCD1 gene in twenty Indian patients with X-ALD. The results were confirmed by sequencing. Genotype-phenotype correlation was also attempted. Prenatal diagnosis (PND) in one family was done using chorionic villi (CV) sample at 12 weeks of gestation. RESULTS: Out of twenty, causative mutations could be identified in twelve patients (60%). Six reported and four novel mutations were identified. Three polymorphisms were also observed. No hot spot was found. No significant genotype-phenotype correlation could be established. CONCLUSIONS: The study identified the mutation spectrum of Indian X-ALD patients, which enabled us to offer accurate genetic counseling, carrier detection and prenatal diagnosis where needed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
103 The CFTR mutants p.Ser549Ile, p.Ser549Arg, that involve the same amino acid position as in the ALD mutant fail to produce mature CFTR and therefore prevent trafficking to the correct cellular localization [18].
X
ABCC7 p.Ser549Arg 21889498:103:32
status: NEW[hide] Identification of mutations in the putative ATP-bi... J Clin Invest. 1994 Aug;94(2):516-20. Fanen P, Guidoux S, Sarde CO, Mandel JL, Goossens M, Aubourg P
Identification of mutations in the putative ATP-binding domain of the adrenoleukodystrophy gene.
J Clin Invest. 1994 Aug;94(2):516-20., [PMID:8040304]
Abstract [show]
The recently identified adrenoleukodystrophy (ALD) gene is predicted to encode a peroxisomal protein of 745 amino acids that includes one domain for ATP-binding, termed nucleotide-binding fold (NBF). To determine whether mutations occur in the putative NBF of ALD protein, we analyzed by denaturing gradient gel electrophoresis (DGGE) exon 6 and 8 that encode most part of this domain in 50 ALD patients. Four amino acid substitutions, three frameshift mutations leading to premature termination signal, and a splicing mutation were identified. These amino acid substitutions occurred at residues highly conserved in other ATP-binding cassette (ABC) proteins. In addition, a nonsense mutation was detected in exon 4.
Comments [show]
None has been submitted yet.
No. Sentence Comment
48 Asterisks indicate the posi- *l I U13 | tion of the four missense mutations in ALD protein (ALDP): R518W substitution occurs at the same amino acid position as in the CFTR mutant S1255P, and S606L at the same position as in the S5491 or S549R CFTR mutants; R617C and R617H have no equivalents in CFTR mutants.
X
ABCC7 p.Ser549Arg 8040304:48:237
status: NEW143 The CFTR mutants S5491 and S549R, that involve the same amino acid position as in the ALD mutant S606L, fail to produce mature CFTR and therefore prevent trafficking to the correct cellular localization ( 12).
X
ABCC7 p.Ser549Arg 8040304:143:27
status: NEW[hide] Distinct functions and cooperative interaction of ... Proc Natl Acad Sci U S A. 2001 Jun 19;98(13):7431-6. Epub 2001 May 29. Karttunen JT, Lehner PJ, Gupta SS, Hewitt EW, Cresswell P
Distinct functions and cooperative interaction of the subunits of the transporter associated with antigen processing (TAP).
Proc Natl Acad Sci U S A. 2001 Jun 19;98(13):7431-6. Epub 2001 May 29., [PMID:11381133]
Abstract [show]
The ATP-binding cassette (ABC) transporter TAP translocates peptides from the cytosol to awaiting MHC class I molecules in the endoplasmic reticulum. TAP is made up of the TAP1 and TAP2 polypeptides, which each possess a nucleotide binding domain (NBD). However, the role of ATP in peptide binding and translocation is poorly understood. We present biochemical and functional evidence that the NBDs of TAP1 and TAP2 are non-equivalent. Photolabeling experiments with 8-azido-ATP demonstrate a cooperative interaction between the two NBDs that can be stimulated by peptide. The substitution of key lysine residues in the Walker A motifs of TAP1 and TAP2 suggests that TAP1-mediated ATP hydrolysis is not essential for peptide translocation but that TAP2-mediated ATP hydrolysis is critical, not only for translocation, but for peptide binding.
Comments [show]
None has been submitted yet.
No. Sentence Comment
283 Not only is the absence of this serine unique among ABC transporters, but a mutation at this site in CFTR (S549R) is responsible for some cases of cystic fibrosis (46).
X
ABCC7 p.Ser549Arg 11381133:283:107
status: NEW[hide] Structural biology of Rad50 ATPase: ATP-driven con... Cell. 2000 Jun 23;101(7):789-800. Hopfner KP, Karcher A, Shin DS, Craig L, Arthur LM, Carney JP, Tainer JA
Structural biology of Rad50 ATPase: ATP-driven conformational control in DNA double-strand break repair and the ABC-ATPase superfamily.
Cell. 2000 Jun 23;101(7):789-800., [PMID:10892749]
Abstract [show]
To clarify the key role of Rad50 in DNA double-strand break repair (DSBR), we biochemically and structurally characterized ATP-bound and ATP-free Rad50 catalytic domain (Rad50cd) from Pyrococcus furiosus. Rad50cd displays ATPase activity plus ATP-controlled dimerization and DNA binding activities. Rad50cd crystal structures identify probable protein and DNA interfaces and reveal an ABC-ATPase fold, linking Rad50 molecular mechanisms to ABC transporters, including P glycoprotein and cystic fibrosis transmembrane conductance regulator. Binding of ATP gamma-phosphates to conserved signature motifs in two opposing Rad50cd molecules promotes dimerization that likely couples ATP hydrolysis to dimer dissociation and DNA release. These results, validated by mutations, suggest unified molecular mechanisms for ATP-driven cooperativity and allosteric control of ABC-ATPases in DSBR, membrane transport, and chromosome condensation by SMC proteins.
Comments [show]
None has been submitted yet.
No. Sentence Comment
127 across the concave side of the dimer (Figure 4B), which interface of the Rad50 dimer and is analogous to a mutation in CFTR (S549R) that results in cystic fibrosis (Zie-widens toward its ends.
X
ABCC7 p.Ser549Arg 10892749:127:125
status: NEW167 As likely both ATP molecules5A) and is analogous to a CFTR mutation, S549R.
X
ABCC7 p.Ser549Arg 10892749:167:69
status: NEW[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]
Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.
Comments [show]
None has been submitted yet.
No. Sentence Comment
81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations.
X
ABCC7 p.Ser549Arg 22581207:81:2697
status: NEW[hide] Retrospective analysis of stored dried blood spots... J Cyst Fibros. 2012 Jul;11(4):332-6. doi: 10.1016/j.jcf.2012.01.001. Epub 2012 Feb 1. Barben J, Gallati S, Fingerhut R, Schoeni MH, Baumgartner MR, Torresani T
Retrospective analysis of stored dried blood spots from children with cystic fibrosis and matched controls to assess the performance of a proposed newborn screening protocol in Switzerland.
J Cyst Fibros. 2012 Jul;11(4):332-6. doi: 10.1016/j.jcf.2012.01.001. Epub 2012 Feb 1., [PMID:22300503]
Abstract [show]
BACKGROUND: Newborn screening (NBS) for Cystic Fibrosis (CF) has been introduced in many countries, but there is no ideal protocol suitable for all countries. This retrospective study was conducted to evaluate whether the planned two step CF NBS with immunoreactive trypsinogen (IRT) and 7 CFTR mutations would have detected all clinically diagnosed children with CF in Switzerland. METHODS: IRT was measured using AutoDELFIA Neonatal IRT-Kit in stored NBS cards. RESULTS: Between 2006 and 2009, 66 children with CF were reported, 4 of which were excluded for various reasons (born in another country, NBS at 6 months, no informed consent). 98% (61/62) had significantly higher IRT compared to matched control group. There was one false negative IRT result in an asymptomatic child with atypical CF (normal pancreatic function and sweat test). CONCLUSIONS: All children but one with atypical CF would have been detected with the planned two step protocol.
Comments [show]
None has been submitted yet.
No. Sentence Comment
80 CFTR mutations Alleles found Percentage of total Homozygous (n) F508del a 86 68.2 30 3905insT a 4 3.2 1 G542X a 3 2.4 - R553X a 3 2.4 1 W1282X a 2 1.6 - 1717-1 GNA a 2 1.6 - N1303K a 0 0.0 - S549R 3 2.4 1 Q525X 3 2.4 - Y1092X 2 1.6 - 3120+1 GNA b 2 1.6 1 2347delG 2 1.6 - 2176insC 1 0.8 - 3659delC 1 0.8 - 3359delCTCTG 1 0.8 - W1089X 1 0.8 - 711+1 GNT 1 0.8 - D1152H 1 0.8 - G1244E 1 0.8 - R1066C 1 0.8 - R31C 1 0.8 - R347P 1 0.8 - R74W 1 0.8 - S945L 1 0.8 - T501I 1 0.8 - K68X 1 0.8 - Total 126 100.0% 34 a Seven most common CF-gene mutations in Switzerland ("Swiss panel")=79.4% (100/126) of alleles.
X
ABCC7 p.Ser549Arg 22300503:80:191
status: NEW[hide] Ivacaftor potentiation of multiple CFTR channels w... J Cyst Fibros. 2012 May;11(3):237-45. doi: 10.1016/j.jcf.2011.12.005. Epub 2012 Jan 30. Yu H, Burton B, Huang CJ, Worley J, Cao D, Johnson JP Jr, Urrutia A, Joubran J, Seepersaud S, Sussky K, Hoffman BJ, Van Goor F
Ivacaftor potentiation of multiple CFTR channels with gating mutations.
J Cyst Fibros. 2012 May;11(3):237-45. doi: 10.1016/j.jcf.2011.12.005. Epub 2012 Jan 30., [PMID:22293084]
Abstract [show]
BACKGROUND: The investigational CFTR potentiator ivacaftor (VX-770) increased CFTR channel activity and improved lung function in subjects with CF who have the G551D CFTR gating mutation. The aim of this in vitro study was to determine whether ivacaftor potentiates mutant CFTR with gating defects caused by other CFTR gating mutations. METHODS: The effects of ivacaftor on CFTR channel open probability and chloride transport were tested in electrophysiological studies using Fischer rat thyroid (FRT) cells expressing different CFTR gating mutations. RESULTS: Ivacaftor potentiated multiple mutant CFTR forms with defects in CFTR channel gating. These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations. CONCLUSION: These in vitro data suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support investigation of the potential clinical benefit of ivacaftor in CF patients who have CFTR gating mutations beyond G551D.
Comments [show]
None has been submitted yet.
No. Sentence Comment
4 These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations.
X
ABCC7 p.Ser549Arg 22293084:4:40
status: NEW39 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11].
X
ABCC7 p.Ser549Arg 22293084:39:39
status: NEW67 The CF-associated CFTR mutations, S549N, S549R, and S1251N, are located in the ABC signature sequence (Fig. 4; LSGGQ; S549N,R in NBD1) and Walker A motif (Fig. 4; S1251N in NBD2), that form the ATP binding sites [14].
X
ABCC7 p.Ser549Arg 22293084:67:41
status: NEW68 Immunoblot and Ussing chamber studies indicated that, although the maturation of S549N- and S1251N-CFTR was similar to normal, the baseline level of chloride transport was b10% of normal CFTR (Figs. 1 and 3; Table 2).
X
ABCC7 p.Ser549Arg 22293084:68:41
status: NEW69 S549R-CFTR showed maturation comparable to 26±2% (n=5) of normal CFTR (Fig. 1D), which did not account for the b1% of normal CFTR function (Fig. 3; Table 2).
X
ABCC7 p.Ser549Arg 22293084:69:0
status: NEW70 These results indicated that the function of S549N-, S549R-, and S1251N-CFTR at the cell surface was minimal.
X
ABCC7 p.Ser549Arg 22293084:70:0
status: NEWX
ABCC7 p.Ser549Arg 22293084:70:53
status: NEW71 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTRmRNA (%NormalCFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTRMaturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations MatureCFTR (%NormalCFTR) A B D C Mature Immature Fig. 1.
X
ABCC7 p.Ser549Arg 22293084:71:53
status: NEWX
ABCC7 p.Ser549Arg 22293084:71:75
status: NEWX
ABCC7 p.Ser549Arg 22293084:71:201
status: NEWX
ABCC7 p.Ser549Arg 22293084:71:318
status: NEWX
ABCC7 p.Ser549Arg 22293084:71:454
status: NEW82 Taken together, these data suggested that defective channel gating was the predominant defect in S549N-, S549R- and S1251N-CFTR.
X
ABCC7 p.Ser549Arg 22293084:82:105
status: NEW83 In FRT cells expressing S549N-, S549R-, and S1251N-CFTR, acute addition of 10 μM ivacaftor increased the channel open probability and total chloride transport by N10-fold over baseline levels (Figs. 2 and 3; Tables 1 and 2).
X
ABCC7 p.Ser549Arg 22293084:83:105
status: NEW91 In addition, we showed that the 3 additional mutations, S549N, S549R, and S1251N also have characteristics consistent with gating defects.
X
ABCC7 p.Ser549Arg 22293084:91:63
status: NEW96 Taken together, these in vitro results provide a rationale for testing the potential benefit of ivacaftor in individuals with CF who have a CFTR gating mutation other than G551D, including the G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P, and G1349D CFTR gating mutations.
X
ABCC7 p.Ser549Arg 22293084:96:209
status: NEW97 Evaluation of CF-associated CFTR mutations that were expected to cause protein alterations in the ATP-binding sites formed by the NBDs indicated that S549N- and S1251N-CFTR also shared similar in vitro functional characteristics with G551D-CFTR and could be classified as CFTR gating mutations.
X
ABCC7 p.Ser549Arg 22293084:97:209
status: NEW98 Unlike S549N-CFTR and S1251N-CFTR, S549R-CFTR exhibited a partial reduction in the level of CFTR maturation compared to normal CFTR (see also Ref. [16]).
X
ABCC7 p.Ser549Arg 22293084:98:35
status: NEW99 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 µM Ivacaftor * * * * * * * * * * * CFTR Mutation ChannelOpenProbability ChannelOpenProbability (%NormalCFTR) B 1pA 3sec + 10 µM Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2.
X
ABCC7 p.Ser549Arg 22293084:99:25
status: NEWX
ABCC7 p.Ser549Arg 22293084:99:35
status: NEWX
ABCC7 p.Ser549Arg 22293084:99:86
status: NEWX
ABCC7 p.Ser549Arg 22293084:99:416
status: NEW106 Patch-clamp studies showed that the channel open probability of S549R-CFTR was less than 1% of normal CFTR.
X
ABCC7 p.Ser549Arg 22293084:106:64
status: NEW107 These results indicated that although the predominant defect caused by the S549R CFTR mutation was defective CFTR channel gating, a mild processing defect was also observed.
X
ABCC7 p.Ser549Arg 22293084:107:64
status: NEWX
ABCC7 p.Ser549Arg 22293084:107:75
status: NEW127 Like G551D, the G551S, G1244E, S1255P, and G1349D CFTR gating mutations, as well as the S549N, S549R, and S1251N CFTR gating mutations identified in the Table 1 Effect of ivacaftor on the channel gating activity of CFTR with gating mutations.
X
ABCC7 p.Ser549Arg 22293084:127:95
status: NEW128 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 μ;M ivacaftor Baseline With 10 μM ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57±0.03 100 0.63±0.02 111 0.400±0.04 100 0.800±0.04 a 200 G551D 0.46±0.06 81 0.46±0.03 81 0.019±0.01 b 5 0.121±0.035 a 30 G178R 0.59±0.11 103 0.66±0.08 116 0.005±0.001 b 1 0.228±0.022 a 57 S549N 0.55±0.02 97 0.61±0.02 108 0.003±0.010 b 1 0.396±0.119 a 99 S549R 0.45±0.01 b 79 0.55±0.02 a 96 0.004±0.010 b 1 0.143±0.031 a 36 G551S 0.57±0.13 100 0.64±0.02 113 0.010±0.001 b 3 0.337±0.110 a 84 G970R 0.55±0.03 96 0.55±0.03 97 0.001±0.001 b 0 0.245±0.042 a 61 G1244E 0.44±0.11 77 0.54±0.08 94 0.011±0.010 b 3 0.470±0.122 a 118 S1251N 0.54±0.07 95 0.63±0.04 111 0.003±0.010 b 1 0.350±0.03 a 88 S1255P 0.70±0.03 b 122 0.71±0.02 125 0.018±0.016 b 5 0.468±0.168 a 117 G1349D 0.49±0.08 85 0.63±0.06 111 0.019±0.015 b 5 0.315±0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation.
X
ABCC7 p.Ser549Arg 22293084:128:95
status: NEWX
ABCC7 p.Ser549Arg 22293084:128:545
status: NEW130 0 100 200 300 400 -9 -8 -7 -6 -5 -4 G178R G551D G551S 0 S549N S549R Ivacaftor [Log M] 0 100 200 300 400 0 50 100 150 200 -9 -8 -7 -6 -5 -4 G970R G1244E S1255P G1349D 0 S1251N Ivacaftor [Log M] ChlorideTransport (%NormalCFTR) Normal Forskolin G178R G551S G970R G1244E 50 2 1 min S1255P Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 0 50 100 150 200 * * * * * * * * * * * * * CFTR Mutation ChlorideTransport(µA/cm2)ChlorideTransport(µA/cm2) ChlorideTransport(A/cm2) ChlorideTransport (%NormalCFTR) B G1349D G551D A F508del C S549N S549R S1251N Baseline Baseline present study, cause protein alterations in the ATP binding pockets formed by the two NBDs required for normal CFTR channel gating (Fig. 4) [2].
X
ABCC7 p.Ser549Arg 22293084:130:62
status: NEWX
ABCC7 p.Ser549Arg 22293084:130:318
status: NEWX
ABCC7 p.Ser549Arg 22293084:130:590
status: NEW131 The G178R and G970R CFTR gating mutations alter the intracellular cytoplasmic loops that are believed to link the ATP-driven conformational changes in the NBDs to the opening of the CFTR channel pore formed by the membrane spanning domains [27].
X
ABCC7 p.Ser549Arg 22293084:131:62
status: NEWX
ABCC7 p.Ser549Arg 22293084:131:321
status: NEWX
ABCC7 p.Ser549Arg 22293084:131:607
status: NEW144 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D.
X
ABCC7 p.Ser549Arg 22293084:144:247
status: NEW40 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11].
X
ABCC7 p.Ser549Arg 22293084:40:39
status: NEW72 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTR mRNA (% Normal CFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTR Maturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations Mature CFTR (% Normal CFTR) A B D C Mature Immature Fig. 1.
X
ABCC7 p.Ser549Arg 22293084:72:75
status: NEWX
ABCC7 p.Ser549Arg 22293084:72:201
status: NEWX
ABCC7 p.Ser549Arg 22293084:72:321
status: NEWX
ABCC7 p.Ser549Arg 22293084:72:458
status: NEW92 In addition, we showed that the 3 additional mutations, S549N, S549R, and S1251N also have characteristics consistent with gating defects.
X
ABCC7 p.Ser549Arg 22293084:92:63
status: NEW100 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 &#b5;M Ivacaftor * * * * * * * * * * * CFTR Mutation Channel Open Probability Channel Open Probability (% Normal CFTR) B 1pA 3sec + 10 &#b5;M Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2.
X
ABCC7 p.Ser549Arg 22293084:100:25
status: NEWX
ABCC7 p.Ser549Arg 22293084:100:86
status: NEWX
ABCC7 p.Ser549Arg 22293084:100:420
status: NEW108 These results indicated that although the predominant defect caused by the S549R CFTR mutation was defective CFTR channel gating, a mild processing defect was also observed.
X
ABCC7 p.Ser549Arg 22293084:108:75
status: NEW129 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 bc;M ivacaftor Baseline With 10 bc;M ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57&#b1;0.03 100 0.63&#b1;0.02 111 0.400&#b1;0.04 100 0.800&#b1;0.04 a 200 G551D 0.46&#b1;0.06 81 0.46&#b1;0.03 81 0.019&#b1;0.01 b 5 0.121&#b1;0.035 a 30 G178R 0.59&#b1;0.11 103 0.66&#b1;0.08 116 0.005&#b1;0.001 b 1 0.228&#b1;0.022 a 57 S549N 0.55&#b1;0.02 97 0.61&#b1;0.02 108 0.003&#b1;0.010 b 1 0.396&#b1;0.119 a 99 S549R 0.45&#b1;0.01 b 79 0.55&#b1;0.02 a 96 0.004&#b1;0.010 b 1 0.143&#b1;0.031 a 36 G551S 0.57&#b1;0.13 100 0.64&#b1;0.02 113 0.010&#b1;0.001 b 3 0.337&#b1;0.110 a 84 G970R 0.55&#b1;0.03 96 0.55&#b1;0.03 97 0.001&#b1;0.001 b 0 0.245&#b1;0.042 a 61 G1244E 0.44&#b1;0.11 77 0.54&#b1;0.08 94 0.011&#b1;0.010 b 3 0.470&#b1;0.122 a 118 S1251N 0.54&#b1;0.07 95 0.63&#b1;0.04 111 0.003&#b1;0.010 b 1 0.350&#b1;0.03 a 88 S1255P 0.70&#b1;0.03 b 122 0.71&#b1;0.02 125 0.018&#b1;0.016 b 5 0.468&#b1;0.168 a 117 G1349D 0.49&#b1;0.08 85 0.63&#b1;0.06 111 0.019&#b1;0.015 b 5 0.315&#b1;0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation.
X
ABCC7 p.Ser549Arg 22293084:129:527
status: NEW145 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D.
X
ABCC7 p.Ser549Arg 22293084:145:247
status: NEW[hide] Measurements of CFTR-Mediated Cl(-) Secretion in H... PLoS One. 2012;7(10):e47708. doi: 10.1371/journal.pone.0047708. Epub 2012 Oct 17. Sousa M, Servidoni MF, Vinagre AM, Ramalho AS, Bonadia LC, Felicio V, Ribeiro MA, Uliyakina I, Marson FA, Kmit A, Cardoso SR, Ribeiro JD, Bertuzzo CS, Sousa L, Kunzelmann K, Ribeiro AF, Amaral MD
Measurements of CFTR-Mediated Cl(-) Secretion in Human Rectal Biopsies Constitute a Robust Biomarker for Cystic Fibrosis Diagnosis and Prognosis.
PLoS One. 2012;7(10):e47708. doi: 10.1371/journal.pone.0047708. Epub 2012 Oct 17., [PMID:23082198]
Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is caused by approximately 1,900 mutations in the CF transmembrane conductance regulator (CFTR) gene encoding for a cAMP-regulated chloride (Cl(-)) channel expressed in several epithelia. Clinical features are dominated by respiratory symptoms, but there is variable organ involvement thus causing diagnostic dilemmas, especially for non-classic cases. METHODOLOGY/PRINCIPAL FINDINGS: To further establish measurement of CFTR function as a sensitive and robust biomarker for diagnosis and prognosis of CF, we herein assessed cholinergic and cAMP-CFTR-mediated Cl(-) secretion in 524 freshly excised rectal biopsies from 118 individuals, including patients with confirmed CF clinical diagnosis (n = 51), individuals with clinical CF suspicion (n = 49) and age-matched non-CF controls (n = 18). Conclusive measurements were obtained for 96% of cases. Patients with "Classic CF", presenting earlier onset of symptoms, pancreatic insufficiency, severe lung disease and low Shwachman-Kulczycki scores were found to lack CFTR-mediated Cl(-) secretion (<5%). Individuals with milder CF disease presented residual CFTR-mediated Cl(-) secretion (10-57%) and non-CF controls show CFTR-mediated Cl(-) secretion >/=30-35% and data evidenced good correlations with various clinical parameters. Finally, comparison of these values with those in "CF suspicion" individuals allowed to confirm CF in 16/49 individuals (33%) and exclude it in 28/49 (57%). Statistical discriminant analyses showed that colonic measurements of CFTR-mediated Cl(-) secretion are the best discriminator among Classic/Non-Classic CF and non-CF groups. CONCLUSIONS/SIGNIFICANCE: Determination of CFTR-mediated Cl(-) secretion in rectal biopsies is demonstrated here to be a sensitive, reproducible and robust predictive biomarker for the diagnosis and prognosis of CF. The method also has very high potential for (pre-)clinical trials of CFTR-modulator therapies.
Comments [show]
None has been submitted yet.
No. Sentence Comment
90 One ''CF suspicion`` patient with severe CF symptoms and the F508del/S549R genotype, evidenced very low levels of CFTR function (,5% normalized to controls).
X
ABCC7 p.Ser549Arg 23082198:90:69
status: NEW174 For instance, we were able to detect very low function (,5% CFTR function vs non-CF controls) in a patient bearing S549R, recently described as Figure 4.
X
ABCC7 p.Ser549Arg 23082198:174:115
status: NEW190 For example, the patient with S549R could be tested ex vivo for the correction with the FDA-approved potentiator Ivacaftor, as suggested by the in vitro data [42].
X
ABCC7 p.Ser549Arg 23082198:190:30
status: NEW[hide] CFTR mutation screening in an assisted reproductiv... Aust N Z J Obstet Gynaecol. 2011 Dec;51(6):536-9. doi: 10.1111/j.1479-828X.2011.01348.x. Epub 2011 Aug 22. Field PD, Martin NJ
CFTR mutation screening in an assisted reproductive clinic.
Aust N Z J Obstet Gynaecol. 2011 Dec;51(6):536-9. doi: 10.1111/j.1479-828X.2011.01348.x. Epub 2011 Aug 22., [PMID:21875427]
Abstract [show]
INTRODUCTION: Cystic fibrosis (CF) is the most common deleterious single-gene recessive disorder in non-Hispanic Caucasians. Mutations within the CF transmembrane receptor (CFTR) gene produce a variable phenotype, including pulmonary disease, pancreatic insufficiency, meconium ileus and infertility. Screening of antenatal/preconception patients to identify CFTR mutation carriers has been shown to reduce the incidence of CF-affected babies at birth. The application of preconception screening to assisted reproductive technology (ART) patients enables carrier couples a choice between prenatal screening and preimplantation genetic diagnosis (PGD). AIM: To screen patients entering an infertility clinic, for 30 common CFTR mutations, and to detect carrier patients prior to initiating assisted reproductive treatment. METHOD: DNA from 5600 infertility patients was screened using a PCR/OLA kit for 30 CFTR mutations. All identified carriers and carrier couples were offered genetic counselling. Prenatal testing and PGD for CFTR mutations were offered to carrier couples where appropriate. RESULTS: A total of 5600 patients were screened for 30 CFTR mutations with 261 carriers being identified and at a significantly increased carrier rate of one in 21.5 (4.66% +/- 0.55%). R117H/c.350G>A was significantly increased in this infertile population and accounted for 13.8% of all mutations identified. Twelve carrier couples were identified, and nine carrier couples had at least one cycle of PGD for CFTR mutations. CONCLUSION: The carrier rate of CFTR mutations is elevated in patients presenting for infertility treatment, and preconception screening should be encouraged in all patients entering ART clinics.
Comments [show]
None has been submitted yet.
No. Sentence Comment
37 Table 1 A breakdown of the CFTR mutations identified in the infertile patient population, the percentage of those mutations identified, the percentage of the infertile population screened, the percentage of the same mutations identified in the antenatal population by Massie et al. and figures published by Bobadilla et al. for the corresponding CFTR mutations in a global population study 'Legacy Mutation Name` and HGVS convention nomenclature* Number of mutations identified in infertile population Percentage of mutations identified in infertile population (%) Percentage of mutations identified in antenatal population4 (%) Percentage of mutations identified in a global population5 (%) F508delCTT / c.1521_1523delCTT 185 70.9 88.89 75.48 R117H / c.350G>A 36 13.8 0.63 G551D / c.1652G>A 12 4.6 2.78 3.82 G542X / c.1624G>T 6 2.3 0.93 1.83 N1303K / c.3909C>G 4 1.5 0.93 0.95 621+1G>T / c.489+1G>T 5 1.9 0.93 0.96 I507del / c.1519-1521delATC 2 0.8 0.53 3659delC / c.3528delC 2 0.8 R1162X / c.3484C>T 1 0.4 0.20 3120+1G>A / c.2988+1G>A 1 0.4 2184-delA / c.2052delA 1 0.4 3849+10kbC>T / c.3717-2477C>T 1 0.4 4.63 2789+5G>A / c.2657+5G>A 1 0.4 0.93 R347P / c.1040G>A 1 0.4 0.16 1717-1G>A / c.1585-1G>A 1 0.4 0.81 R553X / c.1657C>T 1 0.4 S549R / c.1647T>G 1 0.4 Total CFTR mutations identified 261 Total patients screened 5600 Incidence of CF carriers at QFG 1 in 21.5 (4.66%) CF, cystic fibrosis; CFTR, CF transmembrane receptor.
X
ABCC7 p.Ser549Arg 21875427:37:1236
status: NEW[hide] The use of DHPLC (Denaturing High Performance Liqu... J Prenat Med. 2010 Jul;4(3):45-8. Mesoraca A, Di Natale M, Cima A, Di Giacomo G, Sarti M, Barone MA, Bizzoco D, Cignini P, Mobili L, D'emidio L, Giorlandino C
The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis.
J Prenat Med. 2010 Jul;4(3):45-8., [PMID:22439061]
Abstract [show]
OBJECTIVE: The aim of the study is to evaluate the role of Denaturing High Performance Liquid Chromatography (DHPLC) in the second level screening of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene. METHODS: A 9-month prospective study, between June 2008 and March 2009 at Artemisia Fetal Medical Centre, included 3829 samples of amniotic fluid collected from women undergoing mid-trimester amniocentesis.The genetic diagnosis of CF was based on research of the main mutations of the CFTR gene on fetal DNA extracted from the amniocytes, (first level screening) using different commercial diagnostic systems. A second level screening using DHPLC, on the amniotic fluid and on a blood sample from the couple, was offered in case of fetuses heterozygous at first level screening. RESULTS: Of 3829 fetuses, 134 were found to be positive, 129 heterozygous and 5 affected. Of the 129 couples, following appropriate genetic counselling, 53 requested a second level screening. Through the use of DHPLC, 44 couples were found to be negative, and in nine couples, nine rare mutations were identified. CONCLUSIONS: The first level screening can be useful to evidence up to 75% of the CF mutations. The second level screening can identify a further 10% of mutant alleles. DHPLC was found to be a reliable and specific method for the rapid identification of the rare CFTR mutations which were not revealed in initial first level screening.
Comments [show]
None has been submitted yet.
No. Sentence Comment
100 48 Journal of Prenatal Medicine 2010; 4 (3): 45-50 Table III Mutations found with II level screening through DHPLC Mutations of mutated alleles DF508 29 W1282X 3 N1303K 8 1717-1G®A 2 3659delC 1 G85E 1 2789 +5G®A 2 R553X 2 R1162X 1 R117H 1 G542X 3 Total 53Table I Mutations found through I level screeningMutations analysed with I level screening through OLA CFTR Mutations Position on the CFTR gene DF508 Exon 10 3849+10KbC®T Intron 19 R334W Exon 7 W1282X Exon 10 V520F Exon 10 3905insT Exon 20 N1303K Exon 21 3876delA Exon 20 1717-1G®A Exon 11 3659delC Exon 19 DI507 Exon 10 A455E Exon 9 G85E Exon 3 2789 +5G®A Exon 14 / Intron 14 2183AA®G Exon 13 1898+1G®A Exon 12 / Intron 12 R347P Exon 7 R347H Exon 7 R560T Exon 11 1078delT Exon 7 R553X Exon 11 711+1G®T Exon 5 / Intron 5 G551D Exon 11 R1162X Exon 19 S549R Exon 11 R117H Exon 4 S549N Exon 11 621+1G®T Exon 4 G542X Exon 11 394delTT Exon 3 3120+1G®ðA Exon 16/ Intron 16 2184delA Exon 13 Table II Mutations found through I level screening Mutations Positions on CFTR gene R1066C Exon 17 b L1065P Exon 17 b A1006E Exon 19 R75Q Exon 3 D537E Exon 11 W1134X Exon 18 W1145X Exon 18 L1077P Exon 17b C524X Exon 11 Total 9 The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis Journal of Prenatal Medicine 2010; 4 (3): 45-50 49 tion was to provide the couple with adequate counselling in order to better understand the genotype-phenotype correlation in the various associations of mutations.
X
ABCC7 p.Ser549Arg 22439061:100:838
status: NEWX
ABCC7 p.Ser549Arg 22439061:100:845
status: NEW[hide] CFTR H609R mutation in Ecuadorian patients with cy... J Cyst Fibros. 2009 Jul;8(4):280-1. Epub 2009 May 19. Moya-Quiles MR, Glover G, Mondejar-Lopez P, Pastor-Vivero MD, Fernandez-Sanchez A, Sanchez-Solis M
CFTR H609R mutation in Ecuadorian patients with cystic fibrosis.
J Cyst Fibros. 2009 Jul;8(4):280-1. Epub 2009 May 19., [PMID:19457724]
Abstract [show]
Mutation epidemiology in each ethnic group is important for cystic fibrosis diagnosis and genetic counselling. To date, little has been reported on the prevalence of cystic fibrosis in the Ecuadorian population where the mutation distribution appears to differ from that of Europe. We present a series of four Ecuadorian patients homozygous for the H609R mutation in the CFTR gene. This is the first report of detection of this mutation in the Ecuadorian population. Taking advantage of the homozygous status of the patients, an evaluation of the most important clinical parameters is presented. From the diagnostic point of view, the information provided by our study is of relevance in designing an appropriate strategy for genetic testing of patients in Ecuador and in European countries where immigration from Ecuador is common.
Comments [show]
None has been submitted yet.
No. Sentence Comment
28 Genotypes G85E/G85E and G85E/S549R were found in the other two patients.
X
ABCC7 p.Ser549Arg 19457724:28:29
status: NEW26 Genotypes G85E/G85E and G85E/S549R were found in the other two patients.
X
ABCC7 p.Ser549Arg 19457724:26:29
status: NEW[hide] Cystic fibrosis: a new mutation in the Lebanese po... J Cyst Fibros. 2008 Sep;7(5):429-32. Epub 2008 May 2. Farra C, Medawar R, Mroueh S, Souaid M, Cabet F, Awwad J
Cystic fibrosis: a new mutation in the Lebanese population.
J Cyst Fibros. 2008 Sep;7(5):429-32. Epub 2008 May 2., [PMID:18455968]
Abstract [show]
BACKGROUND: Cystic fibrosis is the most common autosomal recessive disorder in Caucasians. Little has been reported on its occurrence in Arab and Lebanese populations where mutation distribution seems to differ from that of Europeans. We report on the occurrence of a frameshift mutation 4016insG in two Lebanese Muslim siblings, products of consanguineous parents. This mutation generates a stop codon instead of Arginine-1301 and has never been reported before. METHODS: Both probands manifested early onset of severe respiratory and pancreatic involvement. DNA analysis was performed by PCR and sequencing for exons 1, 4, 10, 11, 20, 21 of the CFTR gene. RESULTS: Both probands were found to be homozygous for the 4016insG. Their parents were both heterozygous for the same mutation. CONCLUSION: The frameshift mutation reported in this article is being described for the first time.
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 Recently, a panel of 11 common mutations accounting overall for 70% of all Arab CF chromosomes have been reported : ΔF508del, 3120+1G"A, N1303K, W1282X, G115X, 711+1G"A, S549R, I1234V, 1548delG , H139L and 4010del4 [9].
X
ABCC7 p.Ser549Arg 18455968:46:175
status: NEW[hide] Validation of high-resolution DNA melting analysis... J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7. Audrezet MP, Dabricot A, Le Marechal C, Ferec C
Validation of high-resolution DNA melting analysis for mutation scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7., [PMID:18687795]
Abstract [show]
High-resolution melting analysis of polymerase chain reaction products for mutation scanning, which began in the early 2000s, is based on monitoring of the fluorescence released during the melting of double-stranded DNA labeled with specifically developed saturation dye, such as LC-Green. We report here the validation of this method to scan 98% of the coding sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. We designed 32 pairs of primers to amplify and analyze the 27 exons of the gene. Thanks to the addition of a small GC-clamp at the 5' ends of the primers, one single melting domain and one identical annealing temperature were obtained to co-amplify all of the fragments. A total of 307 DNA samples, extracted by the salt precipitation method, carrying 221 mutations and 21 polymorphisms, plus 20 control samples free from variations (confirmed by denaturing high-performance liquid chromatography analysis), was used. With the conditions described in this study, 100% of samples that carry heterozygous mutations and 60% of those with homozygous mutations were identified. The study of a cohort of 136 idiopathic chronic pancreatitis patients enabled us to prospectively evaluate this technique. Thus, high-resolution melting analysis is a robust and sensitive single-tube technique for screening mutations in a gene and promises to become the gold standard over denaturing high-performance liquid chromatography, particularly for highly mutated genes such as CFTR, and appears suitable for use in reference diagnostic laboratories.
Comments [show]
None has been submitted yet.
No. Sentence Comment
75 In addition to heterozygous variants, 10 homozygote samples carrying F508del, 394delT, R117H, G542X, S549R, 4016inT homozygous mutations, and R75Q, T854T, 1001ϩ11 CϾT, and Q1463Q homozygous variants, were also tested.
X
ABCC7 p.Ser549Arg 18687795:75:101
status: NEW[hide] Analysis of the CFTR gene in Iranian cystic fibros... J Cyst Fibros. 2008 Mar;7(2):102-9. Epub 2007 Jul 27. Alibakhshi R, Kianishirazi R, Cassiman JJ, Zamani M, Cuppens H
Analysis of the CFTR gene in Iranian cystic fibrosis patients: identification of eight novel mutations.
J Cyst Fibros. 2008 Mar;7(2):102-9. Epub 2007 Jul 27., [PMID:17662673]
Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most common inherited disorder in Caucasian populations, with over 1400 mutations identified in the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene. Mutations in the CFTR gene may be also causative for CBAVD (Congenital Bilateral Absence of the Vas Deferens). The type and distribution of mutations varies widely between different countries and/or ethnic groups, and is relatively unknown in Iran. We therefore performed a comprehensive analysis of the CFTR gene in Iranian CF patients. METHODS: 69 Iranian CF patients, and 1 CBAVD patient, were analysed for mutations in the complete coding region, and its exon/intron junctions, of their CFTR genes, using different methods, such as ARMS (amplification refractory mutation system)-PCR, SSCP (single stranded conformation polymorphism) analysis, restriction enzyme digestion analysis, direct sequencing, and MLPA (Multiplex Ligation-mediated Probe Amplification). RESULTS: CFTR mutation analysis revealed the identification of 37 mutations in 69 Iranian CF patients. Overall, 81.9% (113/138) CFTR genes derived from Iranian CF patients could be characterized for a disease-causing mutation. The CBAVD patient was found to be homozygous for the p.W1145R mutation. The most common mutations were p.F508del (DeltaF508) (18.1%), c.2183_2184delAAinsG (2183AA>G) (6.5%), p.S466X (5.8%), p.N1303K (4.3%), c.2789+5G>A (4.3%), p.G542X (3.6%), c.3120+1G>A (3.6%), p.R334W (2.9%) and c.3130delA (2.9%). These 9 types of mutant CFTR genes totaled for 52% of all CFTR genes derived from the 69 Iranian CF patients. Eight mutations, c.406-8T>C, p.A566D, c.2576delA, c.2752-1_2756delGGTGGCinsTTG, p.T1036I, p.W1145R, c.3850-24G>A, c.1342-?_1524+?del, were found for the first time in this study. CONCLUSIONS: We identified 37 CFTR mutations in 69 well characterized Iranian CF patients, obtaining a CFTR mutation detection rate of 81.9%, the highest detection rate obtained in the Iranian population so far. These findings will assist in genetic counseling, prenatal diagnosis and future screening of CF in Iran.
Comments [show]
None has been submitted yet.
No. Sentence Comment
66 Results A total of 69 unrelated CF patients (38 male and 31 female; aged between 2 months and 15 years) of Iranian Table 2 Genotype of CFTR genes in 53 Iranian patients Genotype Exon/intron Number of patients p.F508del/p.F508del E10/E10 10 p.F508del/p.R1162X E10/E19 2 p.F508del/p.T1036I E10/E17a 1 p.F508del/p.R1066C E10/E17b 1 p.F508del/c.1342-?_1524+?del E10/E9 1 p.S466X/p.S466X E10/E10 4 c.2183_2184delAAinsG/ c.2183_2184delAAinsG E13/E13 4 c.2183_2184delAAinsG/c.186- ?_296+?del E13/E2 1 p.N1303K/p.N1303K E21/E21 2 p.N1303K/p.S945L E21/E15 1 p.N1303K/c.1677delTA E21/E10 1 p.G542X/p.G542X E11/E11 2 p.G542X/c.2789+5GNA E11/I14b 1 c.3120+1GNA/c.3120+1GNA I16/I16 2 c.3120+1GNA/c.3121-1GNA I16 1 c.3121-1GNA/p.T1086I I16/E17b 1 c.3130delA/c.3130delA E17a/E17a 2 p.D192G/p.D192G E5/E5 1 p.R334W/p.R334W E7/E7 1 p.R334W/p.S945L E7/E15 1 p.R334W/p.L1077P E7/E17b 1 c.1525-1GNA/c.1525-1GNA I9/I9 1 p.S549R/p.S549R E11/E11 1 p.A566D/p.A566D E12/E12 1 c.1898+1GNT/c.1898+1GNT I12/I12 1 c.2576delA/p.S1455X/ E13/E24 1 c.2184insA/c.1677delTA E10/E13 1 p.R785X/p.R785X E13/E13 1 c.2752-1_2756delGGTGGCinsTTG/ c.2752-1_2756delGGTGGCinsTTG I14a/E14b 1 c.2789+5GNA/c.2789+5GNA I14b/I14b 1 p.K1177X/p.K1177X E19/E19 1 c.406-?_1716+?del/c.406-?_1716+?del E4-E10/E4-E10 1 Total 53 origin were extensively studied for the presence of mutations in the CFTR gene, for the presence of the deep intronic 3849+10 kbC→T mutation, and large deletions/ duplications.
X
ABCC7 p.Ser549Arg 17662673:66:901
status: NEWX
ABCC7 p.Ser549Arg 17662673:66:909
status: NEW65 Results A total of 69 unrelated CF patients (38 male and 31 female; aged between 2 months and 15 years) of Iranian Table 2 Genotype of CFTR genes in 53 Iranian patients Genotype Exon/intron Number of patients p.F508del/p.F508del E10/E10 10 p.F508del/p.R1162X E10/E19 2 p.F508del/p.T1036I E10/E17a 1 p.F508del/p.R1066C E10/E17b 1 p.F508del/c.1342-?_1524+?del E10/E9 1 p.S466X/p.S466X E10/E10 4 c.2183_2184delAAinsG/ c.2183_2184delAAinsG E13/E13 4 c.2183_2184delAAinsG/c.186- ?_296+?del E13/E2 1 p.N1303K/p.N1303K E21/E21 2 p.N1303K/p.S945L E21/E15 1 p.N1303K/c.1677delTA E21/E10 1 p.G542X/p.G542X E11/E11 2 p.G542X/c.2789+5GNA E11/I14b 1 c.3120+1GNA/c.3120+1GNA I16/I16 2 c.3120+1GNA/c.3121-1GNA I16 1 c.3121-1GNA/p.T1086I I16/E17b 1 c.3130delA/c.3130delA E17a/E17a 2 p.D192G/p.D192G E5/E5 1 p.R334W/p.R334W E7/E7 1 p.R334W/p.S945L E7/E15 1 p.R334W/p.L1077P E7/E17b 1 c.1525-1GNA/c.1525-1GNA I9/I9 1 p.S549R/p.S549R E11/E11 1 p.A566D/p.A566D E12/E12 1 c.1898+1GNT/c.1898+1GNT I12/I12 1 c.2576delA/p.S1455X/ E13/E24 1 c.2184insA/c.1677delTA E10/E13 1 p.R785X/p.R785X E13/E13 1 c.2752-1_2756delGGTGGCinsTTG/ c.2752-1_2756delGGTGGCinsTTG I14a/E14b 1 c.2789+5GNA/c.2789+5GNA I14b/I14b 1 p.K1177X/p.K1177X E19/E19 1 c.406-?_1716+?del/c.406-?_1716+?del E4-E10/E4-E10 1 Total 53 origin were extensively studied for the presence of mutations in the CFTR gene, for the presence of the deep intronic 3849+10 kbCT mutation, and large deletions/ duplications.
X
ABCC7 p.Ser549Arg 17662673:65:901
status: NEWX
ABCC7 p.Ser549Arg 17662673:65:909
status: NEW[hide] ENaCbeta and gamma genes as modifier genes in cyst... J Cyst Fibros. 2008 Jan;7(1):23-9. Epub 2007 Jun 7. Viel M, Leroy C, Hubert D, Fajac I, Bienvenu T
ENaCbeta and gamma genes as modifier genes in cystic fibrosis.
J Cyst Fibros. 2008 Jan;7(1):23-9. Epub 2007 Jun 7., [PMID:17560176]
Abstract [show]
BACKGROUND: Clinical phenotype varies among cystic fibrosis (CF) patients with identical CF transmembrane conductance regulator (CFTR)genotype, suggesting that genetic modifiers exist. Transgenic mice that overexpress SCNN1beta present CF-like lung disease symptoms. Mutations or variants in SCNN1beta may therefore potentially modulate the clinical phenotype in CF patients. METHODS: We analysed by DHPLC SCNN1beta and SCNN1gamma genes in 56 patients with classical CF. Patients were classified into two groups according to their CFTR genotype and their severity: 38 patients with severe genotype and an unexpectedly mild lung phenotype, and 18 patients with mild genotype and a severe lung phenotype. RESULTS: We found 3 patients out of 56 carrying at least one missense mutation. Two were novel (p.Thr313Met in SCNN1beta, p.Leu481Gln in SCNN1gamma) and two were previously described (p.Gly589Ser in SCNN1beta and p.Val546Ileu in SCNNgamma). p.Thr313Met has been identified in a CF patient with mild genotype and severe lung phenotype suggesting that it could act in increasing ENaC activity. The three other variants have been identified in CF patients with severe genotype and mild lung phenotype suggesting that they might decrease ENaC activity. However, the function of ENaC in the nasal epithelia of these patients, evaluated by nasal potential difference measurements, did not support the fact that these variants were functional, at least in nasal epithelium. CONCLUSION: Our results suggest that genetic variants in ENaCbeta and gamma genes do not modulate disease severity in the majority of CF patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
72 Twenty-one were homozygous for the Phe508del mutation and 17 were compound heterozygous or homozygous for two severe mutations (R553X:1717-1GNA, Phe508del:W1282X, Phe508del:1717-1GNA, 2 Phe508del:3659delC, Phe508del:N1303K, Phe508del:W57X, Phe508del:Q1411X, G542X:1380insT, Phe508del:R553X, Table 1 Parameters for amplification of the ENaCβ and ENaCγ gene fragments (GenBank accession number NM_000336 and NM_001039, respectively) Fragment Sequence of primers Annealing temperature (°C) ENaCβ Exon 2 2F 5' gtgtcccagctgatgtgcgt 3' 55 2R 5' tgaggccagctgtgcactcc 3' Exon 3 3F 5' acagactactatggagtggg 3' 55 3R 5' aagaaacacccatcagcctc 3' Exon 4 4F 5' gtcctgctagcagctcccac 3' 59 4R 5' caaccgtaacatgccactgt 3' Exon 5 5F 5' ctgccctgcagctgatgctg 3' 55 5R 5' ccctgcaacagctgatggtc 3' Exon 6 6F gtctcctttctgcctcagga 3' 59 6R 5' tcagaccctctaggactgcc 3' Exon 7 7F 5' aggtgcagaaagggcttcct 3' 63 7R 5' catgaggcgtgcaccaccttcccac 3' Exon 8 8F 5' ctgaccatgcctgtgttctc 3' 59 8R 5' ctctatggtcagagcctctg 3' Exon 9-10 9F 5' cagaggctcagcagggaaca 3' 63 10R 5' catcttatgcccagacttgt 3' Exon 11 11F 5' gatgctgcagatggcaactt 3' 55 11R 5' gagctgtcctgtgtccaaac 3' Exon 12 12F 5' acattagtcccggcccttct 3' 55 12R 5' ggtattgggagactcctaaa 3' Exon 13 13F 5' fgaggcaagaatgtgtggcct 3' 59 13R 5' tcttggctgctcagtgagtt 3' ENaCγ Exon 2 2F 5' agcacgcccgtcctcagagt 3' 57 2R 5' ccagtgtgtcactttcggga 3' Exon 3 3F 5' tgaggctgacacgtgttgat 3' 55 3R 5' tgcccctaagcagtgaaaga 3' Exon 4 4F 5' agtagcgataggaccgatgg 3' 55 4R 5' tcagagctgccagtccttag 3' Exon 5 5F 5' cccaacttcagctaagatgc 3' 55 5R 5' agatctccttggcacaggtt 3' Exon 6 6F 5' ttggatcacagcaggttgtc 3' 55 6R 5' gatctgttctctccaagcct 3' Exon 7 7F 5' ctgtctggtgctccttgcaa 3' 55 7R 5' ccagcttagatataactttg 3' Exon 8 8F 5' tgagcaaagacatgaatggc 3' 57 8R 5' agtgcctattgccaggacta 3' Exon 9-10-11 9F 5' tccaaagctcatgctgccct 3' 57 11R 5' acagaggaacagggtagagg 3' Exon 12 12F 5' ggatgccaaggctcttgatt 3' 52 12R 5' gccaggaagatgctcacatt 3' Exon 13 13F 5' aggttcctcttgatggtgt 3' 55 13R 5' ggtcctgactagatctgtct 3' Table 2 Parameters for dHPLC conditions Fragment Temperature (°C) ENaCβ Exon 2 62.3/63.3 Exon 3 59.5/60.7 Exon 4 62.2/63.4 Exon 5 59.5/61 Exon 6 63 Exon 7 61.6/62.6/63.6 Exon 8 62.8/64.8 Exon 9-10 61.5/62.5/65 Exon 11 61/62/63.5 Exon 12 69 Exon 13 61/63.3/64.8 ENaCγ Exon 2 60.8/63.2/66 Exon 3 61/61.4 Exon 4 60.6 Exon 5 59.5/60.5 Exon 6 56.5/59/60.5 Exon 7 63/63.6 Exon 8 59.5/63 Exon 9-10-11 60.7/61.5/62.7/64.7 Exon 12 59.5/61.7 Exon 13 61/62.2 Phe508del:I507del, Phe508del:4382delA, S549R:3120+ 1GNA, Phe508del:3120+1GNA, Y122X:Y122X; Phe508del:W846X; Phe508del:E60X).
X
ABCC7 p.Ser549Arg 17560176:72:2524
status: NEWX
ABCC7 p.Ser549Arg 17560176:72:2531
status: NEW[hide] A haplotype framework for cystic fibrosis mutation... J Mol Diagn. 2006 Feb;8(1):119-27. Elahi E, Khodadad A, Kupershmidt I, Ghasemi F, Alinasab B, Naghizadeh R, Eason RG, Amini M, Esmaili M, Esmaeili Dooki MR, Sanati MH, Davis RW, Ronaghi M, Thorstenson YR
A haplotype framework for cystic fibrosis mutations in Iran.
J Mol Diagn. 2006 Feb;8(1):119-27., [PMID:16436643]
Abstract [show]
This is the first comprehensive profile of cystic fibrosis transmembrane conductance regulator (CFTR) mutations and their corresponding haplotypes in the Iranian population. All of the 27 CFTR exons of 60 unrelated Iranian CF patients were sequenced to identify disease-causing mutations. Eleven core haplotypes of CFTR were identified by genotyping six high-frequency simple nucleotide polymorphisms. The carrier frequency of 2.5 in 100 (1 in 40) was estimated from the frequency of heterozygous patients and suggests that contrary to popular belief, cystic fibrosis may be a common, under-diagnosed disease in Iran. A heterogeneous mutation spectrum was observed at the CFTR locus in 60 cystic fibrosis (CF) patients from Iran. Twenty putative disease-causing mutations were identified on 64 (53%) of the 120 chromosomes. The five most common Iranian mutations together represented 37% of the expected mutated alleles. The most frequent mutation, DeltaF508 (p.F508del), represented only 16% of the expected mutated alleles. The next most frequent mutations were c.1677del2 (p.515fs) at 7.5%, c.4041C>G (p.N1303K) at 5.6%, c.2183AA>G (p.684fs) at 5%, and c.3661A>T (p.K1177X) at 2.5%. Three of the five most frequent Iranian mutations are not included in a commonly used panel of CF mutations, underscoring the importance of identifying geographic-specific mutations in this population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
177 Six additional mutations reported in at least two other Arab populations, including c.711ϩ1GϾA, p.R75X, c.1548delG, c.3120ϩ1GϾA, c.3199del6, and p.S549R,30,42,53-56 could have been detected in our assay but were not found in Iran.
X
ABCC7 p.Ser549Arg 16436643:177:171
status: NEW[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]
Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS.
X
ABCC7 p.Ser549Arg 16049310:51:2932
status: NEWX
ABCC7 p.Ser549Arg 16049310:51:3028
status: NEW[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]
Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
176 In comprehensive non-U.S. studies from Brazil, Colombia, and Spain, 420 mutations were identified (231, 117, and 72, respectively).33-35 Only seven occurred with a relative frequency Ͼ1%: ⌬F508 (67.4%), G542X (9%), N1303K (2.4%), R1162X (2.4%), R334W (2.1%), W1282X (1.2%), and S549R (1%).
X
ABCC7 p.Ser549Arg 15858154:176:291
status: NEW177 Interestingly, all but one of these (S549R) are part of the 25 mutation screening panel, which may reflect a greater Caucasian admixture.
X
ABCC7 p.Ser549Arg 15858154:177:37
status: NEW[hide] Rapid screening for 31 mutations and polymorphisms... Methods Mol Med. 2005;114:147-71. Dunbar SA, Jacobson JW
Rapid screening for 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator gene by Lminex xMAP suspension array.
Methods Mol Med. 2005;114:147-71., [PMID:16156102]
Abstract [show]
A suspension array hybridization assay is described for the detection of 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator (CFTR) gene using Luminex xMAP technology. The Luminex xMAP system allows simultaneous detection of up to 100 different targets in a single multiplexed reaction. Included in the method are the procedures for design of oligonucleotide capture probes and PCR amplification primers, coupling oligonucleotide capture probes to carboxylated microspheres, hybridization of coupled microspheres to oligonucleotide targets, production of targets from DNA samples by multiplexed PCR amplification, and detection of PCR-amplified targets by direct hybridization to probe-coupled microspheres. Mutation screening with the system is rapid, requires relatively few sample manipulations, and provides adequate resolution to reliably genotype the 25 CFTR mutations and 6 CFTR polymorphisms contained in the ACMG/ACOG/NIH-recommended core mutation panel for general population CF carrier screening.
Comments [show]
None has been submitted yet.
No. Sentence Comment
119 Coriell Cell Repositories, NA12960 ΔI507/R347P Patient sample G551D/R347P Coriell Cell Repositories, NA12785 621+1G→T/711+1G→T Coriell Cell Repositories, NA11280 621+1G→T/G85E Coriell Cell Repositories, NA11282 3849+10kbC→T/3849+10kbC→T Coriell Cell Repositories, NA11860 A455E/normal Patient sample 621+1G→T/A455E Coriell Cell Repositories, NA11290 R1162X/normal Coriell Cell Repositories, NA12585 ΔF508/3659delC Coriell Cell Repositories, NA11275 2789+5G→A/2789+5G→A Coriell Cell Repositories, NA11859 2184delA/normal Patient sample 1898+1G→A/normal Patient sample 621+1G→T/3120+1G→A Coriell Cell Repositories, NA07441 3120+1G→A/3120+1G→A Patient sample F508C/normal Coriell Cell Repositories, NA13033 I506V/normal Coriell Cell Repositories, NA13032 R347H/normal Patient sample ΔF508/3120G→A Patient sample S549N/normal Patient sample S549R/normal Patient sample CFTR, cystic fibrosis transmembrane conductance regulator gene.
X
ABCC7 p.Ser549Arg 16156102:119:953
status: NEW[hide] High heterogeneity of CFTR mutations and unexpecte... J Cyst Fibros. 2004 Dec;3(4):265-72. des Georges M, Guittard C, Altieri JP, Templin C, Sarles J, Sarda P, Claustres M
High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France.
J Cyst Fibros. 2004 Dec;3(4):265-72., [PMID:15698946]
Abstract [show]
In this report, we present updated spectrum and frequency of mutations of the CFTR gene that are responsible for cystic fibrosis (CF) in Languedoc-Roussillon (L-R), the southwestern part of France. A total of 75 different mutations were identified by DGGE in 215 families, accounting for 97.6% of CF genes and generating 88 different mutational genotypes. The frequency of p.F508del was 60.23% in L-R versus 67.18% in the whole country and only five other mutations (p.G542X, p.N1303K, p.R334W, c.1717-1G>A, c.711+1G>T) had a frequency higher than 1%. The mutations were scattered over 20 exons or their border. This sample representing only 5.7% of French CF patients contributed to 24% of CFTR mutations reported in France. This is one of the highest molecular allelic heterogeneity reported so far in CF. We also present the result of a neonatal screening program based on a two-tiered approach "IRT/20 mutations/IRT" analysis on blood spots, implemented in France with the aim to improve survival and quality of life of patients diagnosed before clinical onset. This 18-month pilot project showed an unexpected low incidence of CF (1/8885) in South of France, with only six CF children detected among 43,489 neonates born in L-R, and 13 among 125,339 neonates born in Provence-Alpes-Cote-d'Azur (PACA).
Comments [show]
None has been submitted yet.
No. Sentence Comment
68 of chromosomes (frequency %) p.M1V 1 1 (0.23) p.M1K 1 1 (0.23) c.300delA 3 1 (0.23) p.P67L 3 1 (0.23) c.359insT 3 1 (0.23) p.G85E 3 3 (0.70) c.394delTT 3 1 (0.23) p.Q98R 4 1 (0.23) p.R117H 4 2 (0.47) p.Y122X 4 2 (0.47) p.Y161N 4 1 (0.23) c.621+1GNT intron 4 1 (0.23) c.621+2TNG intron 4 1 (0.23) p.I175V 5 2 (0.47) c.711+1GNT intron 5 5 (1.16) p.L206W 6 3 (0.70) p.Q220X 6 1 (0.23) p.L227R 6 1 (0.23) c.1078delT 7 2 (0.47) p.R334W 7 7 (1.63) p.R347P 7 2 (0.47) c.1215delG 7 1 (0.23) c.T5 intron 8 1 (0.23) p.D443Y 9 1 (0.23) p.I506T 10 1 (0.23) p.I507del 10 4 (0.93) p.F508del 10 259 (60.23) p.F508C 10 1 (0.23) c.1677delTA 10 1 (0.23) c.1717-8GNA intron 10 1 (0.23) c.1717-1GNA intron 10 6 (1.40) p.G542X 11 23 (5.35) p.S549R 11 1 (0.23) p.G551D 11 2 (0.47) p.R553X 11 1 (0.23) c1811+1.6kbANG intron 11 4 (0.93) c.1812-1GNA intron 11 1 (0.23) p.T582I 12 1 (0.23) p.E585X 12 2 (0,47) c.1898+1GNA intron 12 1 (0.23) [c.1898+5GNA ;p.E725K] intron 12 1 (0.23) c.1898+73TNG intron 12 1 (0.23) c.2183AANG 13 4 (0.93) c.2184insA 13 1 (0.23) p.K710X 13 4 (0.93) c.2423delG 13 1 (0.23) p.S776X 13 1 (0.23) c.2493ins8 13 1 (0.23) p.R792X 13 1 (0.23) p.K830X 13 1 (0.23) p.D836Y 14a 1 (0.23) p.W846X1 14a 1 (0.23) c.2711delT 14a 1 (0.23) c.2789+5GNA intron 14b 3 (0.70) p.S945L 15 3 (0.70) p.D993Y 16 1 (0.23) c.3129del4 17a 1 (0.23) c.3195del6 17a 1 (0.23) c.3272-26ANG intron 17a 1 (0.23) [c.3395insA ;pI148T] 17b/4 1 (0,23) p.Y1092X 17b 3 (0.70) Table 1 (continued) Mutation Location exon/intron No.
X
ABCC7 p.Ser549Arg 15698946:68:721
status: NEW[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]
Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
105 d G149R, S489X, S492F, S549R, 1898+1G>A, 2622+1G>A, G970R, R1066H, W1204X, 3850-1G>A, Q1313X.
X
ABCC7 p.Ser549Arg 10923036:105:23
status: NEW[hide] A comparison of fluorescent SSCP and denaturing HP... Hum Mutat. 2000;15(6):556-64. Ellis LA, Taylor CF, Taylor GR
A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning.
Hum Mutat. 2000;15(6):556-64., [PMID:10862085]
Abstract [show]
We examined 67 different mutations in 16 different amplicons in a comparison of mutation detection by fluorescent single strand conformation polymorphism (F-SSCP) and by denaturing HPLC (DHPLC). F-SSCP was used to analyze fluorescent amplicons with internal size standards and automated fragment analysis (GeneScan, PE Applied Biosystems, Foster City, CA). In DHPLC, unlabelled amplicons were analyzed by reverse phase HPLC with fragment detection by absorbance at 260nm. Both methods had high sensitivity (95-100%) and specificity (100%). Overall, F-SSCP with external temperature control was the more sensitive method, but DHPLC was particularly useful for the rapid analysis of novel fragments.
Comments [show]
None has been submitted yet.
No. Sentence Comment
81 MDE alone failed to detect R560T, S549R, and R709X under any conditions described.
X
ABCC7 p.Ser549Arg 10862085:81:34
status: NEW97 Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE.
X
ABCC7 p.Ser549Arg 10862085:97:1305
status: NEW135 Effect of Amplicon Size on Mutation Detection Rate in ABCC7 Exon 11 SSCP slab gels SSCP 310 DHPLC 49:1, 20°C MDE, 20°C 35°C Exon 11 ABCC7 190bp 490bp 190bp 490bp 190bp 490bp 190bp 490bp 1717-1G>A - - + + + + + + G542X + + + + + - + + S549N + + + + + + - - S549R + + - + + + + - G551D - + + + - - + - R553X + + + + + + + - G551D/R553X + + + + + + + - R560T + - - + - - + + R560K + + + + - - + + 1811+1G>C + + + + + + + + Sensitivity 9/10 8/10 8/10 10/10 7/10 6/10 9/10 5/10 ammonium acetate as an ion-pairing agent has the unintended consequence of modifying the stability of GC and AT base pairs in a similar manner to the effects of tetra-alkyl ammonium salts, tetraethyl ammonium chloride and tetramenthyl ammonium chloride.
X
ABCC7 p.Ser549Arg 10862085:135:271
status: NEW[hide] Spectrum of CFTR mutations in the Middle North of ... Hum Mutat. 1999;14(1):89. Telleria JJ, Alonso MJ, Calvo C, Alonso M, Blanco A
Spectrum of CFTR mutations in the Middle North of Spain and identification of a novel mutation (1341G-->A). Mutation in brief no. 252. Online.
Hum Mutat. 1999;14(1):89., [PMID:10447267]
Abstract [show]
We have analyzed 39 unrelated cystic fibrosis (CF) families by denaturing gradient gel electrophoresis (DGGE) and direct sequencing in order to determine the spectrum of CF mutations in our population. This approach has allowed us to detect 72 out of the 78 CF chromosomes (92.3%). The DF508 mutation was found to be present in 51/78 (65.4%) CF chromosomes, in accordance with the predicted Northwest-Southeast gradient within the European population. Another 14 known mutations, and the novel 1341G-->A mutation were identified. Nine out of fifteen non DF508 mutations were present in a single chromosome. The 1341G-->A mutation, found in 2 unrelated patients, is a new mutation associated to severe phenotype, causing pancreatic insufficiency and chronic lung infections. Our data suggest a different distribution of non-DF508 mutations in our population when compared with previous studies carried out in Spanish CF families. Six out of the 14 non-F508 in our study were not present in a recent study carried out in 640 Spanish families with CE These six mutations account for 29.6% non DF508 chromosomes in our sample.
Comments [show]
None has been submitted yet.
No. Sentence Comment
33 Spectrum of CFTR Mutations Table 1 Spectrum of CFTR mutations identified in the present study compared with data published by Casals et al. (Casals et al. 1997) This study Casals et al. Mutation Exon/Intron n % n % ∆F508 E 10 51 65.4 681 53.2 711+1G→T I 5 3 3.8 22 1.7 G542X E 11 3 3.8 108 8.43 1213delT E 7 2 2.6 0 0 1341G→A E 8 2 2.6 0 0 R1066C E 17b 2 2.6 14 1.09 1717-1G→A I 10 1 1.3 1 0.08 S549R E 11 1 1.3 0 0 V562I E 12 1 1.3 0 0 G576A E 12 1 1.3 0 0 2183AA→G E13 1 1.3 5 0.39 2789+5G→A I 14b 1 1.3 11 0.86 Q890X E 15 1 1.3 13 1.01 3849+1G→A I 19 1 1.3 0 0 N1303K E 21 1 1.3 34 2.65 Other 0 0 391 30.5 Known mutations 72 92.3 1155 90.23 Unknown mutations 6 7.7 125 9.7 DISCUSSION The knowledge of the spectrum of mutations causing CF in any specific geographic region provide useful information to design the best approach in pre and postnatal diagnosis of CF; for the screening of mutations in the population at risk; to stimate the genetic risk etc. Moreover, the response to different therapeutic approaches could vary depending on the CF mutations in any case.
X
ABCC7 p.Ser549Arg 10447267:33:424
status: NEW[hide] Localization and suppression of a kinetic defect i... J Biol Chem. 1997 Jun 20;272(25):15739-44. Qu BH, Strickland EH, Thomas PJ
Localization and suppression of a kinetic defect in cystic fibrosis transmembrane conductance regulator folding.
J Biol Chem. 1997 Jun 20;272(25):15739-44., [PMID:9188468]
Abstract [show]
A growing body of evidence indicates that the most common cystic fibrosis-causing mutation, DeltaF508, alters the ability of the cystic fibrosis transmembrane conductance regulator (CFTR) protein to fold and transit to the plasma membrane. Here we present evidence that the DeltaF508 mutation affects a step on the folding pathway prior to formation of the ATP binding site in the nucleotide binding domain (NBD). Notably, stabilization of the native state with 4 mM ATP does not alter the temperature-dependent folding yield of the mutant DeltaF508 NBD1 in vitro. In contrast, glycerol, which promotes DeltaF508-CFTR maturation in vivo, increases the folding yield of NBD1DeltaF and reduces the off pathway rate in vitro, although it does not significantly alter the free energy of stability. Likewise a second site mutation, R553M, which corrects the maturation defect in vivo, is a superfolder which counters the effects of DeltaF508 on the temperature-dependent folding yield in vitro, but does not significantly alter the free energy of stability. A disease-causing mutation, G551D, which does not alter the maturation of CFTR in vivo but rather its function as a chloride channel, and the S549R maturation mutation have no discernible effect on the folding of the domain. These results demonstrate that DeltaF508 is a kinetic folding mutation that affects a step early in the process, and that there is a significant energy barrier between the native state and the step affected by the mutation precluding the use of native state ligands to promote folding. The implications for protein folding in general are that the primary sequence may not necessarily simply define the most stable native structure, but rather a stable structure that is kinetically accessible.
Comments [show]
None has been submitted yet.
No. Sentence Comment
5 A disease-causing mutation, G551D, which does not alter the maturation of CFTR in vivo but rather its function as a chloride channel, and the S549R maturation mutation have no discernible effect on the folding of the domain.
X
ABCC7 p.Ser549Arg 9188468:5:142
status: NEW12 Several other CF-causing mutations known to be maturation-defective, including S549R, are located in NBD1 (11) as are mutations of critical functional residues such as G551D (12).
X
ABCC7 p.Ser549Arg 9188468:12:79
status: NEW23 In the present study we use this system to examine the effects of the R553M second site mutation, the G551D functional mutation, the S549R maturation-defective mutation, glycerol, and ATP binding on the folding pathway and thermodynamic stability of NBD1.
X
ABCC7 p.Ser549Arg 9188468:23:133
status: NEW25 EXPERIMENTAL PROCEDURES Expression, Purification, and Folding of CFTR NBD1s-Oligonucleotide-mediated mutagenesis (19) was used to generate R553M, G551D, and S549R mutations in plasmid pBQ2.4 containing CFTR cDNAs.
X
ABCC7 p.Ser549Arg 9188468:25:157
status: NEW36 Printed in U.S.A. This paper is available on line at http://www.jbc.org CATTTGACCTCCAC-3Ј (25 bases); G551D primer, 5Ј-CTTGCTCGTT- GATCTCCACTCAGTG-3Ј (25 bases); S549R primer, 5Ј-CGTTGAC- CTCCTCTCAGTGTGATTCC-3Ј (26 bases).
X
ABCC7 p.Ser549Arg 9188468:36:133
status: NEWX
ABCC7 p.Ser549Arg 9188468:36:182
status: NEW38 Expression cassette polymerase chain reaction was employed to synthesize the cDNA fragments of CFTR NBD1-R553M, NBD1-G551D, and NBD1-S549R containing a 5Ј NdeI site, a 3Ј XhoI site, and a stop codon as described previously for NBD1 and NBD1⌬F (5).
X
ABCC7 p.Ser549Arg 9188468:38:133
status: NEW59 The expression levels of NBD1-G551D and NBD1-S549R are approximately one-half of the wild-type NBD1 level (data not shown).
X
ABCC7 p.Ser549Arg 9188468:59:45
status: NEW88 Significantly the R553M mutation increases the length of the lag phase and decreases the rate of change in light scattering, indicating that the rate of formation of the off pathway conformer is dramatically reduced in this mutant.
X
ABCC7 p.Ser549Arg 9188468:88:21
status: NEW89 Once again the double mutant NBD1⌬F-R553M dramatically increases the lag time and decreases the rate change in light scattering in comparison with NBD1⌬F.
X
ABCC7 p.Ser549Arg 9188468:89:34
status: NEWX
ABCC7 p.Ser549Arg 9188468:89:138
status: NEW90 Two other mutations, S549R and G551D, do not affect the domain folding yield compared with the wild-type NBD1 in vitro (Fig. 4A).
X
ABCC7 p.Ser549Arg 9188468:90:21
status: NEW91 In vivo studies indicate that the S549R mutation but not G551D is maturation-defective in the full-length protein (11); however, the NBD1-S549R folding yield is not decreased in vitro indicating that it does not act by altering the ability of the domain itself to fold.
X
ABCC7 p.Ser549Arg 9188468:91:34
status: NEWX
ABCC7 p.Ser549Arg 9188468:91:138
status: NEW101 The mGdnHCl values are similar for the NBD1s except for S549R, which has a somewhat larger value indicating that the change in solvent-accessible surface area upon folding is appropriate for a protein of this size.
X
ABCC7 p.Ser549Arg 9188468:101:56
status: NEW102 These results indicate that the inability of the ⌬F508 and S549R CFTR to transit to the apical membrane and the effect of the R553M suppressor cannot be explained simply by a reduction or enhancement in the free energy of stability of the mutant proteins.
X
ABCC7 p.Ser549Arg 9188468:102:66
status: NEW111 Protein NBD1 NBD1⌬F NBD1-R553M NBD1⌬F-R553M NBD1-S549R NBD1-G551D Kd (M) 91 88 89 87 81 61 FIG. 3.
X
ABCC7 p.Ser549Arg 9188468:111:63
status: NEW128 The effects of the S549R and G551D mutations on the temperature-sensitive folding of NBD1 and the rate of formation of off pathway conformers.
X
ABCC7 p.Ser549Arg 9188468:128:19
status: NEWX
ABCC7 p.Ser549Arg 9188468:128:93
status: NEW130 "A,temperature-dependent folding of NBD1 (q), NBD1⌬F (E), NBD1-G551D (ç), and NBD1-S549R (É).
X
ABCC7 p.Ser549Arg 9188468:130:95
status: NEW131 B, formation of off pathway conformers of NBD1 (solid line), NBD1⌬F (dotted line), NBD1-G551D (dashed line), and NBD1-S549R (dotted and dashed line).
X
ABCC7 p.Ser549Arg 9188468:131:125
status: NEW137 The 1.8 M folded NBD1 (q), NBD1⌬F (E), NBD1-R553M (ç), NBD1⌬F-R553M (É), NBD1-G551D (f), and NBD1-S549R (Ⅺ) in 30 mM Tris-HCl, pH 8.0, 40 mM arginine, 0.2 mM EDTA, and 0.1 mM dithiothreitol were incubated with GdnHCl at the indicated concentration for 2 h. The sample was excited at 282 nm, and fluorescence emission spectra were collected.
X
ABCC7 p.Ser549Arg 9188468:137:130
status: NEW149 Protein ⌬GD,0 ⌬⌬GD,0 Cm m kJ/mol kJ/mol M kJ/mol/M NBD1 15.5 1.5 10.3 NBD1⌬F 14.4 -1.1 1.3 11.2 NBD1-R553M 16.6 1.1 1.4 11.7 NBD1⌬F-R553M 14.1 -1.4 1.4 10.1 NBD1-S549R 16.7 1.2 1.2 13.4 NBD1-G551D 16.6 1.1 1.4 11.7 reduction in the folding yield in vitro (5) and of the efficiency of maturation and transit to the plasma membrane in vivo (10).
X
ABCC7 p.Ser549Arg 9188468:149:197
status: NEW176 In addition, G551D does not significantly alter the binding affinity of NBD1-G551D for ATP.
X
ABCC7 p.Ser549Arg 9188468:176:15
status: NEW177 The effect of the mutation may be due to altered domain-domain interactions or the reduced ability of NBD1-G551D to hydrolyze ATP (7).
X
ABCC7 p.Ser549Arg 9188468:177:4
status: NEW178 Similarly, the S549R mutation, which like ⌬F508 inhibits the formation of mature functional CFTR in vivo (11), has no discernible effect on the ability of NBD1 to fold (Fig. 4).
X
ABCC7 p.Ser549Arg 9188468:178:15
status: NEW179 The S549R mutation may alter a surface important for interaction with other CFTR domains or other proteins during the process of conformational maturation.
X
ABCC7 p.Ser549Arg 9188468:179:4
status: NEW34 25, Issue of June 20, pp. 15739-15744, 1997 (c) 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. This paper is available on line at http://www.jbc.org CATTTGACCTCCAC-39 (25 bases); G551D primer, 59-CTTGCTCGTT- GATCTCCACTCAGTG-39 (25 bases); S549R primer, 59-CGTTGAC- CTCCTCTCAGTGTGATTCC-39 (26 bases).
X
ABCC7 p.Ser549Arg 9188468:34:286
status: NEW57 The expression levels of NBD1-G551D and NBD1-S549R are approximately one-half of the wild-type NBD1 level (data not shown).
X
ABCC7 p.Ser549Arg 9188468:57:45
status: NEW99 The mGdnHCl values are similar for the NBD1s except for S549R, which has a somewhat larger value indicating that the change in solvent-accessible surface area upon folding is appropriate for a protein of this size.
X
ABCC7 p.Ser549Arg 9188468:99:56
status: NEW100 These results indicate that the inability of the DF508 and S549R CFTR to transit to the apical membrane and the effect of the R553M suppressor cannot be explained simply by a reduction or enhancement in the free energy of stability of the mutant proteins.
X
ABCC7 p.Ser549Arg 9188468:100:59
status: NEW109 Protein NBD1 NBD1DF NBD1-R553M NBD1DF-R553M NBD1-S549R NBD1-G551D Kd (mM) 91 88 89 87 81 61 FIG. 3.
X
ABCC7 p.Ser549Arg 9188468:109:49
status: NEW126 The effects of the S549R and G551D mutations on the temperature-sensitive folding of NBD1 and the rate of formation of off pathway conformers.
X
ABCC7 p.Ser549Arg 9188468:126:19
status: NEW129 B, formation of off pathway conformers of NBD1 (solid line), NBD1DF (dotted line), NBD1-G551D (dashed line), and NBD1-S549R (dotted and dashed line).
X
ABCC7 p.Ser549Arg 9188468:129:118
status: NEW135 The 1.8 mM folded NBD1 (cf;), NBD1DF (E), NBD1-R553M (&#e7;), NBD1DF-R553M (&#c9;), NBD1-G551D (f), and NBD1-S549R (M) in 30 mM Tris-HCl, pH 8.0, 40 mM arginine, 0.2 mM EDTA, and 0.1 mM dithiothreitol were incubated with GdnHCl at the indicated concentration for 2 h. The sample was excited at 282 nm, and fluorescence emission spectra were collected.
X
ABCC7 p.Ser549Arg 9188468:135:113
status: NEW147 Protein DGD,0 DDGD,0 Cm m kJ/mol kJ/mol M kJ/mol/M NBD1 15.5 1.5 10.3 NBD1DF 14.4 21.1 1.3 11.2 NBD1-R553M 16.6 1.1 1.4 11.7 NBD1DF-R553M 14.1 21.4 1.4 10.1 NBD1-S549R 16.7 1.2 1.2 13.4 NBD1-G551D 16.6 1.1 1.4 11.7 reduction in the folding yield in vitro (5) and of the efficiency of maturation and transit to the plasma membrane in vivo (10).
X
ABCC7 p.Ser549Arg 9188468:147:162
status: NEW[hide] SSCP analysis: a blind sensitivity trial. Hum Mutat. 1997;10(1):65-70. Jordanova A, Kalaydjieva L, Savov A, Claustres M, Schwarz M, Estivill X, Angelicheva D, Haworth A, Casals T, Kremensky I
SSCP analysis: a blind sensitivity trial.
Hum Mutat. 1997;10(1):65-70., [PMID:9222762]
Abstract [show]
Studies of the sensitivity of SSCP analysis usually have been performed under conditions contrary to the rules of quality control trials and have produced widely different results. We have performed a blind trial of the sensitivity of SSCP analysis for the detection of mutations in fragments up to 500 bp in length under a fixed single set of electrophoretic conditions. The mutation detection rate was 84%. In addition, we have identified a second mutation in nine samples. All these mutations are polymorphisms, including a novel polymorphism 1248 + 52T/C first reported in the present work.
Comments [show]
None has been submitted yet.
No. Sentence Comment
22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories.
X
ABCC7 p.Ser549Arg 9222762:22:1829
status: NEW57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1.
X
ABCC7 p.Ser549Arg 9222762:57:962
status: NEW[hide] CFTR haplotype analysis reveals genetic heterogene... Am J Hum Genet. 1995 Jun;56(6):1359-66. Rave-Harel N, Madgar I, Goshen R, Nissim-Rafinia M, Ziadni A, Rahat A, Chiba O, Kalman YM, Brautbar C, Levinson D, et al.
CFTR haplotype analysis reveals genetic heterogeneity in the etiology of congenital bilateral aplasia of the vas deferens.
Am J Hum Genet. 1995 Jun;56(6):1359-66., [PMID:7539210]
Abstract [show]
Congenital bilateral aplasia of the vas deferens (CBAVD) was suggested to be a mild form of cystic fibrosis (CF). Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in males with CBAVD revealed that in some males CBAVD is caused by two defective CFTR alleles. The genetic basis of CBAVD in the other males and its association with CF remained unclear. We undertook this study to test the hypothesis of commonality of CBAVD and CF by haplotype analysis, in the CFTR locus, of males suffering from CBAVD and of their families. According to the hypothesis of commonality of CBAVD and CF, two brothers with CBAVD are expected to carry the same two CFTR alleles, while their fertile brothers are expected to carry at least one different allele. Eleven families were studied, of which two families, with unidentified CFTR mutations, did not support this hypothesis. In these families two brothers with CBAVD inherited different CFTR alleles. Their fertile brothers inherited the same CFTR alleles as their brothers with CBAVD. These results provide evidence for genetic heterogeneity in CBAVD. Though in some families CBAVD is associated with two CFTR mutations, we suggest that in others it is caused by other mechanisms, such as mutations at other loci or homozygosity or heterozygosity for partially penetrant CFTR mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
38 The entire studied group of males with CBAVD was tested for 16 CFTR mutations, using DNA-PCR amplification (Saiki et al. 1985, 1988), followed by specific tests as described elsewhere: AF508 (Rommens et al. 1990); W1282X (Shoshani et al. 1992a); G542X, S549R, S549I, and 1717-1G-+A, by direct sequencing of exon 11, using oligonucleotide primers (Zielenski et al. 1991b); N1303K (Osborne et al. 1991); 3849+10Kb C&-T (Highsmith et al. 1994); W1089X and 4010delTATT (Shoshani et al.
X
ABCC7 p.Ser549Arg 7539210:38:253
status: NEW58 Mutation Analysis Fourteen CF-R mutations that were elsewhere identified among the Israeli CF patient population (Kerem et al. 1994) were analyzed: W1282X, AF508, N1303K, G542X, 3849+10Kb C--T, S549R, S549I, W1089X, 4010delTATT, G85E, 1717-1G--A, D1152H, 405+1G--A, and Q359K1T360K.
X
ABCC7 p.Ser549Arg 7539210:58:194
status: NEW59 Mutation Analysis Fourteen CF-R mutations that were elsewhere identified among the Israeli CF patient population (Kerem et al. 1994) were analyzed: W1282X, AF508, N1303K, G542X, 3849+10Kb C--T, S549R, S549I, W1089X, 4010delTATT, G85E, 1717-1G--A, D1152H, 405+1G--A, and Q359K1T360K.
X
ABCC7 p.Ser549Arg 7539210:59:194
status: NEW[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]
Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).
Comments [show]
None has been submitted yet.
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population.
X
ABCC7 p.Ser549Arg 7525963:21:271
status: NEW[hide] Direct sequencing of the complete CFTR gene: the m... Hum Mol Genet. 1993 Oct;2(10):1551-6. Cheadle JP, Goodchild MC, Meredith AL
Direct sequencing of the complete CFTR gene: the molecular characterisation of 99.5% of CF chromosomes in Wales.
Hum Mol Genet. 1993 Oct;2(10):1551-6., [PMID:7505689]
Abstract [show]
We have performed an extensive mutation analysis on 184 CF families in Wales. In our previous study, mutations on 329/369 CF chromosomes were identified after screening for delta F508 and sixteen other mutations. To identify the mutations on the remaining 40 uncharacterized CF chromosomes, we have carried out direct DNA sequencing over the complete coding region, intron splice sites, and part of the promoter region of the CFTR gene. During this study we have designed a set of internal sequencing primers which allow clear sequencing through the aforementioned regions. Sequence analysis revealed 15 further mutations (4 of which are novel), and 10 previously described polymorphisms. In total, we have identified 29 mutations, the distribution of which provides further insight into the functional domains of the CFTR protein. We have characterised 99.5% of the CF chromosomes (365/367, one sample degraded). In order to ascertain accurate frequency data for the Welsh population, CF families with at least 3 'Welsh' grandparents were strictly regarded as 'Welsh'. Of these 91 families, delta F508 accounts for 71.6%, 621 + 1G-->T 6.6% and 1898 + 1G-->A 5.5%. The implications for CF population screening in Wales are discussed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
59 C T T G : S S549R heterozygote G A T C 3659 deIC heterozygote C T A G " , T >G -»•Wt__ T A • C T , T A • A C C C .
X
ABCC7 p.Ser549Arg 7505689:59:12
status: NEW62 S549N (G-A a: 1778) and S549R (T-G at 1779) were sequenced from 1115', 1078 delT from 7i5\ 3659 deIC from 19e3'b, and 3272-26A-G from 17Bi5'.
X
ABCC7 p.Ser549Arg 7505689:62:24
status: NEW64 17b 18 19 20 21 22 23 24 M1V E60X O220X | R117H G85E 621*1G>T 977msA AF508 I AI607 1898*1G>A G642X 2184delA 1078delT I I 8549N 2184insA I I 1154insTC S549R G651D I R553X I R560T I 1717-1G>A W846X1 3272-26A>G L1077P R12B3U 3669delC 4 016in aT I N1303K 3849*10kbC>T Figure 2.
X
ABCC7 p.Ser549Arg 7505689:64:150
status: NEW[hide] Molecular mechanisms of CFTR chloride channel dysf... Cell. 1993 Jul 2;73(7):1251-4. Welsh MJ, Smith AE
Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis.
Cell. 1993 Jul 2;73(7):1251-4., [PMID:7686820]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
17 Classes of CFTR Mutations That Cause CF Class Defect Examples Do- Fre- Clin- main quency ical Protein production Nonsense mutations Frameshift Splice Processing Conduction 6542X NBDI 3.4 3905 insT NBD2 2.1 621 + G-T MSDl 1.3 Al507 NBDl AF506 NBDl s5491 NBDl S549R NED1 A559T NED1 N1303K NBDP G551 D NBDl G551S NBDl G1244E NBDP S1255P NBDP G1349D NBDP RI 17H MSDI R334W MSDl R347P MSDl 0.5 67.2 Rare 0.3 Rare 1.a 2.4 Rare Rare Rare Rare 0.6 0.4 0.5 PI PI PI PI PI PI PI PI PS PI PI PI PS PS PS NED, nucleotide-binding domain; MSD, membrane-spanning domain; PI, pancreatic insufficiency; PS, pancreatic sufficiency.
X
ABCC7 p.Ser549Arg 7686820:17:258
status: NEW[hide] A comprehensive CFTR mutation analysis of German c... Hum Mol Genet. 1993 Jun;2(6):809-11. Reiss J, Ellermeyer U, Rininsland F, Ballhausen P, Lenz U, Wagner S, Schlosser M
A comprehensive CFTR mutation analysis of German cystic fibrosis patients.
Hum Mol Genet. 1993 Jun;2(6):809-11., [PMID:7689013]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
56 Frequency of CFTR mutations checked routinely in German CF patients Mutation AF508 AI507 R553X G542X G551D R347P N1303K 1717 -lg-a S549R others in exon total Exon 10 10 11 11 11 7 21 llfb) 11 ll(c) Frequency 375/500 1/500 17/124(a) 13/124 7/124 6/124 6/124 5/124 2/124 0/124 % of total CF chromosomes 75.1 0.2 3.4 2.6 1.4 1.2 1.2 1.0 0.4 0.0 86.5 Reference (3) (17) (18) (17) (18) (10) (19) (17) (17) (20) (a) Non-AF508 chromosomes.
X
ABCC7 p.Ser549Arg 7689013:56:131
status: NEW[hide] Screening for five mutations detects 97% of cystic... Am J Hum Genet. 1992 Nov;51(5):951-6. Abeliovich D, Lavon IP, Lerer I, Cohen T, Springer C, Avital A, Cutting GR
Screening for five mutations detects 97% of cystic fibrosis (CF) chromosomes and predicts a carrier frequency of 1:29 in the Jewish Ashkenazi population.
Am J Hum Genet. 1992 Nov;51(5):951-6., [PMID:1384328]
Abstract [show]
To determine the distribution and frequency of cystic fibrosis (CF) mutations in the Israeli population, we have screened 96 patients for 11 relatively common mutations. Five mutations--delta F508, G542X, W1282X, N1303K, and 3849 + 10kb C-->T--were found to account for 97% of the CF alleles in the Ashkenazi Jews. In contrast, of the 11 mutations tested, only delta F508 was detected in Jewish patients of Sephardic or Oriental origin, accounting for 43% of the CF alleles. Four mutations--delta F508, G542X, W1282X, and N1303K--accounted for 55% of the CF alleles in Arab patients. In a pilot screening study, a random sample of 424 Ashkenazi individuals was analyzed for three mutations--delta F508, W1282X, and G542X. Thirteen individuals were detected as heterozygotes (six for delta F508 and seven for W1282X), predicting a heterozygote frequency of 1:29. This is similar to the frequency of carriers in the Caucasian population of northern European ancestry. On the basis of these data, the Ashkenazi population is considered to be a candidate for CF heterozygote screening.
Comments [show]
None has been submitted yet.
No. Sentence Comment
50 The mutations G551D, S549N, S5491, S549R, and 1717-1 G-OA were analyzed according to the method of Kerem et al.
X
ABCC7 p.Ser549Arg 1384328:50:35
status: NEW56 The mutations 621 + 1 G-oT, 1717-1 G-oA, S549N, S549I, S549R, G551D, and R553Xwere not foundin our patients.
X
ABCC7 p.Ser549Arg 1384328:56:55
status: NEW[hide] Genetic determination of exocrine pancreatic funct... Am J Hum Genet. 1992 Jun;50(6):1178-84. Kristidis P, Bozon D, Corey M, Markiewicz D, Rommens J, Tsui LC, Durie P
Genetic determination of exocrine pancreatic function in cystic fibrosis.
Am J Hum Genet. 1992 Jun;50(6):1178-84., [PMID:1376016]
Abstract [show]
We showed elsewhere that the pancreatic function status of cystic fibrosis (CF) patients could be correlated to mutations in the CF transmembrane conductance regulator (CFTR) gene. Although the majority of CF mutations--including the most common, delta F508--strongly correlated with pancreatic insufficiency (PI), approximately 10% of the mutant alleles may confer pancreatic sufficiency (PS). To extend this observation, genomic DNA of 538 CF patients with well-documented pancreatic function status were analyzed for a series of known mutations in their CFTR genes. Only 20 of the 25 mutations tested were found in this population. They accounted for 84% of the CF chromosomes, with delta F508 being the most frequent (71%), and the other mutations accounted for less than 5% each. A total of 30 different, complete genotypes could be determined in 394 (73%) of the patients. The data showed that each genotype was associated only with PI or only with PS, but not with both. This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as delta F508, delta I507, Q493X, G542X, R553X, W1282X, 621 + 1G----T, 1717-1G----A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T.
Comments [show]
None has been submitted yet.
No. Sentence Comment
58 Intron 10: 1717-1G-'A Exon 11: G542X .......... S549R ........... G551D .......... R553X .......... R560T .......... Exon 12: Y563N .......... P574H .......... Exon 19: 3659delC ....... Exon 20: W1282X ....... Exon 21: N1303K ..... G460-C A deletion G482-'A A deletion T575-C 621 + 1G-T C1132-T C1172- G C1496-A G1505-'T G1570-T C1609-T 3-bp deletion 3-bp deletion G1690-T G1717-1-A G1756-T T1779-G G1784- A C1789-T G1811-C T1819- A C1853- A C deletion G3978-A C4041-G Asp 110-His Frameshift Arg 117-His Frameshift Ile 148-Thr Splice mutation Arg 334-Trp Arg 347-Pro Ala 455- Glu Gly 458-'Val Gly480-Cys Gln 493- stop del of Ile 507 del of Phe 508 Val 520-Phe Splice mutation Gly 542- stop Ser 549-'Arg Gly 551-WAsp Arg 553- stop Arg 560- Thr Tyr 563- Asn Pro 574-His Frameshift Trp 1282-stop Asn 1303-Lys Dean et al. 1990 White et al. 1991 Dean et al. 1990 Zielenski et al. 1991a F. Rininsland, D. Bozon, and L.-C. Tsui, unpublished data Zielenski et al. 1991a Gasparini et al. 1991 Dean et al. 1990 Kerem et al. 1990b Cuppens et al. 1990 Strong et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1989b Jones et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Cutting et al. 1990 Cutting et al. 1990 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Vidaud et al. 1990 Osborne et al. 1990 PI or PS, but not with both.
X
ABCC7 p.Ser549Arg 1376016:58:48
status: NEW[hide] Association of a nonsense mutation (W1282X), the m... Am J Hum Genet. 1992 Jan;50(1):222-8. Shoshani T, Augarten A, Gazit E, Bashan N, Yahav Y, Rivlin Y, Tal A, Seret H, Yaar L, Kerem E, et al.
Association of a nonsense mutation (W1282X), the most common mutation in the Ashkenazi Jewish cystic fibrosis patients in Israel, with presentation of severe disease.
Am J Hum Genet. 1992 Jan;50(1):222-8., [PMID:1370365]
Abstract [show]
Only about 30% of the cystic fibrosis chromosomes in the Israeli cystic fibrosis patient populations carry the major CF mutation (delta F508). Since different Jewish ethnic groups tended to live as closed isolates until recent times, high frequencies of specific mutations are expected among the remainder cystic fibrosis chromosomes of these ethnic groups. Genetic factors appear to influence the severity of the disease. It is therefore expected that different mutations will be associated with either severe or mild phenotype. Direct genomic sequencing of exons included in the two nucleotide-binding folds of the putative CFTR protein was performed on 119 Israeli cystic fibrosis patients from 97 families. One sequence alteration which is expected to create a termination at residue 1282 (W1282X) was found in 63 chromosomes. Of 95 chromosomes, 57 (60%) are of Ashkenazi origin. Together with the delta F508 (23% in this group), G542X, N1303K, and 1717-1G----A mutations, the identification of 92% of cystic fibrosis chromosomes of Ashkenazi origin becomes possible. Patients homozygous for the W1282X mutation (n = 16) and patients heterozygous for the delta F508 and W1282X mutations (n = 22) had similarly severe disease, reflected by pancreatic insufficiency, high incidence of meconium ileus (37% and 27%, respectively), early age at diagnosis, poor nutritional status, and variable pulmonary function. In conclusion, the W1282X mutation is the most common cystic fibrosis mutation in the Ashkenazi Jewish patient population in Israel. This nonsense mutation is associated with presentation of severe disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
29 In a previous study of a small group of Israeli CF patients, four additional rare mutations (1717- 1G--A, G542X, S5491, and S549R) were found (Kerem et al. 1990b).
X
ABCC7 p.Ser549Arg 1370365:29:124
status: NEW56 The G542X, S5491, S549R, N1303K, and 1717- 1G--A mutations were detected by PCR and subse- quent allele specific oligo nucleotide hybridization as described elsewhere (Kerem et al. 1990b; Osborne et al. 1991).
X
ABCC7 p.Ser549Arg 1370365:56:18
status: NEW79 Therefore, for assessment of the severity of the W1282X mutation, it would have been appropriate to compare patients homozygous for the W1282X mutation with patients homozygous for the AF508 mutation and with patients heterozygous for Table I Analysis of Mutation Frequencies Identified in 97 Israeli CF Patients JEWISH PATIENTS ARAB Ashkenazim Sepharadim Unclassified PATIENTS No. of chromosomes sampled.... 95 51 8 40 W1282X (no. [%]) .................. 57 (60) 1 (2) 3 (38) 2 (5) AF508 (no. [%])..................... 21 (23) 18 (35) 2 (25) 10 (25) G542X (no. [%]).................... 4 (4) 2 (4)0 2 (5) N1303K (no. [%]) .................. 4 (4) 0 0 2 (5) 1717-1G-A (no. [%]) ............. 1 (1) 0 0 1 (3) S5491 (no. [%])...................... 0 0 0 2 (5) S549R (no. [%])..................... 0 1 (2) 2 (25) 2 (5) Total mutations (no. [%])...... 87 (92) 22 (43) 7 (88) 21 (53) both mutations.
X
ABCC7 p.Ser549Arg 1370365:79:761
status: NEW[hide] Single-strand conformation polymorphism (SSCP) ana... Hum Genet. 1992 Jan;88(3):283-7. Plieth J, Rininsland F, Schlosser M, Cooper DN, Reiss J
Single-strand conformation polymorphism (SSCP) analysis of exon 11 of the CFTR gene reliably detects more than one third of non-delta F508 mutations in German cystic fibrosis patients.
Hum Genet. 1992 Jan;88(3):283-7., [PMID:1370807]
Abstract [show]
In Central Europe, the delta F508 deletion accounts for approximately 75% of mutations in the cystic fibrosis transmembrane conductance regulator gene causing cystic fibrosis. The remainder comprise a large number of individually infrequent mutations whose detection requires a disproportionately large effort. However, a sizeable proportion of non-delta F508 mutations have been found to cluster within exon 11. We have taken advantage of this clustering to detect a total of five previously described point mutations present on 26/72 (36%) non-delta F508 chromosomes by polymerase chain reaction/direct sequencing of exon 11. These exon 11 mutations were then subjected to single-strand conformation polymorphism (SSCP) analysis, which was shown (i) to discriminate reliably between mutant and wildtype alleles and (ii) to generate reproducible mutation-specific band patterns. This analysis thus represents the first attempt to assess SSCP analysis retrospectively, and serves to illustrate the potential of this screening technique in diagnostic medicine.
Comments [show]
None has been submitted yet.
No. Sentence Comment
72 SSCP analysis performed on DNAs of six individuals with the following genotypes (nucleotide change in brackets): lanes W wildtype/wildtype, lanes 1 G551D/wildtype (G-*A), lanes 2 1717- 1G-~A/wildtype (G--~A), lanes 3 G542X/wildtype (G--~T), lanes 4 R553X/wildtype (C----~T),lanes 5 S549R/S549R(T-*G).
X
ABCC7 p.Ser549Arg 1370807:72:282
status: NEW[hide] Active intestinal chloride secretion in human carr... Am J Hum Genet. 2000 Dec;67(6):1422-7. Epub 2000 Oct 30. Hogenauer C, Santa Ana CA, Porter JL, Millard M, Gelfand A, Rosenblatt RL, Prestidge CB, Fordtran JS
Active intestinal chloride secretion in human carriers of cystic fibrosis mutations: an evaluation of the hypothesis that heterozygotes have subnormal active intestinal chloride secretion.
Am J Hum Genet. 2000 Dec;67(6):1422-7. Epub 2000 Oct 30., [PMID:11055897]
Abstract [show]
To explain the very high frequency of cystic fibrosis (CF) mutations in most populations of European descent, it has been proposed that CF heterozygotes have a survival advantage when infected with Vibrio cholerae or Escherichia coli, the toxins of which induce diarrhea by stimulation of active intestinal chloride secretion. Two assumptions underlie this hypothesis: (1) chloride conductance by the CF transmembrane conductance regulator (CFTR) is the rate-limiting step for active intestinal chloride secretion at all levels of expression, from approximately zero in patients with CF to normal levels in people who are not carriers of a mutation; and (2) heterozygotes have smaller amounts of functional intestinal CFTR than do people who are not carriers, and heterozygotes therefore secrete less chloride when exposed to secretagogues. The authors used an intestinal perfusion technique to measure in vivo basal and prostaglandin-stimulated jejunal chloride secretion in normal subjects, CF heterozygotes, and patients with CF. Patients with CF had essentially no active chloride secretion in the basal state, and secretion was not stimulated by a prostaglandin analogue. However, CF heterozygotes secreted chloride at the same rate as did people without a CF mutation. If heterozygotes are assumed to have less-than-normal intestinal CFTR function, these results mean that CFTR expression is not rate limiting for active chloride secretion in heterozygotes. The results do not support the theory that the very high frequency of CF mutations is due to a survival advantage that is conferred on heterozygotes who contract diarrheal illnesses mediated by intestinal hypersecretion of chloride.
Comments [show]
None has been submitted yet.
No. Sentence Comment
57 The remaining patient (patient 6) had only one detected CFTR mutation; however, because this patient definitely Table 1 Demographics and CFTR Mutation Analysis Group and Subject (Sex [Age])a Ethnicityb CFTR Mutation Analysisc CFTR Intron 8 Poly(T) Analysis Parents: 1 (M [28]) White Negative/DF508 7T/9T 2 (F [32]) White Negative/DF508 7T/9T 3 (F [44]) White Negative/DF508 7T/9T 4 (M [36]) AA Negative/DF508 9T/9T 5 (M [54]) White Negative/N1303K 7T/9T 6 (F [24]) White Negative/S549R 7T/7T 7 (F [30]) AA Negative/3120af9;1G-A 7T/7T Patients: 1 (F [20]) White DF508/N1303K 9T/9T 2 (F [22]) White DF508/DF508 9T/9T 3 (F [33]) White DF508/1898af9;1G-A 7T/9T 4 (F [27]) White DF508/DI507 7T/9T 5 (M [28]) White DF508/DF508 9T/9T 6 (F [31]) White Negative/DF508 7T/9T 7 (M [18]) White DF508/M1101K 7T/9T 8 (M [18]) White DF508/M1101K 7T/9T a Members of the patient group had CF; members of the parent group had offspring with CF who were not necessarily included in the present study.
X
ABCC7 p.Ser549Arg 11055897:57:482
status: NEW[hide] Analysis of 31 CFTR mutations in 55 families from ... Early Hum Dev. 2001 Nov;65 Suppl:S161-4. Gomez-Llorente MA, Suarez A, Gomez-Llorente C, Munoz A, Arauzo M, Antunez A, Navarro M, Gil A, Gomez-Capilla JA
Analysis of 31 CFTR mutations in 55 families from the South of Spain.
Early Hum Dev. 2001 Nov;65 Suppl:S161-4., [PMID:11755047]
Abstract [show]
We carried out a molecular analysis of 350 chromosomes from 55 families originating from the South of Spain (Andalucia) who were diagnosed with cystic fibrosis (CF). We used polymerase chain reaction, followed by an oligonucleotide ligation assay (OLA) and sequence-coded separation using capillary electrophoresis. A frequency of 43.5% for DeltaF508 was found, making it the most common CF mutation in our sample. Seven more mutations (G542X, R334W, R1162X, 2789+5G-->A, R117H, DeltaI507 and W1282X) were detected and accounted for 24.7% of the total. The remaining mutations (31.8%) were undetectable with the methodology used in this study.
Comments [show]
None has been submitted yet.
No. Sentence Comment
30 T I.5 R553X E.11 1078delT E.7 R560T E.11 R347P E.7 S549R E.11 R347H E.7 S549N E.11 R334W E.7 3849 + 10kbC !
X
ABCC7 p.Ser549Arg 11755047:30:51
status: NEW[hide] The rad50 signature motif: essential to ATP bindin... J Mol Biol. 2004 Jan 23;335(4):937-51. Moncalian G, Lengsfeld B, Bhaskara V, Hopfner KP, Karcher A, Alden E, Tainer JA, Paull TT
The rad50 signature motif: essential to ATP binding and biological function.
J Mol Biol. 2004 Jan 23;335(4):937-51., [PMID:14698290]
Abstract [show]
The repair of double-strand breaks in DNA is an essential process in all organisms, and requires the coordinated activities of evolutionarily conserved protein assemblies. One of the most critical of these is the Mre11/Rad50 (M/R) complex, which is present in all three biological kingdoms, but is not well-understood at the biochemical level. Previous structural analysis of a Rad50 homolog from archaebacteria illuminated the catalytic core of the enzyme, an ATP-binding domain related to the ABC transporter family of ATPases. Here, we present the crystallographic structure of the Rad50 mutant S793R. This missense signature motif mutation changes the key serine residue in the signature motif that is conserved among Rad50 homologs and ABC ATPases. The S793R mutation is analogous to the mutation S549R in the cystic fibrosis transmembrane conductance regulator (CFTR) that results in cystic fibrosis. We show here that the serine to arginine change in the Rad50 protein prevents ATP binding and disrupts the communication among the other ATP-binding loops. This structural change, in turn, alters the communication between Rad50 monomers and thus prevents Rad50 dimerization. The equivalent mutation was made in the human Rad50 gene, and the resulting mutant protein did form a complex with Mre11 and Nbs1, but was specifically deficient in all ATP-dependent enzymatic activities. This signature motif structure-function homology extends to yeast, because the same mutation introduced into the Saccharomyces cerevisiae RAD50 gene generated an allele that failed to complement a rad50 deletion strain in DNA repair assays in vivo. These structural and biochemical results extend our understanding of the Rad50 catalytic domain and validate the use of the signature motif mutant to test the role of Rad50 ATP binding in diverse organisms.
Comments [show]
None has been submitted yet.
No. Sentence Comment
5 The S793R mutation is analogous to the mutation S549R in the cystic fibrosis transmembrane conductance regulator (CFTR) that results in cystic fibrosis.
X
ABCC7 p.Ser549Arg 14698290:5:48
status: NEW33 This S793R in the ABC ATPase signature motif of Rad50 is analogous to a mutation in the ABC ATPase CFTR (S549R) that results in cystic fibrosis.27 - 29 The three-dimensional structure of this S793R mutant was solved at 2.1 A da; , and shows that the arginine residue at position 793 disrupts the ATP binding and forms inappropriate contacts with nearby amino acid residues.
X
ABCC7 p.Ser549Arg 14698290:33:105
status: NEW163 Strains and symbols are the same as in A. domains (NBD), and a serine to arginine change at residue 549 of NBD1 (equivalent to S793R in pfRad50) generates a non-functional transporter protein and consequently the cystic fibrosis disorder,28 suggesting that the same mutation may have similar effects in other proteins containing ABC domains.
X
ABCC7 p.Ser549Arg 14698290:163:64
status: NEW189 Given that the analogous mutation in CFTR (S549R) results in cystic fibrosis,27 - 29 the important role of the signature motif in coupling ATP interactions to ABC ATPase functions characterized here may be general to all ABC ATPase proteins.
X
ABCC7 p.Ser549Arg 14698290:189:43
status: NEW[hide] Diagnosis of cystic fibrosis in adults with diffus... J Cyst Fibros. 2004 Mar;3(1):15-22. Hubert D, Fajac I, Bienvenu T, Desmazes-Dufeu N, Ellaffi M, Dall'ava-Santucci J, Dusser D
Diagnosis of cystic fibrosis in adults with diffuse bronchiectasis.
J Cyst Fibros. 2004 Mar;3(1):15-22., [PMID:15463882]
Abstract [show]
We assessed the contribution of the sweat test, genotyping and nasal potential difference (NPD) in the diagnosis of cystic fibrosis (CF) in adults with diffuse bronchiectasis (DB). Among 601 adults referred for DB from 1992 to 2001, 46 were diagnosed with CF. The sweat test was positive in 37 patients and normal or intermediate in nine patients. Two CF mutations were identified in 18 patients (39%) by screening for 31 mutations and in 36 patients (78%) after complete genetic analysis. NPD was suggestive of CF in 71% of the patients. The combination of the sweat test and genetic analysis led to the diagnosis of CF in 45 patients. In the nine patients with normal or intermediate sweat test, the diagnosis was confirmed by screening for 31 mutations in five, by complete genetic screening in three, and by NPD in the remaining patient. Searching for CF should start with sweat test. If the sweat test is normal or intermediate, screening for 31 mutations may help to diagnose CF. A complete genetic analysis is indicated when only one mutation is detected and/or when other clinical features, such as obstructive azoospermia or pancreatic insufficiency, are suggestive of CF. NPD measurement is indicated in controversial cases.
Comments [show]
None has been submitted yet.
No. Sentence Comment
47 We used an oligonucleotide ligation assay using a commercially available kit (Cystic Fibrosis Assay, Applied Biosystems, Foster City, CA, USA) to seek 31 mutations in the CFTR gene (F508del, I507del, Q943X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA) which allowed to detect 82% of the CF alleles in France.
X
ABCC7 p.Ser549Arg 15463882:47:259
status: NEW129 * 31 mutations: F508del, I507del, Q493X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q ** 4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA. that the laboratory criteria for the diagnosis of CF should be expanded to include identification of CFTR mutations and abnormal bioelectrical properties of the nasal epithelium, in addition to the sweat test w7x.
X
ABCC7 p.Ser549Arg 15463882:129:93
status: NEW[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]
Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.
Comments [show]
None has been submitted yet.
No. Sentence Comment
42 Some have concentrated in the search of specific mutations that are Table 1 Mutations found in the Latin American CF patients Exon 1 p.L6VÌe; Exon 3 p.W57X, p.R75X, p.G85E Exon 4 p.R117H Exon 6a p.H199Y, p.V201M, p.L206W, p.Q220X, p.V232D, c.846delTÌe; Exon 6b p.Y275XÌe;, c.935delA Exon 7 p.R334W, p.R347P, p.Y362XÌe;, c.1078delT, c.1215delG Exon 8 c.1323_1324insAÌe; Exon 9 c.1460_1461delATÌe;, c.1353_1354insTÌe;,# Exon 10 p.I506T, p.I507del, p.F508del Exon 11 p.G542X, p.S549N, p.S549R, p.G551D, p.G551S, p.R553X, p.L558S, p.A559T, c.1782delA Exon 12 p.S589I Exon 13 p.H609RÌe;, p.P750L, p.V754M, c.1924_1930del, c.2055_2063del, c.2183AA NG;c.2184delA, c.2184delA, c.2185_2186insC, c.2347delG, c.2566_2567insTÌe;, c.2594_2595delGTÌe; Exon 14a p.R851L, c.2686_2687insTÌe; Exon 15 c.2869_2870insG Exon 16 c.3120+1GNA Exon 17a p.I1027T, c.3171delC, c.3199_3204del Exon 17b p.G1061R, p.R1066C, p.W1069X#, p.W1089X, p.Y1092X, p.W1098CÌe; Exon 19 p.R1162X, p.W1204X, p.Q1238X, c.3617_3618delGAÌe;#, c.3659delC Exon 20 p.W1282X, p.R1283M Exon 21 p.N1303K, c.4016_4017insT Exon 22 c.4160_4161insGGGGÌe; 5' flanking c.-834GNT Intron 2 c.297-1GNAÌe;, c.297-2ANG Intron 3 c.406-1GNA Intron 4 c.621+1GNT Intron 5 c.711+1GNT Intron 8 c.IVS8-5T Intron 10 c.1716GNA, c.1717-1GNA Intron 11 c.1811+1.6KbANG, c.1812-1GNA Intron 12 c.1898+1GNA, c.1898+3ANG Intron 14 c.2789+2_2789+3insA, c.2789+5GNA Intron 17a c.3272-26ANG Intron 17b c.3500-2ANGÌe; Intron 19 c.3849+1GNA, c.3849+10KbCNT Intron 20 c.4005+1GNA, c.4005-1GNA# Mutations are listed according to their position in the gene.
X
ABCC7 p.Ser549Arg 16963320:42:512
status: NEW51 Table 2 p.I507del p.S549N p.S549R p.G551D p.G551S p.R553X p.L558S p.A559T p.S589I p.H609RÌe; p.P750L p.V754M p.R851L p.I1027T p.G1061R p.R1066C p.W1069X# p.W1089X p.Y1092X p.W1098CÌe; p.W1204X 3 0 1 0 1 1 1 1 1 0 4 1 2 3 1 3 0.24 1 0.08 1 0.08 6 0.48 2 0.16 1 0.08 1 0.08 4 0.32 1 0.08 1 4 1 2 1 1 0 0 0 1 0 0 0 1 1 0 1 0 2 0 1 3 0 0 0 0 0 0 1 0.05 1 0.05 1 0.05 10 0.54 1 0.05 2 0.11 3 0.16 3 0 0 0 1 0 1 1 2 0.79 4 1.58 4 1 1 1 1 4 1.83 1 0.46 1 0.46 1 0.46 1 0.46 0 0 0 0 0 0 0 5 5 1 1 1 1 1 1 1 1 1 1 1 5 1.82 6 2.19 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 1.31 1 1.31 1 1.31 10 6 6 6 1 22 1 1 2 1 1 1 1 1 1 6 1 3 5 1 1 0.23 0.14 0.14 0.14 0.02 0.51 0.02 0.02 0.05 0.02 0.02 0.02 0.02 0.02 0.02 0.14 0.02 0.07 0.11 0.02 0.02 (continued on next page) Table 2 Mutation frequencies in Latin American CF patients Country p.Q1238X p.R1283M c.-834GNT c.297-1GNA* c.297-2ANG c.406-1GNA c.621+1GNT c.711+1GNT c.846delT* c.935delA c.1078delT c.1215delG c.1323_1324insA* c.1353_1354insT*# c.1460_1461delAT* Argentina 1 3 1 1 1 1 1 Subtotal and frequency (%) 1 0.08 1 0.08 4 0.32 1 0.08 1 0.08 1 0.08 Brazil 1 1 1 1 0 0 Subtotal and frequency (%) 1 0.05 2 0.11 1 0.05 Chile 0 0 Subtotal and frequency (%) Colombia 1 1 Subtotal and frequency (%) 1 0.46 1 0.46 Costa Rica Frequency (%) 0 Cuba Frequency (%) Ecuador Subtotal and frequency (%) Mexico 1 3 1 2 1 1 Subtotal and frequency (%) 1 0.36 3 1.09 1 0.36 1 0.36 2 0.73 1 0.36 Uruguay Frequency (%) 1 1.31 Venezuela Subtotal and frequency (%) Total 1 1 1 1 1 3 7 2 1 2 1 1 1 1 1 Frequency (%) 0.02 0.02 0.02 0.02 0.02 0.07 0.16 0.05 0.02 0.05 0.02 0.02 0.02 0.02 0.02 (continued ) Table 2 c.1716GNA c.1717-1GNA c.1782delA c.1811+1,6KbANG c.1812-1GNA c.1898+1GNA c.1898+3ANG c.1924_1930del c.2055_2063del c.2183AANG;c.2184delA c.2184delA c.2185_2186insC 5 1 4 1 1 1 0 1 2 2 6 0.48 1 0.08 6 0.48 2 0.16 1 0.08 1 0.08 1 0.08 1 0 6 5 1 3 0 0 0 0 7 0.37 5 0.27 1 0.05 3 0.16 0 0 12 1 12 5.50 1 0.46 0 0 1 1 2 2 1 0.36 1 0.36 2 0.73 2 0.73 1 1.31 1 14 1 18 5 3 1 1 2 6 1 1 0.02 0.32 0.02 0.41 0.11 0.07 0.02 0.02 0.05 0.14 0.02 0.02 (continued on next page) Table 2 Mutation frequencies in Latin American CF patients Country c.2347delG c.2566_2567insT* c.2594_2595delGT* c.2686_2687insT* c.2789+2_2789+3insA c.2789+5GNA c.2869_2870insG c.3120+1GNA c.3171delC c.3199_3204del c.3272-26ANG c.3500-2ANG* Argentina 2 1 2 2 3 3 1 1 2 Subtotal and frequency (%) 2 0.16 1 0.08 2 0.16 2 0.16 6 0.48 1 0.08 1 0.08 2 0.16 Brazil 2 1 1 1 6 0 0 4 0 Subtotal and frequency (%) 2 0.11 1 0.05 1 0.05 10 0.54 1 0.05 Chile Subtotal and frequency (%) Colombia 1 1 1 Subtotal and frequency (%) 1 0.46 1 0.46 1 0.46 Costa Rica Frequency (%) Cuba Frequency (%) Ecuador Subtotal and frequency (%) Mexico 2 Subtotal and frequency (%) 2 0.73 Uruguay Frequency (%) 1 1.31 Venezuela Subtotal and frequency (%) Total 2 2 1 3 2 9 1 12 1 2 2 1 Frequency (%) 0.05 0.05 0.02 0.07 0.05 0.21 0.02 0.28 0.02 0.05 0.05 0.02 (continued ) Table 2 c.3617_3618delGA*,# c.3659delC c.3849+1GNA c.3849+10kbCNT c.4005+1GNA c.4005-1GNA# c.4016_4017insT c.4160_4161insGGGG* c.IVS8-5T Unknown Authors 37 Aulehla-Scholz [17] 2 4 1 2 4 76 Visich [12] 1 78 Iba&#f1;ez [18] 54 Varela 2004 8 Prieto [19] 2 1 1 1 18 Oller-Ramirez 2004 4 0.32 6 0.48 1 0.08 1 0.08 2 0.16 5 0.40 271 21.75 205 Raskin [20] 32 Chiba [21] 1 89 Bernardino [22] 60 Marostica [23] 69 Parizotto [24] 99 Cabello [25,26] 33 Martins [27] 70 Streit [28] 0 5 120 Raskin [15] 0 0 12 Goloni-Bertollo [29] 1 0.05 5 0.27 789 42.46 48 Rios [30] 22 Molina [31] 1 11 Navarro [32] 0 3 34 Repetto [33] 4 1.58 115 45.63 1 67 Keyeux [14] 17 Restrepo [34] 1 0.46 84 38.53 0 25 52.08 Venegas [35] 95 65.97 Collazo [36] 20 Merino [37] 30 Cassiman 2004 15 Paz-y-Mino [38] 65 63.72 1 1 53 Orozco [13] 2 35 Villalobos [39] 3 1.09 1 0.36 88 32.11 11 14.47 Luzardo [40,41] 36 Restrepo [34] 41 Alvarado [42] 77 56.62 1 4 1 18 1 1 2 1 5 1620 0.02 0.09 0.02 0.41 0.02 0.02 0.05 0.02 0.11 37.21 Mutation frequencies in Latin American CF patients most frequently found in Caucasians, by allele specific polymerase chain reaction (AS-PCR), enzymatic digestion, allele specific oligonucleotide hybridization (ASO), or using mainly commercial kits, whereas other studies used a systematic approach to analyse the promoter, coding and exon/ intron boundaries of the CFTR region in the search for any possible mutation.
X
ABCC7 p.Ser549Arg 16963320:51:28
status: NEW90 Table 4 Mutations with frequencies between 0.1% and 1% Mutation Frequency Country Number of chromosomes % p.R334W 39 0.90 Argentina, Brazil, Chile, Colombia, Uruguay p.G85E 32 0.73 Argentina, Brazil, Ecuador, Mexico, Uruguay p.R553X 22 0.51 Argentina, Brazil, Chile, Mexico, Uruguay c.1811+1.6KbANG 18 0.41 Argentina, Colombia c.3849+10KbCNT 18 0.41 Argentina, Mexico c.1717-1GNA 14 0.32 Argentina, Brazil, Uruguay c.3120+1GNA 12 0.28 Argentina, Brazil Colombia p.I507del 10 0.23 Brazil, Mexico, Uruguay c.2789+5GNA 9 0.21 Argentina, Brazil, Colombia, Uruguay c.621+1GNT 7 0.16 Argentina, Brazil, Mexico p.S549N 6 0.14 Mexico p.S549R 6 0.14 Argentina, Brazil, Colombia p.G551D 6 0.14 Argentina, Mexico p.R1066C 6 0.14 Argentina, Colombia, Mexico c.2183ANG;c.2184delA 6 0.14 Argentina, Mexico p.Y1092X 5 0.11 Colombia, Mexico c.1812-1GNA 5 0.11 Brazil c.IVS8-5T 5 0.11 Argentina c.3659delC 4 0.09 Argentina Unfortunately, at present not all Latin-American countries have started molecular studies in their patients with a probable Cystic Fibrosis diagnosis.
X
ABCC7 p.Ser549Arg 16963320:90:628
status: NEW111 As discussed, another way to disclose similarities or differences in the distribution of mutations in the CF patients from Latin Table 6 Screening panel of CFTR mutations Country Total number of mutations Minimum panel Detection power Uruguay 12 6 mutations: p.F508del, p.G542X, p.R1162X, p.N1303K (p.R334W, p.G85E) 78% Argentina 52 7 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.R334W, p.G85E) 71% M&#e9;xico 35 8 mutations: p.F508del, p.G542X, p.N1303K (p.R75X, p.I507del, p.S549N,c.406-1GNA, c.3849+10kbGNA) 58% Colombia 19 7 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.S549R, c.1811+1.6kbANG) 56% Brazil 41 6 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.R334W) 53% The total number of mutations found in each country is indicated in the second column from left.
X
ABCC7 p.Ser549Arg 16963320:111:610
status: NEW[hide] Newborn screening for cystic fibrosis in Alberta: ... Paediatr Child Health. 2010 Nov;15(9):590-4. Lilley M, Christian S, Hume S, Scott P, Montgomery M, Semple L, Zuberbuhler P, Tabak J, Bamforth F, Somerville MJ
Newborn screening for cystic fibrosis in Alberta: Two years of experience.
Paediatr Child Health. 2010 Nov;15(9):590-4., [PMID:22043142]
Abstract [show]
On April 1, 2007, Alberta became the first province in Canada to introduce cystic fibrosis (CF) to its newborn screening program. The Alberta protocol involves a two-tier algorithm involving an immunoreactive trypsinogen measurement followed by molecular analysis using a CF panel for 39 mutations. Positive screens are followed up with sweat chloride testing and an assessment by a CF specialist. Of the 99,408 newborns screened in Alberta during the first two years of the program, 221 had a positive CF newborn screen. The program subsequently identified and initiated treatment in 31 newborns with CF. A relatively high frequency of the R117H mutation and the M1101K mutation was noted. The M1101K mutation is common in the Hutterite population. The presence of the R117H mutation has created both counselling and management dilemmas. The ability to offer CF transmembrane regulator full sequencing may help resolve diagnostic dilemmas. Counselling and management challenges are created when mutations are mild or of unknown clinical significance.
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 These include the following mutations: delF508, I507del, G542X, G85E, R117H, 621+1GT, 711+1GT, G551D, R334W, R347P, A455E, 1717-1GA, R560T, R553X, N1303K, 1898+1GA, 2184delA, 2789+5GA, 3120+1GA, R1162X, 3659delC, 3849+10kbCT, W1282X, 1078delT, 394delTT, Y122X, R347H, V520F, A559T, S549N, S549R, 1898+5GT, 2183AAG, 2307insA, Y1092X, M1101K, S1255X, 3876delA and 3905insT.
X
ABCC7 p.Ser549Arg 22043142:46:338
status: NEW84 TAbLe 1 Mutation frequency Mutation name Number of times detected (247 total mutations) Frequency, % expected, % (reference) delF508* 156 63.2 68.6 (1) R117H* 36 14.6 0.7 (1) G551D* 11 4.5 2.1 (1) 3849+10kbCT* 6 2.4 0.7 (1) M1101K 5 2.0 Undetermined (1) G542X* 4 1.6 2.4 (1) 1717-1GA* 4 1.6 0.7 (1) 621+1GT* 3 1.2 0.9 (1) 3120+1GA* 3 1.2 1.5 (1) G85E* 2 0.8 0.3 (1) A455E* 2 0.8 0.2 (1) R553X* 2 0.8 0.9 (1) 2789+5GA* 2 0.8 0.3 (1) ƊI507* 1 0.4 0.3 (1) 711+1GT* 1 0.4 0.1 (1) R334W* 1 0.4 0.2 (1) N1303K* 1 0.4 1.3 (1) 1898+1GA* 1 0.4 Undetermined (1) 2184delA* 1 0.4 0.1 (1) 394delTT 1 0.4 Undetermined (1) R347H 1 0.4 0.2 (4) V520F 1 0.4 0.2 (4) S549N 1 0.4 0.1 (1) 2307insA 1 0.4 0.2 (1) R347P* 0 0 0.2 (1) R560T* 0 0 0.2 (1) R1162X* 0 0 0.2 (1) 3659delC* 0 0 0.2 (1) W1282X* 0 0 1.4 (1) 1078delT 0 0 0.03 (2) Y122X 0 0 Undetermined (3) A559T 0 0 0.2 (1) S549R 0 0 Undetermined (1) 1898+5GT 0 0 Undetermined (1) 2183AAG 0 0 0.1 (1) Y1092X 0 0 Undetermined (1) S1255X 0 0 0.2 (1) 3876delA 0 0 Undetermined (4) 3905insT 0 0 0.12 (1) *American College of Medical Genetics-recommended mutations TAbLe 2 Positive cystic fibrosis newborn screen summary Screen result Unaffected Affected Further follow-up required Lost to follow-up Total Probable screen 0 23 0 0 23 Inconclusive screen One mutation 179 8 2 2 191 Markedly elevated IRT 2 0 0 0 2 R117H/F508del 0 0 5 0 5 Total 181 31 7 2 221 Data presented as n. IRT Immunoreactive trypsinogen TAbLe 3 F508del/R117H cases ID number Mutation status Sweat test result(s), &#b5;mol/L Other clinical information 24827 F508del/R117H 28 None 23726 F508del/R117H 36/insufficient/20 Fecal elastase normal 22578 F508del/R117H 10 None 24500 F508del/R117H 34/insufficient None 18527 F508del/R117H 29 None 23317 F508del/R117H+5T 47/62 Affected sibling 5T 5 thymine There were 23 newborns with probable screens.
X
ABCC7 p.Ser549Arg 22043142:84:912
status: NEW[hide] [Mucoviscidosis: CFTR mutation-specific therapy: a... Arch Pediatr. 2013 Jan;20(1):63-73. doi: 10.1016/j.arcped.2012.10.018. Epub 2012 Nov 27. Leonard A, Leal T, Lebecque P
[Mucoviscidosis: CFTR mutation-specific therapy: a ray of sunshine in a cloudy sky].
Arch Pediatr. 2013 Jan;20(1):63-73. doi: 10.1016/j.arcped.2012.10.018. Epub 2012 Nov 27., [PMID:23199563]
Abstract [show]
There is a need to find a cure for pulmonary disease in cystic fibrosis (CF), though full benefit of this approach will be restricted to those patients with well-preserved lungs. The most promising route is currently that of a pharmacological mutation-specific approach aiming at correcting the mechanism by which mutations lead to impairment of chloride conductance across respiratory epithelial cells. In the past 14years, 7 candidate drugs (CPX, 4PBA, gentamicin, PTC124, VX-770 or Ivacaftor, VX-809 or Lumacaftor, and Miglustat) have been investigated in CF patients. A postulate of 14 out of the 15 published studies has been that an effective agent had to improve total chloride secretion as assessed in vivo by nasal potential difference measurements. The present review casts a critical look at these studies. Apparent inconsistencies are discussed as well as possible limitations of nasal potential difference measurements as outcome parameters in these trials. Primarily targeting a mutation carried by less than 2% of French CF patients, the 2 Ivacaftor studies could well be a milestone on the long road toward a cure for CF. However, further data on safety and long-term efficacy are obviously needed and the current price of this medication in the US would make it unaffordable for European patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
178 De re &#b4;centes donne &#b4;es in vitro sugge `rent que cette me &#b4;dication soit e &#b4;galement efficace sur 9 autres mutations de la me c6;me classe (G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, G1349D) [50,51].
X
ABCC7 p.Ser549Arg 23199563:178:173
status: NEW[hide] Recent developments in targeting protein misfoldin... Bioorg Med Chem Lett. 2013 Apr 1;23(7):1935-44. doi: 10.1016/j.bmcl.2013.01.089. Epub 2013 Feb 4. Denny RA, Gavrin LK, Saiah E
Recent developments in targeting protein misfolding diseases.
Bioorg Med Chem Lett. 2013 Apr 1;23(7):1935-44. doi: 10.1016/j.bmcl.2013.01.089. Epub 2013 Feb 4., [PMID:23454013]
Abstract [show]
Protein misfolding is an emerging field that crosses multiple therapeutic areas and causes many serious diseases. As the biological pathways of protein misfolding become more clearly elucidated, small molecule approaches in this arena are gaining increased attention. This manuscript will survey current small molecules from the literature that are known to modulate misfolding, stabilization or proteostasis. Specifically, the following targets and approaches will be discussed: CFTR, glucocerebrosidase, modulation of toxic oligomers, serum amyloid P (SAP) sections and HSF1 activators.
Comments [show]
None has been submitted yet.
No. Sentence Comment
58 Examples of class II LOF mutations are F508del, I507del, and S549R.
X
ABCC7 p.Ser549Arg 23454013:58:61
status: NEW[hide] Molecular and functional analysis of the large 5' ... J Mol Diagn. 2013 May;15(3):331-40. doi: 10.1016/j.jmoldx.2013.01.001. Epub 2013 Mar 5. Giordano S, Amato F, Elce A, Monti M, Iannone C, Pucci P, Seia M, Angioni A, Zarrilli F, Castaldo G, Tomaiuolo R
Molecular and functional analysis of the large 5' promoter region of CFTR gene revealed pathogenic mutations in CF and CFTR-related disorders.
J Mol Diagn. 2013 May;15(3):331-40. doi: 10.1016/j.jmoldx.2013.01.001. Epub 2013 Mar 5., [PMID:23470247]
Abstract [show]
Patients with cystic fibrosis (CF) manifest a multisystemic disease due to mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR); despite extensive testing of coding regions, a proportion of CF alleles remains unidentified. We studied 118 patients with CF and CFTR-related disorders, most with one or both unknown mutations after the scanning of CFTR coding regions, and a non-CF control group (n = 75) by sequencing the 6000-bp region at the 5' of the CFTR gene. We identified 23 mutations, of which 9 were novel. We expressed such mutations in vitro using four cell systems to explore their functional effect, relating the data to the clinical expression of each patient. Some mutations reduced expression of the gene reporter firefly luciferase in various cell lines and may act as disease-causing mutations. Other mutations caused an increase in luciferase expression in some cell lines. One mutation had a different effect in different cells. For other mutations, the expression assay excluded a functional role. Gene variants in the large 5' region may cause altered regulation of CFTR gene expression, acting as disease-causing mutations or modifiers of its clinical phenotype. Studies of in vitro expression in different cell systems may help reveal the effect of such mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
177 On the other hand, a mutation that enhances CFTR expression and mitigates the effect of the S549R mutation has been described.26 c.-5914A>G was identified in an adult patient with a CFTR-RD with both undetected mutations who had only bronchiectasis and a borderline sweat chloride level.
X
ABCC7 p.Ser549Arg 23470247:177:92
status: NEW[hide] A comprehensive assay for CFTR mutational analysis... Clin Chem. 2013 Oct;59(10):1481-8. doi: 10.1373/clinchem.2013.206466. Epub 2013 Jun 17. Abou Tayoun AN, Tunkey CD, Pugh TJ, Ross T, Shah M, Lee CC, Harkins TT, Wells WA, Tafe LJ, Amos CI, Tsongalis GJ
A comprehensive assay for CFTR mutational analysis using next-generation sequencing.
Clin Chem. 2013 Oct;59(10):1481-8. doi: 10.1373/clinchem.2013.206466. Epub 2013 Jun 17., [PMID:23775370]
Abstract [show]
BACKGROUND: Cystic fibrosis is a life-threatening genetic disorder that has been associated with mutations in the CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] gene. Hundreds of CFTR mutations have been detected to date. Current CFTR genotyping assays target a subset of these mutations, particularly a mutation panel recommended by the American College of Medical Genetics for carrier screening of the general population. Fast sequencing of the entire coding sequence in a scalable manner could expand the detection of CFTR mutations and facilitate management of costs and turnaround times in the clinical laboratory. METHODS: We describe a proof-of-concept CFTR assay that uses PCR target enrichment and next-generation sequencing on the Ion Torrent Personal Genome Machine (PGM) platform. RESULTS: The scalability of the assay was demonstrated, with an average mean depth of coverage ranging from 500x to 3500x, depending on the number of multiplexed patient samples and the Ion Torrent chip used. In a blinded study of 79 previously genotyped patient DNA samples and cell lines, our assay detected most of the mutations, including single-nucleotide variants, small insertions and deletions, and large copy-number variants. The reproducibility was 100% for detecting mutations in independent runs. Our assay demonstrated high specificity, with only 2 false-positive calls (at 2184delA) found in 2 samples caused by a sequencing error in a homopolymer stretch of sequence. The detection rate for variants of unknown significance was very low in the targeted region. CONCLUSIONS: With continued optimization and system refinements, PGM sequencing promises to be a powerful, rapid, and scalable means of clinical diagnostic sequencing.
Comments [show]
None has been submitted yet.
No. Sentence Comment
53 of cases af9;/af9; c.1521_1523delCTT; c.1521_1523delCTT èc;F508; èc;F508 CF Yes 97 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.350Gb0e;A èc;F508; R117H CF Yes 53; 50 Dartmouth 1 af9;/af9; c.350Gb0e;A; c.1477Cb0e;T R117H; Q493*b CF Yes 52; 49 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.1000Cb0e;T èc;F508; R334W CF Yes 49; 54 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.489af9;1Gb0e;T èc;F508; 621af9;1Gb0e;T CF Yes 48; 47 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.1364Cb0e;A èc;F508; A455E CF Yes 51; 46 Dartmouth 1 af9;/af9; c.489af9;1Gb0e;T; c.2988af9;1Gb0e;A 621af9;1Gb0e;T; 3120af9;1Gb0e;A CF Yes 48; 49 Coriell 1 af9;/af9; c.1521_1523delCTT; c.1657Cb0e;T èc;F508; R553* CF Yes 44; 49c Coriell 2 af9;/af9; c.1521_1523delCTT; c.3528delC èc;F508; 3659delC CF Yes 46; 46 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.579af9;1Gb0e;T 621af9;1Gb0e;T; 711af9;1Gb0e;T CF Yes 50; 51 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.254Gb0e;A 621af9;1Gb0e;T; G85E CF Yes 50; 45 Coriell 1 af9;/af9; c.1521_1523delCTT; c.1679Gb0e;C èc;F508; R560T CF Yes 44; 52 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.1364Cb0e;A 621af9;1Gb0e;T; A455E CF Yes 50; 49 Coriell 1 af9;/af9; c.3909Cb0e;G; c.4046Gb0e;A N1303K; G1349D CF Yes 47; 52 Coriell 1 af9;/af9; c.2657af9;5Gb0e;A; c.2657af9;5Gb0e;A 2789af9;5Gb0e;A; 2789af9;5Gb0e;A CF Yes 100 Coriell 1 af9;/af9; c.1040Gb0e;C; c.1652Gb0e;A R347P; G551D CF Yes 51; 49 Coriell 1 af9;/af9; c.1000Cb0e;T; c.3368-2Ab0e;T R334W; 3500-2Ab0e;G CF Yes 53; 45 Coriell 1 af9;/af9; c.254Gb0e;A; c.3454Gb0e;C G85E; D1152H CF Yes 44; 47 Coriell 1 af9;/af9; c.1521_1523delCTT; c.350Gb0e;A èc;F508; R117H CF Yes 49; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.54-5940_273af9;10250del21kb èc;F508; CFTRdel2,3 CF Yes 47; N/Ad Coriell 1 af9;/af9; c.1521_1523delCTT; c.1766af9;1Gb0e;A èc;F508; 1898af9;1Gb0e;A CF Yes 47; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.2051_2052delAAinsG èc;F508; K684Sfs CF Yes 47; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.2052del èc;F508; K684Nfs*38 CF Yes 51; 55 Coriell 1 af9;/afa; c.1521_1523delCTT èc;F508 Carrier Yes 50c Dartmouth 16 af9;/afa; c.1652Gb0e;A G551D Carrier Yes 50c Dartmouth 5 af9;/afa; c.1519_1521delATC èc;I507 Carrier Yes 46 Dartmouth 1 af9;/afa; c.3454Gb0e;C D1152H Carrier Yes 50 Dartmouth 1 af9;/afa; c.1657Cb0e;T R553* Carrier Yes 51 Dartmouth 1 af9;/afa; c.178Gb0e;T E60* Carrier Yes 51 Dartmouth 1 af9;/afa; c.3846Gb0e;A W1282* Carrier Yes 45c Dartmouth 3 af9;/afa; c.1000Cb0e;T R334W Carrier Yes 51 Dartmouth 1 af9;/afa; c.1624Gb0e;T G542* Carrier Yes 47c Dartmouth 4 af9;/afa; c.3484Cb0e;T R1162* Carrier Yes 43 Dartmouth 1 af9;/afa; c.1766af9;1Gb0e;A 1898af9;1Gb0e;A Carrier Yes 57 Dartmouth 1 af9;/afa; c.3773_3774insT 3905insT (L1258Ffs*7) Carrier Yes 37 Dartmouth 1 af9;/afa; c.350Gb0e;A R117H Carrier Yes 50c Dartmouth 3 af9;/afa; c.1645Ab0e;C S549R Ab0e;C Carrier No N/A Dartmouth 1 af9;/afa; c.1040Gb0e;A R347H Carrier Yes 47 Dartmouth 1 af9;/afa; c.3909Cb0e;G N1303K Carrier Yes 46 Dartmouth 1 af9;/afa; c.3718-2477Cb0e;T 3849af9;10kbCb0e;T Carrier Yes 51 Coriell 1 af9;/afa; c.2988af9;1Gb0e;A 3120af9;1Gb0e;A Carrier Yes 49 Coriell 1 af9;/afa; c.489af9;1Gb0e;T 621af9;1Gb0e;T Carrier Yes 50 Coriell 1 af9;/afa; c.1585-1Gb0e;A 1717-1Gb0e;A Carrier Yes 51 Coriell 1 afa;/afa;e N/Af N/A Normal N/A N/A Dartmouth 9 a af9;/af9;, 2 pathogenic mutations; af9;/afa;, carrier of a single pathogenic mutation; afa;/afa;, absence of any pathogenic mutations.
X
ABCC7 p.Ser549Arg 23775370:53:3309
status: NEW96 The missed mutation (S549R; Ab0e;C, c.1645Ab0e;C; Table 1) was expected, because it was masked by one of the primers in our design, a limitation that will be addressed in the Fig. 1.
X
ABCC7 p.Ser549Arg 23775370:96:21
status: NEW[hide] Genetic testing of sperm donors for cystic fibrosi... Eur J Obstet Gynecol Reprod Biol. 2013 Sep;170(1):183-7. doi: 10.1016/j.ejogrb.2013.06.022. Epub 2013 Jul 15. Landaburu I, Gonzalvo MC, Clavero A, Ramirez JP, Yoldi A, Mozas J, Zamora S, Martinez L, Castilla JA
Genetic testing of sperm donors for cystic fibrosis and spinal muscular atrophy: evaluation of clinical utility.
Eur J Obstet Gynecol Reprod Biol. 2013 Sep;170(1):183-7. doi: 10.1016/j.ejogrb.2013.06.022. Epub 2013 Jul 15., [PMID:23866907]
Abstract [show]
OBJECTIVE: To evaluate the clinical utility of genetic testing for cystic fibrosis (CF) and spinal muscular atrophy (SMA) in sperm donors. STUDY DESIGN: We studied the results of the genetic tests for CF and SMA applied to 372 sperm donor candidates. The CF carrier screening test analysed 32 mutations on the CFTR gene. Regarding SMA, the carrier test studied possible deletions of SMN1/2 by Multiplex Ligation-dependent Probe Amplification (MLPA) methodology. RESULTS: The carrier frequency obtained was greater for SMA than for CF. After adjusting the results obtained for the sensitivity of the tests, and taking into account the prevalence of female carriers in our population, the probability of transmission of the disease to the child from a donor with a negative genetic test was about five times lower in the case of SMA than in CF, although this difference was not statistically significant. The number of donors needed to screen (NNS) to avoid the occurrence of a child being affected by CF and SMA in our population was similar in both cases (1591 vs. 1536). CONCLUSIONS: This study demonstrates the need to include SMA among the diseases for which genetic screening is performed in the process of sperm donor selection. We believe that testing donors for SMA is as important and as useful as doing so for CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 The panel of mutations studied was: S549N, S549R, R553X, G551D, V520F, I507del, F508del, 3876delA, 1717-1G->A, G542X, R560T, 3120+1G->A, A455E, R117H, 394delTT, 2183AA- >G, 2184delA, 2789+5G->A, 1898+1G->A, 621+1G->T, 711+1G- >T, G85E, R347P, R347H, W1282X, R334W, 1078delT, 3849+10kbC->T, R1162X, N1303K, 3659delC, 3905insT.
X
ABCC7 p.Ser549Arg 23866907:51:43
status: NEW[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]
Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.
Comments [show]
None has been submitted yet.
No. Sentence Comment
28 These include the most common CFTR gating mutation, G551D, as well as the G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D mutations [12].
X
ABCC7 p.Ser549Arg 23891399:28:88
status: NEW[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]
Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
44 RESULTS The 32-mutation panel is composed of the 23 variants from the ACMG/ACOG screening panel combined with 9 additional mutations, namely, 3876delA, R347H, S549N, 3905insT, 1078delT, V520F, 394delTT, S549R, and 2183AA>G.
X
ABCC7 p.Ser549Arg 24357848:44:203
status: NEW47 Even the 1078delT mutation that was removed from the ACMG/ ACOG screening panel achieved 0.1% prevalence.8 Only the S549R variant was observed at a lower frequency (0.07%).
X
ABCC7 p.Ser549Arg 24357848:47:116
status: NEW63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population.
X
ABCC7 p.Ser549Arg 24357848:63:1251
status: NEWX
ABCC7 p.Ser549Arg 24357848:63:3351
status: NEW80 The Table 3ߒ Frequency of 5T/7T/9T genotypes as a result of R117H reflex testing Poly-T alleles Number of detected alleles (%) CF32 panel CF69 panel 5T/5T 23 (0.44) 2 (0.73) 5T/7T 430 (8.27) 26 (9.49) 5T/9T 38 (0.73) 1 (0.37) 7T/7T 4,103 (78.93) 219 (79.92) 7T/9T 604 (11.61) 26 (9.49) 9T/9T 1 (0.02) 0 Total 5,198 (100) 274 (100) 394delTTd c.262_263delTT 3 0.10 G178Rd p.G178R 3 0.10 V520Fd p.V520F 3 0.10 2143delTd c.2012delT 2 0.06 935delAe c.803delA 2 0.06 A455Eb p.A455E 2 0.06 Q890Xd p.Q890X 2 0.06 S549Rd p.S549R 2 0.06 2869insGd c.2737insG 1 0.03 405ߙ+ߙ3A>Ce c.273ߙ+ߙ3A>C 1 0.03 G480Ce p.G480C 1 0.03 M1101Kd p.M1101K 1 0.03 Y122Xd p.Y122X 1 0.03 Total 3,088 100 a 1898ߙ+ߙ5G>Te , 444delA, G330X, S364Pe , K710X, and S1196X mutations were not detected in the target population.
X
ABCC7 p.Ser549Arg 24357848:80:520
status: NEW[hide] The relative frequency of CFTR mutation classes in... J Cyst Fibros. 2014 Jul;13(4):403-9. doi: 10.1016/j.jcf.2013.12.003. Epub 2014 Jan 16. De Boeck K, Zolin A, Cuppens H, Olesen HV, Viviani L
The relative frequency of CFTR mutation classes in European patients with cystic fibrosis.
J Cyst Fibros. 2014 Jul;13(4):403-9. doi: 10.1016/j.jcf.2013.12.003. Epub 2014 Jan 16., [PMID:24440181]
Abstract [show]
More than 1900 different mutations in the CFTR gene have been reported. These are grouped into classes according to their effect on the synthesis and/or function of the CFTR protein. CFTR repair therapies that are mutation or mutation class specific are under development. To progress efficiently in the clinical phase of drug development, knowledge of the relative frequency of CFTR mutation classes in different populations is useful. Therefore, we describe the mutation class spectrum in 25,394 subjects with CF from 23 European countries. In 18/23 countries, 80% or more of the patients had at least one class II mutation, explained by F508del being by far the most frequent mutation. Overall 16.4% of European patients had at least one class I mutation but this varied from 3 countries with more than 30% to 4 countries with less than 10% of subjects. Overall only respectively 3.9, 3.3 and 3.0% of European subjects had at least one mutation of classes III, IV and V with again great variability: 14% of Irish patients had at least one class III mutation, 7% of Portuguese patients had at least one class IV mutation, and in 6 countries more than 5% of patients had at least one class V mutation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
56 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations Large deletions and insertions 1078delT; 1717-1GA; 3659delC; 621+1GT Class II Defective protein processing G85E, F508del, I507del, R560T, N1303K Class III Defective protein regulation ('gating`) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R117H, R334W, R347P Class V Reduced amount of functioning protein 2789+5GA, 3849+10KbCT, A455E Unclassified All other mutations, including those unknown.
X
ABCC7 p.Ser549Arg 24440181:56:343
status: NEW[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]
Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B).
X
ABCC7 p.Ser549Arg 24517344:81:758
status: NEW[hide] New pharmacological approaches for cystic fibrosis... Pharmacol Ther. 2015 Jan;145:19-34. doi: 10.1016/j.pharmthera.2014.06.005. Epub 2014 Jun 14. Bell SC, De Boeck K, Amaral MD
New pharmacological approaches for cystic fibrosis: promises, progress, pitfalls.
Pharmacol Ther. 2015 Jan;145:19-34. doi: 10.1016/j.pharmthera.2014.06.005. Epub 2014 Jun 14., [PMID:24932877]
Abstract [show]
With the discovery of the CFTR gene in 1989, the search for therapies to improve the basic defects of cystic fibrosis (CF) commenced. Pharmacological manipulation provides the opportunity to enhance CF transmembrane conductance regulator (CFTR) protein synthesis and/or function. CFTR modulators include potentiators to improve channel gating (class III mutations), correctors to improve abnormal CFTR protein folding and trafficking (class II mutations) and stop codon mutation read-through drugs relevant for patients with premature stop codons (most class I mutations). After several successful clinical trials the potentiator, ivacaftor, is now licenced for use in adults and children (>six years), with CF bearing the class III G551D mutation and FDA licence was recently expanded to include 8 additional class III mutations. Alternative approaches for class I and class II mutations are currently being studied. Combination drug treatment with correctors and potentiators appears to be required to restore CFTR function of F508del, the most common CFTR mutation. Alternative therapies such as gene therapy and pharmacological modulation of other ion channels may be advantageous because they are mutation-class independent, however progress is less well advanced. Clinical trials for CFTR modulators have been enthusiastically embraced by patients with CF and health care providers. Whilst novel trial end-points are being evaluated allowing CFTR modulators to be efficiently tested, many challenges related to the complexity of CFTR and the biology of the epithelium still need to be overcome.
Comments [show]
None has been submitted yet.
No. Sentence Comment
547 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations: G542X, R1162X, RW1282X Deletions and insertions: CFTRdele2,3; 1078delT; 1717-1G A; 3659delC; 621+1G N T Class II Defective protein processing G85E, F508del, I507del, R560T, A561E, R1066C, N1303K Class III Defective protein regulation (gating) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R334W, R347P, R117H Class V Reduced amount of functioning protein 2789+5G A, 3272-26ANG, 3849+10KbC T, A455E Class VI Reduced cell surface stability Rescued F508del, c.120del23 Unclassified All other mutations, including those unknown a F508del-CFTR pocket (at NBD1:ICL4 interface) (Farinha et al., 2013).
X
ABCC7 p.Ser549Arg 24932877:547:386
status: NEW[hide] CFTR Modulators for the Treatment of Cystic Fibros... P T. 2014 Jul;39(7):500-11. Pettit RS, Fellner C
CFTR Modulators for the Treatment of Cystic Fibrosis.
P T. 2014 Jul;39(7):500-11., [PMID:25083129]
Abstract [show]
Defects in a single gene lead to the defective proteins that cause cystic fibrosis, making the disease an ideal candidate for mutation-targeted therapy. Although ivacaftor is currently the only FDA-approved CFTR modifier, others are in development.
Comments [show]
None has been submitted yet.
No. Sentence Comment
36 At 48 weeks, 67% of patients in the ivacaftor group had not had a pulmonary exacerbation compared with 41% in the Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Ramsey(2011)30 STRIVE: Randomized, double-blind, placebo-controlled G551D Age 12-53 years N = 161 FEV1 40-90% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Percent change in FEV1 from baseline to 24 wks (P < 0.001): IVA, 10.4%; PBO, -0.2% ߦ Percent change in FEV1 from baseline to 48 wks compared with PBO (P < 0.001): IVA, 10.5% ߦ Percent of patients pulmonary exacerbation-free at 48 wks: IVA, 67%; PBO, 41% ߦ Change in body weight from baseline to 48 wks: IVA, 3.1 kg; PBO, 0.4 kg ߦ Sweat chloride change from baseline to 48 wks compared with PBO (P < 0.001): IVA, -48.1 mmol/L ߦ Change in CFQ-R respiratory domain from baseline to 48 wks (P < 0.001): IVA, 5.9 pts; PBO, -2.7 pts Davies (2013)29 ENVISION: Randomized, double-blind, placebo-controlled G551D Age 6-11 years N = 52 FEV1 40-105% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Absolute change in FEV1 percentage from baseline at 48 wks compared with PBO (P < 0.001): IVA, 10% ߦ Absolute change in FEV1 percentage from baseline at 24 wks (P < 0.001): IVA, 12.6%; PBO, 0.1% ߦ Mean change in sweat chloride from baseline to 48 wks compared with PBO (P < 0.001): IVA, -54.3 mmol/L ߦ Body weight change from baseline to 48 wks compared with PBO (P < 0.001): IVA, 2.8 kg ߦ Absolute CFQ-R change from baseline to 24 wks compared with PBO (P = 0.109): IVA, 6.1 pts McKone (2013)31 PERSIST: Open-label extension G551D Age ࣙ 6 years Patients had completed 48 wks of either ENVISION or STRIVE IVA 150 mg b.i.d. 96 wks (patients received 96 wks or 144 wks of IVA depending on ENVISION or STRIVE randomization) ߦ Absolute change in percent predicted FEV1: &#b0; &#b0; STRIVE (IVA IVA) Study start (48 wks of prior treatment): 9.4 &#b1; 8.3 &#b0; &#b0; STRIVE (IVA IVA) 144 wks: 9.4 &#b1; 10.8 &#b0; &#b0; STRIVE (PBO IVA) Study start: -1.2 &#b1; 7.8 &#b0; &#b0; STRIVE (PBO IVA) 96 wks: 9.5 &#b1; 11.2 &#b0; &#b0; ENVISION (IVA IVA) Study start (48 wks of prior treatment): 10.2 &#b1; 15.7 &#b0; &#b0; ENVISION (IVA IVA) 144 wks: 10.3 &#b1; 12.4 &#b0; &#b0; ENVISION (PBO IVA) Study start: -0.6 &#b1; 10.1 &#b0; &#b0; ENVISION (PBO IVA) 96 wks: 10.5 &#b1; 11.5 ߦ Absolute change in weight (kg): &#b0; &#b0; STRIVE (IVA IVA) Study start (48 wks of prior treatment): 3.4 &#b1; 4.9 &#b0; &#b0; STRIVE (IVA IVA) 144 wks: 4.1 &#b1; 7.1 &#b0; &#b0; STRIVE (PBO IVA) Study start: 0.3 &#b1; 2.2 &#b0; &#b0; STRIVE (PBO IVA) 96 wks: 3 &#b1; 4.2 &#b0; &#b0; ENVISION (IVA IVA) Study start (48 wks of prior treatment): 6.1 &#b1; 2.9 &#b0; &#b0; ENVISION (IVA IVA) 144 wks: 14.8 &#b1; 5.7 &#b0; &#b0; ENVISION (PBO IVA) Study start: 2.9 &#b1; 1.8 &#b0; &#b0; ENVISION (PBO IVA) 96 wks: 10.1 &#b1; 4.1 ߦ Absolute change in CFQ-R respiratory domain: &#b0; &#b0; STRIVE (IVA IVA) Study start (48 wks of prior treatment): 6.4 &#b1; 16.8 &#b0; &#b0; STRIVE (IVA IVA) 144 wks: 6.8 &#b1; 19.6 &#b0; &#b0; STRIVE (PBO IVA) Study start: -3.6 &#b1; 14.1 &#b0; &#b0; STRIVE (PBO IVA) 96 wks: 9.8 &#b1; 16.2 &#b0; &#b0; ENVISION (IVA IVA) Study start (48 wks of prior treatment): 7.4 &#b1; 17.4 &#b0; &#b0; ENVISION (IVA IVA) 144 wks: 10.6 &#b1; 18.9 &#b0; &#b0; ENVISION (PBO IVA) Study start: 0.8 &#b1; 18.4 &#b0; &#b0; ENVISION (PBO IVA) 96 wks: 10.8 &#b1; 12.8 CFTR Modulators for the Treatment of Cystic Fibrosis Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Davies (2013)32 Placebo-controlled, double-blind, crossover study G551D Age > 6 years N = 17 FEV1 > 90% LCI > 7.4 Sequence 1: PBO WO IVA 150 mg b.i.d. Sequence 2: IVA 150 mg b.i.d. WO PBO 28-day treatment and WO periods ߦ Average change in LCI from baseline compared with PBO (P < 0.0001): IVA, -2.16 (95% CI, -2.88 to -1.44) ߦ Average change in FEV1 from baseline compared with PBO (P = 0.0103): IVA, 8.67 (95% CI, 2.36 to 14.97) ߦ Average change in FEF25-75 from baseline compared with PBO (P = 0.0237): IVA, 16.56 (95% CI, 2.30 to 27.71) Barry (2013)34 Retrospective review G551D Age 20-31 in IVA group N = 21 FEV1 < 40% IVA 150 mg b.i.d. (n = 21); matched controls (n = 35) Median duration, 237 days ߦ Absolute FEV1 change from baseline (P = 0.0075): IVA, 0.125 L; CON, 0.01 L ߦ Percent predicted FEV1 change from baseline (P = 0.0092): IVA, 12.7%, CON, 2.2% ߦ Median weight increase from baseline: IVA, 1.8 kg; CON, 0.1 kg ߦ Median inpatient days per year decreased from 23 days to 0 days in the IVA group (P = 0.001) ߦ Median total intravenous antibiotic days per year decreased from 74 days to 38 days in the IVA group (P = 0.002) De Boeck (2013)37 KONNECTION: Randomized, double-blind, crossover, placebo-controlled Non-G551D gating mutations G178R, G551S, S549N, S549R, G970R, G1244E, S1251N, S1255P, G1349D Age ࣙ 6 years N = 39 FEV1 ࣙ 40% Treatment sequence 1: IVA 150 mg b.i.d. WO PBO open-label Treatment sequence 2: PBO WO IVA 150 mg b.i.d. open-label 8 wks of IVA or PBO; 4-8 wks WO period; 16 wks open label ߦ Absolute change from baseline percent predicted FEV1 (P < 0.0001): IVA, 7.49%; PBO, -3.19% ߦ Absolute change from baseline BMI (P < 0.0001): IVA, 0.68; PBO, 0.02 ߦ Absolute change from baseline in CFQ-R respiratory domain (P = 0.0004): IVA, 8.94 pts; PBO, -0.67 pts ߦ Absolute change from baseline in sweat chloride (mmol/L): IVA, -52.28; PBO, -3.11 Flume (2011)35 Randomized, double-blind, placebo-controlled, parallel group with open-label extension Homozygous F508del Age ࣙ 12 years Part 1: N = 140 Part 2: N = 33 42 patients were eligible for part 2 if change in FEV1 ࣙ 10% or sweat chloride decreased by at least 15 mmol/L at day 15 and week 8 Part 1: IVA 150 mg b.i.d. or PBO 16 wks Part 2: Open label IVA 150 mg b.i.d.
X
ABCC7 p.Ser549Arg 25083129:36:5197
status: NEW56 These promising results led to an FDA label expansion to include CF patients with the following eight mutations in addition to G551D: G178R, S549R, S549N, G551S, G1244E, S1251N, S1255P, and G1349D.38 Clinical Considerations Ivacaftor was well tolerated in clinical trials.
X
ABCC7 p.Ser549Arg 25083129:56:141
status: NEW[hide] A cocktail drug therapy for patients with cystic f... J Cyst Fibros. 2014 Sep;13(5):489-90. doi: 10.1016/j.jcf.2014.07.002. Epub 2014 Jul 24. Chen JH
A cocktail drug therapy for patients with cystic fibrosis?
J Cyst Fibros. 2014 Sep;13(5):489-90. doi: 10.1016/j.jcf.2014.07.002. Epub 2014 Jul 24., [PMID:25088968]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
6 More recently, VX-770 has been approved by the FDA (NDA 203188, www.fda.gov) and recommended by the EMA (EMA/CHMP/365663/2014) for use with an additional eight CF gating (class III) mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D), although, including G551D, these mutations still just occur in ~5% of CF patients worldwide.
X
ABCC7 p.Ser549Arg 25088968:6:207
status: NEW[hide] Defining a mutational panel and predicting the pre... Sultan Qaboos Univ Med J. 2014 Aug;14(3):e323-9. Epub 2014 Jul 24. Fass UW, Al-Salmani M, Bendahhou S, Shivalingam G, Norrish C, Hebal K, Clark F, Heming T, Al-Khusaiby S
Defining a mutational panel and predicting the prevalence of cystic fibrosis in oman.
Sultan Qaboos Univ Med J. 2014 Aug;14(3):e323-9. Epub 2014 Jul 24., [PMID:25097766]
Abstract [show]
OBJECTIVES: Cystic fibrosis transmembrane conductance regulator (CFTR) mutations form distinct mutational panels in different populations and subgroups. The frequency of cystic fibrosis (CF) mutations and prevalence are unknown in Oman. This study aimed to elucidate the mutational panel and prevalence of CF for the North Al Batinah (NAB) region in Oman and to estimate the national prevalence of CF based on the carrier screening of unrelated volunteers. METHODS: The study included retrospective and prospective analyses of CF cases in the NAB region for 1998-2012. Genetic analysis of disease-causing mutations was conducted by screening of the entire coding sequence and exon-intron borders. The obtained mutational panel was used for the carrier screening of 408 alleles of unrelated and unaffected Omani individuals. RESULTS: S549R and F508del were the major mutations, accounting for 89% of mutations in the patient population. Two private mutations, c.1733-1734delTA and c.1175T>G, were identified in the patient cohort. Two carriers, one for F508del and another for S549R, were identified by screening of the volunteer cohort, resulting in a predicted prevalence for Oman of 1 in 8,264. The estimated carrier frequency of CF in Oman was 1 in 94. The carrier frequency in the NAB region was 3.9 times higher. CONCLUSION: The mutational panel for the NAB region and the high proportion of S549R mutations emphasises the need for specific screening for CF in Oman. The different distribution of allele frequencies suggests a spatial clustering of CF in the NAB region.
Comments [show]
None has been submitted yet.
No. Sentence Comment
7 Results: S549R and F508del were the major mutations, accounting for 89% of mutations in the patient population.
X
ABCC7 p.Ser549Arg 25097766:7:9
status: NEW9 Two carriers, one for F508del and another for S549R, were identified by screening of the volunteer cohort, resulting in a predicted prevalence for Oman of 1 in 8,264.
X
ABCC7 p.Ser549Arg 25097766:9:46
status: NEW12 Conclusion: The mutational panel for the NAB region and the high proportion of S549R mutations emphasises the need for specific screening for CF in Oman.
X
ABCC7 p.Ser549Arg 25097766:12:79
status: NEW17 S549R is the predominant disease-causing mutation.
X
ABCC7 p.Ser549Arg 25097766:17:0
status: NEW20 Application to Patient Care - The predominance of only two major disease-causing CF mutations in the population (S549R and F508del) allows for economically efficient detection methods and a fast confirmation of a clinical CF diagnosis in 89% of cases.
X
ABCC7 p.Ser549Arg 25097766:20:114
status: NEW52 Restriction digest analysis was used for the screening of the substitution S549R in the volunteer cohort.
X
ABCC7 p.Ser549Arg 25097766:52:75
status: NEW59 For the estimation of CF prevalence, the allele Table 1: Mutational panel of cystic fibrosis transmembrane conductance regulator (CFTR) mutations of unrelated patients in the North Al Batinah region (N = 14) cDNA name Protein name Legacy name Location at exon # (legacy nomenclature exon #) Number of alleles Allelic frequency c.1647T>G p.Ser549Arg S549R (T>G) 12 (11) 21 0.75 c.1521-1523delCTT p.Phe508del F508del 11 (10) 4 0.14 ߤc.1733-1734delTA p.Leu578Argfs*10 - 13 (12) 2 0.07 c.1175T>G p.Val392Gly V392G 9 (8) 1 0.04 cDNA = complementary deoxyribonucleic acid.
X
ABCC7 p.Ser549Arg 25097766:59:339
status: NEWX
ABCC7 p.Ser549Arg 25097766:59:349
status: NEW63 However, detailed information about CF allele frequencies are available for the NAB region, as determined by the current study, as well as in the neighbouring UAE.11 These findings allow the prediction of CF prevalence in Oman based on the most commonly observed mutations, S549R and F508del.
X
ABCC7 p.Ser549Arg 25097766:63:274
status: NEW73 The substitution S549R and the three base pair deletion F508del mutations accounted for 89.2% of all disease-causing mutations in the patient cohort [Table 1].
X
ABCC7 p.Ser549Arg 25097766:73:17
status: NEW74 S549R was the predominant mutation followed by F508del, with an allele frequency of 0.75 and 0.14, respectively [Table 1].
X
ABCC7 p.Ser549Arg 25097766:74:0
status: NEW75 One individual was a compound heterozygote with S549R on one allele and the reported but not yet clinically described alteration c.1175T>G (p.Val392Gly) at exon 9 (or exon 8 using legacy nomenclature) on the other allele.27 The substitution of thymine to guanine results in the amino acid valine being changed to glycine at the position 392.
X
ABCC7 p.Ser549Arg 25097766:75:48
status: NEW82 The joined allele frequency for F508del and S549R in the NAB region was 0.89, which is very similar to the reported allele frequency of 0.95 for these two mutations in the UAE.11 The total CF allele frequency for F508del and S549R for the whole of Oman is unknown.
X
ABCC7 p.Ser549Arg 25097766:82:44
status: NEWX
ABCC7 p.Ser549Arg 25097766:82:225
status: NEW85 One individual was identified as a carrier for F508del and another individual as a carrier for S549R.
X
ABCC7 p.Ser549Arg 25097766:85:95
status: NEW86 Applying the average allele frequency for F508del and S549R, the identified mutations accounted for 92% of CF mutations in the population.
X
ABCC7 p.Ser549Arg 25097766:86:54
status: NEW94 e327 Discussion The substitution S549R and three base pair deletion F508del were found to be the two most common CF mutations in the NAB region of Oman.
X
ABCC7 p.Ser549Arg 25097766:94:33
status: NEW96 The clinical characteristics were in accordance with recorded homozygote mutations of S549R and F508del in CFTR2, including sweat chloride concentrations above 100 mmol/L, pancreatic insufficiency and diminished pulmonary function.27 The disease liability of S549R was recently confirmed.28 The predominant and characteristic mutation of the current CF cohort was the substitution S549R with an allele frequency of 0.75 [Table 1].
X
ABCC7 p.Ser549Arg 25097766:96:86
status: NEWX
ABCC7 p.Ser549Arg 25097766:96:259
status: NEWX
ABCC7 p.Ser549Arg 25097766:96:381
status: NEW97 The high coverage of CF cases by only two mutations was similar to findings in the UAE, where S549R and F508del were reported to be disease-causing in 95% of the investigated CF cases.27 Concordantly, in all investigated alleles of CF patients in the UAE, the substitution S549R occurred with the highest allele frequency (0.68).29 An explanation for the observed similarity might be the territorial proximity of the two countries and the cultural and historical ties between extended families which may go beyond administrative borders.
X
ABCC7 p.Ser549Arg 25097766:97:94
status: NEWX
ABCC7 p.Ser549Arg 25097766:97:273
status: NEW98 The allele frequency of S549R in an analysis of 27,177 chromosomes from 23 European and three North African countries only accounts for 12 identified chromosomes with S549R, resulting in an allele frequency of 4.4 x 10-4 .15 In addition, to the best of the authors` knowledge, S549R has been reported in six chromosomes of CF patients of Moroccan descent in Israel but in no other Arab epidemiological study of CF.29-31 Therefore, the high allele frequency of S549R in Oman and the UAE might suggest a specific geographical cluster for this substitution.
X
ABCC7 p.Ser549Arg 25097766:98:24
status: NEWX
ABCC7 p.Ser549Arg 25097766:98:167
status: NEWX
ABCC7 p.Ser549Arg 25097766:98:277
status: NEWX
ABCC7 p.Ser549Arg 25097766:98:460
status: NEW101 Other regional mutations occur with higher frequencies, such as 1548delG in Saudi Arabia18 and E1104X in Libya.19 The observed frequency for S549R in Oman follows exactly this pattern.
X
ABCC7 p.Ser549Arg 25097766:101:141
status: NEW105 The CF patient in the cohort who was compound heterozygote for c.1175G>T and S549R had mild pancreatic insufficiency and sweat chloride levels of above 100 mmol/L.
X
ABCC7 p.Ser549Arg 25097766:105:77
status: NEW108 It is significant to note that the mutational panel established in this study, with the predominance of the mutations S549R and F508del, emphasises the need for the development of regional laboratory strategies for fast and effective CF mutational screening and molecular genetic diagnoses.
X
ABCC7 p.Ser549Arg 25097766:108:118
status: NEW109 For S549R, the disruption of the restriction site of the DraIII enzyme can be considered a fast and cost-efficient screening tool.
X
ABCC7 p.Ser549Arg 25097766:109:4
status: NEW111 The strategy of screening for potential S549R carrier status in volunteer samples was successfully applied in this study and can be readily adapted for clinical use. In addition, this strategy does not exclude other private mutations which might be identified during the screening of future CF patients.
X
ABCC7 p.Ser549Arg 25097766:111:40
status: NEW112 However, it appears unlikely that the predominance of S549R identified in the Omani mutational panel of this study, with an allele frequency of 0.75, will be replaced by another as yet unidentified mutation because of the very close similarity to the S549R frequency reported in the UAE.
X
ABCC7 p.Ser549Arg 25097766:112:54
status: NEWX
ABCC7 p.Ser549Arg 25097766:112:251
status: NEW123 Third, the CF mutations S549R and F508del were the major mutations in the area and have also been reported in the UAE which shares a border with the NAB region.
X
ABCC7 p.Ser549Arg 25097766:123:24
status: NEW124 Therefore, the identification of two carriers in the NAB region but not in any other sample might indicate an increased allele frequency for the CF mutations S549R and F508del in the area.
X
ABCC7 p.Ser549Arg 25097766:124:158
status: NEW126 From these results, it appears that the major CFTR mutations S549R and F508del follow a spatial north-to-south pattern within the Omani population.
X
ABCC7 p.Ser549Arg 25097766:126:61
status: NEW131 Conclusion The two predominant CF mutations of S549R and F508del define the mutational panel in Oman.
X
ABCC7 p.Ser549Arg 25097766:131:47
status: NEW132 The mutation S549R appears to be clustered in one region and occurs with a higher prevalence in the NAB region of Oman.
X
ABCC7 p.Ser549Arg 25097766:132:13
status: NEW[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]
Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
359 Third, at the level of the NBD1:NBD2 heterodimer, CF-causing mutations are concentrated within the canonical ATP-binding site (S549N, S549R, G551D/G551S, G1244E, S1251N, and S1255P) (Fig. 7d).
X
ABCC7 p.Ser549Arg 25287046:359:134
status: NEW[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]
Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17].
X
ABCC7 p.Ser549Arg 25304080:59:917
status: NEW[hide] Profile of cystic fibrosis in a single referral ce... J Adv Res. 2014 Sep;5(5):563-8. doi: 10.1016/j.jare.2013.07.005. Epub 2013 Jul 15. El-Falaki MM, Shahin WA, El-Basha NR, Ali AA, Mehaney DA, El-Attar MM
Profile of cystic fibrosis in a single referral center in Egypt.
J Adv Res. 2014 Sep;5(5):563-8. doi: 10.1016/j.jare.2013.07.005. Epub 2013 Jul 15., [PMID:25685524]
Abstract [show]
It was generally believed that Cystic fibrosis (CF) is rare among Arabs; however, the few studies available from Egypt and other Arabic countries suggested the presence of many undiagnosed patients. The aim of the present study was to determine the frequency of CF patients out of the referred cases in a single referral hospital in Egypt. A total of 100 patients clinically suspected of having CF were recruited from the CF clinic of the Allergy and Pulmonology Unit, Children's Hospital, Cairo University, Egypt, throughout a 2 year period. Sweat chloride testing was done for all patients using the Wescor macroduct system for collection of sweat. Quantitative analysis for chloride was then done by the thiocyanate colorimetric method. Patients positive for sweat chloride (60 mmol/L) were tested for the DeltaF508 mutation using primer specific PCR for cystic fibrosis transmembrane conductance regulator (CFTR) gene. Thirty-six patients (36%) had a positive sweat chloride test. The main clinical presentations in patients were chronic cough in 32 (88.9%), failure to thrive in 27 (75%), steatorrhea in 24 (66.7%), and hepatobiliary involvement in 5 (13.9%). Positive consanguinity was reported in 50% of CF patients. Thirty-two patients were screened for DeltaF508 mutation. Positive DeltaF508 mutation was detected in 22 (68.8%) patients, 8 (25%) were homozygous, 14 (43.8%) were heterozygous, and 10 (31.3%) tested were negative. CF was diagnosed in more than third of patients suspected of having the disease on clinical grounds. This high frequency of CF among referred patients indicates that a high index of suspicion and an increasing availability of diagnostic tests lead to the identification of a higher number of affected individuals.
Comments [show]
None has been submitted yet.
No. Sentence Comment
130 In some cases, these more frequent mutations may be specific for a subset of the people in the Middle East defined by a common ethnic or religious background, e.g., the 1548delG mutation in Saudi Arabia [18,26], Bedouin tribes in the case of I1234V [27], the S549R (T > G) mutation in Bedouins from the United Arab Emirates and Oman [21], and the 548A > T mutation in Bahrain [28].
X
ABCC7 p.Ser549Arg 25685524:130:259
status: NEW[hide] Functional reconstitution and channel activity mea... J Vis Exp. 2015 Mar 9;(97). doi: 10.3791/52427. Eckford PD, Li C, Bear CE
Functional reconstitution and channel activity measurements of purified wildtype and mutant CFTR protein.
J Vis Exp. 2015 Mar 9;(97). doi: 10.3791/52427., [PMID:25867140]
Abstract [show]
The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of transporters. The phosphorylation and nucleotide dependent chloride channel activity of CFTR has been frequently studied in whole cell systems and as single channels in excised membrane patches. Many Cystic Fibrosis-causing mutations have been shown to alter this activity. While a small number of purification protocols have been published, a fast reconstitution method that retains channel activity and a suitable method for studying population channel activity in a purified system have been lacking. Here rapid methods are described for purification and functional reconstitution of the full-length CFTR protein into proteoliposomes of defined lipid composition that retains activity as a regulated halide channel. This reconstitution method together with a novel flux-based assay of channel activity is a suitable system for studying the population channel properties of wild type CFTR and the disease-causing mutants F508del- and G551D-CFTR. Specifically, the method has utility in studying the direct effects of phosphorylation, nucleotides and small molecules such as potentiators and inhibitors on CFTR channel activity. The methods are also amenable to the study of other membrane channels/transporters for anionic substrates.
Comments [show]
None has been submitted yet.
No. Sentence Comment
30 While the correctors VX-809 and VX-661 (are not yet approved for use in patients, the potentiator Kalydeco (ivacaftor; VX-770) is being used at 150 mg every 12 hr in CF patients >6 years with at least one G551D-CFTR mutation, and more recently for patients with one of G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D.
X
ABCC7 p.Ser549Arg 25867140:30:283
status: NEW[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]
Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.
Comments [show]
None has been submitted yet.
No. Sentence Comment
300 These patients had the following mutations on the other allele: F508del (p.Phe508del) (1 CF-PS, 4 CFTR-RD and 1 CBAVD, including 2 siblings), G85E (p.Gly85Glu) (1 CF-PS), W1282X (p.Trp1282*) (2 CFTR-RD siblings), L320V (p.Leu320Val) (1 CFTR-RD), S549R(A>C) (p.Ser549Arg) (1 CFTR-RD), 711+5G>A (c.579+5G>A) (1 CBAVD) and unknown (1 CBAVD).
X
ABCC7 p.Ser549Arg 25910067:300:260
status: NEW318 These patients had the following mutations on the other allele: F508del (p.Phe508del) (3 CF-PS, 5 CFTR-RD and 10 CBAVD), N1303K (p.Asn1303Lys) (1 CF-PS, 3 CFTR-RD and 1 CBAVD), 1717-1G>A (c.1585-1G>A) (3 CF-PS and 1 CFTR-RD), W1282X (p.Trp1282*) (3 CFTR-RD), G542X (p.Gly542*) (1 CF-PS, 1 CFTR-RD and 1 CBAVD), Y849X (p.Tyr849*) (1 CFTR-RD), 3849+10kbC>T (c.3717+12191C>T) (1 CFTR-RD), R1162X (p.Arg1162*) (1 CBAVD), S549R(A>C) (p.Ser549Arg) (1 CFTR-RD) and unknown (1 CF-PS and 3 CBAVD).
X
ABCC7 p.Ser549Arg 25910067:318:431
status: NEW381 [Glu479*;Val754Met] F508del c.1521_1523delCTT CF-PI CF-causing p.Phe508del 1717-8G>A c.1585-8G>A CF-PI CF-causing 1717-1G>A c.1585-1G>A CF-PI CF-causing D529N c.1585G>A CF-PI nd p.Asp529Asn G542X c.1624G>T CF-PI CF-causing p.Gly542* S549R(A>C) c.1645A>C CF-PI CF-causing p.Ser549Arg S549N c.1646G>A CF-PI CF-causing p.Ser549Asn S549R(T>G) c.1647T>G CF-PI CF-causing p.Ser549Arg G551D c.1652G>A CF-PI CF-causing p.Gly551Asp Q552X c.1654C>T CF-PI CF-causing p.Gln552* R553X c.1657C>T CF-PI CF-causing p.Arg553* L558S c.1673T>C CF-PI unknown significance p.Leu558Ser Y569D c.1705T>G CFTR-RD,CBAVD unknown significance p.Tyr569Asp Continued on next page 2 0 | L U C A R E L L I E T A L .
X
ABCC7 p.Ser549Arg 25910067:381:273
status: NEWX
ABCC7 p.Ser549Arg 25910067:381:368
status: NEW[hide] Translating the genetics of cystic fibrosis to per... Transl Res. 2015 Apr 15. pii: S1931-5244(15)00131-0. doi: 10.1016/j.trsl.2015.04.008. Corvol H, Thompson KE, Tabary O, le Rouzic P, Guillot L
Translating the genetics of cystic fibrosis to personalized medicine.
Transl Res. 2015 Apr 15. pii: S1931-5244(15)00131-0. doi: 10.1016/j.trsl.2015.04.008., [PMID:25940043]
Abstract [show]
Cystic fibrosis (CF) is the most common life-threatening recessive genetic disease in the Caucasian population. This multiorgan disease is caused by mutations in the gene encoding the CF transmembrane conductance regulator (CFTR) protein, a chloride channel recognized as regulating several apical ion channels. The gene mutations result either in the lack of the protein at the apical surface or in an improperly functioning protein. Morbidity and mortality because of the mutation of CFTR are mainly attributable to lung disease resulting from chronic infection and inflammation. Since its discovery as the causative gene in 1989, much progress has been achieved not only in clinical genetics but also in basic science studies. Recently, combinations of these efforts have been successfully translated into development and availability for patients of new therapies targeting specific CFTR mutations to correct the CFTR at the protein level. Current technologies such as next gene sequencing and novel genomic editing tools may offer new strategies to identify new CFTR variants and modifier genes, and to correct CFTR to pursue personalized medicine, which is already developed in some patient subsets. Personalized medicine or P4 medicine ("personalized," "predictive," "preventive," and "participatory") is currently booming for CF. The various current and future challenges of personalized medicine as they apply to the issues faced in CF are discussed in this review.
Comments [show]
None has been submitted yet.
No. Sentence Comment
155 Furthermore, Kalydeco has been tested in patients carrying other class III mutations, or targeted class IVand V mutations (sharing functional similarities with the class III).58 The new trials led to an extension of the FDA and European Medical Agency approval to 8 additional gating mutations: p.Gly178Arg (p.G178R), p.Ser549Asn (p.S549N), p.Ser549Arg (p.S549R), p.Gly551Ser (p.G551S), p.Gly1244Glu (p.G1244E), p.Ser1251Asn (p.S1251N), p.Ser1255Pro (pS1255P), and p.Gly1349Asp (p.G1349D).59 Recently, ivacaftor has also been shown to benefit patients carrying the c.350G .
X
ABCC7 p.Ser549Arg 25940043:155:343
status: NEWX
ABCC7 p.Ser549Arg 25940043:155:356
status: NEW[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]
Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.
Comments [show]
None has been submitted yet.
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance.
X
ABCC7 p.Ser549Arg 26014425:79:1485
status: NEWX
ABCC7 p.Ser549Arg 26014425:79:1504
status: NEWX
ABCC7 p.Ser549Arg 26014425:79:1542
status: NEWX
ABCC7 p.Ser549Arg 26014425:79:1561
status: NEW[hide] [Challenges of personalized medicine for cystic fi... Arch Pediatr. 2015 Jul;22(7):778-86. doi: 10.1016/j.arcped.2015.04.015. Epub 2015 May 26. Corvol H, Taytard J, Tabary O, Le Rouzic P, Guillot L, Clement A
[Challenges of personalized medicine for cystic fibrosis].
Arch Pediatr. 2015 Jul;22(7):778-86. doi: 10.1016/j.arcped.2015.04.015. Epub 2015 May 26., [PMID:26021452]
Abstract [show]
Personalized medicine, or P4 medicine for "Personalized", "Predictive", "Preventive" and "Participatory", is currently booming for cystic fibrosis, with the development of therapies targeting specific CFTR mutations. The various challenges of personalized medicine applied to cystic fibrosis issues are discussed in this paper.
Comments [show]
None has been submitted yet.
No. Sentence Comment
135 Compte tenu de l`efficacite &#b4; de KalydecoW chez ces patients, le laboratoire VertexW a ensuite teste &#b4;, puis de &#b4;montre &#b4; son efficacite &#b4; chez des patients porteurs d`autres mutations de classe III, ce qui a permis cette anne &#b4;e une extension d`autorisation de mise sur le marche &#b4; (AMM) pour 8 mutations supple &#b4;mentaires : G1244E, G1349D, G178R, G551S, S1251N, S1255P, S549N et S549R [37].
X
ABCC7 p.Ser549Arg 26021452:135:413
status: NEW[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]
Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.
Comments [show]
None has been submitted yet.
No. Sentence Comment
76 Using the US and Italian data, we calculated equally low MIP scores for G178R (0.09, n = 22), S549N (0.12, n = 39), S1251N (0.07, n = 14), and G1244E (0.0, n = 3), but not for S549R (0.21, n = 14) (Supplementary Table S1 online).
X
ABCC7 p.Ser549Arg 26087176:76:176
status: NEW[hide] Targeting ion channels in cystic fibrosis. J Cyst Fibros. 2015 Sep;14(5):561-70. doi: 10.1016/j.jcf.2015.06.002. Epub 2015 Jun 23. Mall MA, Galietta LJ
Targeting ion channels in cystic fibrosis.
J Cyst Fibros. 2015 Sep;14(5):561-70. doi: 10.1016/j.jcf.2015.06.002. Epub 2015 Jun 23., [PMID:26115565]
Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause a characteristic defect in epithelial ion transport that plays a central role in the pathogenesis of cystic fibrosis (CF). Hence, pharmacological correction of this ion transport defect by targeting of mutant CFTR, or alternative ion channels that may compensate for CFTR dysfunction, has long been considered as an attractive approach to a causal therapy of this life-limiting disease. The recent introduction of the CFTR potentiator ivacaftor into the therapy of a subgroup of patients with specific CFTR mutations was a major milestone and enormous stimulus for seeking effective ion transport modulators for all patients with CF. In this review, we discuss recent breakthroughs and setbacks with CFTR modulators designed to rescue mutant CFTR including the common mutation F508del. Further, we examine the alternative chloride channels TMEM16A and SLC26A9, as well as the epithelial sodium channel ENaC as alternative targets in CF lung disease, which remains the major cause of morbidity and mortality in patients with CF. Finally, we will focus on the hurdles that still need to be overcome to make effective ion transport modulation therapies available for all patients with CF irrespective of their CFTR genotype.
Comments [show]
None has been submitted yet.
No. Sentence Comment
604 When tested in clinical trials, the potentiator ivacaftor (also known as VX-770) showed a marked clinical benefit, with substantial improvement of lung function, reduction of pulmonary exacerbations, and increase in body weight in CF patients with G551D and 8 additional Class III mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D) [32-35].
X
ABCC7 p.Ser549Arg 26115565:604:306
status: NEW[hide] Concentration of fractional excretion of nitric ox... J Cyst Fibros. 2015 Nov;14(6):733-40. doi: 10.1016/j.jcf.2015.07.002. Epub 2015 Jul 22. Kotha K, Szczesniak RD, Naren AP, Fenchel MC, Duan LL, McPhail GL, Clancy JP
Concentration of fractional excretion of nitric oxide (FENO): A potential airway biomarker of restored CFTR function.
J Cyst Fibros. 2015 Nov;14(6):733-40. doi: 10.1016/j.jcf.2015.07.002. Epub 2015 Jul 22., [PMID:26210165]
Abstract [show]
BACKGROUND: Lower airway biomarkers of restored cystic fibrosis transmembrane conductance regulator (CFTR) function are limited. We hypothesized that fractional excretion of nitric oxide (FENO), typically low in CF patients, would demonstrate reproducibility during CFTR-independent therapies, and increase during CFTR-specific intervention (ivacaftor) in patients with CFTR gating mutations. METHODS: Repeated FENO and spirometry measurements in children with CF (Cohort 1; n=29) were performed during hospital admission for acute pulmonary exacerbations and routine outpatient care. FENO measurements before and after one month of ivacaftor treatment (150mg every 12h) were completed in CF patients with CFTR gating mutations (Cohort 2; n=5). RESULTS: Cohort 1: Mean forced expiratory volume in 1s (FEV1 % predicted) at enrollment was 72.3% (range 25%-102%). Mean FENO measurements varied minimally over the two inpatient and two outpatient measurements (9.8-10.9ppb). There were no clear changes related to treatment of pulmonary exacerbations, gender, genotype or microbiology, and weak correlation with inhaled corticosteroid use (P<0.05). Between the two inpatient measurements, FEV1 % predicted increased by 7.3% (P<0.03) and FENO did not change. In Cohort 2, mean FENO increased from 6.6ppb (SD=2.19) to 11.8ppb (SD=4.97) during ivacaftor treatment. Mean sweat chloride dropped by 58mM and mean FEV1 % predicted increased by 10.2%. CONCLUSIONS: Repeated FENO measurements were stable in CF patients, whereas FENO increased in all patients with CFTR gating mutations treated with ivacaftor. Acute changes in FENO may serve as a biomarker of restored CFTR function in the CF lower airway during CFTR modulator treatment.
Comments [show]
None has been submitted yet.
No. Sentence Comment
53 Patients enrolled in Cohort 2 (Fig. 1B) included five CF patients with rare CFTR gating mutations (S549N/S549N in three subjects, G178R/F508del in one subject, and S549R/ F508del in one subject) who were candidates for ivacaftor therapy.
X
ABCC7 p.Ser549Arg 26210165:53:164
status: NEW154 Genotypes of the five individual subjects were S549N/S549N (CF01-03), S549R/F508del (CF04), and G178R/F508del (CF05).
X
ABCC7 p.Ser549Arg 26210165:154:70
status: NEW[hide] The impact of a national population carrier screen... J Cyst Fibros. 2015 Sep 16. pii: S1569-1993(15)00203-9. doi: 10.1016/j.jcf.2015.08.007. Stafler P, Mei-Zahav M, Wilschanski M, Mussaffi H, Efrati O, Lavie M, Shoseyov D, Cohen-Cymberknoh M, Gur M, Bentur L, Livnat G, Aviram M, Alkrinawi S, Picard E, Prais D, Steuer G, Inbar O, Kerem E, Blau H
The impact of a national population carrier screening program on cystic fibrosis birth rate and age at diagnosis: Implications for newborn screening.
J Cyst Fibros. 2015 Sep 16. pii: S1569-1993(15)00203-9. doi: 10.1016/j.jcf.2015.08.007., [PMID:26386752]
Abstract [show]
BACKGROUND: Population carrier screening (PCS) has been available in Israel since 1999 and universally subsidized since 2008. We sought to evaluate its impact. METHODS: A retrospective review of governmental databanks, the national CF registry and CF centers. RESULTS: CF rate per 100,000 live births has decreased from 14.5 in 1990 to 6 in 2011. From 2004-2011 there were 95 CF births: 22 utilized PCS; 68 (72%) had 2 known CFTR mutations; 37% were pancreatic sufficient. At diagnosis, age was 6 (0-98) months; 53/95 had respiratory symptoms, 41/95 failure to thrive and 19/95 pseudomonas. Thirty-four (36%) were Arabs and 19 (20%) orthodox Jews, compared to 20% and 8% respectively, in the general population. CONCLUSIONS: PCS markedly reduced CF birth rates with a shift towards milder mutations, but was often avoided for cultural reasons. As children regularly have significant disease at diagnosis, we suggest a balanced approach, utilizing both PCS and newborn screening.
Comments [show]
None has been submitted yet.
No. Sentence Comment
55 Mutation DF508 G542X W1282X N1303K 3849 + 10kbC- N T D1152H 405 + 1GA G85E S549R W1089X 1717 + 1GA I1234Va Y1092Xb 3121-1G N Ab 3120 + 1kbdel8.6 kbc 2183AA N Gc 4010delTATTc The first 14 mutations served as the panel used for Jewish population carrier screening program during the study period.
X
ABCC7 p.Ser549Arg 26386752:55:82
status: NEW[hide] Ivacaftor in a young boy with the rare gating muta... BMC Pulm Med. 2015 Oct 16;15:123. doi: 10.1186/s12890-015-0120-1. Lenherr N, Lura M, Trachsel D, Latzin P, Hammer J
Ivacaftor in a young boy with the rare gating mutation S549R--use of lung clearance index to track progress: a case report.
BMC Pulm Med. 2015 Oct 16;15:123. doi: 10.1186/s12890-015-0120-1., [PMID:26474553]
Abstract [show]
BACKGROUND: Ivacaftor acts as a potentiator of the cystic fibrosis transmembrane conductance regulator (CFTR) and increases the transepithelial chloride transport of CFTR in 9 of 10 known gating mutations causing cystic fibrosis. S549R is a rare gating mutation considered to be less sensitive to potentiators than all other gating mutations. CASE PRESENTATION: We report our first experience with ivacaftor in an 8-year-old boy with the rare S549R gating mutation. Besides subjective clinical improvements, the sweat chloride level and the lung clearance index decreased impressively within a few weeks of treatment while forced expiratory volume in the first second values remained in normal range. CONCLUSION: We emphasize the value of measuring small airway function by lung clearance index as an outcome measure for new interventions targeting the correction of the CFTR defect at an age before traditional lung function parameters start to deteriorate.
Comments [show]
None has been submitted yet.
No. Sentence Comment
0 CASE REPORT Open Access Ivacaftor in a young boy with the rare gating mutation S549R - use of lung clearance index to track progress: a case report Nina Lenherrߤ , Marco Lur&#e0;ߤ , Daniel Trachsel, Philipp Latzin and Juerg Hammer* Abstract Background: Ivacaftor acts as a potentiator of the cystic fibrosis transmembrane conductance regulator (CFTR) and increases the transepithelial chloride transport of CFTR in 9 of 10 known gating mutations causing cystic fibrosis.
X
ABCC7 p.Ser549Arg 26474553:0:79
status: NEW1 S549R is a rare gating mutation considered to be less sensitive to potentiators than all other gating mutations.
X
ABCC7 p.Ser549Arg 26474553:1:0
status: NEW2 Case presentation: We report our first experience with ivacaftor in an 8-year-old boy with the rare S549R gating mutation.
X
ABCC7 p.Ser549Arg 26474553:2:100
status: NEW5 Keywords: Cystic fibrosis, Ivacaftor, S549R, Gating mutation, N2MBW, LCI Background Ivacaftor acts as a potentiator of the cystic fibrosis transmembrane conductance regulator (CFTR) and increases the transepithelial chloride (Cl- ) transport of CFTR in 9 of 10 known gating mutations and in R117H mutation (class IV) causing cystic fibrosis.
X
ABCC7 p.Ser549Arg 26474553:5:38
status: NEW7 In 2014 the approval was extended for 8 additional gating mutations, including S549R.
X
ABCC7 p.Ser549Arg 26474553:7:79
status: NEW8 S549R is a rare gating mutation (41 described patients in CFTR2 [2]) primarily described in the Bedouin population of the United Arab Emirates, in Saudi Arabia and in North Africa.
X
ABCC7 p.Ser549Arg 26474553:8:0
status: NEW9 The clinical phenotype seen with the homozygous S549R mutation is generally severe and similar to homozygous deltaF508 mutation [3, 4].
X
ABCC7 p.Ser549Arg 26474553:9:48
status: NEW16 We report our first experience with ivacaftor and the usefulness of LCI in a young Swiss patient with the S549R mutation to demonstrate improvements in lung function in response to this therapy when FEV1 is within normal limits.
X
ABCC7 p.Ser549Arg 26474553:16:106
status: NEW19 Lenherr et al. BMC Pulmonary Medicine (2015) 15:123 DOI 10.1186/s12890-015-0120- Case presentation Case report An 8-year-old boy with S549R/1717-1G > A genotype was started on ivacaftor (150 mg b.i.d.) on compassionate use.
X
ABCC7 p.Ser549Arg 26474553:19:135
status: NEW32 However, the weakest drug effect was described for the S549R mutation [5].
X
ABCC7 p.Ser549Arg 26474553:32:55
status: NEW33 S549R was initially considered a class II mutation leading to defective CFTR protein processing [12].
X
ABCC7 p.Ser549Arg 26474553:33:0
status: NEW34 Recent electrophysiological studies using Fischer rat thyroid cells have suggested the presence of a predominant gating defect besides a mild processing defect of CFTR in S549R [5].
X
ABCC7 p.Ser549Arg 26474553:34:171
status: NEW36 Against this background, the impressive clinical and functional improvement in our patient with the S549R mutation was better than expected.
X
ABCC7 p.Ser549Arg 26474553:36:100
status: NEW37 These results are in line with a recently published clinical trial study including four patients with S549R mutation [6].
X
ABCC7 p.Ser549Arg 26474553:37:102
status: NEW45 Conclusion This report provides anecdotal evidence of benefit of ivacafor in S549R mutation.
X
ABCC7 p.Ser549Arg 26474553:45:77
status: NEW[hide] Hallmarks of therapeutic management of the cystic ... J Cyst Fibros. 2015 Nov;14(6):687-99. doi: 10.1016/j.jcf.2015.09.006. Epub 2015 Oct 29. Amaral MD, Balch WE
Hallmarks of therapeutic management of the cystic fibrosis functional landscape.
J Cyst Fibros. 2015 Nov;14(6):687-99. doi: 10.1016/j.jcf.2015.09.006. Epub 2015 Oct 29., [PMID:26526359]
Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) protein does not operate in isolation, rather in a dynamic network of interacting components that impact its synthesis, folding, stability, intracellular location and function, referred to herein as the 'CFTR Functional Landscape (CFFL)'. For the prominent F508del mutation, many of these interactors are deeply connected to a protein fold management system, the proteostasis network (PN). However, CF encompasses an additional 2000 CFTR variants distributed along its entire coding sequence (referred to as CFTR2), and each variant contributes a differential liability to PN management of CFTR and to a protein 'social network' (SN) that directs the probability of the (patho)physiologic events that impact ion transport in each cell, tissue and patient in health and disease. Recognition of the importance of the PN and SN in driving the unique patient CFFL leading to disease highlights the importance of precision medicine in therapeutic management of disease progression. We take the view herein that it is not CFTR, rather the PN/SN, and their impact on the CFFL, that are the key physiologic forces driving onset and clinical progression of CF. We posit that a deep understanding of each patients PN/SN gained by merging genomic, proteomic (mass spectrometry (MS)), and high-content microscopy (HCM) technologies in the context of novel network learning algorithms will lead to a paradigm shift in CF clinical management. This should allow for generation of new classes of patient specific PN/SN directed therapeutics for personalized management of the CFFL in the clinic.
Comments [show]
None has been submitted yet.
No. Sentence Comment
656 The FDA approval of Ivacaftor for multiple G551D like phenotypic variants including G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D [159,160] found at the cell surface with gating defects [161,162], and the FDA-approval of a combination of Lumacaftor and Ivacaftor for treatment of F508del [156] are examples of successful application of these technologies.
X
ABCC7 p.Ser549Arg 26526359:656:98
status: NEW[hide] CFTR potentiator therapy ameliorates impaired insu... J Cyst Fibros. 2015 Nov 4. pii: S1569-1993(15)00255-6. doi: 10.1016/j.jcf.2015.10.012. Tsabari R, Elyashar HI, Cymberknowh MC, Breuer O, Armoni S, Livnat G, Kerem E, Zangen DH
CFTR potentiator therapy ameliorates impaired insulin secretion in CF patients with a gating mutation.
J Cyst Fibros. 2015 Nov 4. pii: S1569-1993(15)00255-6. doi: 10.1016/j.jcf.2015.10.012., [PMID:26547591]
Abstract [show]
OBJECTIVE: To investigate the effect of treatment with ivacaftor on insulin secretion in patients with cystic fibrosis (CF) (DeltaF508\S549R) having CFRD/impaired insulin secretion. METHODS: A standard OGTT was performed before and after 16weeks of treatment with ivacaftor in 2 sibling patients with CF carrying the S549R gating mutation. The area under the curve (AUC) for glucose and insulin was calculated using the trapezoidal estimation. RESULTS: Before treatment, the OGTT of case 1 showed indeterminate glycemia; the OGTT of case 2 indicated CFRD. After ivacaftor treatment the OGTT demonstrated improved insulin secretion pattern mainly by increased first phase early insulin secretion, resulting in reduction of the AUC of glucose in both cases. CONCLUSIONS: The treatment with ivacaftor in patients with CF carrying gating mutation can ameliorate impaired insulin secretion. Further studies and larger cohorts are needed to evaluate the impact of ivacaftor on insulin secretion in patients with CF carrying gating or other mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 Methods: A standard OGTT was performed before and after 16 weeks of treatment with ivacaftor in 2 sibling patients with CF carrying the S549R gating mutation.
X
ABCC7 p.Ser549Arg 26547591:1:136
status: NEW58 Further support for our observation is based on an additional case at another CF center where a 13.5 y girl with CF (W1282X/S549R) and BMI of 24.4 was diagnosed with CFRD based on blood glucose level of 206 mg/dl at 120 min during OGTT.
X
ABCC7 p.Ser549Arg 26547591:58:124
status: NEW66 Improving this specific parameter in the S549R mutation may account for the improvement of the OGTT which may slow down the pathophysiologic cascade leading to overt CFRD.
X
ABCC7 p.Ser549Arg 26547591:66:41
status: NEW70 The insulin secretion in response to ivacaftor enables early phase insulin action and early normalization or improvement of the OGTT in patients with CFRD In conclusion, we describe the beneficial effect of 4 month ivacaftor treatment on the pathologic OGTT of 2 patients with CF carrying the S549R gating mutation.
X
ABCC7 p.Ser549Arg 26547591:70:293
status: NEW[hide] [Male infertility caused by bilateral agenesis of ... Rev Med Interne. 1997;18(2):114-8. Durieu I, Bey-Omar F, Rollet J, Boggio D, Bellon G, Morel Y, Vital Durand D
[Male infertility caused by bilateral agenesis of the vas deferens: a new clinical form of cystic fibrosis?].
Rev Med Interne. 1997;18(2):114-8., [PMID:9092029]
Abstract [show]
Congenital bilateral absence of vas deferens causes male excretory infertility and represents 1 to 2% of male infertility. Because of a genotypic similarity with cystic fibrosis, the possible in vitro fertilization with epididymal sperm requires careful genetic counselling. We studied genotype, sweat chloride concentration, respiratory function tests, sinus abnormalities, pancreatic and hepatic functions in 22 subjects with congenital bilateral absence of vas deferens. Among them, four were compound heterozygotus, all of them with the R117H mutation. Ten had a positive sweat test, one of them also being compound heterozygotus. Congenital bilateral absence of vas deferens and double mutation or positive sweat test led to high probable cystic fibrosis diagnosis in 13 subjects. Six subjects were heterozygotus for one cystic fibrosis mutation, criterium which is not sufficient for cystic fibrosis diagnosis; five of them had sinus abnormalities, present in 11 of the 22 subjects. Only three patients had no mutation nor sweat chloride abnormalities. This work confirms the high frequency of cystic fibrosis mutations in males with congenital bilateral absence of vas deferens, with a higher frequency of positive sweat test than in other publications, and a high frequency of sinus abnormalities. This monosymptomatic phenotype of cystic fibrosis suggests new hypotheses for a relationship between genotype and phenotype.
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 Vingt-deux mutations du gene CFTR ont Cte recher- chtes : les cinq plus frequentes (AF508, G542X, N1303K, 1717-G--A, G85E) et les 17 suivantes : R117H, 556delA, R334W, R347H, R347P, S549N, S5491, S549R, G551D, R553X,R560T,G1244E3,S1255X,W1282X,R1283K,3898 ins C, D1270N.
X
ABCC7 p.Ser549Arg 9092029:46:196
status: NEW
admin on 2016-08-19 15:16:22