ABCMdb

ABCC7 p.Glu193Lys

Admin's notes:	Class II-III (maturation defect, gating defect) Veit et al.
ClinVar:	c.577G>T , p.Glu193* D , Pathogenic/Likely pathogenic, not provided c.577G>A , p.Glu193Lys ? , not provided
CF databases:	c.577G>T , p.Glu193* D , CF-causing c.577G>A , p.Glu193Lys (CFTR1) ? , This missense mutation has been detected in an Italian CF patient through DGGE and direct sequencing. This mutation has been detected in a PS patient (maternal chromosome), associated with haplotype C; the paternal chromosome carries the [delta]F508 mutation. This mutation was found in onw out of 29 non-[delta]F508 Italian CF chromosomes and was not found in 11 normal chromosomes.
Predicted by SNAP2:	A: D (91%), C: D (95%), D: D (91%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: N (53%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (91%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: N, F: D, G: D, H: D, I: D, K: N, L: D, M: D, N: N, P: D, Q: N, R: D, S: N, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]

Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
370 G178R and E193K reduced anion translocation capability [172]. Login to comment

[hide] Aberrant CFTR-dependent HCO3- transport in mutatio... Nature. 2001 Mar 1;410(6824):94-7. Choi JY, Muallem D, Kiselyov K, Lee MG, Thomas PJ, Muallem S
Aberrant CFTR-dependent HCO3- transport in mutations associated with cystic fibrosis.
Nature. 2001 Mar 1;410(6824):94-7., 2001-03-01 [PMID:11242048]

Abstract [show]
Cystic fibrosis (CF) is a disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR). Initially, Cl- conductance in the sweat duct was discovered to be impaired in CF, a finding that has been extended to all CFTR-expressing cells. Subsequent cloning of the gene showed that CFTR functions as a cyclic-AMP-regulated Cl- channel; and some CF-causing mutations inhibit CFTR Cl- channel activity. The identification of additional CF-causing mutants with normal Cl- channel activity indicates, however, that other CFTR-dependent processes contribute to the disease. Indeed, CFTR regulates other transporters, including Cl(-)-coupled HCO3- transport. Alkaline fluids are secreted by normal tissues, whereas acidic fluids are secreted by mutant CFTR-expressing tissues, indicating the importance of this activity. HCO3- and pH affect mucin viscosity and bacterial binding. We have examined Cl(-)-coupled HCO3- transport by CFTR mutants that retain substantial or normal Cl- channel activity. Here we show that mutants reported to be associated with CF with pancreatic insufficiency do not support HCO3- transport, and those associated with pancreatic sufficiency show reduced HCO3- transport. Our findings demonstrate the importance of HCO3- transport in the function of secretory epithelia and in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
49 The E193K, D648V, H949Yand R1070Q mutants, all associated with CF with pancreatic suf®ciency, had no effect on Cl-transport but reduced HCO3 transport by 50±65%. Login to comment
186 letters to nature 96 NATURE |VOL 410 |1 MARCH 2001 |www.nature.com HCO3 -/Cl- transportratio 0 0.25 0.50 0.75 1.00 WT I148T G178R R297Q G551D H620Q G970R A1067T G1244E S1255P G1349D E193K G551S A800G H949Y R1070Q Pancreatic insufficient Pancreatic sufficientD648V N CI148T G178R E193K R297Q R117H A1067T R1070Q G1244E S1255P G1349D NBD2 RD H949Y G970R CL4CL3CL2CL1 NBD1 G551D G551S H620Q D648V A800G Figure 3 The HCO3:Cl-transport ratio of CFTR mutants associated with CF. Login to comment

[hide] Ion channels-related diseases. Acta Biochim Pol. 2000;47(3):685-703. Dworakowska B, Dolowy K
Ion channels-related diseases.
Acta Biochim Pol. 2000;47(3):685-703., [PMID:11310970]

Abstract [show]
There are many diseases related to ion channels. Mutations in muscle voltage-gated sodium, potassium, calcium and chloride channels, and acetylcholine-gated channel may lead to such physiological disorders as hyper- and hypokalemic periodic paralysis, myotonias, long QT syndrome, Brugada syndrome, malignant hyperthermia and myasthenia. Neuronal disorders, e.g., epilepsy, episodic ataxia, familial hemiplegic migraine, Lambert-Eaton myasthenic syndrome, Alzheimer's disease, Parkinson's disease, schizophrenia, hyperekplexia may result from dysfunction of voltage-gated sodium, potassium and calcium channels, or acetylcholine- and glycine-gated channels. Some kidney disorders, e.g., Bartter's syndrome, policystic kidney disease and Dent's disease, secretion disorders, e.g., hyperinsulinemic hypoglycemia of infancy and cystic fibrosis, vision disorders, e.g., congenital stationary night blindness and total colour-blindness may also be linked to mutations in ion channels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
311 Milder forms of the disease result from such mutations as Arg117His, Glu193Lys, Arg334Trp and Arg347Pro which produce channels that are less likely to open or have reduced amplitude (Sheppard et al., 1993; Seibert et al., 1997). Login to comment

[hide] Genotype-phenotype correlation in cystic fibrosis:... Am J Med Genet. 2002 Jul 22;111(1):88-95. Salvatore F, Scudiero O, Castaldo G
Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes.
Am J Med Genet. 2002 Jul 22;111(1):88-95., 2002-07-22 [PMID:12124743]

Abstract [show]
More than 1,000 mutations have been identified in the cystic fibrosis (CF) transmembrane regulator (CFTR) disease gene. The impact of these mutations on the protein and the wide spectrum of CF phenotypes prompted a series of Genotype-Phenotype correlation studies. The CFTR genotype is invariably correlated with pancreatic status-in about 85% of cases with pancreatic insufficiency and in about 15% of cases with pancreatic sufficiency. The correlations between the CFTR genotype and pulmonary, liver, and gastrointestinal expression are debatable. The heterogeneous phenotype in CF patients bearing the same genotype or homozygotes for nonsense mutations implicated environmental and/or genetic factors in the disease. However, the discordant phenotype observed in CF siblings argued against a major role of environmental factors and suggested that genes other than CFTR modulate the CF phenotype. A locus that modulates gastrointestinal expression was identified in mice and subsequently in humans. By analyzing nine CF patients discordant for meconium ileus we were able to show that this locus had a dominant effect. Moreover, in a collaborative study we found a higher rate of polymorphisms in beta-defensin genes 1 and 2 in CF patients and in controls. In another multicenter study mutations in alpha-1 antitrypsin (A1AT) and mannose binding lectin genes were found to be independent risk factors for liver disease in CF patients. The body of evidence available suggests that the variegated CF phenotype results from complex interactions between numerous gene products.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 A series of mutations usually associated with pancreatic sufficiency have been identified and defined as ''mild`` with reference to pancreatic status [Kerem et al., 1989c]: G85E, G91R, R117H, E193K, P205S, R334W, T338I, R347H, R347L, R347P, R352Q, A455E, S492F, S549N, P574H, D579G, 711 þ 5 G > A, C866Y, F1052V, H1054D, R1066H, R1068H, H1085R, D1152H, S1159P, S1251N, F1286S, G1349D, 2789 þ 5 G > A, and 3849 þ 10kb C > T [Dean et al., 1990; Cutting et al., 1990a; Cremonesi et al., 1992; Highsmith et al., 1994]. Login to comment

[hide] Analysis of cystic fibrosis transmembrane conducta... Am J Med Genet A. 2003 Jul 1;120A(1):72-6. Timmreck LS, Gray MR, Handelin B, Allito B, Rohlfs E, Davis AJ, Gidwani G, Reindollar RH
Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina.
Am J Med Genet A. 2003 Jul 1;120A(1):72-6., 2003-07-01 [PMID:12794695]

Abstract [show]
The relationship between cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations and congenital absence of the uterus and vagina (CAUV) was examined. CFTR mutations have previously been associated with congenital bilateral absence of the vas deferens (CBAVD). CBAVD is caused by a disruption in the vas deferens, a Wolffian duct derivative. Because the embryologic development of the Mullerian ducts directly depends on the prior normal development of the Wolffian ducts, the same gene products may be necessary for normal embryologic development of both ductal systems. This study evaluated the role of CFTR mutations in the development of CAUV. DNA samples from 25 patients with CAUV were tested for the presence of 33 of the most common CFTR mutations. Protein-coding DNA fragments from the CFTR gene were amplified in vitro by the polymerase chain reaction (PCR) and analyzed for mutations using allele-specific oligonucleotide (ASO) probes. Two patients were heterozygous for CFTR mutations. One was heterozygous for the W1282X mutation and the other was heterozygous for the DeltaF508 mutation. The incidence of the 33 CFTR mutations found in the patients with CAUV (8%) was twice that found in the general population (4%), but much less than the incidence of CFTR mutations in men with CBAVD (80%). This data suggests that it is unlikely for CFTR mutations to cause CAUV in females as they cause CBAVD in some males. Furthermore, the data suggest that CAUV in females may be the same disorder as CBAVD in males who do not have CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 Mutations continue to be identified in association with CBAVD: A800G, G149R, R258G, E193K [Mercier et al., 1995], D1270N, and G576A [Ravnik-Glavac et al., 2000], to name a few. Login to comment

[hide] Atomic model of human cystic fibrosis transmembran... Cell Mol Life Sci. 2008 Aug;65(16):2594-612. Mornon JP, Lehn P, Callebaut I
Atomic model of human cystic fibrosis transmembrane conductance regulator: membrane-spanning domains and coupling interfaces.
Cell Mol Life Sci. 2008 Aug;65(16):2594-612., [PMID:18597042]

Abstract [show]
We describe herein an atomic model of the outward-facing three-dimensional structure of the membrane-spanning domains (MSDs) and nucleotide-binding domains (NBDs) of human cystic fibrosis transmembrane conductance regulator (CFTR), based on the experimental structure of the bacterial transporter Sav1866. This model, which is in agreement with previous experimental data, highlights the role of some residues located in the transmembrane passages and directly involved in substrate translocation and of some residues within the intracellular loops (ICL1-ICL4) making MSD/NBD contacts. In particular, our model reveals that D173 ICL1 and N965 ICL3 likely interact with the bound nucleotide and that an intricate H-bond network (involving especially the ICL4 R1070 and the main chain of NBD1 F508) may stabilize the interface between MSD2 and the NBD1F508 region. These observations allow new insights into the ATP-binding sites asymmetry and into the molecular consequences of the F508 deletion, which is the most common cystic fibrosis mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
255 Other CF-associated mutations of interest in ICL1 and ICL3 are (i) E193K, a mutation of an ICL1 residue that exhibits, similarly to G178R, impaired anion translocation capacity [73], and (ii) S945L, H949Yand G970R, which affect ICL3 residues and are probably involved (as G970R) in obtaining or maintaining the open state of the transporter [74]. Login to comment

[hide] Mutation-specific potency and efficacy of cystic f... J Pharmacol Exp Ther. 2009 Sep;330(3):783-91. Epub 2009 Jun 2. Caputo A, Hinzpeter A, Caci E, Pedemonte N, Arous N, Di Duca M, Zegarra-Moran O, Fanen P, Galietta LJ
Mutation-specific potency and efficacy of cystic fibrosis transmembrane conductance regulator chloride channel potentiators.
J Pharmacol Exp Ther. 2009 Sep;330(3):783-91. Epub 2009 Jun 2., [PMID:19491324]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel. The mutations G551D and G1349D, which affect the nucleotide-binding domains (NBDs) of CFTR protein, reduce channel activity. This defect can be corrected pharmacologically by small molecules called potentiators. CF mutations residing in the intracellular loops (ICLs), connecting the transmembrane segments of CFTR, may also reduce channel activity. We have investigated the extent of loss of function caused by ICL mutations and the sensitivity to pharmacological stimulation. We found that E193K and G970R (in ICL1 and ICL3, respectively) cause a severe loss of CFTR channel activity that can be rescued by the same potentiators that are effective on NBD mutations. We compared potency and efficacy of three different potentiators for E193K, G970R, and G551D. The 1,4-dihydropyridine felodipine and the phenylglycine PG-01 [2-[(2-1H-indol-3-yl-acetyl)-methylamino]-N-(4-isopropylphenyl)-2-phenylac etamide] were strongly effective on the three CFTR mutants. The efficacy of sulfonamide SF-01 [6-(ethylphenylsulfamoyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic acid cycloheptylamide], another CFTR potentiator, was instead significantly lower than felodipine and PG-01 for the E193K and G970R mutations, and almost abolished for G551D. Furthermore, SF-01 modified the response of G551D and G970R to the other two potentiators, an effect that may be explained by an allosteric antagonistic effect. Our results indicate that CFTR potentiators correct the basic defect caused by CF mutations residing in different CFTR domains. However, there are differences among potentiators, with felodipine and PG-01 having a wider pharmacological activity, and SF-01 being more mutation specific. Our observations are useful in the prioritization and development of drugs targeting the CF basic defect.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 We found that E193K and G970R (in ICL1 and ICL3, respectively) cause a severe loss of CFTR channel activity that can be rescued by the same potentiators that are effective on NBD mutations. Login to comment
6 We compared potency and efficacy of three different potentiators for E193K, G970R, and G551D. Login to comment
8 The efficacy of sulfonamide SF-01 [6-(ethylphenylsulfamoyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic acid cycloheptylamide], another CFTR potentiator, was instead significantly lower than felodipine and PG-01 for the E193K and G970R mutations, and almost abolished for G551D. Login to comment
91 To this respect, we considered I148T, I175V, Q179K, and E193K in ICL1 (Seibert et al., 1997) and G970R in ICL3 (Seibert et al., 1996). Login to comment
97 E193K and G970R showed the most severe defect, with more than 10-fold decreased activity relative to wild-type CFTR (Fig. 1A). Login to comment
98 D1152H was significantly more active than E193K and G970R but approximately five times less than the wild-type protein. Login to comment
116 E193K, G970R, and D1152H. Login to comment
117 For example, potentiators increased anion transport of E193K by more than 15-fold relative to forskolin alone (Fig. 1A). Login to comment
127 To confirm the results obtained with the functional assay, and to determine precisely the potency and maximal effect for each potentiator, we generated stable transfectants for E193K and G970R, the two ICL mutants having the most severe deficit in cAMP response. Login to comment
128 FRT cells with stable expression of E193K- and G970R-CFTR were used to measure transepithelial Cl- currents in parallel with FRT cells expressing G551D-CFTR, a classical mutant causing a severe channel-gating defect. Login to comment
129 Figure 2 shows data obtained from the E193K. Login to comment
143 The former two values were approximately 2-fold higher than those measured for E193K. Login to comment
144 On the contrary, SF-01 potency was not significantly different between E193K and G970R. Login to comment
145 The G970R mutant showed another interesting characteristic consisting in a noncomplete inhibition by CFTRinh-172 at 10 ␮M (compare data in Fig. 2. Pharmacological stimulation of the E193K mutant. A to C, representative short-circuit current recordings from transfected FRT cells showing response of the E193K-CFTR mutant to different concentrations of felodipine, PG-01, and SF-01. Login to comment
151 In all experiments, CFTRinh-172 reduced the G970R current by only 79 Ϯ 2%, whereas for the other mutants and for wild-type CFTR the inhibition was greater than 95% (98 Ϯ 1% for E193K, p Ͻ 0.01). Login to comment
157 In agreement with such reports, we found that PG-01 and felodipine Kd values were indeed increased by ϳ10-fold in G551D compared with E193K (Fig. 4, A-C). Login to comment
161 Second, its potency, although difficult to measure because of the small size of the currents, was not different from that measured for E193K and G970R (Table 1). Login to comment
164 Kd Imax nH n ␮M ␮A/cm2 E193K PG-01 0.22 Ϯ 0.03 37.4 Ϯ 3.6 1.5 Ϯ 0.2 6 SF-01 0.74 Ϯ 0.19 20.6 Ϯ 2.7 1.3 Ϯ 0.1 9 Felodipine 0.67 Ϯ 0.14 32.7 Ϯ 2.4 1.4 Ϯ 0.1 9 G970R PG-01 0.45 Ϯ 0.07** 60.2 Ϯ 8.1 1.4 Ϯ 0.2 10 SF-01 0.45 Ϯ 0.07ns 17.6 Ϯ 2.7 1.6 Ϯ 0.2 10 Felodipine 2.03 Ϯ 0.39** 75.7 Ϯ 7.4 1.2 Ϯ 0.1 9 G551D PG-01 1.94 Ϯ 0.54*† 21.5 Ϯ 4.4 1.4 Ϯ 0.2 8 SF-01 1.10 Ϯ 0.12ns 5.9 Ϯ 0.7 1.8 Ϯ 0.3 15 Felodipine 10.22 Ϯ 1.12**†† 68.4 Ϯ 5.4 2.2 Ϯ 0.4 9 ns, nonsignificant. Login to comment
166 the same potentiator in E193K. Login to comment
221 Our results show that E193K, G970R, and, to a lesser extent, D1152H cause a marked decrease in CFTR activity. Login to comment
229 We focused our study on E193K and G970R, the two ICL mutants having the most severe loss in CFTR activity, and, for comparison, on G551D. Login to comment
231 First, PG-01, SF-01, and felodipine were effective on E193K and the apparent affinity for this CFTR mutant was close to that reported previously for ⌬F508 under similar conditions of stimulation with forskolin (Pedemonte et al., 2005a,b). Login to comment
237 effective on G970R although with a significant decrease in potency relative to E193K and ⌬F508. Login to comment
239 However, SF-01 efficacy was nearly halved in E193K, severely reduced in G970R, and almost abolished in G551D, whereas potency, at least in G970R, was not significantly different from that measured in E193K. Login to comment
262 This seems supported by the fact that the Kd for PG-01 and felodipine is increased by the same extent in G970R (ϳ2-fold) and in G551D (ϳ10-fold) with respect to E193K, whereas the apparent potency of SF-01 does not change. Login to comment

[hide] Pharmacological therapy for cystic fibrosis: from ... J Cyst Fibros. 2011 Jun;10 Suppl 2:S129-45. Becq F, Mall MA, Sheppard DN, Conese M, Zegarra-Moran O
Pharmacological therapy for cystic fibrosis: from bench to bedside.
J Cyst Fibros. 2011 Jun;10 Suppl 2:S129-45., [PMID:21658632]

Abstract [show]
With knowledge of the molecular behaviour of the cystic fibrosis transmembrane conductance regulator (CFTR), its physiological role and dysfunction in cystic fibrosis (CF), therapeutic strategies are now being developed that target the root cause of CF rather than disease symptoms. Here, we review progress towards the development of rational new therapies for CF. We highlight the discovery of small molecules that rescue the cell surface expression and defective channel gating of CF mutants, termed CFTR correctors and CFTR potentiators, respectively. We draw attention to alternative approaches to restore epithelial ion transport to CF epithelia, including inhibitors of the epithelial Na(+) channel (ENaC) and activators of the Ca(2+)-activated Cl(-) channel TMEM16A. The expertise required to translate small molecules identified in the laboratory to drugs for CF patients depends on our ability to coordinate drug development at an international level and our ability to provide pertinent biological information using suitable disease models.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
243 [141] COS-7, HEK293, FRT G551D, G1349D, E193K, G970R YFP cell-based assay, electrophysiology Study demonstrates that potentiators are active on mutations residing in different CFTR domains and that potencies are mutation-specific. Login to comment

[hide] Channel-lining residues in the M3 membrane-spannin... Biochemistry. 1998 Sep 1;37(35):12233-40. Akabas MH
Channel-lining residues in the M3 membrane-spanning segment of the cystic fibrosis transmembrane conductance regulator.
Biochemistry. 1998 Sep 1;37(35):12233-40., 1998-09-01 [PMID:9724537]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) forms a chloride-selective channel. Residues from the 12 putative membrane-spanning segments form at least part of the channel lining. We need to identify the channel-lining residues in order to understand the structural basis for the channel's functional properties. Using the substituted-cysteine-accessibility method we mutated to cysteine, one at a time, 24 consecutive residues (Asp192-Ile215) in the M3 membrane-spanning segment. Cysteines substituted for His199, Phe200, Trp202, Ile203, Pro205, Gln207, Leu211, and Leu214 reacted with charged, sulfhydryl-specific reagents that are derivatives of methanethiosulfonate (MTS). We infer that these residues are on the water-accessible surface of the protein and probably form a portion of the channel lining. When plotted on an alpha-helical wheel the exposed residues from Gln207 to Leu214 lie within an arc of 60 degrees; the exposed residues in the cytoplasmic half (His199-Ile203) lie within an arc of 160 degrees. We infer that the secondary structures of the extracellular and cytoplasmic halves of M3 are alpha-helical and that Pro205, in the middle of the M3 segment, may bend the M3 segment, moving the cytoplasmic end of the segment in toward the central axis of the channel. The bend in the M3 segment may help to narrow the channel lumen near the cytoplasmic end. In addition, unlike full-length CFTR, the current induced by the deletion construct, Delta259, is inhibited by the MTS reagents, implying that the channel structure of Delta259 is different than the channel structure of wild-type CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
222 Several mutations of residues in and flanking the M3 membrane-spanning segment have been identified in patients with CF, including D192G, E193K, H199Y, P205S, and L206W (58, 60-63). Login to comment

[hide] Validation of double gradient denaturing gradient ... Clin Chem. 1999 Jan;45(1):35-40. Cremonesi L, Carrera P, Fumagalli A, Lucchiari S, Cardillo E, Ferrari M, Righetti SC, Zunino F, Righetti PG, Gelfi C
Validation of double gradient denaturing gradient gel electrophoresis through multigenic retrospective analysis.
Clin Chem. 1999 Jan;45(1):35-40., [PMID:9895335]

Abstract [show]
Among established techniques for the identification of either known or new mutations, denaturing gradient gel electrophoresis (DGGE) is one of the most effective. However, conventional DGGE is affected by major drawbacks that limit its routine application: the different denaturant gradient ranges and migration times required for different DNA fragments. We developed a modified version of DGGE for high-throughput mutational analysis, double gradient DGGE (DG-DGGE), by superimposing a porous gradient over the denaturant gradient, which maintains the zone-sharpening effect even during lengthy analyses. Because of this innovation, DG-DGGE achieves the double goals of retaining full effectiveness in the detection of mutations while allowing identical run time conditions for all fragments analyzed. Here we use retrospective analysis of a large number of well-characterized mutations and polymorphisms, spanning all predicted melting domains and the whole genomic sequence of three different genes--the cystic fibrosis transmembrane conductance regulator (CFTR), the beta-globin, and the p53 genes--to demonstrate that DG-DGGE may be applied to the rapid scanning of any sequence variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Mutations and polymorphisms analyzed in the CFTR gene. Position Denaturant gradient Mutation Exon 1 40-90% 125G/Ca,b M1V (A3G at 133) 175insT 182delT Exon 3 10-60% W57G (T3G at 301) 356G/Aa G85E (G3A at 386) Exon 4 20-70% R117H (G3A at 482) 541delC 621ϩ1G3T I148T (T3C at 575) Exon 5 20-70% E193K (G3A at 709) Intron 5 20-70% 711ϩ3A3G Exon 7 20-70% 1078delT R334W (C3T at 1132) T338I (C3T at 1145) R347P (G3C at 1172)b R347H (G3A at 1172) R352Q (G3A at 1187) Exon 10 20-70% M470V (1540A/G)a ⌬F508 (del 3 bp at 1652) Intron 10 10-60% 1717-1G3A Exon 11 10-60% G542X (G3T at 1756) 1784delG R553X (C3T at 1789) Exon 12 10-60% D579G (A3G at 1868) E585X (G3T at 1885) Intron 12 10-60% 1898ϩ3A3G Exon 13 30-80% 2183AA3G E730X (G3T at 2320) L732X (T3G at 2327) 2347delG Exon 14a 10-60% T854T (2694T/G)a V868V (2736G/A)a Intron 14b 30-80% 2789ϩ5G3A Exon 15 20-70% M952I (G3C at 2988)b Exon 17a 20-70% L997F (G3C at 3123)b Exon 17b 20-70% F1052V (T3G at 3286) R1066C (C3T at 3328) R1066H (G3A at 3329) A1067T (G3A at 3331) Exon 18 20-70% D1152H (G3C at 3586)b Exon 19 30-80% R1158X (C3T at 3604) Exon 20 20-70% S1251N (G3A at 3384) W1282X (G3A at 3978) Exon 21 20-70% N1303K (C3G at 4041)b Exon 22 30-80% G1349D (G3A at 4178) 4382delA Exon 24 30-80% Y1424Y (4404C/T)a a Polymorphism. Login to comment

[hide] Stimulation of murine intestinal secretion by dail... Cell Physiol Biochem. 2011;28(2):239-50. Epub 2011 Aug 16. Al-Nakkash L, Batia L, Bhakta M, Peterson A, Hale N, Skinner R, Sears S, Jensen J
Stimulation of murine intestinal secretion by daily genistein injections: gender-dependent differences.
Cell Physiol Biochem. 2011;28(2):239-50. Epub 2011 Aug 16., [PMID:21865731]

Abstract [show]
Background/Aims: The effect of daily injections with genistein (naturally occurring phytoestrogen) on intestinal chloride (Cl(-)) secretion was measured with Ussing chamber short circuit current (I(sc), muA/cm(2)), in C57BL/6J male and female mice, using 600 mg/kg genistein/day (600G), 300 mg/kg genistein/day (300G), 150 mg/kg genistein/day (150G) or genistein-free vehicle control (0G) for 1- or 2-weeks. Methods and Results: Injecting with 600G elicited significant increases in basal I(sc) in females after 1-week (n70 muA/cm(2), n=15, p < 0.05) and in males after 2-weeks (n80 muA/cm(2), n=5, p < 0.05) compared to their 0G counterparts. Chloride-free ringer significantly reduced basal I(sc) by 65% in 600G males and 72% in 600G females, suggesting that Cl(-) was the major anion comprising the genistein-stimulated secretion. The forskolin-stimulated (10 muM) I(sc) was significantly inhibited by the CFTR chloride channel inhibitors, glibenclamide (500 muM) and CFTR(inh)-172 (100 muM) in 600G males and females, suggesting some contribution by genistein-dependent CFTR-mediated Cl(-) secretion. We found no associated changes in intestinal morphology, nor change in total CFTR protein with 600G. There was a 5% increase in apical/subapical ratio in 600G males compared to controls (no change in females). Conclusion: These data suggest that male and female mice both exhibit increased Cl- secretion with 600G, however, the mechanisms mediating this are gender-dependent.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
239 The idea of mutation specific correctors was verified by Caputo et al. [51] whose results suggested that felodipine and the phenyglycine PG-01, exerted a wider pharmacological effect (acting on CFTR mutations E193K, G970R and G551D) compared to the lesser potentiative sulfonamide SF-01. Login to comment

[hide] Disease-associated mutations in cytoplasmic loops ... Biochemistry. 1997 Sep 30;36(39):11966-74. Seibert FS, Jia Y, Mathews CJ, Hanrahan JW, Riordan JR, Loo TW, Clarke DM
Disease-associated mutations in cytoplasmic loops 1 and 2 of cystic fibrosis transmembrane conductance regulator impede processing or opening of the channel.
Biochemistry. 1997 Sep 30;36(39):11966-74., [PMID:9305991]

Abstract [show]
Since little is known about the contribution to function of the N-terminal cytoplasmic loops (CL1, residues 139-194; CL2, residues 242-307) of cystic fibrosis transmembrane conductance regulator (CFTR), all nine point mutations identified in CLs 1 and 2 from patients with cystic fibrosis were reconstructed in the expression vector pcDNA3-CFTR and expressed transiently in COS-1 and HEK-293 cells and stably in Chinese hamster ovary (CHO) cells. Four amino acid substitutions retarded production of mature, fully glycosylated CFTR, suggesting that misprocessing of the channel causes the disease symptoms in the affected patients. Protein maturation could not be promoted by cell culture conditions of reduced temperature (26 degrees C). When properly processed mutants were evaluated for functional defects by the iodide efflux method, the G178R- and E193K-CFTR-expressing cell lines showed impaired anion translocation activities. Patch-clamp studies of single channels revealed that E193K variants had a significantly decreased open probability, which resulted from an increase in the mean closed time of the channels. This contrasted with a previous study of disease-associated point mutations in CL3 that mainly affected the mean open time. None of the maturation-competent CL 1 and 2 mutants had altered conductance. Thus, the N-terminal CLs appear not to contribute to the anion translocation pathway of CFTR; rather, mutations in CL1 can impede transition to the open state. Interestingly, the ability of the non-hydrolyzable ATP analogue adenylyl imidodiphosphate (AMP-PNP) to lock the channel into open bursts was abolished by the I148T and G178R amino acid substitutions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 When properly processed mutants were evaluated for functional defects by the iodide efflux method, the G178R- and E193K-CFTR-expressing cell lines showed impaired anion translocation activities. Login to comment
4 Patch-clamp studies of single channels revealed that E193K variants had a significantly decreased open probability, which resulted from an increase in the mean closed time of the channels. Login to comment
106 However, only the mutations I148T, I175V, G178R, E193K, and R297Q allowed wild-type-like maturation of the protein to the fully glycosylated 170 kDa species (band C). Login to comment
121 The only exceptions to this scheme were the G178R and E193K variants, which both produced activities that were lower than predicted from their wild-type-like maturation profile; in all five experiments analyzed, the decrease was more severe for G178R-CFTR-expressing cells. Login to comment
124 Still, to ensure that the decreased levels of activity of G178R-CFTR- and E193K-CFTR-expressing cells were not the result of a post-ER targeting defect but that the CFTR variants indeed reached their site of action, surface labeling was performed with the membrane-impermeant reagent biotin-LC-hydrazide (4042). Login to comment
128 To further characterize decreases in the anion permeation profile of G178R-CFTR and E193K-CFTR and to observe potentially small changes in the chloride channel activity of the remaining three maturation-competent mutants, the more sensitive patch-clamping method was applied. Login to comment
131 A striking exception was E193K that, in agreement with the iodide efflux data for intact cells, produced a significant decrease in the open probability (Po) of CFTR when measured in excised patches (Figure 7A). Login to comment
133 Interestingly, however, the reduction in Po was due to an increase in the mean closed time of the E193K channels (Figure 7C), in marked contrast to the effect of CL3 mutations, which modified the mean open time of CFTR (21). Login to comment
154 Two additional mutations, G178R and E193K, significantly reduced CFTR`s anion translocation capability as observed by iodide efflux assays. Login to comment
155 In the case of the E193K variants the reduced iodide efflux was explained by the decreased Po found in single-channel patches. Login to comment
171 The finding that the two mutations in CLs 1 and 2 with the most severe effects on the chloride channel activity of CFTR introduce a positive charge into CL1 (G178R and E193K) is consistent with an important role of electrostatic interactions in the normal functioning of the loops. Login to comment
175 In contrast, the decreased anion translocation capability caused by mutations in CL1, in the case of E193K, resulted from an increase in the mean closed time. Login to comment
203 Mutations in CLs 1 and 3 had drastic effects on the ability of CFTR to respond to regulatory stimuli: E193K in CL1 decreased the opening rate, in agreement with the decreased Po of a CL1 deletion variant (19) and the reduced iodide efflux activity of G178R-CFTR, whereas mutations in CL3 affected the duration of the open state (21). Login to comment

[hide] Human epithelial cystic fibrosis transmembrane con... Biophys J. 1996 Dec;71(6):3148-56. Xie J, Drumm ML, Zhao J, Ma J, Davis PB
Human epithelial cystic fibrosis transmembrane conductance regulator without exon 5 maintains partial chloride channel function in intracellular membranes.
Biophys J. 1996 Dec;71(6):3148-56., [PMID:8968585]

Abstract [show]
The cardiac isoform of the cystic fibrosis transmembrane conductance regulator (CFTR) is a splice variant of the epithelial CFTR, with lacks 30 amino acids encoded by exon 5 in the first intracellular loop. For examination of the role of exon 5 in CFTR channel function, a CFTR deletion mutant, in which exon 5 was removed from the human epithelial CFTR, was constructed. The wild type and delta exon5 CFTR were expressed in a human embryonic kidney cell line (293 HEK). Fully mature glycosylated CFTR (approximately 170 kDa) was immunoprecipitated from cells transfected with wild type CFTR cDNA, whereas cells transfected with delta exon5 CFTR express only a core-glycosylated from (approximately 140 kDa). The Western blot test performed on subcellular membrane fractions showed that delta exon5 CFTR was located in the intracellular membranes. Neither incubation at lower temperature (26 degrees C) nor stimulation of 293 HEK cells with forskolin or CPT-cAMP caused improvement in glycosylation and processing of delta exon5 CFTR proteins, indicating that the human epithelial CFTR lacking exon5 did not process properly in 293 HEK cells. On incorporation of intracellular membrane vesicles containing the delta exon5 CFTR proteins into the lipid bilayer membrane, functional phosphorylation- and ATP-dependent chloride channels were identified. CFTR channels with an 8-pS full-conductance state were observed in 14% of the experiments. The channel had an average open probability (Po) of 0.098 +/- 0.022, significantly less than that of the wild type CFTR (Po = 0.318 +/- 0.028). More frequently, the delta exon5 CFTR formed chloride channels with lower conductance states of approximately 2-3 and approximately 4-6 pS. These subconductance states were also observed with wild type CFTR but to a much lesser extent. Average Po for the 2-3-pS subconductance state, estimated from the area under the curve on an amplitude histogram, was 0.461 +/- 0.194 for delta exon5 CFTR and 0.332 +/- 0.142 for wild type (p = 0.073). The data obtained indicate that deleting 30 amino acids from the first intracellular loop of CFTR affects both processing and function of the CFTR chloride channel.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
204 The facts that a splice mutation that deletes exon 5 was found to be a cystic fibrosis disease-causing mutant and that there is an array of cystic fibrosis mutations in the region encoded by exon 5 (L165S, K166E, R170C, 1175V, G178R, D192N, D192G, E193K; Fonknechten et al., 1992; Romey et al., 1994; Zielenski et al., 1991; Audrezet et al., 1994; Mercier et al., 1995; Cystic Fibrosis Mutation Data Base) suggest that exon 5 is important for the structure, function, or both of the CFTR chloride channel. Login to comment
205 The facts that a splice mutation that deletes exon 5 was found to be a cystic fibrosis disease-causing mutant and that there is an array of cystic fibrosis mutations in the region encoded by exon 5 (L165S, K166E, R170C, 1175V, G178R, D192N, D192G, E193K; Fonknechten et al., 1992; Romey et al., 1994; Zielenski et al., 1991; Audrezet et al., 1994; Mercier et al., 1995; Cystic Fibrosis Mutation Data Base) suggest that exon 5 is important for the structure, function, or both of the CFTR chloride channel. Login to comment

[hide] Search for mutations in pancreatic sufficient cyst... Hum Genet. 1995 Sep;96(3):312-8. Brancolini V, Cremonesi L, Belloni E, Pappalardo E, Bordoni R, Seia M, Russo S, Padoan R, Giunta A, Ferrari M
Search for mutations in pancreatic sufficient cystic fibrosis Italian patients: detection of 90% of molecular defects and identification of three novel mutations.
Hum Genet. 1995 Sep;96(3):312-8., [PMID:7544319]

Abstract [show]
A cohort of 31 cystic fibrosis patients showing pancreatic sufficiency and bearing an unidentified mutation on at least one chromosome was analyzed through denaturing gradient gel electrophoresis of the whole coding region of the cystic fibrosis transmembrane conductance regulator gene, including intron-exon boundaries. Three new and 19 previously described mutations were detected. The combination of these with known mutations detected by other methods, allowed the characterization of mutations on 56/62 (90.3%) chromosomes. Among those identified, 17 can be considered responsible for pancreatic sufficiency, since they were found in patients carrying a severe mutation on the other chromosome. Among these presumed mild mutations, eight were detected more than once, R352Q being the most frequent in this sample (4.83%). Intragenic microsatellite analysis revealed that the six chromosomes still bearing unidentified mutations are associated with five different haplotypes. This may indicate that these chromosomes bear different mutations, rarely occurring among cystic fibrosis patients, further underlying the molecular heterogeneity of the genetic defects present in patients having pancreatic sufficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 Amongst these, three were previously unreported (W57G, D579G and E193K) (Fig. 1). Login to comment
42 The remaining 19 included R352Q (Cremonesi et al. 1992) (three chromosomes), G85E (Zielenski et al. 1991a), Dl152H (High- Fig. 1 A-C Direct sequencing of PCR products from three cystic fibrosis patients (CF) carrying the W57G (A), E193K (B) and D579G (C) mutations, in parallel with control samples (C) displaying normal sequences (N/N) smith et al., personal communication to the CF Genetic Analysis Consortium), R1066H (Ferec et al. 1992), T338I (Saba et al. 1993), 711 +5G--+A (Gasparini et al., personal communication to the CF Genetic Analysis Consortium), M1V (Cheadle et al. 1993), R334W (Gasparini et al. 1991) (two chromosomes each), 4382delA (Claustres et al. 1993), R1158X (Ronchetto et al. 1992), F1052V (Mercier et al. 1993), G1349D (Beaudet et al. 1991), 1898+3A-+G (Cremonesi et al. 1992), $549N (Cutting et al. 1990), 711+ 3A-->G (Petreska et al. 1994), R347P (Dean et al. 1990), 2789+5G--+A (Highsmith et al. 1990), R1066C (Fanen et al. 1992) and S1251N (K~ilin et al. 1992) (one chromosome each). Login to comment
61 20 The third mutation, E193K, was a G709---~A transition 21 in exon 5 substituting the glutamic acid 193 with a lysine. Login to comment
65 31 The W57G mutation was not detected on an additional 132 CF and 50 normal chromosomes, D579G on an additional 115 CF and 50 normal chromosomes and E193K on an additional 108 CF and 54 normal chromosomes. Login to comment
70 (UN yet unidentified mutation) Patient Genotype after Genotype at the end number preliminary screening of the analysis UN/UN M1V/4382delA 1717-1G---~A/UN 1717-1G---~A/R1066H AF508/UN AF508/D579G UN/UN M1V/UN AF508/UN AF508/UN UN/UN T338I/R1158X UN/UN G85E/71 I+5G---~A UN/UN D1152H/UN AF508/UN AF508/UN AF508/UN AF508/3849+ 10kbC---~T UN/UN 711+3A---~G/UN AF508/UN AF508/F1052V UN/UN R352Q/W57G UN/UN 1898+3A----~G/UN AF508/UN AF508/711+5G--~A G542X/UN G542X/DI 152H AF508/UN AF508/E193K 1717-1G---~A/UN 1717-1G---~A/2789+5A---)G AF508/UN AF508/G1349D AF508/UN AF508/G85E AF508/UN AF508/R347P AF508/UN AF508/R352Q AF508/UN AF508/R352Q AF508/UN AF508/S549N G542X/UN G542X/R1066H AF508/UN AF508/T338I AF508/UN AF508/R334W AF508/UN AF508/R334W AF508/UN AF508/S1251N AF508/UN AF508/R1066C AF508/UN AF508/D579G results) while the remaining three haplotypes had been found in association with other rare mutations, which were excluded by DGGE analysis in these patients (Table 3). Login to comment
77 Among the new mutations detected in this study, both D579G and E193K were found in patients compound heterozygous for AF508 and presumably cause the mild pancreatic status, being dominant over AF508. Login to comment
85 In total, among the mutations detected in our PS patients, 17 (D579G, E193K, F1052V, 711+5G---~A, G1349D, G85E, R347R R352Q, $549N, 2789+5A---~G, D1152H, R1066H, R334W, T338I, 3849+10kbC---~T, S1251N, R1066C) have been detected in compound heterozygosity with a mutation already classified as severe (AF508, 1717-1G--~A, G542X) and thus can be considered as presumably mild. Login to comment
86 Of these mutations, seven (G85E, EI93K, 711+5G--qA, R347P, R334W, R352Q, T338|) are located in the first transmembrane (I TM) domain, five (2789+ 5A---~G, RI066H, F1052V, D1152H, R1066C) in the second transmembrane (II TM) domain, four in the nucleo- R334W R347P R352Q T338I E193K 711+.E G85E 1 2 3 4 D579G G->A I S 549N 5 6a 6b 7 8 9 10 11 12 13 3849+11 !11 ! Login to comment

[hide] Is congenital bilateral absence of vas deferens a ... Am J Hum Genet. 1995 Jan;56(1):272-7. Mercier B, Verlingue C, Lissens W, Silber SJ, Novelli G, Bonduelle M, Audrezet MP, Ferec C
Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients.
Am J Hum Genet. 1995 Jan;56(1):272-7., [PMID:7529962]

Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) is an important cause of sterility in men. Although the genetic basis of this condition is still unclear, it has been shown recently that some of these patients carry mutations in their cystic fibrosis transmembrane conductance regulator (CFTR) genes. To extend this observation, we have analyzed the entire coding sequence of the CFTR gene in a cohort of 67 men with CBAVD, who are otherwise healthy. We have identified four novel missense mutations (A800G, G149R, R258G, and E193K). We have shown that 42% of subjects were carriers of one CFTR allele and that 24% are compound heterozygous for CFTR alleles. Thus, we have been unable to identify 76% of these patients as carrying two CFTR mutations. Furthermore, we have described the segregation of CFTR haplotypes in the family of one CBAVD male; in this family are two male siblings, with identical CFTR loci but displaying different phenotypes, one of them being fertile and the other sterile. The data presented in this family, indicating a discordance between the CBAVD phenotype and a marked carrier (delta F508) chromosome, support the involvement of another gene(s), in the etiology of CBAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 We have identified four novel missense mutations (A800G, G149R, R258G, and E193K). Login to comment
65 In addition, we identified the following missense mutations: four R668C, one A800G, one (G628R + S1235R, borne on the same chromosome), one (R74W + D1270N, borne on the same chromosome), six R117H, one F1052V, one R117C, one S1235R, one G149R, one R258G, two R347H, one R1066H, one R75L, and one E193K. Login to comment
77 of Patients Genotypea 1 AF508 + (G628R + S1235R) 1 AF508 + (R74W + D1270N) 2 AF508 + R668C 4 AF508 + R117H 1 AF508 + R258G 1 AF508 + R75L 1 E193K + N1303K 1 R347H + R1066H 1 R117C + W1282X 1 R553X + R668C 1 G149R + R668C 1 R117H+R117H 18 AF508/unidentified 4 W1282X/unidentified 1 G542X/unidentified 1 N1303K/unidentified 1 S1235R/unidentified 1 R347H/unidentified 1 A800G/unidentified 1 F1052V/unidentified 23 unidentified/unidentified a In parentheses are the two mutations located on the same haplotype. Login to comment
88 (iv) The fourth novel mutation we have observed occurs at position 709 and corresponds to a G--.A change that results in a glutamic acid codon instead of a lysine codon (E193K). Login to comment
92 For all four of these new mutations, a segregation analysis was performed in each family, allowing us to show that G149R, R258G, and E193K were carried by a particular allele and that these mutations were not de novo mutations. Login to comment
107 C T A G G T A T G A A G-A T A G T T T A G ATC C C T C A a G C->G A A A C T T G E193K T C A C A T T G-A G A A T a C A ASOOG Figure 2 Autoradiographs showing nucleotide sequence of portions of exons 5, 13, and 4 of CFTR and demonstrating the mutations E193K, A800G, and G149R, respectively. Login to comment

[hide] The neglected ion: HCO3-. Nat Med. 2001 Mar;7(3):292-3. Quinton PM
The neglected ion: HCO3-.
Nat Med. 2001 Mar;7(3):292-3., [PMID:11231624]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 Some CFTR mutations (E193K) may support apparently normal, or even much larger than normal (A800G), Cl-transport whereas others (R117H) do not. Login to comment

[hide] Cystic fibrosis: the 'bicarbonate before chloride'... Curr Biol. 2001 Jun 26;11(12):R463-6. Wine JJ
Cystic fibrosis: the 'bicarbonate before chloride' hypothesis.
Curr Biol. 2001 Jun 26;11(12):R463-6., [PMID:11448786]

Abstract [show]
The specific effects of some mutations that cause cystic fibrosis suggest that reduced HCO(3)(-) transport is the key to understanding cystic fibrosis pathology. But there is a puzzling discrepancy between measures of CFTR-mediated chloride conductance in expression systems and the sweat chloride values of patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 Finally, two other cystic fibrosis mutations cited by Choi et al. [7], A800G and E193K, occur in patients who have congenital bilateral Figure 1 Results of Choi et al. [7], replotted to show bicarbonate and chloride transport as a percentage of wild-type (WT) values (dashed line). Login to comment
53 E193K occurs with the severe mutation N1303K in a patient with 'none of the signs or symptoms of cystic fibrosis`, suggesting it is a very mild mutation. Login to comment

[hide] Managing the underlying cause of cystic fibrosis: ... Paediatr Drugs. 2013 Oct;15(5):393-402. doi: 10.1007/s40272-013-0035-3. Galietta LJ
Managing the underlying cause of cystic fibrosis: a future role for potentiators and correctors.
Paediatr Drugs. 2013 Oct;15(5):393-402. doi: 10.1007/s40272-013-0035-3., [PMID:23757197]

Abstract [show]
Cystic fibrosis (CF), a severe genetic disease, is caused by mutations that alter the structure and function of CFTR, a plasma membrane channel permeable to chloride and bicarbonate. Defective anion transport in CF irreversibly damages the lungs, pancreas, liver, and other organs. CF mutations cause loss of CFTR function in multiple ways. In particular, class 3 mutations such as p.Gly551Asp strongly decrease the time spent by CFTR in the open state (gating defect). Instead, class 2 mutations impair the maturation of CFTR protein and its transport from the endoplasmic reticulum to the plasma membrane (trafficking defect). The deletion of phenylalanine 508 (p.Phe508del), the most frequent mutation among CF patients (70-90 %), destabilizes the CFTR protein, thus causing both a trafficking and a gating defect. These two defects can be overcome with drug-like molecules generically called correctors and potentiators, respectively. The potentiator Kalydeco (also known as Ivacaftor or VX-770), developed by Vertex Pharmaceuticals, has been recently approved by the US FDA and the European Medicines Agency (EMA) for the treatment of CF patients carrying at least one CFTR allele with the p.Gly551Asp mutation (2-5 % of all patients). In contrast, the corrector VX-809, which significantly improves p.Phe508del-CFTR trafficking in vitro, is still under study in clinical trials. Because of multiple defects caused by the p.Phe508del mutation, it is probable that rescue of the mutant protein will require combined treatment with correctors having different mechanisms of action. This review evaluates the status of experimental and clinical research in pharmacotherapy for the CF basic defect.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 There are several studies describing the discovery of very effective potentiators, in many cases with nanomolar potency, that can rescue channel activity not only of p.Phe508del, but also of p.Gly551Asp, p.Gly1349Asp, p.Glu193Lys, p.Gly970Arg, p.Asp1152His, and other mutations [51, 52]. Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
54 In contrast, the estimated total protein levels for E193K-CFTR (177 &#b1; 12% normal CFTR; n = 6), R352Q-CFTR (178 &#b1; 4% normal CFTR; n = 6), and D1152H-CFTR (256 &#b1; 16% normal CFTR; n = 9) were higher (P b 0.05; ANOVA followed by Tukey's least significant difference test) compared with normal CFTR, suggesting that the baseline chloride transport may be overestimated by ~1.8 to 2.6 fold for these three mutant CFTR forms. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment

[hide] Murine and human CFTR exhibit different sensitivit... Am J Physiol Lung Cell Mol Physiol. 2015 Oct 1;309(7):L687-99. doi: 10.1152/ajplung.00181.2015. Epub 2015 Jul 24. Cui G, McCarty NA
Murine and human CFTR exhibit different sensitivities to CFTR potentiators.
Am J Physiol Lung Cell Mol Physiol. 2015 Oct 1;309(7):L687-99. doi: 10.1152/ajplung.00181.2015. Epub 2015 Jul 24., [PMID:26209275]

Abstract [show]
Development of therapeutic molecules with clinical efficacy as modulators of defective CFTR includes efforts to identify potentiators that can overcome or repair the gating defect in mutant CFTR channels. This has taken a great leap forward with the identification of the potentiator VX-770, now available to patients as "Kalydeco." Other small molecules with different chemical structure also are capable of potentiating the activity of either wild-type or mutant CFTR, suggesting that there are features of the protein that may be targeted to achieve stimulation of channel activity by structurally diverse compounds. However, neither the mechanisms by which these compounds potentiate mutant CFTR nor the site(s) where these compounds bind have been identified. This knowledge gap partly reflects the lack of appropriate experimental models to provide clues toward the identification of binding sites. Here, we have compared the channel behavior and response to novel and known potentiators of human CFTR (hCFTR) and murine (mCFTR) expressed in Xenopus oocytes. Both hCFTR and mCFTR were blocked by GlyH-101 from the extracellular side, but mCFTR activity was increased with GlyH-101 applied directly to the cytoplasmic side. Similarly, glibenclamide only exhibited a blocking effect on hCFTR but both blocked and potentiated mCFTR in excised membrane patches and in intact oocytes. The clinically used CFTR potentiator VX-770 transiently increased hCFTR by approximately 13% but potentiated mCFTR significantly more strongly. Our results suggest that mCFTR pharmacological sensitivities differ from hCFTR, which will provide a useful tool for identifying the binding sites and mechanism for these potentiators.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
306 However, recent data indicating that VX-770 potentiates channels bearing multiple disease-causing mutations, spread across CFTR, and that VX-770 potentiates one mutant but not another one in the same domain (for example, VX-770 potentiated TM mutants T338I- and R347H- but not S341P- and E92K-CFTR and potentiated cytoplasmic loop mutants E193K- and K1060T- but not R1066M- and L1065P-CFTR) do not support this conclusion (30, 38). Login to comment