ABCMdb

ABCC7 p.Asn1303Lys

Admin's notes:	Class II-III-VI (maturation defect, gating defect, reduced stability) Veit et al.
ClinVar:	c.3908A>T , p.Asn1303Ile ? , not provided c.3909C>G , p.Asn1303Lys D , Pathogenic c.3907A>C , p.Asn1303His D , Pathogenic
CF databases:	c.3909C>G , p.Asn1303Lys D , CF-causing ; CFTR1: The substitution was found in three adult British Caucasian patients all of whom are heterozygous for the mutation. Two of the patients are pancreatic sufficient with mild to moderate lung disease, and their other chromosomes carry an, as yet, uncharacterized mutation. In all patients the substitution appears to be associated with the haplotype 1,2,2 at XV-2C, KM19 and pMP6d-9 respectively. The third patient has the 551 mutation on the other chromosome, is pancreatic insufficient and died in respiratory failure at the age of 22. c.3907A>C , p.Asn1303His (CFTR1) ? , The mutation can be detected by ASO hybridization (normal: 5'-TAG AAA AAA CTTGGA-3'; mutant: 5'-TAG AAA ACA CTT GGA-3'). The patient is 22 years old and is originating from the Kabilie ethnic group (North Africa); he presents a severe disease, including hepatic and exocrine pancreatic insufficiencies. c.3908A>T , p.Asn1303Ile (CFTR1) ? ,
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: N (78%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

II-III-VI (maturation defect, gating defect, reduced stability) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Polymorphisms of MRP1 (ABCC1) and related ATP-depe... Pharmacogenet Genomics. 2005 Aug;15(8):523-33. Conseil G, Deeley RG, Cole SP
Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters.
Pharmacogenet Genomics. 2005 Aug;15(8):523-33., [PMID:16006996]

Abstract [show]
Genetic variations in drug metabolizing enzymes and targets are established determinants of adverse drug reactions and interactions, but less is known about the role of genetic polymorphisms in membrane transport proteins. MRP1 (ABCC1) is one of 13 polytopic membrane proteins that comprise the 'C' subfamily of the ATP-binding cassette (ABC) superfamily of transport proteins. MRP1 and related ABCC family members, including MRP2, 3, 4 and 5 (ABCC2, 3, 4 and 5), each have a distinctive pattern of tissue expression and substrate specificity. Together, these five transporters play important roles in the disposition and elimination of drugs and other organic anions, and in maintenance of blood-tissue barriers, as confirmed by enhanced chemosensitivity of respective knockout mice. Moreover, Mrp2 (Abcc2) deficient animals display mild conjugated hyperbilirubinemia, corresponding to a human condition known as Dubin-Johnson syndrome (DJS). Naturally occurring mutations in MRP/ABCC-related drug transporters have been reported, some of which are non-synonymous single nucleotide polymorphisms. The consequences of the resulting amino acid changes can sometimes be predicted from in vitro site-directed mutagenesis studies or from knowledge of mutations of analogous (conserved) residues in ABCC proteins that cause DJS, Pseudoxanthoma elasticum (ABCC6), cystic fibrosis (CFTR/ABCC7) or persistent hyperinsulinemic hypoglycemia of infancy (SUR1/ABCC8). Continual updating of databases of sequence variants and haplotype analysis, together with in vitro biochemical validation assays and pharmacological studies in knockout animals, should make it possible to determine how genetic variation in the MRP-related transporters contributes to the range of responses to drugs and chemicals observed in different human populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 In the kidney, glomeruli and distal collecting tubules express MRP1, and, in the brain, MRP1 appears to form part of the drug permeability barrier Fig. 1 CF (CFTR/ABCC7) Q1291R E1228G Q1238R G1244E/V G1247R G1249R S1251N S1255P/L W1282G/R/C R1283K/M N1303K Y1307C E1321Q K1351E Q1352H R1268Q V1298F T1301I G1302R A1303P R1314W/Q G1321S R1339C Q1347H I1350L G1354R D1361N Q1382R A1450T R1347E R1351P V1359G/M S1368A G1377R G1382S R1392H R1419C R1435Q G1477R G1479R R1492W E1505K DJS (MRP2/ABCC2) NBD1 NBD2 COOH MEMBRANE MSD MSD MSD 12131415161710116 7 8 91 23 4 5TM H2 N Extracellular Intracellular PXE (ABCC6) PHHI (SUR1/ABCC8) Two-dimensional structure of MRP-related proteins. Login to comment

[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]

Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
299 [137] Q493A, Q1291A, N505C, N1303K Q493A and N505C reduced and increased the frequency of CO, respectively. Login to comment

[hide] Molecular analysis of the cystic fibrosis gene rev... Mol Hum Reprod. 1999 Jan;5(1):10-3. Lissens W, Mahmoud KZ, El-Gindi E, Abdel-Sattar A, Seneca S, Van Steirteghem A, Liebaers I
Molecular analysis of the cystic fibrosis gene reveals a high frequency of the intron 8 splice variant 5T in Egyptian males with congenital bilateral absence of the vas deferens.
Mol Hum Reprod. 1999 Jan;5(1):10-3., [PMID:10050655]

Abstract [show]
It has previously been shown that defects in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are largely responsible for the condition of congenital bilateral absence of the vas deferens (CBAVD), without associated renal abnormalities, in Caucasian populations. To assess the involvement of the CFTR in CBAVD in a population with presumed low cystic fibrosis (CF) frequency, we have analysed 20 CBAVD males from Egypt for the presence of 12 common Caucasian CFTR mutations and the intron 8 5T splice variant, IVS-5T, known to be a major cause of CBAVD in Caucasian patients. In 16 of the males without associated renal abnormalities only one deltaF508 carrier was identified, but an exceptionally high frequency of the IVS-5T variant was found (14 of 32 alleles or 43.7%), confirming that this variant is involved in many cases of CBAVD, even in populations where CF is rare. CFTR mutations or the IVS-5T variant were found neither in the remaining four patients with associated renal abnormalities nor in the spouses of the 20 CBAVD patients. However, one patient was homozygous for a leucine to proline substitution at amino acid position 541 (L541P) of the CFTR. It is as yet not clear whether this change is involved in CBAVD in this male.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Initially, eight of the males` samples were analysed by a commercial kit allowing the detection of eight mutations in the CFTR gene: ∆F508, ∆I507, G542X, G551D, R553X, 1717-1G→A, W1282X and N1303K (INNO-LiPA CF, Innogenetics, Zwijnaarde, Belgium). Login to comment

[hide] Analysis of the complete coding region of the CFTR... Hum Hered. 1999 Mar;49(2):81-4. Loumi O, Baghriche M, Delpech M, Kaplan JC, Bienvenu T
Analysis of the complete coding region of the CFTR gene in ten Algerian cystic fibrosis families.
Hum Hered. 1999 Mar;49(2):81-4., [PMID:10077727]

Abstract [show]
The spectrum of cystic fibrosis (CF) mutations in the North African population remains poorly known. In order to offer an effective diagnostic service and to determine accurate risk estimates, we decided to identify the CF mutations in 10 Algerian CF families. We carried out a chemical-clamp denaturing gradient gel electrophoresis analysis of the CFTR gene and automated direct DNA sequencing. We identified 5 mutations and we characterized 60% of the CF chromosomes. Taking advantage of the homogeneity of the sample, we report clinical features of homozygous CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
17 CF mutations and variants detected in Algerian patients (n = 20 CF chromosomes) Mutations Localization n % Cum fr. del CTT exon 10 4 20 20 N1303K C→G 4041 exon 21 4 20 40 711+1G→T G→T711+1 intron 5 2 10 50 1812-1G→A G→A 1812-1 intron 11 1 5 55 V754M G→A 2392 exon 13 1 5 60 Total 12 60 Table 1b. Variants detected in Algerian subjects (n = 40 chromosomes) Variants Localization n % A→G 1540 exon 10 8 20 P1290P A→G 4002 exon 20 1 2.5 T854T T→G 2694 exon 14a 11 27.5 Q1463Q G→A 4521 exon 24 7 17.5 875+40A→G intron 6a 2 5 5T intron 8 1 2.5 n = number of chromosomes; cum. Login to comment
27 Among the 16 CF chromosomes carrying an unidentified mutated allele, 4 different mutations were identified, as reported in table 1a: N1303K (20%), 711 + 1G→T (10%), V754M (5%), 1812 - 1G→A (5%). Login to comment
31 The N1303K mutation has already been reported to be significantly more common in Southern European populations than in Northern European populations (Cystic Fibrosis Consortium). Login to comment
55 In our study, we identified 3 homozygous CF patients: 'F508/'F508, N1303K/N1303K, 711 + 1G→T/711 + 1G→T. Login to comment
57 The N1303K/N1303K homozygous patient from related parents was a 4-year-old girl with pancreatic insufficiency and serious pulmonary disease with P. aeruginosa colonization, and 3 positive sweat chloride tests confirmed the CF diagnosis. Login to comment
74 Four other mutations have been identified: Hum Hered 1999;49:81-84 Loumi/Baghriche/Delpech/Kaplan/ Bienvenu N1303K (20%), 711 + 1G→T (10%), 1812 - 1G→A (5%) and V754M (5%). Login to comment

[hide] The complex relationships between cystic fibrosis ... Hum Reprod. 1999 Feb;14(2):371-4. Dohle GR, Veeze HJ, Overbeek SE, van den Ouweland AM, Halley DJ, Weber RF, Niermeijer MF
The complex relationships between cystic fibrosis and congenital bilateral absence of the vas deferens: clinical, electrophysiological and genetic data.
Hum Reprod. 1999 Feb;14(2):371-4., [PMID:10099982]

Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) is found in 1-2% of infertile males and in most male cystic fibrosis (CF) patients. CF and some of the CBAVD cases were found to share the same genetic background. In this study, 21 males with CBAVD had extensive physical and laboratory testing for symptoms of CF. Possible defective cellular chloride transport was measured by interstitial current measurement of rectal suction biopsies. Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation analysis was performed for 10 common CFTR mutations. CF-related symptoms were found in six men. On laboratory testing slightly abnormal liver and pancreatic function was found in seven patients. The sweat test was found to be abnormal in four patients; interstitial current measurement showed defective chloride excretion in 11 patients. CFTR gene mutations were found in 66% of the patients: eight were compound heterozygotes; in six, only one common mutation could be detected. The 5T allele in one copy of intron 8 was found in four men. CBAVD appears to be a heterogeneous clinical and genetic condition. A CFTR gene mutation was found in both copies of the allele or interstitial current measurement showed defective chloride excretion in 14/21 cases. Genetic counselling is clearly indicated for couples seeking pregnancy through epididymal or testicular sperm aspiration and intracytoplasmic sperm injection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 CFTR mutation analysis was performed for 10 mutations: we analysed for the mutations R117H, A455E, ∆F508, 1717-1G→A, G542X, R553X, R1162X, S1251N, W1282X, and N1303K. Login to comment

[hide] Blood immunoreactive trypsinogen concentrations ar... Acta Paediatr. 1999 Mar;88(3):338-41. Lecoq I, Brouard J, Laroche D, Ferec C, Travert G
Blood immunoreactive trypsinogen concentrations are genetically determined in healthy and cystic fibrosis newborns.
Acta Paediatr. 1999 Mar;88(3):338-41., [PMID:10229049]

Abstract [show]
Newborns with cystic fibrosis (CF) have increased blood immunoreactive trypsinogen concentrations. When screening for CF in the newborn by immunoreactive trypsinogen measurement, an abnormally high proportion of healthy deltaF508 carriers is found among false-positive neonates, suggesting that a relationship could exist between immunoreactive trypsinogen concentration at birth and the genetic status. Therefore, this study analysed the possible relationships between neonatal blood immunoreactive trypsinogen concentrations and genotype in 1842 healthy newborns and 111 CF patients detected by a neonatal screening programme. A close correlation was found between immunoreactive trypsinogen and deltaF508: the probability of a healthy newborn being a carrier of this mutation increased regularly with the neonatal immunoreactive trypsinogen concentration. In CF patients, there was a significant difference between deltaF508 homozygotes and deltaF508/X (X = other mutation) compound heterozygotes with respect to the mean neonatal blood immunoreactive trypsinogen concentration. CF neonates with two mutations affecting the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator protein had significantly higher mean immunoreactive trypsinogen concentrations than patients with one mutation affecting a membrane-spanning domain. The data strongly suggest that the neonatal immunoreactive trypsinogen concentration is, in part, genetically determined, with a wide range of variations, similar to the features which have been shown for the relations between the genotype and clinical phenotypes of CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Twins or unrelated patients with identical genotype had very similar neonatal IRT concentrations: DF508/I148T (twins), 1040 and 1055 mg LÀ1 ; N1303K/G149R (twins), 1600 and 1725 mg LÀ1 ; DF508/E585X, 900 and 945 mg LÀ1 ; DF508/ G542X, 1535 and 1660 mg LÀ1 ; DF508/L206W, 980, 1090 and 1100 mg LÀ1 . Login to comment
72 In this study, CF newborns with one mutation in an exon encoding for either NBD1 or NBD2 (DF508, G542X, G551D, E585X, N1303K, etc.) and the other affecting one of the MSD (R117H, 574delA, I148T, G149R, L206W, etc.) had significantly lower IRT concentrations than CF neonates with both mutations located in NBD. Login to comment

[hide] Blood concentrations of pancreatitis associated pr... Arch Dis Child Fetal Neonatal Ed. 1999 Mar;80(2):F118-22. Sarles J, Barthellemy S, Ferec C, Iovanna J, Roussey M, Farriaux JP, Toutain A, Berthelot J, Maurin N, Codet JP, Berthezene P, Dagorn JC
Blood concentrations of pancreatitis associated protein in neonates: relevance to neonatal screening for cystic fibrosis.
Arch Dis Child Fetal Neonatal Ed. 1999 Mar;80(2):F118-22., [PMID:10325788]

Abstract [show]
AIM: To determine whether pancreatitis associated protein (PAP) is a marker for cystic fibrosis which could be used in neonatal screening for the disease. METHODS: PAP was assayed on screening cards from 202,807 neonates. Babies with PAP > or = 15 ng/ml, or > or = 11.5 ng/ml and immunoreactive trypsinogen (IRT) > or = 700 ng/ml were recalled for clinical examination, sweat testing, and cystic fibrosis transmembrane regulator (CFTR) gene analysis. RESULTS: Median PAP value was 2.8 ng/ml. Forty four cases of cystic fibrosis were recorded. Recalled neonates (n = 398) included only 11 carriers. A receiver operating characteristic curve analysis showed that PAP above 8.0 ng/ml would select 0.76% of babies, including all those with cystic fibrosis, except for one with meconium ileus and two with mild CFTR mutations. Screening 27,146 babies with both PAP and IRT showed that only 0.12% had PAP > 8.0 ng/ml and IRT > 700 ng/ml, including all cases of cystic fibrosis. CONCLUSION: PAP is increased in most neonates with cystic fibrosis and could be used for CF screening. Its combination with IRT looks promising.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 Other genotypes were F508/G542X (n=4), F508/N1303K (n=2), F508/I148T (n=2), F508/R117H, F508/R553X, F508/1717-1G->A, F508/ 1078delT, F508/2789+5G->A, F508/ E1308X (a novel CFTR mutation), R553X/ 394delTT, and N1303K/R553X. Login to comment

[hide] Screening for cystic fibrosis transmembrane conduc... Mol Hum Reprod. 1999 Jun;5(6):587-93. Boucher D, Creveaux I, Grizard G, Jimenez C, Hermabessiere J, Dastugue B
Screening for cystic fibrosis transmembrane conductance regulator gene mutations in men included in an intracytoplasmic sperm injection programme.
Mol Hum Reprod. 1999 Jun;5(6):587-93., [PMID:10341008]

Abstract [show]
The present study was undertaken to evaluate the frequency and nature of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene in infertile patients undergoing intracytoplasmic sperm injection. A total of 90 patients were screened for a panel of 10 mutations in the CFTR gene frequently involved in congenital absence of the vas deferens (CAVD); the patients included 14 with azoospermia and CAVD, 39 patients with azoospermia without CAVD (n = 39) and 37 patients with severe oligozoospermia. The length of the polymorphic polypyrimidine tract (allele 5T, 7T and 9T) in the intron 8/exon 9 splice-acceptor site was also determined. In 10 out of 14 patients with CAVD, CFTR mutations were found; nine patients had one DeltaISOdiaDeltaF508 mutation and one patient had two CFTR mutations (N1303K/R117H). Allele 5T was present in eight of these patients. In six patients, 5T was the non-DeltaISOdiaDeltaF508 allele and in two patients there was no known CFTR mutation. None of the CFTR mutations were observed in patients with azoospermia without CAVD or with severe oligozoospermia and the frequency of allele 5T was 3.6% (three out of 78 alleles) and 1.35% (one out of 74 alleles) respectively. Our observation suggests that the CFTR gene is not involved in either spermatogenesis or in the pathology of the genital tract, except for CAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 In 10 out of 14 patients with CAVD, CFTR mutations were found; nine patients had one ∆∆F508 mutation and one patient had two CFTR mutations (N1303K/R117H). Login to comment
51 Each patient was tested for the nine most frequent cystic fibrosis-causing CFTR mutations: ∆F508, ∆I507, 1717-1G→A, G542X, G551D, R553X, W1282X, N1303K, 621ϩ1G→T and the three most frequent CFTR mutations involved in CBAVD (∆F508, R117H and the IVS8 polyT). Login to comment
53 The other mutations were detected using either heteroduplex analysis (∆I507), allele specific oligonucleotide (ASO) hybridization (G542X, 1717-1G→A, IVS8 polyT) (Kerem et al., 1990), restriction endonuclease analysis (G551D, R553X, W1282X) (Zielenski et al., 1991) or polymerase chain reaction (PCR)-mediated site-directed mutagenesis (621ϩ1G→T, R117H, N1303K) (Friedman et al., 1991). Login to comment
60 Restriction digestion and electrophoresis (Figures 2 and 3) Detection of 621ϩ1G→T, R117H, G551D, R553X, W1282X and N1303K were performed using appropriate restriction enzymes (New England Biolabs, Ozyme, Saint Quentin Yvelines, France) as described in Table IV. Login to comment
64 Clinical status, semen characteristics and concentrations of follicle stimulating hormone (FSH) in azoospermic patients No. Plasma FSH Semen volume Semen pH Semen fructose Semen Semen carnitine CFTR genotype (mIU/ml) (ml) (µmoles) α-glucosidase (mIU) (nmoles) Patients with congenital absence of the vas deferens (CAVD) 1 4.5 0.7 6.5 0 3 20 ∆F508/N 9T/5T 2 6.9 0.5 6.8 - - - ∆F508/N 9T/7T 3 1.9 0.2 6.5 Ͻ1 - - ∆F508/N 9T/5T 4 0.7 0.5 6.8 0 3 20 ∆F508/N 9T/7T 5 6.0 0.3 6.8 - - - ∆F508/N 9T/5T 6 3.6 0.5 6.5 - 3 20 ∆F508/N 9T/5T 7 4.0 1.5 6.5 - - - ∆F508/N 9T/5T 8 5.9 1.2 6.5 0 4 20 ∆F508/N 9T/7T 9 3.8 - - - - - ∆F508/N 9T/5T 10 5.0 - - 0 - 24 N1303K/ 9T/7T R117H *11 2.0 0.8 7.1 0 2 - N/N 9T/7T 12 4.3 0.3 7.4 0 - 3.6 N/N 7T/7T 13 1.0 0.4 6.5 0 - - N/N 9T/5T 14 2.0 1.3 6.8 0 5 - N/N 9T/5T Patients without CAVD 15 7.4 1.8 8.3 29 1 126 N/N 7T/7T 16 - 2.2 8.5 33 20 154 N/N 7T/7T 17 - 4.4 8.3 35 12 352 N/N 7T/7T 18 3.6 8.5 8.1 187 82 680 N/N 7T/7T 19 3.1 2.5 8.5 25 - 100 N/N 7T/7T 20 3.4 0.4 6.5 Ͻ1 7 28 N/N 7T/5T 21 1.6 1.4 8.3 4.2 5 126 N/N 7T/9T 22 3.1 3.0 8.7 78 2 270 N/N 7T/7T 23 0.9 3.0 9.0 - - - N/N 7T/7T 24 4.4 10.0 7.9 190 - 300 N/N 7T/7T 25 1.3 2.2 8.1 40 - 44 N/N 7T/7T 26 2.9 2.6 8.3 26 8 286 N/N 7T/7T 27 1.7 2.1 8.3 44 - 84 N/N 7T/7T 28 - 9.0 8.1 180 27 540 N/N 7T/7T 29 - 1.5 8.3 23 - 120 N/N 7T/7T 30 4.1 0.3 7.1 - - - N/N 7T/7T 31 4.9 1.7 8.3 20 20 - N/N 7T/7T 32 7.2 1.0 7.9 Ͻ1 3 30 N/N 7T/7T 33 9.0 1.5 6.5 Ͻ1 2 - N/N 7T/5T 34 11.7 5.0 7.9 90 - 400 N/N 7T/7T 35 7.2 4.6 8.1 92 132 1518 N/N 7T/9T 36 4.4 2.5 8.1 30 11 1510 N/N 7T/7T 37 14 3.6 8.3 50 27 900 N/N 7T/7T 38 4.9 6.0 7.9 72 - 300 N/N 7T/7T 39 6.0 1.8 8.3 31 17 252 N/N 7T/7T 40 14.3 1.5 8.3 22 1 90 N/N 7T/9T 41 6.6 2.2 - 27 - 290 N/N 7T/7T 42 4.8 0.5 6.8 0 3 42 N/N 7T/7T 43 13.9 2.0 7.8 - - - N/N 7T/7T 44 3.9 3.9 8.3 47 11 - N/N 7T/7T 45 1.5 1.8 8.6 11 - - N/N 7T/7T 46 4.2 3.0 8.5 25 28 210 N/N 7T/7T 47 4.0 5.8 7.9 122 42 696 N/N 7T/9T 48 16.3 5.0 8.7 145 68 900 N/N 7T/7T 49 7.2 4.0 7.5 - - - N/N 7T/5T 50 8.0 4.3 8.1 34 200 1284 N/N 7T/7T 51 23.9 0.8 9.0 5.6 17 184 N/N 7T/7T 52 - 2.2 8.5 35 - 308 N/N 7T/9T 53 17.8 3.1 8.1 31 50 527 N/N 7T/7T Fructose, α glucosidase and carnitine are expressed per ejaculate. Login to comment
74 One patient was a compound heterozygote, R117H/N1303K. Login to comment
94 Methods for detecting mutations Mutation Method R117H PCR-mediated-site-directed mutagenesis, HaeII digestion N: 113 ϩ 24 bp R117H: 137 bp 621ϩ1G→T MseI digestion N: 269 ϩ 33 bp 621ϩ1G→T: 215 ϩ 54 ϩ 33 bp IVS8polyT ASO hybridization: hybridization at 50°C 5T: TGT GTG TGT TTT TAA CAG washing at 55°C 7T: TGT GTG TTT TTT TAA CAG washing at 51°C 9T: GTG TGT TTT TTT TTA ACA G washing at 55°C ∆I507 Heteroduplex DNA formation ∆F508 Heteroduplex DNA formation (see Figure 1) 17171G→A ASO hybridization, hybridization at 42°C, washing at 54°C N: TTT GGT AAT AGG ACA TCT CC 17171G→A: TTT GGT AAT AAG ACA TCT CC G542X ASO hybridization, hybridization at 42°C, washing at 49°C N: ACC TTC TCC AAG AAC T G542X: ACC TTC TCA AAG AAC T G551D DpnII digestion: N: 425 bp G551D: 243 ϩ 182 bp R553X HincII digestion N: 239 ϩ 186 bp R553X: 425 bp W1282X MnlI digestion N: 178 ϩ 172 ϩ 123 bp W1282X: 301 ϩ 172 bp N1303K PCR-mediated-site-directed mutagenesis, BstNI digestion N: 266 ϩ 23 bp N1303K: 289 bp The underlining indicates the location of nucleotide substitution in normal and mutated allele. Login to comment
99 Our results are in accordance with these data, since nine of the 14 patients (64.2%) with CAVD were heterozygous for one CFTR mutation (∆F508) and one patient with CBAVD (7.1%) was a compound heterozygote (R117H/N1303K) and was 7T/9T. Login to comment
100 N1303K is classified as a severe mutation with respect to pancreatic status in CF patients. Login to comment
127 Detection of the mutation N1303K by polymerase chain reaction (PCR). Login to comment
130 Lane 1: 1 kb DNA ladder (Life Technologies, Cergy-Pontoise, France); Lanes 2 and 6: heterozygote for the N1303K mutation; Lanes 3, 4, 5, 7: normal homozygote; Lane 8: BstNI cut control DNA; Lane 9: uncut control DNA. Login to comment

[hide] Proportion of cystic fibrosis gene mutations not d... JAMA. 1999 Jun 16;281(23):2217-24. Mak V, Zielenski J, Tsui LC, Durie P, Zini A, Martin S, Longley TB, Jarvi KA
Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia.
JAMA. 1999 Jun 16;281(23):2217-24., 1999-06-16 [PMID:10376575]

Abstract [show]
CONTEXT: Infertile men with obstructive azoospermia may have mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, many of which are rare in classic cystic fibrosis and not evaluated in most routine mutation screening. OBJECTIVE: To assess how often CFTR mutations or sequence alterations undetected by routine screening are detected with more extensive screening in obstructive azoospermia. DESIGN: Routine screening for the 31 most common CFTR mutations associated with the CF phenotype in white populations, testing for the 5-thymidine variant of the polythymidine tract of intron 8 (IVS8-5T) by allele-specific oligonucleotide hybridization, and screening of all exons through multiplex heteroduplex shift analysis followed by direct DNA sequencing. SETTING: Male infertility clinic of a Canadian university-affiliated hospital. SUBJECTS: Of 198 men with obstructive (n = 149) or nonobstructive (n = 49; control group) azoospermia, 64 had congenital bilateral absence of the vas deferens (CBAVD), 10 had congenital unilateral absence of the vas deferens (CUAVD), and 75 had epididymal obstruction (56/75 were idiopathic). MAIN OUTCOME MEASURE: Frequency of mutations found by routine and nonroutine tests in men with obstructive vs nonobstructive azoospermia. RESULTS: Frequency of mutations and the IVS8-5T variant in the nonobstructive azoospermia group (controls) (2% and 5.1% allele frequency, respectively) did not differ significantly from that in the general population (2% and 5.2%, respectively). In the CBAVD group, 72 mutations were found by DNA sequencing and IVS8-5T testing (47 and 25, respectively; P<.001 and P = .002 vs controls) vs 39 by the routine panel (P<.001 vs controls). In the idiopathic epididymal obstruction group, 24 mutations were found by DNA sequencing and IVS8-5T testing (12 each; P=.01 and P=.14 vs controls) vs 5 by the routine panel (P=.33 vs controls). In the CUAVD group, 2 mutations were found by routine testing (P=.07 vs controls) vs 4 (2 each, respectively; P=.07 and P=.40 vs controls) by DNA sequencing and IVS8-5T testing. The routine panel did not identify 33 (46%) of 72, 2 (50%) of 4, and 19 (79%) of 24 detectable CFTR mutations and IVS8-5T in the CBAVD, CUAVD, and idiopathic epididymal obstruction groups, respectively. CONCLUSIONS: Routine testing for CFTR mutations may miss mild or rare gene alterations. The barrier to conception for men with obstructive infertility has been overcome by assisted reproductive technologies, thus raising the concern of iatrogenically transmitting pathogenic CFTR mutations to the progeny.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 Analysis for 31 of the most common CFTR mutations found within the white CF population,60 consisting of ⌬F508, W1282X, G542X, G551D, N1303K, R553X, G85E, R117H, S549N, V520F, R334W, A455E, R347P, R1162X, Y122X, S549R, 621+1G→T, ⌬I507, R560T, R347H, 3659delC, Q493X, 1898+1G→T, 711+1G→T, 3849+10C→T, 1717-1G→A, 3849+4A→G, 3905insT, 1078delT, 2183AA→G, and 2789+5G→A. Briefly, the technique involved amplification by polymerase chain reaction61 of the relevant exons, followed by digestion with appropriate restriction endonucleases and acrylamide gel electrophoresis with ethidium bromide staining. Login to comment
45 (%) Men With 2 Mutations ⌬F508/IVS8-5T 7 (11) ⌬F508/IVS8-5T 1 (10) ⌬F508/IVS8-5T 1 (1.8) ⌬F508/R117H 6 (9) W1282X/IVS8-5T 1 (1.8) ⌬F508/L206W 1 (1.6) G544S/IVS8-5T 1 (1.8) ⌬F508/M952T 1 (1.6) V754M/-741T→G 1 (1.8) ⌬F508/P67L 1 (1.6) R75Q/R258G 1 (1.8) ⌬F508/S549R 1 (1.6) R334W/R334W 1 (1.6) R117H/R117H 1 (1.6) R117H/IVS8-5T 1 (1.6) R347P/IVS8-5T 1 (1.6) N1303K/IVS8-5T 1 (1.6) 1677delTA/IVS8-5T 1 (1.6) R117L/IVS8-5T 1 (1.6) D979A/IVS8-5T 1 (1.6) IVS8-5T/IVS8-5T 1 (1.6) Men With 1 Mutation IVS8-5T/N 10 (16) ⌬F508/N 1 (10) IVS8-5T/N 9 (16) ⌬F508/N 1 (2) ⌬F508/N 6 (9) IVS8-5T/N 1 (10) ⌬F508/N 1 (1.8) G542X/N 1 (2) W1282X/N 2 (3) R75Q/N 1 (1.8) IVS8-5T/N 5 (10) L206W/N 1 (1.6) W1282X/N 1 (1.8) 4016insT/N 1 (1.6) R117H/N 1 (1.8) 2423delG/N 1 (1.8) Men With No Mutations 18 (28) 7 (70) 37 (66) 42 (86) *N indicates that no CFTR mutations or variants were detected. Login to comment
47 tion panel included W1282X (2 alleles), R334W (2 alleles), S549R (1 allele), R347P (1 allele), and N1303K (1 allele). Login to comment
58 (%) 31 Mutation panel† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1 (1) R117H 9 (7) W1282X 2 (1.8) G542X 1 (1) W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) Extensive screen† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1Mutations included in R117H 9 (7) W1282X 2 (1.8) G542X 131 mutation panel W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) L206W 2 (1.6)‡ R75Q 2 (1.8)‡Mutations not included in P67L 1 (0.8)‡ G544S 1 (0.9)‡31 mutation panel 1677delTA 1 (0.8)‡ 2423delG 1 (0.9)‡ R117L 1 (0.8)‡ V754M 1 (0.9)‡ 4016insT 1 (0.8)‡ -741T→G 1 (0.9)‡ D979A 1 (0.8)§ R258G 1 (0.9)§ M952T 1 (0.8)¶ IVS8-5T 25 (20)# 2 (10) 12 (11) 5 (5) Detectable mutations 72 (56)# 4 (20) 24 (21)# 7 (7) Detectable mutations missed by 31 mutation panel 33 (46) 2 (50) 19 (79) Detectable non-IVS8-5T mutations missed by 31 mutation panel 8 (17) 0 (0) 7 (58) *Percentages indicate allele frequency. Login to comment
83 These severe CFTR gene mutations are associated with pancreatic insufficiency and are generally class 1 through 3 mutations: ⌬F508, W1282X, N1303K, S549R, 1677delTA, R117L, 4016insT, G544S, 2423delG, V754M, and 741T→G. Login to comment

[hide] Detection of five rare cystic fibrosis mutations p... Clin Chem. 1999 Jul;45(7):957-62. Castaldo G, Fuccio A, Cazeneuve C, Picci L, Salvatore D, Raia V, Scarpa M, Goossens M, Salvatore F
Detection of five rare cystic fibrosis mutations peculiar to Southern Italy: implications in screening for the disease and phenotype characterization for patients with homozygote mutations.
Clin Chem. 1999 Jul;45(7):957-62., [PMID:10388469]

Abstract [show]
BACKGROUND: The search for the eight most frequent mutations (i.e., DeltaF508, G542X, W1282X, N1303K, 1717-1G-->A, R553X, 2183AA-->G, and I148T) by allele-specific oligonucleotide dot-blot analysis revealed 78% of 396 cystic fibrosis alleles in Southern Italy. The observation of frequent haplotypes on the unidentified cystic fibrosis alleles suggested that a few mutations could account for a large number of unidentified alleles. METHODS: We screened most of the coding sequence of the cystic fibrosis transmembrane regulator gene by denaturing gradient gel electrophoresis to determine the spectrum of these mutations in 68 unrelated cystic fibrosis patients bearing one or both unidentified mutations. RESULTS: The screening revealed five mutations, R1158X, 711+1G-->T, 4016insT, L1065P, and G1244E, each of which had a frequency of 1.3-1.8% (7% collectively). The 7% increase in the detection rate (85% vs 78%) reduces by >50% the residual risk of being cystic fibrosis carriers for couples who had tested negative by molecular analysis. We therefore designed a second allele-specific oligonucleotide set to analyze the five mutations. Among the patients analyzed, one patient homozygous for the L1065P mutation expressed a mild pulmonary and intestinal form of the disease with pancreatic insufficiency. Two other patients, homozygous for mutations R1158X and 4016insT, both expressed a severe cystic fibrosis phenotype. CONCLUSIONS: Five cystic fibrosis mutations are peculiar to patients from Southern Italy. The method described for their analysis is efficient, inexpensive, and can be semi-automated by use of a robotic workstation. The results obtained in patients from Southern Italy may have an impact on laboratories in other countries, given the large migrations of populations from Southern Italy to other countries in the last two centuries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 A few mutations (i.e., ⌬F508, N1303K, G542X, and R553X) are frequent worldwide; the other mutations are regional or "private" mutations. Login to comment
36 All patients were first analyzed for eight CF mutations, i.e., ⌬F508, N1303K, G542X, W1282X, 1717-1G3A, R553X, 2183AA3G, and I148T (9). Login to comment
39 methods The eight CF mutations (i.e., ⌬F508, N1303K, G542X, W1282X, 1717-1G3A, R553X, 2183AA3G, and I148T) were identified with a semi-automated procedure based on a single multiplex PCR amplification followed by the allele-specific oligonucleotide (ASO) identification we described previously (9). Login to comment

[hide] The cystic fibrosis conductance regulator gene exo... Am J Rhinol. 1999 May-Jun;13(3):221-3. Bucholtz GA, Ejercito VS, Burmester JK
The cystic fibrosis conductance regulator gene exon sequence is normal in a patient with edematous eosinophilic nasal polyps.
Am J Rhinol. 1999 May-Jun;13(3):221-3., [PMID:10392242]

Abstract [show]
Nasal polyps are the most common mass lesions found in the nose and their etiology is unknown. Nasal polyps from cystic fibrosis (CF) patients are histologically distinct from nasal polyps from patients without CF. It has been suggested that a mutation (G551D) of the cystic fibrosis transmembrane conductance regulator (CFTR) gene may play a role in nasal polyp formation in patients without CF. To investigate the possibility that this or other CFTR gene exon mutations are required for nasal polyp formation, the CFTR gene exons were sequenced from peripheral blood DNA derived from an adult patient with edematous eosinophilic nasal polyps and no personal or family history of CF. No mutations or deletions were identified in any of the CFTR exons. A single polymorphism (A or G) was found in exon 10, base pair 1540, amino acid 470. This polymorphism was detected in 11 of 16 subjects (69%) with edematous eosinophilic nasal polyps and 10 of 21 normal subjects (48%) without nasal polyps and was not statistically significant (p = 0.316). These results demonstrate that mutations of the CFTR coding region are not a prerequisite for the formation of edematous eosinophilic nasal polyps.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 12,13 Burger et al. analyzed 112 nasal polyp specimens from non-CF patients for 8 cystic fibrosis conductance regulator (CFTR) gene mutations (Ll508, Ll] 507, D 11OH, TI17H, 621+ IG---7T, N1303K, G551D, R553X).14 Ho- Delivered by Publishing Technology to: University of North Carolina IP: 152.19.83.63 On: Mon, 08 Aug 2011 14:07:01 Copyright (c) Oceanside Publications, Inc. All rights reserved. For permission to copy go to www.copyright.com mozygous or compound heterozygous individuals were not found. Login to comment

[hide] Frequency of CFTR gene mutations in males particip... Hum Reprod. 1999 Jul;14(7):1833-4. Jakubiczka S, Bettecken T, Stumm M, Nickel I, Musebeck J, Krebs P, Fischer C, Kleinstein J, Wieacker P
Frequency of CFTR gene mutations in males participating in an ICSI programme.
Hum Reprod. 1999 Jul;14(7):1833-4., [PMID:10402399]

Abstract [show]
A higher prevalence of cystic fibrosis transmembrane regulator (CFTR) gene mutations has been suggested both in men affected by congenital aplasia of the vas deferens, and in individuals presenting with reduced sperm quality. In this case, an increased risk for offspring being affected by cystic fibrosis (CF) can be expected in couples who are planning to undergo intracytoplasmic sperm injection (ICSI), since most of the male partners suffer from infertility. In order to determine the risk for these couples more precisely, we offered them a test for the most frequent CF mutations prevalent in the German population. The frequency of mutations within the CFTR gene in the female group was in the same range as expected for the general population (six out of 150). In 10 out of 207 males tested, infertility could be explained by exogenous factors not related to CFTR. Among the remaining 197 males with idiopathic infertility, we detected 13 heterozygotes for a mutation within the CFTR gene. This slightly, but significantly (P = 0.014), elevated rate could indicate that infertile males have, compared with the general population, an increased risk of being a carrier of a CFTR gene mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 Materials and methods CFTR screening included the most frequent CFTR mutations in the German population (R347P, ∆F508, G542X, S549I,N,R(A→C), G551D, R553X, N1303K, and 3849ϩ10kbC→T) (Do¨rk et al., 1994) as well as the mutation R117H and the analysis of the IVS8-T haplotype. Login to comment

[hide] Two buffer PAGE system-based SSCP/HD analysis: a g... Eur J Hum Genet. 1999 Jul;7(5):590-8. Liechti-Gallati S, Schneider V, Neeser D, Kraemer R
Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease.
Eur J Hum Genet. 1999 Jul;7(5):590-8., [PMID:10439967]

Abstract [show]
The large size of many disease genes and the multiplicity of mutations complicate the design of an adequate assay for the identification of disease-causing variants. One of the most successful methods for mutation detection is the single strand conformation polymorphism (SSCP) technique. By varying temperature, gel composition, ionic strength and additives, we optimised the sensitivity of SSCP for all 27 exons of the CFTR gene. Using simultaneously SSCP and heteroduplex (HD) analysis, a total of 80 known CF mutations (28 missense, 22 frameshift, 17 nonsense, 13 splicesite) and 20 polymorphisms was analysed resulting in a detection rate of 97.5% including the 24 most common mutations worldwide. The ability of this technique to detect mutations independent of their nature, frequency, and population specificity was confirmed by the identification of five novel mutations (420del9, 1199delG, R560S, A613T, T1299I) in Swiss CF patients, as well as by the detection of 41 different mutations in 198 patients experimentally analysed. We present a three-stage screening strategy allowing analysis of seven exons within 5 hours and analysis of the entire coding region within 1 week, including sequence analysis of the variants. Additionally, our protocol represents a general model for point mutation analysis in other genetic disorders and has already been successfully established for OTC deficiency, collagene deficiency, X-linked myotubular myopathy (XLMTM), Duchenne and Becker muscular dystrophy (DMD, BMD), Wilson disease (WD), Neurofibromatosis I and II, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, and defects in mitochondrial DNA. No other protocol published so far presents standard SSCP/HD conditions for mutation screening in different disease genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 The distribution of analysed known mutations is similar to that of the total number of mutations in the entire CFTR gene: missense mutations account for 35% (G27E, G85E, R117H, A120T, I148T, H199Y, R334W, T338I, R347P, R347H, A455E, M718K, S5449N, S5449I, G551D, R560T, R560S, S945L, S977P, I1005R, R1066C, R1070Q, M1101K, D1152H, S1235R, R1283M, N1303K, N1303H), followed by 28% of frameshift mutations (175delC, 394delTT, 457TAT- > G, 905delG, 1078delT, I507, F508, 1609delCA, 1677delTA, 2143delT, 2176insC, 218delA, 2184insA, 2869insG, 3659delC, 3732delA, 3821delT, 3905insT, 4016insT, 4172delGC, 4382delA), 21% of nonsense mutations (Q30X, Q39X, Q220X, W401X, Q525X, G542X, Q552X, R553X, V569X, E585X, K710X, R792X, Y1092X, R1162X, S1255X, W1282X, E1371X), and 16% of splice site mutations (621 + 1G- > T, 711 + 1G- > T, 711 + 5G- > A, 1717-1G- > A, 1898 + 1G- > A, 1898 + 5G- > T, 2789 + 5G- > A, 3271 + 1G- > A, 3272-26A- > G, 3601-17T- > C, 3849 + 4A- > G, 3849 + 10kbC- > T, 4374 + 1G- > T). Login to comment
22 Polymerase Chain Reaction Amplification The 27 exons (including exon/intron boundaries) as well as intron 19 of the CFTR gene were amplified by the polymerase chain reaction (PCR)13 using approximately 200 ng of genomic DNA, 10 mM dNTPs (PCR Nucleotide Mix, Boehringer/ Roche Diagnostics Rotkreuz, ZG, Switzerland), 10 mM Tris (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 2.5 unit Taq polymerase (Boehringer/Roche Diagnostics Rotkreuz, ZG, Switzerland) and 20 pmol of each primer in a total volume of 50 µl. Twenty-eight cycles of PCR with denaturation at 94°C for 15 s, annealing at either 61°C (exons 1, 2, 5-12, 13CD, 15, 16, 18-22, 24) or 53°C (exons 3, 4, 13AB, 14a, 14b, 17a, 17b, 21/N1303K, 23) for 15 s and extension at 72°C for 45 s were carried out in PE 9600 and PE 2400 thermocyclers. Login to comment
24 Sequences for the primers 1-10, 11 (forward), 12-16, 17b, 18-20, 21 (forward), 22, 23, 24 (forward) have been reported by Zielenski et al;14 exon 17a was amplified using the primer sequences described by Cheadle et al;15 the primers for the amplification of intron 19 were designed by Highsmith et al;16 and the primer sequence for the detection of N1303K was reported by Friedman et al.17 The following primer sequences were derived from the present study: Exon 11 (reverse): 5' - GTGATTCTTAACCCAC- TAGCC - 3' Exon 21 (reverse): 5' - AAGTGTGTAGAATGATGT- CAGC - 3' Exon 24 (reverse): 5' - CGAGCTCCAATTCCAT- GAGG - 3' SSCP Analysis Three microliters of the amplification product were added to 2-3 µl of SSCP buffer (95% formamide, 100 mM NaOH, 0.25% bromphenol blue, 0.25% xylencyanol) and denatured at 95°C for 2 min followed by rapid cooling on ice. Three microliters of the mixture were loaded on to a 12% nondenaturing polyacrylamide gel (99% acrylamide, 1% piperazine diacrylamide (PDA)) cast on to GelBond (Bioconcept, Allschwil, BL, Switzerland). Login to comment
34 Intron 19, all 27 exons and their exon-intron boundaries, including the 24 most common mutations worldwide (G85E, R117H, 621 + 1G- > T, 711 + 1G- > T, 1078delT, R334W, R347P, A455E, I507, F508, 1717-1G- > A, G542X, S549N, G551D, R553X, R560T, 1898 + 1G- > A, 2184delA, 2789 + 5G- > A, R1162X, 3659delC, 3849 + 10kbC- > T, W1282X, N1303K) (Cystic Fibrosis Genetic Analysis Consortium 1994), and the 15 most common mutations in our population (I148T, 1078delT, R334W, R347P, F508, 1717-1G- > A, G542X, R553X, 2347delG, D1152H, R1162X, 3849 + 10kbC- > T, 3905insT, W1282X, N1303K), were considered in this study. Login to comment
92 The technique developed demonstrates excellent single-strand separation and non-radioactive visualisation on polyacrylamide gels, and is time-saving and directly Table 2 Known mutations identified in 198 CF patients analysed investigatively Exon (E) Number of CFTR mutations intron (I) chromosomes Patient`s nationality Highest prevalence ∆F508 E10 212 miscellaneous 3905insT E20 025 Swiss Swiss, Amish, Arcadian R553X E11 020 Swiss, German German 1717-1G->A I10 017 Swiss, Italian Italian N1303K E21 011 Swiss, French, Italian Italian W1282X E20 014 Swiss, Italian, Israelit Jewish-Askhenazi G542X E11 009 Swiss, Spanish, Italian Spanish 2347delG E13 008 Swiss R1162X E19 006 Swiss, Italian, Russian Italian 3849+10kbC->T I19 005 German, French R347P E07 004 Swiss T5 I08 004 Swiss R334W E07 003 Swiss Q525X E10 003 Swiss 3732delA E19 003 Swiss S1235R E19 003 Italian, Turkish G85E E03 002 Italian, Greek I148T E04 002 Austrian, Turkish French-Canadian 621+1G->T I04 002 French French-Canadian 1078delT E07 002 Swiss E585X E12 002 Italian 2176insC E13 002 Swiss, Italian 2789+5G->A I14b 002 Italian Spanish D1152H E18 002 Swiss, French 4016insT E21 002 Turkish Q39X E02 001 Swiss 394delTT E03 001 Swiss Nordic, Finnish R117H E04 001 Swiss A120T E04 001 Swiss G126D E04 001 Swiss 711+5G->A I05 001 Russian M348K E07 001 Italian L568F E12 001 Italian 2183AA->G E13 001 Italian Italian K710X E13 001 Swiss S945L E15 001 French 3272-26A.->G I17a 001 Swiss M1101K E17b 001 Swiss Huttite 3601-17C->T I18 001 Swiss R1158X E19 001 Swiss 4005+1G-A I20 001 Italian applicable to early diagnostic testing, carrier detection and prenatal diagnosis. Login to comment

[hide] Analysis of 31 CFTR mutations by polymerase chain ... J Med Screen. 1999;6(2):67-9. Gasparini P, Arbustini E, Restagno G, Zelante L, Stanziale P, Gatta L, Sbaiz L, Sedita AM, Banchieri N, Sapone L, Fiorucci GC, Brinson E, Shulse E, Rappaport E, Fortina P
Analysis of 31 CFTR mutations by polymerase chain reaction/oligonucleotide ligation assay in a pilot screening of 4476 newborns for cystic fibrosis.
J Med Screen. 1999;6(2):67-9., [PMID:10444722]

Abstract [show]
OBJECTIVES: Molecular biological testing for genetic diseases has grown rapidly, but speed, accuracy, specificity, sensitivity, throughput, and cost become more important as large scale screening is considered. This is a pilot study of an assay for the simultaneous detection of up to 31 cystic fibrosis mutations in a multicentre population based screening of 4476 Italian newborns. METHODS: The assay is a polymerase chain reaction, followed by an oligonucleotide ligation assay (PCR/OLA) and finally a sequence coded separation. It allows the detection of up to 31 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Guthrie spots were used as a source of template DNA. RESULTS: 144 carriers were detected during the analysis of 4476 samples, which translates into a carrier frequency of 1/31.1. Forty two carriers were detected from 1341 samples in Pavia (1/31.9), 53 from 1574 in Turin (1/29.7), and 49 from 1561 in San Giovanni Rotondo (1/31.8). Fifteen different mutations were detected, the most common being delta F508 (0.625). Other common mutations included G542X (16 of 144), which was particularly common in southern Italy (14 of 49), N1303K (8 of 144), and R117H (8 of 144), detected only in the northern centres. CONCLUSIONS: PCR/OLA is a robust, accurate, user friendly method for cystic fibrosis screening of newborns using blood spots in a semiautomated way at a low cost per mutation (0.8 Euro).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 Other common mutations included G542X (16 of 144), which was particularly common in southern Italy (14 of 49), N1303K (8 of 144), and R117H (8 of 144), detected only in the northern centres. Login to comment
45 Other mutations found with greater than normal frequency were G542X, which is particularly common in southern Italy (14 of 49 individuals from San Giovanni Rotondo), N1303K (8 of 144), and R117H (8 of 144), which was detected only in the northern centres. Login to comment
46 Table 1 Mutations analysed in the CFTR gene using polymerase chain reaction/oligonucleotide litigation assay/sequence coded separation Mutation Location Nucleotide Result F508 Exon 10 3 bp deletion Deletion of Phe-508 I507 Exon 10 3 bp deletion Deletion of Ile-507 (or -506) Q493X Exon 10 C-1609 →→ T Gln-493 → Stop V520F Exon 10 G-1690 → T Val-520 → Phe 1717-1G → A Intron 10 G-1717-1 → A 3`-splice site mutation G542X Exon 11 G-1756 → T Gly-542 → Stop G551D Exon 11 G-1784 → A Gly-551 → Asp R553X Exon 11 C-1789 → T Arg-553 → Stop R560T Exon 11 G-1811 → C Arg-560 → Thr S549R Exon 11 T-1779 → G Ser-549 → Arg S549N Exon 11 G-1778 → A Ser-549 → Asn 3849+10 kb C → T Intron 19 C-3849+10 kb → T Splice mutation 3849+4A → G Intron 19 A-3849+4 → G Splice mutation R1162X Exon 19 C-3616 → T Arg-1162 → Stop 3659delC Exon 19 1 bp deletion Frameshift W1282X Exon 20 G-3978 → A Trp-1282 → Stop 3905insT Exon 20 1 bp insertion Frameshift N1303K Exon 21 C-4041 → G Asn-1303 → Lys G85E Exon 3 G-386 → A Gly-85 → Glu 621+1G → T Intron 4 G-621+1 → T 5`-splice site mutation R117H Exon 4 G-482 → A Arg-117 → His Y122X Exon 4 T-498 → A Tyr-122 → Stop 711+1G → T Intron 5 G-711+1 → T 5`-splice site mutation 1078delT Exon 7 1 bp deletion Frameshift R347P Exon 7 G-1172 → C Arg-347 → Pro R347H Exon 7 G-1172 → A Arg-347 → His R334W Exon 7 C-1132 → T Arg-334 → Trp A455E Exon 9 C-1496 → A Ala-455 → Glu 1898+1G → A Intron 12 G-1898+1 → A 5`-splice site mutation 2184delA Exon 13 Deletion A-2184; A-2183 → G Frameshift 2789+5G → A Intron 14B G-2789+5 → A Splice mutation Table 2 Summary of cystic fibrosis screening results No of samples analysed Normal subjects Carriers Carrier frequency Turin 1574 1521 53 1/29.7 Pavia 1341 1299 42 1/31.9 San Giovanni Rotondo 1561 1512 49 1/31.8 Total 4476 4332 144 1/31.1 Table 3 Detailed list of mutations detected in the Italian population Centre F508 G542X R347P 2183-AG N1303K 711+1GT 1717-1A R347H R117H 1898+1G 2789+5G W1282X R1162X I507 Other TO 33 2 1 1 5 1 1 2 3 2 2 - - - PV 27 - - 1 2 - 1 - 5 - 1 2 1 1 SGR 30 14 2 1 1 1 - - - - - - - - TO, Dipartimento di Patologia Clinica, Ospedale Infantile "Regina Margherita, Torino; PV, Istituto di Anatomia Patologica, Sezione di Anatomia Patologica, Università di Pavia, Pavia; SGR, Servizio di Genetica Medica and Divisione di Neonatologia, IRCCS Casa Sollievo della SoVerenza, San Giovanni Rotondo, Foggia. Login to comment

[hide] Pulmonary outcome in cystic fibrosis is influenced... Infect Immun. 1999 Sep;67(9):4744-50. Parad RB, Gerard CJ, Zurakowski D, Nichols DP, Pier GB
Pulmonary outcome in cystic fibrosis is influenced primarily by mucoid Pseudomonas aeruginosa infection and immune status and only modestly by genotype.
Infect Immun. 1999 Sep;67(9):4744-50., [PMID:10456926]

Abstract [show]
Whether allelic variants of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) independently contribute to pulmonary outcome in CF patients has not been resolved. We used both cross-sectional and mixed-model longitudinal analyses of data from CF patients that were at least 12 years old to determine the influence on pulmonary function (percent predicted forced expiratory volume [FEV(1)]) of the CFTR gene genotype, gender, mucoid Pseudomonas aeruginosa (MPA) infection status, presence of total opsonic antibody to MPA, and, separately, the opsonic antibody activity specific to the mucoid exopolysaccharide (MEP) surface antigen. Two different factors were independently associated with the lack of MPA infection: a high level of MEP-specific opsonic activity (MSOA), implicating an immunologically based mechanism of resistance to infection, and a lack of any type of opsonic antibody to MPA, indicative of no significant exposure or infection. This latter phenotype was found in a subset of CF patients who carried at least one uncommon CFTR gene allele suggestive of a genetic basis for resistance to infection in this group of older CF patients. For CF patients in whom both CFTR gene alleles were identified by screening for the 12 most common variants (75% of alleles), cross-sectional analysis showed that MPA infection was best correlated with lower percent predicted FEV(1), while genotype (two versus one DeltaF508 CFTR gene allele) and a low level of MSOA were associated with increased risk of infection. A mixed-model analysis of longitudinal spirometric measurements that considered multiple risk factors to derive regression equations was used to determine which clinical parameters had the greatest effect on the annual rate of decline in percent predicted FEV(1). This analysis showed that the CFTR gene genotype only modestly modified the constant (y intercept) of the derived equations, while gender and MPA infection status had the largest effects on annual rates of decline in percent predicted FEV(1). These results indicate that the CFTR genotype is usually not a primary determinant of pulmonary function in most CF patients, but gender and MPA infection status are. Infection status is potentially influenced by both immunologic (a high level of MSOA) and genetic factors, such as carriage of a CFTR gene allele that leads to a diagnosis of CF but still confers resistance to infection that is comparable to that of the wild-type CFTR gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Genomic DNA isolated from each subject was evaluated for the presence of any of twelve CFTR gene mutations (⌬F508, G551D, G542X, 621ϩ1G3T, ⌬I507, 1717-1 G3A, R117H, N1303K, W1282X, R560T, R553X, and 3849ϩ10kb C3T) by one of three standard assays (10, 11, 32). Login to comment
101 Of these 12, 9 had one ⌬F508 CFTR gene allele, but the second allele was identified for only 2 of these 9 subjects (N1303K and G542X); the remaining 7 subjects carried a second CFTR gene allele that was not among the 12 most common ones we screened for. Login to comment
118 with overall opsonic antibody titer of Ն5 26 14 Ͻ0.001 a Distribution of non-⌬F508 CFTR gene alleles in the uninfected group: G542X, 3 alleles; G551D, 1 allele; W1282X, 1 allele; N1303K, 1 allele; and not identified, 14 alleles. Login to comment

[hide] Restoration of bacterial killing activity of human... Hum Gene Ther. 1999 Aug 10;10(12):1923-30. Biffi A, Sersale G, Cassetti A, Villa A, Bordignon C, Assael BM, Conese M
Restoration of bacterial killing activity of human respiratory cystic fibrosis cells through cationic vector-mediated cystic fibrosis transmembrane conductance regulator gene transfer.
Hum Gene Ther. 1999 Aug 10;10(12):1923-30., 1999-08-10 [PMID:10466626]

Abstract [show]
In vitro and in vivo studies have demonstrated that gene transfer of the CFTR (cystic fibrosis transmembrane conductance regulator) cDNA into human respiratory cells through nonviral vectors can occur safely and can be done repeatedly. Although functional evaluation of CFTR in cystic fibrosis (CF) patients enrolled in phase I clinical trials using cationic liposomes has shown a partial correction of nasal potential difference, a biological assay indicating a therapeutic relevance of CFTR gene transfer is still missing. Our aims were to study the induction of killing activity toward Pseudomonas aeruginosa (PA) in CF cells by cationic vector-mediated CFTR gene transfer and to use this assay as a therapeutic end point. Luciferase expression and GFP FACS analysis were used to evaluate the optimal vector and the efficiency of gene transfer into non-CF human respiratory cells growing from nasal polyp explants at the air-liquid interface. To prove that transgenic CFTR was expressed in CF cell cultures under the same experimental conditions, a specific RT-PCR was performed. Challenge of the outgrowths with a known amount of PA showed a bacterial clearance activity by non-CF respiratory cells, while in the case of CF cells it even resulted in bacterial growth. Cationic vector-mediated CFTR cDNA determined the recovery of bacterial clearance activity only under those conditions yielding 5% or more of GFP-positive cells. The results shown in this study might be helpful in considering cationic vectors as therapeutic nonviral vectors for transferring CFTR into human CF respiratory cells, as well as for restoring the bacterial killing activity defective in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 The genotypes of CF polyps were D F508/D F508 (n 5 1), D F508/1717-1G R A (n 5 1), D F508/N1303K (n 5 2), and D F508/unknown (n 5 1). Login to comment

[hide] Geographic distribution of cystic fibrosis transme... Ann Trop Paediatr. 1999 Mar;19(1):69-73. Banjar H, Kambouris M, Meyer BF, al-Mehaidib A, Mogarri I
Geographic distribution of cystic fibrosis transmembrane regulator gene mutations in Saudi Arabia.
Ann Trop Paediatr. 1999 Mar;19(1):69-73., [PMID:10605524]

Abstract [show]
A descriptive study was undertaken to characterize the cystic fibrosis transmembrane regulator gene mutations (CFTR) in the Saudi Arabian cystic fibrosis (CF) population in relation to clinical presentation and demographic and ethnic origin. During the period October 1992 to September 1997, 70 patients from 46 families were diagnosed as having CF, based on a typical clinical picture and sweat chloride levels > 60 mmol/l and were screened for CFTR mutations. Twelve mutations were identified in 34 families, which constitutes 70% of the CF alleles in the study group. Pancreatic insufficiency (PI) was found in the following mutations: 1548delG in exon 10 (15%) which occurred mainly in native Saudi patients in the central province; 3120 + 1G-->A in intron 16 (10%) and H139L in exon 4 (7%), found mainly in native Saudis from the eastern province; delta F508 mutation (13%) which occurred mainly in expatriates of Middle Eastern origin from different provinces; L117X in exon 19 (2%); G115X in exon 4 (2%); 711 + 1G-->A in intron 5 (2%); N 1303K in exon 21 (2%) and 425del42 in exon 4 (1%); I1234V in exon 19 (13%) with a predominance of nasal polyps and a variable degree of PI and lung disease; R553X in exon 11 (1%), with electrolyte imbalance; and S549R in 11 (2%) with pancreatic sufficiency and minimal pulmonary disease. The clinical picture did not differ significantly between patients of different ethnic origins with the same CFTR mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 1 Sa S 1 1 N1303K/3120 1 1G® A* 1 NonSa W 1 1 R553X/31201 1G ® A* 1 NonSa W 1 1 7 Total 9 Total 9 Total Exon 19 I1234V 4/1/1 Sa C/W/S 12 13 NP Exon 21 N1303K/3120 1 1G® A* 1 NonSa W 1 1 N1303K/1548delG* 1 Sa E 1 1 2 Total 2 Total 2 Total a All mutations are homozygous except if otherwise indicated; ? Login to comment
40 CFTR mutations identi® ed 4± 11 Severe pancreatic insuf® ciency and lung disease were found in the following CFTR mutations: 1548delG was found in eight families (15% of total alleles), all native Saudis, four families from Central Province; D F508 was found in ® ve families (10%), three of non-Saudi origin from different provinces; 3120 1 1G ® A was found in seven families (9%), three being native Saudi from Eastern Province; H139L was found in three (7%) native Saudi families mainly from Eastern Province; N1303K occurred in two (2%) families and G115X in one family, 425del42, L1177X and 711 1 1G ® A were each found in one family. Login to comment

[hide] Rapid F508del and F508C assay using fluorescent hy... Genet Test. 1999;3(4):365-70. Gundry CN, Bernard PS, Herrmann MG, Reed GH, Wittwer CT
Rapid F508del and F508C assay using fluorescent hybridization probes.
Genet Test. 1999;3(4):365-70., [PMID:10627945]

Abstract [show]
Amplification and fluorescent genotyping of the cystic fibrosis F508del locus was achieved from human genomic DNA in less than 30 min. The hybridization of adjacent fluorescent probes at the mutation site was monitored by resonance energy transfer between fluorescein and Cy5 during heating or cooling. Characteristic curves were obtained for each genotype; the first derivative of these fluorescent curves has a maximum at an apparent hybridization temperature (Tm) that is specific for each probe/allele duplex. The direction and rate of temperature change determines the difference between the apparent Tm and the true equilibrium Tm. One hundred and five sample were genotyped for the F508del cystic fibrosis mutation by heating and cooling curve profiles. These genotypes were validated by allele-specific amplification. Two fluorescein hybridization probes were designed to match the wild-type sequence perfectly from either codons 502 to 513 or from 504 to 511 on the cystic fibrosis transconductance regulator gene of chromosome 7. While genotyping for the F508del, an allele with the F508C base change was detected. For both F508del and F508C variants, the Tm shift from wild type was greater with a 24-mer probe than with a 35-mer probe. Fluorescent monitoring of hybridization probes is a versatile technique that can detect unexpected sequence alterations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
149 Other clinically significant mutations (e.g., G542X, R553X, R1162X, N1303K, W1282X, G551D, G5151X, etc.) Login to comment

[hide] Partial CFTR genotyping and characterisation of cy... Clin Genet. 2000 Jan;57(1):56-60. Zebrak J, Skuza B, Pogorzelski A, Ligarska R, Kopytko E, Pawlik J, Rutkiewicz E, Witt M
Partial CFTR genotyping and characterisation of cystic fibrosis patients with myocardial fibrosis and necrosis.
Clin Genet. 2000 Jan;57(1):56-60., [PMID:10733236]

Abstract [show]
Myocardial necrosis and fibrosis is a rare complication of cystic fibrosis (CF) causing sudden and unexpected death in infancy due to cardiac arrest. Characteristic morphological lesions are recognisable postmortem. The 18 CF patients with this complication had varied clinical features including mild pulmonary involvement, early onset severe pancreatic insufficiency, and profound electrocardiogram (ECG) changes. In this group of patients, 5 were deltaF508 homozygotes, 1 was deltaF508/ N1303K and 1 was a deltaF508/M compound heterozygote. A pair of affected siblings (deltaF508 homozygotes) were fully concordant for myocardial involvement and for the general course of the disease. The co-existence of a genetic predisposition to myocardial lesions resulting most probably from severe cystic fibrosis transmembrane (CFTR) genotypes (such as deltaF508/deltaF508, deltaF508/N1303K) and deficiency of certain trophic factors necessary for metabolism of the myocardium, are postulated to cause myocardial complications in CF leading to circulatory failure and early death.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 In this group of patients, 5 were DF508 homozygotes, 1 was DF508/ N1303K and 1 was a DF508/M compound heterozygote. Login to comment
8 The co-existence of a genetic predisposition to myocardial lesions resulting most probably from severe cystic fibrosis transmembrane (CFTR) genotypes (such as DF508/DF508, DF508/N1303K) and deficiency of certain trophic factors necessary for metabolism of the myocardium, are postulated to cause myocardial complications in CF leading to circulatory failure and early death. Login to comment
58 Of 18 deceased CF patients 5 were DF508 homozygotes, 1 was a compound heterozygote DF508/N1303K and 1 was a compound heterozygote DF508/M (M - unidentified mutation). Login to comment
59 The latter was negative for 14 other mutations: DI507, 1717-1GA, G542X, G551D, R553X, R560T, 3849+10kbCT, N1303K, W1282X, S549I, S549N, 621+1GT, 2789+5GA, R117H. Login to comment
78 No correlation of myocardial complications with CFTR mutations has been performed so far and, in the literature, only one case was recognised as a DF508/M compound heterozygote, negative for R347P, G551D, R553X and N1303K as a second mutation (9). Login to comment
79 In our series 5 patients were DF508 homozygotes, 1 a DF508/N1303K and 1 a DF508/ M compound heterozygote. Login to comment
82 N1303K mutation was also classified as 'severe`, at least with regard to pancreatic involvement (29). Login to comment
95 This conclusion does not negate previous hypotheses: we rather postulate a co-existence of genetic predisposition to myocardial lesions resulting mainly from CFTR genotypes such as DF508/DF508 and DF508/N1303K which are considered 'severe`, and/ or the presence of certain modifier genes together with a deficiency of certain trophic factors necessary for myocardial metabolism. Login to comment
172 Osborne L, Santis G, Schwarz M et al. Incidence and expression of the N1303K mutation of the cystic fibrosis (CFTR) gene. Login to comment

[hide] A new approach for identifying non-pathogenic muta... Hum Genet. 2000 Feb;106(2):172-8. Bombieri C, Giorgi S, Carles S, de Cid R, Belpinati F, Tandoi C, Pallares-Ruiz N, Lazaro C, Ciminelli BM, Romey MC, Casals T, Pompei F, Gandini G, Claustres M, Estivill X, Pignatti PF, Modiano G
A new approach for identifying non-pathogenic mutations. An analysis of the cystic fibrosis transmembrane regulator gene in normal individuals.
Hum Genet. 2000 Feb;106(2):172-8., [PMID:10746558]

Abstract [show]
Given q as the global frequency of the alleles causing a disease, any allele with a frequency higher than q minus the cumulative frequency of the previously known disease-causing mutations (threshold) cannot be the cause of that disease. This principle was applied to the analysis of cystic fibrosis transmembrane conductance regulator (CFTR) mutations in order to decide whether they are the cause of cystic fibrosis. A total of 191 DNA samples from random individuals from Italy, France, and Spain were investigated by DGGE (denaturing gradient gel electrophoresis) analysis of all the coding and proximal non-coding regions of the gene. The mutations detected by DGGE were identified by sequencing. The sample size was sufficient to select essentially all mutations with a frequency of at least 0.01. A total of 46 mutations was detected, 20 of which were missense mutations. Four new mutations were identified: 1341+28 C/T, 2082 C/T, L1096R, and I11131V. Thirteen mutations (125 G/C, 875+40 A/G, TTGAn, IVS8-6 5T, IVS8-6 9T, 1525-61 A/G, M470V, 2694 T/G, 3061-65 C/A, 4002 A/G, 4521 G/A, IVS8 TG10, IVS8 TG12) were classified as non-CF-causing alleles on the basis of their frequency. The remaining mutations have a cumulative frequency far exceeding q; therefore, most of them cannot be CF-causing mutations. This is the first random survey capable of detecting all the polymorphisms of the coding sequence of a gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 Out of the 20 missense mutations, three (G85E, ∆F508, and N1303K) are certainly CF-causing, and several (R31C, K68E, R75Q, I148T, V562L, G576A-R668C, L997F, F1052V, S1235R) have been described in congenital bilateral absence of the vas deferens, in disseminated bronchiectasis, in pancreatitis, or in atypical CF cases mutations as reported in the CFGAC website (). Login to comment
80 Many (13 out of 20) of the missense mutations change highly conserved (5/5 species analyzed) amino acid residues (R75Q, G85E, I148T, I506V, R668C, G622D, L997F, I1027T, F1052V, L1096R, I1131V, R1162L, N1303K); others affect amino acid residues conserved in 4/5 species (K68 E, R170H, M470V, V562L, S1235R), or in 3/5 species (R31C and G576A; Tucker et al. 1992). Login to comment
88 In three further cases where more than one sporadic mutation was observed in the same individual (1341+28 C/T and F1052V and S1235R; ∆F508 and I1027T; 1716G/A and N1303K), data from the literature were not available, and segregation analysis was not possible; thus, their phase could not be established. Login to comment
91 The remaining 30 (after having excluded the certainly CF-causing mutations G85E, ∆F508 and N1303K) have been found a few times only: once (20 mutations), twice (five mutations), three times (three mutations), four times (one mutation), and eight times (one mutation). Login to comment

[hide] CFTR gene mutations and male infertility. Andrologia. 2000 Mar;32(2):71-83. Stuhrmann M, Dork T
CFTR gene mutations and male infertility.
Andrologia. 2000 Mar;32(2):71-83., [PMID:10755189]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are a relatively frequent cause of male infertility. Depending on their molecular consequences, CFTR mutations may either result in typical cystic fibrosis (CF), one of the most common autosomal recessive disorders, which is characterized by chronic lung disease, pancreatic exocrine insufficiency, an increase in the concentration of sweat electrolytes and male infertility, due to obstructive azoospermia, or in atypical (often monosymptomatic) forms of CF such as congenital absence of the vas deferens (bi- or unilateral), bilateral ejaculatory duct obstruction or bilateral obstructions within the epididymides. All males with idiopathic obstructive azoospermia bear an increased risk for CF offspring. Couples requesting microsurgical epididymal sperm aspiration and in vitro fertilization, e.g. intracytoplasmic sperm injection, should be offered genetic counselling and molecular genetic analysis of the CFTR gene, if male infertility due to obstructive azoospermia is the underlying cause.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 Most patients are of German origin CFTR genotype (mutation class in brackets) Patients with typical CF (%) Patients with CBAVD (%) DF508 (2)/DF508 (2) 247 (59.4) 0 DF508 (2)/N1303K (2) 17 (4.1) 0 DF508 (2)/R347P (4) 13 (3.1) 0 DF508 (2)/R553X (1) 11 (2.6) 0 DF508 (2)/G542X (1) 11 (2.6) 0 DF508 (2)/G551D (3) 11 (2.6) 0 DF508 (2)/R1162X (1) 10 (2.4) 0 DF508 (2)/3849+10 KbC T (5) 9 (2.2) 0 DF508 (2)/2789+5G A (5) 9 (2.2) 0 DF508 (2)/3272-26 A G (5) 7 (1.7) 2 (2.6) DF508 (2)/1717-1G A (1) 6 (1.4) 0 DF508 (2)/CFTRdel21Kb (1) 5 (1.2) 0 DF508 (2)/R117H (4) 3 (0.7) 21 (26.9)* DF508 (2)/IVS8-5T (5) 2 (0.5) 9 (11.5)* DF508 (2)/other 33 (7.9) 20 (25.6) Other/other 22 (5.3) 26 (33.3) *Including one CUAVD patient each. Login to comment
122 In this subgroup, eight out of nine patients In summary, CFTR mutations are the molecu- had one of the following mutations detected on lar cause for a variety of different forms of male one of their two CFTR alleles: DF508 (n=4), infertility due to obstructive azoospermia, ranging R117H (n=2), G551D (n=1) and N1303K (n=1) from CBAVD and CUAVD with contralateral (Mickle et al., 1995). Login to comment

[hide] A novel mutation in the CFTR gene correlates with ... J Med Genet. 2000 Mar;37(3):215-8. Wang J, Bowman MC, Hsu E, Wertz K, Wong LJ
A novel mutation in the CFTR gene correlates with severe clinical phenotype in seven Hispanic patients.
J Med Genet. 2000 Mar;37(3):215-8., [PMID:10777364]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
320 Since ATP hydrolysis at NBD2 terminates a burst of activities associated with opening the channel, loss of NBD2 would confer a loss of the gating control.21 A recent study shows that the Walker A motif in NBD2 is more solvent accessible than that in NBD1, suggesting a diVerence in structure and function for the two NBDs.22 In addition to 3876delA, a few other mutations in NBD2, including G1244E, S1255P, S1255X, 3905insT, W1282X, N1303K, and G1349D, all result in a PI phenotype.5 23 It should be noted that S1255P, S1255X, 3905insT, and 3876delA are all clustered around the Walker A motif. Login to comment
570 SYLVAIN R RIVARD* CHRISTIAN ALLARD† JEAN-PIERRE LEBLANC† MARCEL MILOT† GERVAIS AUBIN† FERNAND SIMARD† CLAUDE FÉREC‡ MARC DE BRAEKELEER†§¶ *Département des Sciences Fondamentales, Université du Québec à Chicoutimi, Canada Table 1 Distribution of cystic fibrosis patients diagnosed before the age of 5 by age groups in Saguenay-Lac-Saint-Jean, (A) by genotype, (B) by mutation 0-10 years 10.1-20 years Over 20 years All ages No % No % No % No % (A) Genotype F508/ F508 15 (1) 40.5 21 (2) 36.2 18 (3) 42.9 54 (6) 39.4 F508/621+1G→T 12 (1) 32.4 16 (1) 27.6 10 (1*) 23.8 38 (3*) 27.7 F508/A455E 1 2.7 6 10.3 5 11.9 12 8.8 F508/I148T 1 2.7 1 1.7 2 1.5 F508/Y1092X 3 (1) 5.2 1 2.4 4 (1) 2.9 F508/Q890X 1 2.4 1 0.7 F508/R1158X 1 2.4 1 0.7 621+1G→T/621+1G→T 2 (1) 5.4 4 6.9 1 2.4 7 (1) 5.1 621+1G→T/A455E 1 2.7 4 6.9 3 7.1 8 5.8 621+1G→T/711+1G→T 2 (1) 5.4 2 (1) 3.4 4 (2) 2.9 621+1G→T/Y1092X 1 2.7 1 0.7 621+1G→T/S489X 1 2.7 1 0.7 621+1G→T/G85E 1 (1) 1.7 1 (1) 2.4 2 (2) 1.5 A455E/R117C 1 2.7 1 0.7 N1303K/I148T 1 2.4 1 0.7 Total 37 58 42 137 Death (4) 10.8 (6) 10.3 (5*) 11.9 (15*) 10.9 (B) Mutation F508 16 (1) 43.2 25 (3) 43.1 21 (3) 51.2 62 (7) 45.6 621+1G→T 18 (3) 48.6 23 (3) 39.7 12 (2*) 29.3 53 (8*) 39.0 A455E 3 8.1 10 17.2 8 19.5 21 15.4 Total 37 58 41 136 Death (4) 10.8 (6) 10.3 (5*) (12.2) (15*) (11.0) ( ): Number of deaths. Login to comment

[hide] Molecular analysis in Brazilian cystic fibrosis pa... Genet Test. 2000;4(1):69-74. Bernardino AL, Ferri A, Passos-Bueno MR, Kim CE, Nakaie CM, Gomes CE, Damaceno N, Zatz M
Molecular analysis in Brazilian cystic fibrosis patients reveals five novel mutations.
Genet Test. 2000;4(1):69-74., [PMID:10794365]

Abstract [show]
We have performed molecular genetic analyses on 160 Brazilian patients diagnosed with cystic fibrosis (CF). Screening of mutations in 320 CF chromosomes was performed through single strand conformation polymorphism (SSCP) and heteroduplex analyses assay followed by DNA sequencing of the 27 exons and exon/intron boundaries of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The frequency of CFTR variants of T-tract length of intron 8 (IVS8 Tn) was also investigated. This analysis enabled the detection of 232/320 CF mutations (72.2%) and complete genotyping of 61% of the patients. The deltaF508 mutation was found in 48.4% of the alleles. Another fifteen mutations (previously reported) were detected: G542X, R1162X, N1303K, R334W, W1282X, G58E, L206W, R553X, 621+1G-->T, V232D, 1717-1G-->A, 2347 delG, R851L, 2789+5G-->A, and W1089X. Five novel mutations were identified, V201M (exon 6a), Y275X (exon 6b), 2686 insT (exon 14a), 3171 delC (exon 17a), and 3617 delGA (exon 19). These results contribute to the molecular characterization of CF in the Brazilian population. In addition, the identification of the novel mutation Y275X allowed prenatal diagnosis in a high-risk fetus.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Another fifteen mutations (previously reported) were detected: G542X, R1162X, N1303K, R334W, W1282X, G58E, L206W, R553X, 6211 1GRT, V232D, 1717-1GRA, 2347 delG, R851L, 27891 5GRA, and W1089X. Login to comment
51 The next most common mutations were: G542X (8.8%), R1162X (2.5%), N1303K (2.5%), R334W (2.5%), W1282X (1.3%), G58E (1.3%), L206W (0.6%), and R553X (0.6%). Login to comment
81 In this study, 16 mutations were identified: D F508, G542X, R1162X, N1303K, R334W, W1282X, G58E, L206W, R553X, 6211 1GRT, V232D, 1717-1GRA, 2347 delG, R851L, 27891 5GRA, and W1089X. Login to comment
84 GEN OTYPES, FREQUENCIES, AN D PRESENCE OF PI FRO M 160 CF PATIE NTS (320 CF CHROM OSOM ES) Number and frequency (%) Genotype Number Frequency (%) of patients with PI D F508/D F508 47 29.40 47 (100%) D F508/G542X 13 8.10 13 (100%) D F508/R1162X 6 3.80 6 (100%) D F508/R334W 5 3.10 3 (60%) D F508/N1303K 3 1.90 3 (100%) D F508/W1282X 2 1.20 2 (100%) D F508/G58E 2 1.20 1 (50%) D F508/L206W 1 0.62 0 D F508/R553X 1 0.62 1 (100%) D F508/R851L 1 0.62 0 D F508/2789 1 5g ® A 1 0.62 0 D F508/3617delGA 1 0.62 1 (100%) D F508/3171delC 1 0.62 1 (100%) D F508/2686insT 1 0.62 1 (100%) D F508/Y275X 1 0.62 1 (100%) D F508/U 22 13.80 14 (64%) G542X/G542X 3 1.90 3 (100%) G542X/N1303K 3 1.90 2 (67%) G542X/R1162X 1 0.62 1 (100%) G542X/U 5 3.10 4 (80%) N1303K/R1162X 1 0.62 1 (100%) N1303K/G58E 1 0.62 0 2347delG/2347delG 1 0.62 1 (100%) R334W/V232D 1 0.62 0 R334W/W1089X 1 0.62 1 (100%) R334W/U 1 0.62 1 (100%) W1282X/U 1 0.62 1 (100%) G58E/U 1 0.62 1 (100%) R553X/U 1 0.62 1 (100%) L206W/U 1 0.62 0 621 1 1G ® T/U 1 0.62 1 (100%) 1717-1G ® A/U 1 0.62 Not known V201M/U 1 0.62 0 U/U 27 16.90 12 (44%) Total 160 100 - U, Unknown CF mutation. Login to comment
89 Two other mutations-N1303K (2.5%) and R1162X (2.5%)-were also found in frequencies compatible with the ethnic origins of our Caucasian population. Login to comment
90 The N1303K mutation has been reported in Southern Europeans as the fourth most common mutation, with a frequency of 3.2% (Nunes et al., 1991), and the R1162X mutation is the second most frequent mutation in Northern Italy (about 10%) (Casals et al., 1993). Login to comment
104 However, one of our compound heterozygote patients for severe mutations (N1303K/G542X), has PS. Login to comment
110 Unexpectedly, however one compound heterozygote (N1303K/G542X) CF patients (who was referred to above as having PS) was the son of first cousins, which is compatible with the high frequency of CFTR heterozygotes in the population. Login to comment

[hide] Spectrum of CFTR mutations in Mexican cystic fibro... Hum Genet. 2000 Mar;106(3):360-5. Orozco L, Velazquez R, Zielenski J, Tsui LC, Chavez M, Lezana JL, Saldana Y, Hernandez E, Carnevale A
Spectrum of CFTR mutations in Mexican cystic fibrosis patients: identification of five novel mutations (W1098C, 846delT, P750L, 4160insGGGG and 297-1G-->A).
Hum Genet. 2000 Mar;106(3):360-5., [PMID:10798368]

Abstract [show]
We have analyzed 97 CF unrelated Mexican families for mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Our initial screening for 12 selected CFTR mutations led to mutation detection in 56.66% of the tested chromosomes. In patients with at least one unknown mutation after preliminary screening, an extensive analysis of the CFTR gene by single stranded conformation polymorphism (SSCP) or by multiplex heteroduplex (mHET) analysis was performed. A total of 34 different mutations representing 74.58% of the CF chromosomes were identified, including five novel CFTR mutations: W1098C, P750L, 846delT, 4160insGGGG and 297-1G-->A. The level of detection of the CF mutations in Mexico is still lower than that observed in other populations with a relatively low frequency of the deltaF508 mutation, mainly from southern Europe. The CFTR gene analysis described here clearly demonstrated the high heterogeneity of our CF population, which could be explained by the complex ethnic composition of the Mexican population, in particular by the strong impact of the genetic pool from southern European countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 Detection of known mutations ∆F508, G542X, N1303K, ∆I507 and 2869insG were screened by PCR-mediated site directed mutagenesis (PSM) as previously described (Friedman et al. 1991). Login to comment
41 The second most common mutation was G542X, present in 6.1% of CF chromosomes, followed by ∆I507 and S549N (each 2.5%), N1303K (2.06%) and 2055del→A (1.03%). Login to comment
69 First, we tested these patients for 12 mutations selected for the following reasons: five are the most common mutations worldwide (∆F508, G542X, N1303K, G551D and R553X; CFGAC 1994); 362 Table 1 Frequency of the CFTR gene mutations in 97 (194 chromosomes) Mexican patients Mutation Number of Frequency affected alleles (%) ∆F508 79 40.72 G542X 12 6.18 ∆I507 5 2.57 S549N 5 2.57 N1303K 4 2.06 R75X 3 1.54 406-1G→A 3 1.54 I148T 3 1.54 2055del9→A 2 1.03 935delA 2 1.03 I506T 2 1.03 3199del6 2 1.03 2183AA→G 2 1.03 G551D 1 0.51 R553X 1 0.51 1924del7 1 0.51 G551S 1 0.51 1078delT 1 0.51 Y1092X 1 0.51 R117H 1 0.51 G85E 1 0.51 3849+10KbC→T 1 0.51 1716G→A 1 0.51 W1204X 1 0.51 W1098Ca 1 0.51 846delTa 1 0.51 P750La 1 0.51 V754M 1 0.51 R75Q 1 0.51 W1069X 1 0.51 L558S 1 0.51 4160insGGGGa 1 0.51 297-1G→Aa 1 0.51 H199Y 1 0.51 2869insG 0 0 R1162X 0 0 3120+1G→A 0 0 Total 34 145 74.58% aNovel mutations detected in this study Fig.1 Sequencing ladders showing the CFTR novel mutations. Login to comment

[hide] Identification of novel mutations in Arabs with cy... Eur J Pediatr. 2000 May;159(5):303-9. Kambouris M, Banjar H, Moggari I, Nazer H, Al-Hamed M, Meyer BF
Identification of novel mutations in Arabs with cystic fibrosis and their impact on the cystic fibrosis transmembrane regulator mutation detection rate in Arab populations.
Eur J Pediatr. 2000 May;159(5):303-9., [PMID:10834512]

Abstract [show]
The cystic fibrosis transmembrane regulator (CFTR) gene in Arab patients with cystic fibrosis (CF) (sweat chloride > 60 mmol/l) from 61 unrelated families was screened for mutations in exons 3, 4, 5, 7, 10, 11, 16 and 19 and for mutations W1282X, N1303K and 3,849 + 10kbC --> T. Eight novel mutations were identified. These are: in exon 4: a) 425del42 (an in-frame 42 bp deletion that removes 14 amino acids and causes Gln98 --> His at the point of deletion), b) 475G --> T (Glu115 --> Stop) and c) 548A --> T (His139 --> Leu); in intron 5,711 + 1G --> A (splice site mutation); in exon 10, 1548delG (deletion of a "G" nucleotide causing a frameshift mutation that alters the amino acid sequence at residue 473 and results in translation termination at residue 526); in exon 11, a) 1729T --> C (Ph533E --> Leu) and b) 1,811 + 2 (splice site mutation) and finally in exon 19,3361A --> T (Lys1177 --> Stop). All mutations were detected by heteroduplex analysis and identified by sequencing. Of more than 850 known CFTR mutations, only 9 were encountered. The comparative frequencies of the most common mutations are: 1548delG> 1123V = deltaF508 = 3,120 + 1G --> A > H139L. Screening for these five mutations identifies 60% of the CF alleles in Arab populations. The novel mutation 1548delG is the most frequent (17%) among Arabs. CONCLUSION: Novel Arab-specific mutations were identified in the CFTR gene underlying cystic fibrosis. As a result of this study, the CFTR mutation detection rate among Arabs with cystic fibrosis is now comparable to that of other populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 ORIGINAL PAPER M. Kambouris á H. Banjar á I. Moggari á H. Nazer á M. Al-Hamed á B. F. Meyer Identi®cation of novel mutations in Arabs with cystic ®brosis and their impact on the cystic ®brosis transmembrane regulator mutation detection rate in Arab populations Received: 18 December 1998 / Accepted: 14 May 1999 Abstract The cystic ®brosis transmembrane regulator (CFTR) gene in Arab patients with cystic ®brosis (CF) (sweat chloride >60 mmol/l) from 61 unrelated families was screened for mutations in exons 3, 4, 5, 7, 10, 11, 16 and 19 and for mutations W1282X, N1303K and 3849 + 10kbC ® T. Login to comment
43 Mutation analysis All patients were screened for known mutations 3849 + 10KbC ® T (intron 19), W1282X (exon 20) and N1303K (exon 21) by restriction enzyme digestion analysis with enzymes Mnl I, Bst OI and Hph I respectively according to standard protocols [23]. Login to comment
63 Of more than 850 known CFTR mutations (http:// www.genet.sickkids.on.ca/cftr-cgi-bin/Mutation Table), only 9 were encountered in this study: R75X, A141D, 1249G ® A, DF508, S549R, R553X, 3120 + 1G ® A, I1234V and N1303K. Login to comment
93 In that study, three mutations, DF508 (37.5%), W1282X (15.6%), and N1303K (9.4%) collectively accounted for 62.5% of the CF alleles. Login to comment
100 This is highlighted by the absence of families with the DF508 mutation which is present in 13% of our study group including Saudi Arabs. The study lists only three common mutations among Arab: the ®rst (3120 + 1A ® G) was found in three families while the other two (N1303K and 1548delG), in only two families. Login to comment
111 1 (private mutation) Exon 10 1548delG Frame shift 8 16 Altered residues at aa 473; stop codon at 526 1a [R75X] 1 1a [1811 + 2 T ® C] 1 1a [N1303K] 1 2a [?] Login to comment
114 1 (private mutation) 1779T ® G S549R 1 2 1a [H139L] 1 Total: 2 2.5% 1789C ® T R553X ± protein truncation 1a [3120 + 1G ® A] 1 (private mutation) 1811 + 2T ® C Splice site 1a [1548delG] 1 (private mutation) Exon 16 3120 + 1G ® A Splice site 5 10 1a [R533X] 1 1a [N1303K] 1 1a [?] Login to comment
115 1 Total: 8 11% Exon 19 3661A ® T K1177X ± protein truncation 1 2 (private mutation) 3832A ® G I1234V 7 14 1a [G115X] 1 Total: 8 12.5% Exon 21 4041C ® G N1303K 1a [1548delG] 1 1a [3120 + 1G ® A] 1 Total: 2 1.5% Undetected 11 22 1a [425del42] 1 1a [711 + 1G ® A] 1 2a [1548delG] 2 2a [DF508] 2 1a [F533L] 1 1a [1249 + 1G ® A] 1 1a [3120 + 1G ® A] 1 Total: 20 25% a Indicates a compound heterozygous family. Login to comment

[hide] Heterogeneity for mutations in the CFTR gene and c... Hum Reprod. 2000 Jul;15(7):1476-83. Casals T, Bassas L, Egozcue S, Ramos MD, Gimenez J, Segura A, Garcia F, Carrera M, Larriba S, Sarquella J, Estivill X
Heterogeneity for mutations in the CFTR gene and clinical correlations in patients with congenital absence of the vas deferens.
Hum Reprod. 2000 Jul;15(7):1476-83., [PMID:10875853]

Abstract [show]
Congenital absence of the vas deferens (CAVD) is a heterogeneous disorder, largely due to mutations in the cystic fibrosis (CFTR) gene. Patients with unilateral absence of the vas deferens (CUAVD) and patients with CAVD in association with renal agenesis appear to have a different aetiology to those with isolated CAVD. We have studied 134 Spanish CAVD patients [110 congenital bilateral absence of the vas deferens (CBAVD) and 24 CUAVD], 16 of whom (six CBAVD, 10 CUAVD) had additional renal anomalies. Forty-two different CFTR mutations were identified, seven of them being novel. Some 45% of the CFTR mutations were specific to CAVD, and were not found in patients with cystic fibrosis or in the general Spanish population. CFTR mutations were detected in 85% of CBAVD patients and in 38% of those with CUAVD. Among those patients with renal anomalies, 31% carried one CFTR mutation. Anomalies in seminal vesicles and ejaculatory ducts were common in patients with CAVD. The prevalence of cryptorchidism and inguinal hernia appeared to be increased in CAVD patients, as well as nasal pathology and frequent respiratory infections. This study confirms the molecular heterogeneity of CFTR mutations in CAVD, and emphasizes the importance of an extensive CFTR analysis in these patients. In contrast with previous studies, this report suggests that CFTR might have a role in urogenital anomalies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
104 In a small group of G85E/- 7T/7T 1 patients, alpha-glucosidase activity was 18.5 Ϯ 2.7 mU/ml in 2752-15C→G/- 7T/7T 1 CUAVD (n ϭ 4), and 26.7 Ϯ 5.5 mU/ml in CBAVD (n ϭ 7).L997F/-a 7T/7T 1 1677delTA/- 7T/7T 1 After reclassification of the patients according to the presence Y1014C/- 7T/9T 1 of zero, one or two mutations, none of the variables showed N1303K/- 7T/9T 1 significant differences either in CUAVD or CBAVD (notNegative CFTR mutation 16 (15) -/- 7T/7T 12 (11) shown). Login to comment

[hide] Fetal bowel hyperechogenicity may indicate mild at... J Med Genet. 2000 Aug;37(8):E15. Abramowicz MJ, Dessars B, Sevens C, Goossens M, Girodon-Boulandet E
Fetal bowel hyperechogenicity may indicate mild atypical cystic fibrosis: a case associated with a complex CFTR allele.
J Med Genet. 2000 Aug;37(8):E15., [PMID:10922395]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
14 The N1303K mutation was found in the fetus and the father and no mutation was found on the maternal allele or in the mother. Login to comment
17 The routine DNA analysis showed the presence of the paternal N1303K mutation in both the younger and the older brother. Login to comment
25 The two brothers and fetus are compound heterozygotes for the N1303K mutation and the complex CFTR allele D443Y-G576A-R668C. Login to comment
29 N1303K N D443Y G576A R668C N D443Y G576A R668C N1303K D443Y G576A R668C N1303K D443Y G576A R668C N1303K Electronic letter of 3 www.jmedgenet.com a regular basis and propose the following approach. Login to comment

[hide] Distribution of CFTR gene mutations in cystic fibr... J Med Genet. 2000 Aug;37(8):E16. Teder M, Klaassen T, Oitmaa E, Kaasik K, Metspalu A
Distribution of CFTR gene mutations in cystic fibrosis patients from Estonia.
J Med Genet. 2000 Aug;37(8):E16., [PMID:10922396]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 First, several known mutations were tested directly by the heteroduplex analysis (HA; F508, 394delTT, polyT variants in IVS8), restriction digestion (RD; G551D, R553X, 1811+1.6kbA→G, L206W, 3849+10kbC→T), and amplification refractory mutation system (ARMS, kits from Cellmark Diagnostics, UK; G542X, 621+1G→T, N1303K). Login to comment
66 This is the second most frequent mutation in several Nordic populations, with a relative frequency of 1.9% in Denmark,2 3.2% in Flanders,32 6.5% in Sweden,2 2.2-5.5% in Norway,2 and 30% in Finland.3 It was also found on 1.5% of the CF chromosomes in Russia.32 We did not find any of the mutations more common in European populations, such as G542X (2.6%), N1303K (1.6%), G551D (1.5%), or W1282X (1.0%),4 which is not surprising, as the relative frequency of these mutations is less than 1% in Nordic countries also. Login to comment

[hide] The geographic distribution of cystic fibrosis mut... Eur J Pediatr. 2000 Jul;159(7):496-9. Dawson KP, Frossard PM
The geographic distribution of cystic fibrosis mutations gives clues about population origins.
Eur J Pediatr. 2000 Jul;159(7):496-9., [PMID:10923221]

Abstract [show]
Information regarding three of the more common cystic fibrosis mutations is presented (delta F508, G542X, N13031K) to support the concept of a geography associated with cystic fibrosis mutations. We present the hypothesis that a knowledge of the geography of cystic fibrosis mutations is important for an understanding of genotype-phenotype correlations, gene flow, historical population migration and cystic fibrosis screening. CONCLUSION: A new method of study of mankind's cultural spread is being revealed and the survival of the various mutations supports the concept that they may provide a selective advantage to the carrier.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
12 Eur J Pediatr (2000) 159: 496±499 Ó Springer-Verlag 2000 K. P. Dawson (&) Department of Paediatrics, Faculty of Medicine and Health Sciences, UAE University, PO Box 17666, Al Ain, United Arab Emirates P. M. Frossard Department of Pathology, Faculty of Medicine and Health Sciences, UAE University, PO Box 17666, Al Ain, United Arab Emirates We present here population genetics data that has been gathered about the DF508 mutation and information with regards to two other common mutations, namely G542X and N1303K. Login to comment
58 The frequency of the N1303K allele varies signi®cantly between countries and ethnic groups. Login to comment
113 Osborne L, Santis G, Schwarz M, Osborne L, Santis G, Schwarz M, Klinger K, DoÈ rk T, McIntosh I, Schwartz M, Nunes V, Macek Jr. M, Reiss J, Highsmith Jr. WE, McMahon R, Novelli G, Malik N, BuÈ rger J, Anvret M, Wallace A, Williams C, Mathew C, Rozen R, Graham C, Gasparini P, Bal J, Cassiman JJ, Balassopoulou A, Davidow L, Raskin S, Kalaydjieva L, Kerem B, Richards S, Simon-Bouy B, Super M, Wulbrand U, Keston M, Estivill X, Vavrova V, Friedman KJ, Barton D, Dallapiccola B, Stuhrmann M, Beards F, Hill AJM, Pignatti PF, Cuppens H, Angelicheva D, TuÈ mmler B, Brock DJH, Casals T, Macek M, Schmidtke J, Magee AC, Bonizzato A, DeBoeck C, Kuardjieva A, Hodson M, Knight RA (1992) Incidence and expression of the N1303K mutation of the cystic ®brosis (CFTR) gene. Login to comment

[hide] Safety and biological efficacy of a lipid-CFTR com... Mol Ther. 2000 Jan;1(1):105-14. Noone PG, Hohneker KW, Zhou Z, Johnson LG, Foy C, Gipson C, Jones K, Noah TL, Leigh MW, Schwartzbach C, Efthimiou J, Pearlman R, Boucher RC, Knowles MR
Safety and biological efficacy of a lipid-CFTR complex for gene transfer in the nasal epithelium of adult patients with cystic fibrosis.
Mol Ther. 2000 Jan;1(1):105-14., [PMID:10933918]

Abstract [show]
Gene transfer is an attractive option to treat the basic defect in cystic fibrosis. In a double-blind, placebo-controlled, rising-dose tolerance study in the nasal epithelium, we tested the safety and efficacy of a cationic liposome [p-ethyl-dimyristoylphosphadityl choline (EDMPC) cholesterol] complexed with an expression plasmid containing hCFTR cDNA. Eleven adult CF patients were studied in a protocol that allowed comparisons within individual subjects: vector and placebo were sprayed into alternate nostrils at intervals over 7 h. After dosing, vector-specific DNA was present in nasal lavage of all subjects for up to 10 days. There were no adverse events. The vector-treated epithelium did not exhibit a significant increase in CFTR-mediated Cl- conductance from baseline and was not different from the placebo-treated nostril: mean deltaCFTR Cl- conductance, mV +/- SEM, -1.6+/-0.4 vs -0.6+/-0.4, respectively. CFTR-mediated Cl- conductance increased toward normal during repetitive nasal potential difference measurements over the 3 days before dosing which influenced the postdosing calculations. No vector-specific mRNA was detected in the nasal epithelial scrape biopsies, although endogenous CFTR mRNA was detected in all subjects. We conclude that the lipid-DNA complex is safe, but did not produce consistent evidence of gene transfer to the nasal epithelium by physiologic or molecular measures.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 A nasal scrape biopsy was done TABLE 1 Study Subjects Who Completed the Protocol Subject Age (years) Gender Genotype FEV1 (% pred)a 1 19 Male ⌬F 508/2183delAA-G 101 2 37 Female ⌬F 508/⌬F 508 48 3 35 Female ⌬F 508/⌬F 508 74 4 24 Male ⌬F 508/711 ϩ 1 G Ͼ T 69 5 19 Male ⌬F 508/2183delAA-G 103 6 43 Female ⌬F 508/⌬F 508 55 7 48 Male ⌬F 508/N1303K 48 8 26 Female ⌬F 508/⌬F 508 80 9 28 Male ⌬F 508/⌬F 508 53 10 29 Female ⌬F 508/⌬F 508 42 11 37 Female ⌬F 508/unknown 115 a Subjects were required to have an FEV1 greater than 40% predicted, basal PD Ͼ -30 mV, with absent CFTR-mediated Cl- con- ductance. on days 3 (along the medial surface of the inferior turbinate) and 5 (under the inferior turbinate) and optionally on days 9 Ϯ 2 and 28 Ϯ 2. Login to comment

[hide] Future pharmacological treatment of cystic fibrosi... Respiration. 2000;67(4):351-7. Zeitlin PL
Future pharmacological treatment of cystic fibrosis.
Respiration. 2000;67(4):351-7., [PMID:10940786]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disorder that is caused by over 850 different mutations in the CF gene. It is useful to group these mutations according to the defect that results in the CFTR mRNA or protein. New pharmacological treatments targeted towards specific mutations that are relatively common are being developed. Class I mutations do not produce CFTR protein because of a premature stop signal in the CFTR DNA. These null mutations can be corrected by certain aminoglycosides which cause the aberrant stop signal to be skipped. Mutations leading to a CFTR protein that attains an unstable structure shortly after translation in the endoplasmic reticulum form class II. Class II mutations can be restored to the protein trafficking pathway by manipulation of chaperone protein/CFTR interactions with chemical chaperones or drugs that affect gene regulation such as the butyrates. Production of a CFTR with reduced Cl(-) transport on the basis of abnormal regulation of the chloride channel is the basis of class III. Genistein can overcome this block in regulation. Mutations that partially reduce chloride conductance through CFTR (class IV) can be stimulated with milrinone, which is a phosphodiesterase inhibitor. Finally, mutations that lead to a severe reduction in normal CFTR protein form class V. Increased levels of CFTR could be generated with the butyrates or supplemented with gene therapy. Although most of the reported mutations in CFTR are rare and unclassified, it may be possible to use genotype-phenotype correlations to determine the best approach.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 Examples of CFTR mutations organized by classification of the defect in CFTR biosynthesis Type Genotype Phenotype Defect Cell diagram Drugs that may improve phenotype G542X 621+1 G → T 3905insT W1282X R553X 1717-1 G → A PI no CFTR protein no cell surface chloride transport gentamicin G418 Class II [64] 'F508 N1303K (P574H)a (A455E)a PI defective CFTR processing defective CFTR trafficking no cell surface chloride transport chemical chaperones CPX phenylbutyrate deoxyspergualin Class III [64] G551D G551S PI defective chloride channel regulation reduced or absent cell surface chloride transport genistein pyrophosphate Class IV [64, 66] R117H R334W G314E R347P ('F508)a P574H PS reduced chloride conductance reduced levels of cell surface chloride transport genistein milrinone phenylbutyrate Class V [64] 3849+10 kb C → T 2789+5 G → A 3272-26 A → G A455E 3120+1 G → A 1811+1.6 kb A → G 5Tb PS normal CFTR channels reduced numbers of normal CFTR reduced cell surface chloride transport genistein milrinone phenylbutyrate a Some mutants have features of more than one class of defect. Login to comment

[hide] Mutations of the cystic fibrosis gene, but not cat... Am J Gastroenterol. 2000 Aug;95(8):2061-7. Ockenga J, Stuhrmann M, Ballmann M, Teich N, Keim V, Dork T, Manns MP
Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.
Am J Gastroenterol. 2000 Aug;95(8):2061-7., [PMID:10950058]

Abstract [show]
OBJECTIVE: We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. METHODS: Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). RESULTS: No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CONCLUSIONS: CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Using the ARMS technology (elucigene CF20, Zeneca Diagnostics, Oxfordshire, UK) all samples were tested additionally for the mutations E60X, R347P, A455E, 1078delT, 2183AA3G, G542X, G551D, N1303K, W1282X, 1717-1G3A, R553X, 621ϩ1G3T, R117H, R1162X, 3849ϩ10kbC3T, R334W, S1251N, and 3659delC. Login to comment

[hide] Effect of genistein on native epithelial tissue fr... Br J Pharmacol. 2000 Aug;130(8):1884-92. Mall M, Wissner A, Seydewitz HH, Hubner M, Kuehr J, Brandis M, Greger R, Kunzelmann K
Effect of genistein on native epithelial tissue from normal individuals and CF patients and on ion channels expressed in Xenopus oocytes.
Br J Pharmacol. 2000 Aug;130(8):1884-92., [PMID:10952679]

Abstract [show]
The flavonoid genistein has been shown to activate a Cl(-) conductance in various cell types expressing CFTR. We examined if similar effects can be observed when genistein is applied to native ex vivo tissues from human respiratory tract and rectum. We further compared the effects when genistein was applied to oocytes of Xenopus laevis expressing CFTR. In oocytes, both wtCFTR and DeltaF508-CFTR were activated by genistein while both cyclic AMP (K(v)LQT1) and Ca(2+) (SK4) activated K(+) channels were inhibited at high concentrations of genistein. Biopsies from nasal polyps and rectal mucosa were obtained from normal individuals (non-CF) and CF patients and in the presence of amiloride (10 micromol l(-1); mucosal side) the effects of genistein were assessed using a perfused Ussing chamber. In non-CF airway epithelia, genistein (50 micromol l(-1); mucosal side) increased lumen negative I(sc) but had no additional effects on tissues pre-stimulated with IBMX and forskolin (100 micromol l(-1) and 1 micromol l(-1); both sides). In non-CF rectal biopsies, in the presence of amiloride (10 micromol l(-1); mucosal side) and indomethacin (10 micromol l(-1); basolateral side), genistein increased lumen negative I(sc) and enabled cholinergic (carbachol; CCH, 100 micromol l(-1); basolateral side) stimulation of Cl(-) secretion indicating activation of luminal CFTR Cl(-) channels. However, after stimulation with IBMX/forskolin, genistein induced opposite effects and significantly inhibited CCH activated I(sc). In CF airway and intestinal tissues genistein failed to induce Cl(-) secretion. Thus, genistein is able to activate luminal CFTR Cl(-) conductance in non-CF tissues and mutant CFTR in oocytes. However, additional inhibitory effects on basolateral K(+) conductance and missing effects in native CF tissues do not support the use for pharmacological intervention in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Eight CF patients presenting with nasal polyps were tested for six common mutations: DF508, R553X, N1303K, G542X, G551D and R347P. Login to comment
30 In all CF patients from whom rectal biopsies were studied DNA analysis was carried out for the following CFTR mutations: DF508; R117H and S108F in exon 4; R347P, R347H, I336K and T338I in exon 7; S549N, G551D, R553X, G542X, Q552X, 1717-1 G?A in exon 11; W1282X and 3905insT in exon 20; N1303K in exon 21 and 3849+10kB C?T in intron 19. Login to comment
31 Screening for these mutations identi®ed the genotypes as follows: DF508/DF508 (n=2); DF508/R553X (n=3); DF508/N1303K (n=1); DF508/3905insT (n=1); DF508/7(n=5) (7=mutation not identi®ed). Login to comment
224 In the present study we examined the eect of genistein on tissues derived from CF patients carrying DF508 CFTR on at least one allele and some patients were shown to be compound heterozygous with a second severe mutation (R553X, N1303K, 3905insT, G551D). Login to comment

[hide] Prenatal detection by real-time quantitative PCR a... Clin Chem. 2000 Sep;46(9):1417-20. Costes B, Girodon E, Vidaud D, Flori E, Ardalan A, Conteville P, Fanen P, Niel F, Vidaud M, Goossens M
Prenatal detection by real-time quantitative PCR and characterization of a new CFTR deletion, 3600+15kbdel5.3kb (or CFTRdele19).
Clin Chem. 2000 Sep;46(9):1417-20., [PMID:10973878]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The mutations tested were S549N, S549R, R553X, G551D, V520F, ⌬I507, ⌬F508, Q493X, 1717-1G3A, G542X, R560T, R347P, R347H, 3849ϩ4A3G, W1282X, R334W, 1078delT, 3849ϩ10kbC3T, R1162X, N1303K, 3659delC, 3905insT, A455E, R117H, Y122X, 2183AA3G, 2789ϩ5G3A, 1898ϩ1G3A, 621ϩ1G3T, 711ϩ1G3T, and G85E. Login to comment

[hide] Cystic fibrosis in the pancreas: recent advances p... Curr Gastroenterol Rep. 1999 Apr;1(2):161-5. Bornstein JD, Cohn JA
Cystic fibrosis in the pancreas: recent advances provide new insights.
Curr Gastroenterol Rep. 1999 Apr;1(2):161-5., [PMID:10980944]

Abstract [show]
Idiopathic chronic pancreatitis accounts for up to one third of chronic pancreatitis cases. The most common inherited disease of the exocrine pancreas is cystic fibrosis, which is caused by mutations of a gene encoding an ion transport protein. It was discovered during the past year that many patients with idiopathic chronic pancreatitis have mutations of the gene that causes cystic fibrosis. This article reviews the evidence associating mutations of this gene with chronic pancreatitis and discusses the implications of this association for the evaluation, pathogenesis, classification, and possible prevention of pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 Genotypes of Seven ICP Patients with CFTR mutations Patient Gender Mutations Intron 8 Age at onset, y ICP # Days hospitalized ERCP class 1 Male ⌬F508/R117H 9T/7T 45 11 46 Moderate 2 Female ⌬F508/wt 9T/5T 32 7 52 Moderate 3 Female ⌬F508/wt 9T/5T 48 20 100+ Moderate 4 Female ⌬F508/wt 9T/7T 40 25 100+ Moderate 5 Female ⌬F508/wt 9T/7T 15 16 62 Mild 6 Female R117H/wm 7T/7T 32 6 60 Moderate 7 Male N1303K/wt 7T/9T 43 1 6 Moderate ERCP-endoscopic retrograde cholangiopancreatography; ICP-idiopathic chronic pancreatitis. Login to comment

[hide] Mode of action and application of Scorpion primers... Nucleic Acids Res. 2000 Oct 1;28(19):3752-61. Thelwell N, Millington S, Solinas A, Booth J, Brown T
Mode of action and application of Scorpion primers to mutation detection.
Nucleic Acids Res. 2000 Oct 1;28(19):3752-61., 2000-10-01 [PMID:11000267]

Abstract [show]
Scorpion primers can be used to detect PCR products in homogeneous solution. Their structure promotes a unimolecular probing mechanism. We compare their performance with that of the same probe sequence forced to act in a bimolecular manner. The data suggest that Scorpions indeed probe by a unimolecular mechanism which is faster and more efficient than the bimolecular mechanism. This mechanism is not dependent on enzymatic cleavage of the probe. A direct comparison between Scorpions, TaqMan and Molecular Beacons on a Roche LightCycler indicates that Scorpions perform better, particularly under fast cycling conditions. Development of a cystic fibrosis mutation detection assay shows that Scorpion primers are selective enough to detect single base mutations and give good sensitivity in all cases. Simultaneous detection of both normal and mutant alleles in a single reaction is possible by combining two Scorpions in a multiplex reaction. Such favourable properties of Scorpion primers should make the technology ideal in numerous applications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 We have used Scorpion primers to detect five common ABCC7 mutations, ∆F508 (11-13), N1303K (15), W1282X (12), G542X (12) and G551D (12,16) (Table 1). Login to comment
60 Mutation site Base change Probe-target mismatch ∆F508 M55115 436-438 CTT del - N1303K M55128 329 C→G C-C W1282X M55127 395 G→A C-A G551D M55116 362 G→A C-A G542X M55116 334 G→T C-T All PCR reactions were carried out on a Roche LightCycler. Login to comment
72 Oligo name Code Oligo sequence MTHFR forward primer BPF 5'-CTGACCTGAAGCACTTGAAGG-3' MTHFR reverse primer BPR 5'-ATGTCGGTGCATGCCTTCAC-3' MTHFR Molecular Beacon MMB 5'-FAM GCGAGTGCGGGAGCCGATTTCTCGC MR-3' MTHFR TaqMan MT 5'-FAM TGCGGGAGCCGATTT TAMRA-3' MTHFR Scorpion MS 5'-FAM CCCGCGGAAATCGGCTCCCGCACCGCGGG MR HEG CTGACCTGAAGCACTTGAAGG-3' ∆F508 normal Scorpion 508S 5'-FAM CCGCGCAAACACCAAAGATGATATTTTCTGCGCGG MR HEG AGTTTTCCTGGATTATGCCT-3' ∆F508 mutant Scorpion 508M 5'-ROX CCGC(F)GCAAACACCAATGATATTTTCTGCAGCGG MR HEG AGTTTTCCTGGATTATGCCT-3' ∆F508 reverse primer 508R 5'-TTGGGTAGTGTGAAGGGTTC-3' ∆F508 forward primer 508F 5'-AGTTTTCCTGGATTATGCCT-3' Hybrid Scorpion HS 5'-FAM CCGCGCAAACACCAAAGATGATATTTTCTGCGCGG MR HEG CTTGGAGAAGGTGGAATCAC-3' N1303K Scorpion N13S 5'-FAM CCCGCGCGGAACATTTAGAAAAAACTTGGATCCCGCGCGGG MR HEG TTTCTTGATCACTCCACTGTTC-3' N1303K reverse primer N13R 5'-CATACTTTCTTCTTCTTTTCTTT-3' W1282X Scorpion W12S 5'-FAM CCCGCGCCTTTCCTCCACTGTTGCGCGCGGG MR HEG ATGGTGTGTCTTGGGATTCA-3' W1282X reverse primer W12R 5'-GGCTAAGTCCTTTTGCTCAC-3' G551D Scorpion 551S 5'-FAM CCCGCGCCTCGTTGACCTCCACTCGCGCGGG MR HEG CTTGGAGAAGGTGGAATCAC-3' G551D reverse primer 551R 5'-AAATGCTTGCTAGACCAATA-3' G551D forward primer 551F 5'-CTTGGAGAAGGTGGAATCAC-3' G551D-DIST Scorpion (90 bases between 3'-end of Scorpion primer and 5'-end of probe target) G90 5'-FAM CCCGCGCCTCGTTGACCTCCACTCGCGCGGG MR HEG CAGATTGAGCATACTAAAAG-3' G542X Scorpion G542S 5'-FAM CCGCGCACCTTCTCCAAGAACTAGCGCGG MR HEG CCAAGTTTGCAGAGAAAGAC-3' G542X reverse primer G542R 5'-AAATGCTTGCTAGACCAATA-3' Table 3. Login to comment
73 Annealing and fluorescence monitoring temperatures used for each locus Loci/test Annealing temperature (°C) Monitoring temperature (°C) ∆F508 48 51 N1303K 44 61 W1282X 49 53 G551D 47 55 G551D-DIST 46 55 G542X 48 53 Unimolecular versus bimolecular test 47 51 Distance constraints G90 Scorpion 46 55 G551DS Scorpion 47 55 MTHFR 58 58 described in Results were 95°C for 30 s, 58°C for 60 s and 72°C for 30 s. Login to comment

[hide] Mutation in the gene responsible for cystic fibros... JAMA. 2000 Oct 11;284(14):1814-9. Wang X, Moylan B, Leopold DA, Kim J, Rubenstein RC, Togias A, Proud D, Zeitlin PL, Cutting GR
Mutation in the gene responsible for cystic fibrosis and predisposition to chronic rhinosinusitis in the general population.
JAMA. 2000 Oct 11;284(14):1814-9., 2000-10-11 [PMID:11025834]

Abstract [show]
CONTEXT: Chronic rhinosinusitis (CRS) is a common condition in the US general population, yet little is known about its underlying molecular cause. Chronic rhinosinusitis is a consistent feature of the autosomal recessive disorder cystic fibrosis (CF). OBJECTIVE: To determine whether mutations in the cystic fibrosis transmembrane regulator (CFTR) gene, which is responsible for CF, predispose to CRS. DESIGN: Case-control study conducted from 1996 to 1999 in which the DNA of CRS patients and controls was typed for 16 mutations that account for 85% of CF alleles in the general population. Chronic rhinosinusitis patients with 1 CF mutation were evaluated for a CF diagnosis by sweat chloride testing, nasal potential difference measurement, and DNA analysis for additional mutations. SETTING: Otolaryngology-head and neck clinic of a US teaching hospital. PARTICIPANTS: One hundred forty-seven consecutive adult white patients who met stringent diagnostic criteria for CRS and 123 CRS-free white control volunteers of similar age range, geographic region, and socioeconomic status. MAIN OUTCOME MEASURES: Presence of CF mutations by DNA analysis among CRS patients vs controls. RESULTS: Eleven CRS patients were found to have a CF mutation (DeltaF508, n = 9; G542X, n = 1; and N1303K, n = 1). Diagnostic testing excluded CF in 10 of these patients and led to CF diagnosis in 1. Excluding this patient from the analyses, the proportion of CRS patients who were found to have a CF mutation (7%) was significantly higher than in the control group (n = 2 [2%]; P =.04, both having DeltaF508 mutations). Furthermore, 9 of the 10 CF carriers had the polymorphism M470V, and M470V homozygotes were overrepresented in the remaining 136 CRS patients (P =.03). CONCLUSION: These data indicate that mutations in the gene responsible for CF may be associated with the development of CRS in the general population. JAMA. 2000;284:1814-1819.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 Results Eleven CRS patients were found to have a CF mutation (⌬F508, n=9; G542X, n=1; and N1303K, n=1). Login to comment
30 Analysis of CFTR Genes Genomic DNA samples extracted from the blood of participants were screened for 16 mutations (R117H, 621+1G→T, R334W, R347P, A455E, ⌬I507, ⌬F508, 1717-1 G→A, G542X, S549N, G551D, R553X, R560T, 3849+10 Kb C→T, W1282X, and N1303K) that account for 85% of CF alleles in the white population using the multiplex reverse dot hybridization system (Roche Molecular Systems, Alameda, Calif).16,17 This test also identified the 5T, 7T, and 9T variants of the splice acceptor site in intron 8 and F508C, I507V, and I506V (exon 10) polymorphisms of the CFTR gene. Login to comment
46 Eleven CRS patients were found to have CF mutations (TABLE 1); 9 had the common mutation, ⌬F508, 1 had G542X, and 1 had N1303K. Login to comment
53 Using this technique, we previously demonstrated that at least 96% of mutations in the exons and flanking intron regions of the CFTR gene can be detected.16 A 97% sensitivity was achieved using 115 samples with previously identified mutations16 in this study.Sequenceanalysisofsampleswith anabnormalDGGEpatternidentifiedan R75Q mutation in the N1303K carrier and an L967S mutation in the G542X carrier. Login to comment
66 The patient having 2 CF mutations (No. 1624) had an elevated sweat chloride concentration (102 mmol/L) (normal level, Ͻ60 mmol/L).20 The N1303K carrier patient (No. 1344) had 2 borderline and 1 elevated sweat chloride concentration measurements (55, 58, and 78 mmol/L), while the re- Table 1. Login to comment
67 Cystic Fibrosis (CF) Mutations and Cystic Fibrosis Transmembrane Regulator (CFTR) Variants in Chronic Rhinosinusitis (CRS) Patients and Controls* CRS, No. (%) Non CRS, No. (%) P Value (n = 147) (n = 123) CF mutations ⌬F508/+ 1 2 ⌬F508/M470V 7 0 G542X/M470V, L967S 1 0 N1303K/+; M470V/M; R75Q/+† 1 0 (⌬F508/2789+5G→A)‡ 1 0 Frequency of CF carriers 10 (7) 2 (2) .04§ (n = 136) (n = 121) CFTR variants 5T Variant in non-CF carriers࿣ 5T/+ 11 (9) 6 (6) .25§ Codon 470 genotypes among non-CF carriers࿣ M/M 21 (16) 23 (19) M/V 55 (40) 64 (53) .03¶ V/V 60 (44) 34 (28) *Plus (+) indicates wildtype. Login to comment
84 Cystic Fibrosis Transmembrane Regulator (CFTR) Genotypes and Clinical Features of Chronic Rhinosinusitis Patients Having a Cystic Fibrosis Mutation* Patient No. Sex CFTR Genotype Age of Onset, y Sinus Surgery, No. of Times Polyposis Pulmonary Status Gastrointestinal Status Sweat Chloride Concentration, mmol/L† Other Pertinent Clinical Features 1344 F N1303K/+; M470V/M; R75Q/+‡ Ͻ10 3 - Recurrent bronchitis Lactose intolerant 55, 58, 78 . Login to comment

[hide] Cystic fibrosis in infertility: screening before a... Hum Reprod. 2000 Nov;15(11):2415-7. Lewis-Jones DI, Gazvani MR, Mountford R
Cystic fibrosis in infertility: screening before assisted reproduction: opinion.
Hum Reprod. 2000 Nov;15(11):2415-7., [PMID:11056144]

Abstract [show]
Cystic fibrosis (CF) is the most common autosomal recessive disease in Caucasians. In 97-98% of men with CF, bilateral congenital absence of the vas deferens (CBAVD) blocks the transport of spermatozoa resulting in azoospermia. Abnormalities in sperm parameters have also been identified in males with CF. To date, over 800 disease-causing mutations of the CF transmembrane conductance regulator (CFTR) gene have been identified (also called ABCC7). Current legislation suggests that prior to intracytoplasmic sperm injection (ICSI) treatment, men with CBAVD or unexplained oligozoospermia should be considered for screening. If the male is negative with routine screening then the female partner is not screened. This is fundamentally wrong because if the female is screened and is found to be CF positive on routine testing, her partner would then need the fullest possible investigation of the CFTR gene. It is ideal to screen both partners in cases of oligozoospermia. However, if the resources are stretched, then only the female needs to be routinely screened because if she is negative, then the couple's residual risk of having a CF or CBAVD child will be reduced to 1:960. Only when the female is found to be a carrier does the male partner need routine screening followed by full testing for known mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Science, 245, 1073-1080.3659∆C 3849ϩ10KbC→T Lissens, W., Mercier, B., Tournaye, H. et al. (1996) Cystic fibrosis and infertility caused by congenital bilateral absence of the vas deferens andW1282X N1303K related clinical entities. Login to comment

[hide] The incidence of cystic fibrosis (CF) mutations am... Clin Genet. 2000 Oct;58(4):333-5. Tanackovic G, Barisic I, Gjergja-Matejic R, Hecimovic S, Pavelic J
The incidence of cystic fibrosis (CF) mutations among patients from Croatia.
Clin Genet. 2000 Oct;58(4):333-5., [PMID:11076060]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 After DNA isolation (2), we screened the samples for the 16 most common CFTR mutations: DF508, DI507 [heteroduplex analysis (3)] G542X, G551D, W1282X, N1303K, 3849+10kbCT, R553X, 621+1GT, R1162X, 1717-1GA, 2789+ 5GA, 3849+4AG, 1898+1GA, R117H [restriction fragment length polymorphism, (4-7)] and 3905insT [single-strand conformational polymorphism analysis (8)]. Login to comment
7 The presence of six different mutations was observed on 60 CF chromosomes: DF508, G542X, 1717-1GA, R117H, N1303K and R1162X (Table 1). Login to comment
17 The mutations N1303K, 1717-1GA and R117H were represented with the same frequency of 3.3%. Login to comment
18 Mutation N1303K is relatively common in Italy (4.0%) and the Czech Republic (3.1%) (14, 16), with a lower frequency in Hungary (1.2%) and the Republic of Macedonia (1.8%), while in Slovenia, it appears with a frequency of 0.5% (personal communication) (13, 15). Login to comment
20 Results of CF mutation identification Location of the mutation in the CFTR geneMutation %CF chromosomes with mutation (n)* DF508 65.039exon 10 exon 11G542X 5.03 N1303K exon 21 2 3.3 1717-1GA intron 10 2 3.3 2exon 4R117H 3.3 G85E 1.71exon 3 R1162X exon 19 1 1.7 Total identified - 50 83.3 *Sum of CF chromosomes from 30 patients is 60 (30×2). Login to comment

[hide] CF gene and cystic fibrosis transmembrane conducta... J Am Soc Nephrol. 2000 Dec;11(12):2285-96. Persu A, Devuyst O, Lannoy N, Materne R, Brosnahan G, Gabow PA, Pirson Y, Verellen-Dumoulin C
CF gene and cystic fibrosis transmembrane conductance regulator expression in autosomal dominant polycystic kidney disease.
J Am Soc Nephrol. 2000 Dec;11(12):2285-96., [PMID:11095651]

Abstract [show]
Disease-modifying genes might participate in the significant intrafamilial variability of the renal phenotype in autosomal dominant polycystic kidney disease (ADPKD). Cystic fibrosis (CF) transmembrane conductance regulator (CFTR) is a chloride channel that promotes intracystic fluid secretion, and thus cyst progression, in ADPKD. The hypothesis that mutations of the CF gene, which encodes CFTR, might be associated with a milder renal phenotype in ADPKD was tested. A series of 117 unrelated ADPKD probands and 136 unaffected control subjects were screened for the 12 most common mutations and the frequency of the alleles of the intron 8 polymorphic TN: locus of CF. The prevalence of CF mutations was not significantly different in the ADPKD (1.7%, n = 2) and control (3.7%, n = 5) groups. The CF mutation was DeltaF508 in all cases, except for one control subject (1717-1G A). The frequencies of the 5T, 7T, and 9T intron 8 alleles were also similar in the ADPKD and control groups. Two additional patients with ADPKD and the DeltaF508 mutation were detected in the families of the two probands with CF mutations. Kidney volumes and renal function levels were similar for these four patients with ADPKD and DeltaF508 CFTR (heterozygous for three and homozygous for one) and for control patients with ADPKD collected in the University of Colorado Health Sciences Center database. The absence of a renal protective effect of the homozygous DeltaF508 mutation might be related to the lack of a renal phenotype in CF and the variable, tissue-specific expression of DeltaF508 CFTR. Immunohistochemical analysis of a kidney from the patient with ADPKD who was homozygous for the DeltaF508 mutation substantiated that hypothesis, because CFTR expression was detected in 75% of cysts (compared with <50% in control ADPKD kidneys) and at least partly in the apical membrane area of cyst-lining cells. These data do not exclude a potential protective role of some CFTR mutations in ADPKD but suggest that it might be related to the nature of the mutation and renal expression of the mutated CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Genomic DNA samples were screened using the Elucigene CF12 kit (based on Amplification Refractory Mutation System technology; Zeneca Diagnostics, Abingdon, UK), to detect the following 12 CFTR mutations: 1717-1G3A, G542X, W1282X, N1303K, ⌬F508, 3849ϩ10kbC3T, 621ϩ1G3T, R553X, G551D, R117H, R1162X, and R334W. Login to comment
99 Characteristics of the 12 mutations of the CF gene screened for among the patients with ADPKD and the control subjectsa Name Location Nucleotide Change CFTR Domain Consequence R117H Exon 4 G3A at 482 TM2 Arg3His at 117 621ϩ1G3T Intron 4 G3T at 621ϩ1 mRNA splicing mutation R334W Exon 7 C3T at 1132 TM6 Arg3Trp at 334 ⌬F508 Exon 10 3-bp deletion between 1652 and 1655 NBD1 Phe-508 deletion 1717-1G3A Intron 10 G3A at 1717-1 NBD1 mRNA splicing mutation G542X Exon 11 G3T at 1756 NBD1 Gly3Stop at 542 G551D Exon 11 G3A at 1784 NBD1 Gly3Asp at 551 R553X Exon 11 C3T at 1789 NBD1 Arg3Stop at 553 R1162X Exon 19 C3T at 3616 Arg3Stop at 1162 3849ϩ10kbC3T Intron 19 C3T in a 6.2-kb EcoRI fragment 10 kb from 19 NBD2 Creation of a splice acceptor site W1282X Exon 20 G3A at 3978 NBD2 Trp3Stop at 1282 N1303K Exon 21 C3G at 4041 NBD2 Asn3Lys at 1303 a Modified from reference 16. Login to comment

[hide] Type I, II, III, IV, and V cystic fibrosis transme... Curr Opin Pulm Med. 2000 Nov;6(6):521-9. Choo-Kang LR, Zeitlin PL
Type I, II, III, IV, and V cystic fibrosis transmembrane conductance regulator defects and opportunities for therapy.
Curr Opin Pulm Med. 2000 Nov;6(6):521-9., [PMID:11100963]

Abstract [show]
Recent advances in cellular and molecular biology have furthered the understanding of several genetic diseases, including cystic fibrosis. Mutations that cause cystic fibrosis are now understood in terms of the specific molecular consequences to the cystic fibrosis transmembrane conductance regulator (CFTR) protein expression and function. This knowledge has spawned interest in the development of therapies aimed directly at correcting the defective CFTR itself. In this article, we review the molecular defect underlying each recognized class of CFTR mutation and the potential therapies currently under investigation. Opportunities for protein-repair therapy appear to be vast and range from naturally occurring compounds, such as isoflavonoids, to pharmaceuticals already in clinical use, including aminoglycoside antibiotics, butyrate analogues, phosphodiesterase inhibitors, and adenosine nucleotides. Future therapies may resemble designer compounds like benzo[c]quinoliziniums or take the form of small peptide replacements. Given the heterogeneity and progressive nature of cystic fibrosis, however, optimal benefit from protein-repair therapy will most likely require the initiation of combined therapies early in the course of disease to avoid irreparable organ damage.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 Molecular fate of CFTR protein Type of genetic defect and example Class-specific potential therapeutic approach Specific clinical examples I No synthesis Nonsense G542X Frameshift 394delTT Splice junction 1717-1G→A Aminoglycoside readthrough of premature termination site Gentamicin II Trafficking block AA deletion ∆F508 Missense N1303K Manipulation of intracellular folding environment (chemical or molecular chaperones) Phenylbutyrate, CPX III Block in regulation Missense G551D Stimulation of membrane localized mutant channel Genistein, MPB- compounds IV Altered conductance Missense R117H Augmentation of mutant channel conductance Milrinone, adenosine nucleotides V Reduced synthesis of normal protein Missense A455E Alternative splicing 3849+10kbC→T Maximal activation of decreased but functionally normal channels Stimulation of mRNA and protein synthesis ? Login to comment

[hide] Polymorphism of cystic fibrosis gene in Japanese p... Dig Dis Sci. 2000 Oct;45(10):2007-12. Kimura S, Okabayashi Y, Inushima K, Yutsudo Y, Kasuga M
Polymorphism of cystic fibrosis gene in Japanese patients with chronic pancreatitis.
Dig Dis Sci. 2000 Oct;45(10):2007-12., [PMID:11117575]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and the 5T genotype of the polythymidine tract at the exon 9 splice branch/acceptor site are shown to be associated with chronic pancreatitis in Caucasian patients. In contrast to Western countries, cystic fibrosis is extremely rare in Japan. In this study, we investigated the association of mutations or polymorphisms of the CFTR gene with chronic pancreatitis in Japanese patients. Forty-seven patients with chronic pancreatitis (alcohol-related in 31, idiopathic in 14, and familial in 2) were examined for the deltaF508 and R117H mutations and polymorphisms of intron 8. DNA was extracted from leukocytes. Mutations and polymorphisms were examined by the allele-specific polymerase chain reactions and confirmed by direct sequencing. None of the patients had deltaF508 or R117H mutations in the CFTR gene. All of 47 healthy Japanese showed the homozygous 7T/7T genotype, whereas the frequencies of 5T, 7T, and 9T alleles were 0.043, 0.894, and 0.064 in the patients, respectively. The difference in allele frequency is statistically significant. Therefore, the present study indicates the association of polymorphism of the polythymidine tract in intron 8 of the CFTR gene with chronic pancreatitis in Japanese patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
128 Cohn et al (5) studied 27 patients with chronic idiopathic pancreatitis and detected three different mutations in eight patients: ⌬F508 in five, R117H in two, and N1303K in one. Login to comment

[hide] Unilateral renal agenesis associated with congenit... Hum Reprod. 2001 Feb;16(2):282-8. McCallum T, Milunsky J, Munarriz R, Carson R, Sadeghi-Nejad H, Oates R
Unilateral renal agenesis associated with congenital bilateral absence of the vas deferens: phenotypic findings and genetic considerations.
Hum Reprod. 2001 Feb;16(2):282-8., [PMID:11157821]

Abstract [show]
An association between congenital bilateral absence of the vas deferens (CBAVD), normal renal anatomy and cystic fibrosis (CF) gene mutations is well established (CF/CBAVD). We postulate that unilateral renal agenesis (URA) and CBAVD (URA/CBAVD) may have a non-CF mutation-mediated genetic basis that leads to abnormal development of the entire mesonephric duct at a very early stage in embryo development (< or =7 weeks). The physical, laboratory and radiographic findings of men with URA/CBAVD (n = 17) and CF/CBAVD (n = 97) were compared; the fertilization and pregnancy rates in the URA/CBAVD population calculated, and the incidence of renal agenesis in immediate family members and offspring of men with URA/CBAVD analysed. No statistical differences could be identified within any of the above comparisons. The fertilization rate for the URA/CBAVD group was 58.2 +/- 26.3%. Eight infants and two fetuses had normal renal anatomy, while one terminated male fetus had bilateral renal and vasal agenesis. Thirty first-order relatives had normal renal units. Anatomical expression of the reproductive ductal derivatives in men with URA/CBAVD and CF/CBAVD was similar, but the phenotypic outcome of the renal portion of the mesonephric duct was different. The potential for transmission of this fatal anomaly reinforces the need for prenatal ultrasounds with all pregnancies involving URA/CBAVD men.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 ThereW1282X; ∆F508; R553X; N1303K; 3849ϩ10 kb C-T; R117L; I506; R553G; R560K; 1811ϩ1G-C; 1774delCT; S549R; S549I; R1283K; were no significant correlations with ethnic origin. Login to comment

[hide] Comprehensive mutation screening in a cystic fibro... Pediatrics. 2001 Feb;107(2):280-6. Wine JJ, Kuo E, Hurlock G, Moss RB
Comprehensive mutation screening in a cystic fibrosis center.
Pediatrics. 2001 Feb;107(2):280-6., [PMID:11158459]

Abstract [show]
OBJECTIVES AND BACKGROUND: The identities of a cystic fibrosis (CF) patient's CFTR mutations can influence therapeutic strategies, but because >800 CFTR mutations exist, cost-effective, comprehensive screening requires a multistage approach. Single-strand conformation polymorphism and heteroduplex analysis (SSCP/HA) can be an important part of mutation detection, but must be calibrated within each laboratory. The sensitivity of a combined commercial-SSCP/HA approach to genotyping in a large, ethnically diverse US center CF population has not been established. STUDY DESIGN: We screened all 27 CFTR exons in 10 human participants who had an unequivocal CF diagnosis including a positive sweat chloride test and at least 1 unknown allele after commercial testing for the 70 most common mutations by SSCP/HA. These participants were compared with 7 participants who had negative sweat tests but at least 1 other CF-like symptom meriting complete genotyping. RESULTS: For the 10 CF participants, we detected 11 of 16 unknown alleles (69%) and all 4 of the known alleles (100%), for an overall rate of 75% inpatients not fully genotyped by conventional 70 mutation screen. For 7 participants with negative sweat tests, we confirmed 1 identified mutation in 14 alleles and detected 3 additional mutations. Mutations detected in both groups included 7 missense mutations (S13F, P67L, G98R, S492F, G970D, L1093P, N1303K) and 9 deletion, frameshift, nonsense or splicing mutations (R75X, G542X, DeltaF508, 451-458Delta8 bp, 5T, 663DeltaT, exon 13 frameshift, 1261+1G-->A and 3272-26A-->G). Three of these mutations were novel (G970D, L1093P, and 451-458Delta8 bp(1)). Thirteen other changes were detected, including the novel changes 1812-3 ins T, 4096-278 ins T, 4096-265 ins TG, and 4096-180 T-->G. CONCLUSION: When combined with the 70 mutation Genzyme test, SSCP/HA analysis allows for detection of >95% of the mutations in an ethnically heterogeneous CF center population. We discuss 5 possible explanations that could account for the few remaining undetected mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 Mutations detected in both groups included 7 missense mutations (S13F, P67L, G98R, S492F, G970D, L1093P, N1303K) and 9 deletion, frameshift, nonsense or splicing mutations (R75X, G542X, ⌬F508, 451-458⌬8 bp, 5T, 663⌬T, exon 13 frameshift, 1261؉1G3A and 3272-26A3G). Login to comment
86 Mutations in the Stanford CF Mutation Database After Screening With the Genzyme70 Assay Mutation n % n % ⌬F508 353 67.11% 353 67.11% Splice mutations 16 3.04% 621ϩ1 G3T 5 0.95% 1717-1 G3A 5 0.95% 2789ϩ5 G3A 1 0.19% 1898ϩ1 G3A 1 0.19% 3849ϩ10 kb C3T 4 0.76% Stop mutations 31 5.89% Q493X 1 0.19% G542X 13 2.47% R553X 4 0.76% R1162X 1 0.19% W1282X 10 1.90% S1455X 2 0.38% Insertions/deletions 9 1.71% 681 del C 1 0.19% 2184 del A 2 0.38% 3859 del C 5 0.95% 3905 ins T 1 0.19% Missense mutations 33 6.27% G85E 4 0.76% R117H 3 0.57% R334W 6 1.14% G551D 14 2.66% R560T 3 0.57% N1303K 3 0.57% Unknown mutations 84 15.97% 84 15.97% Total 526 100.00% 526 100.00% ARTICLES tients with positive sweat tests were selected for SSCP/HA analysis based on clinical status, ethnicity, and previous screening with the Genzyme70 assay. Login to comment
115 Mutation Detection in 10 Participants With Positive Sweat Chloride Values I.D. Pancreatic Function Mutation Status Discovered Mutations (Novel) Polymorphisms SP1 PI N1303K/unk* L1093P (17b), M470V (10)* SP2 PI unk*/unk* S13F (exon1) 2184 ins A (exon 13) GATT7/7, 2694 T/G SP3 PS unk*/unk* ⌬451-458 (4); G970D (16) GATT7/6, 2694 T/G SP4 PS unk*/unk* R75X (3), G98R (4) GATT7/7, 492 G/A SP5 PS unk*/unk 3272-26A/G (17b) M470V/M470V (10) SP6 PI/PS (mild) ⌬F508/unk None found - SP7 PI ⌬F508/unk None found GATT6/7,1001ϩ11C/T (6b), M470V (10) SP8 PI unk*/unk S492F (10) GATT7/7 GT11/11 M470V/M470V SP9 PI ⌬F508/unk None found - SP10 PI unk*/unk* 663 ⌬T/663 ⌬T GATT6/6, 2694T3G Column labeled Pancreatic Function indicates the need for dietary supplementation with pancreatic enzymes. Login to comment

[hide] The molecular basis of cystic fibrosis in South Af... Clin Genet. 2001 Jan;59(1):37-41. Goldman A, Labrum R, Claustres M, Desgeorges M, Guittard C, Wallace A, Ramsay M
The molecular basis of cystic fibrosis in South Africa.
Clin Genet. 2001 Jan;59(1):37-41., [PMID:11168023]

Abstract [show]
The spectrum of CFTR mutations in three South African populations is presented. To date. a total of 192 white patients (384 chromosomes) with confirmed CF have been tested. deltaF508 accounts for 76% of the CF chromosomes in this group, with 3272-26A-->G, 394delTT and G542X occurring at the following frequencies: 4, 3.6 and 1.3%, respectively. A further 11 mutations account for 6% of CF chromosomes. A total of 91% of the CF-causing mutations can now be detected in the South African white population. Haplotype analysis suggests a founder effect in South Africans of European origin for the two common CFTR mutations, 3272-26A-->G and 394delTT. The diagnosis of CF has been confirmed in 14 coloured and 12 black CF patients. In the coloured population, both the deltaF508 and 3120 + 1G-->A mutations occur at appreciable frequencies of 43 and 29%, respectively. In the black population, the most common CF-causing mutation, the 3120 + 1G-->A mutation, occurs at an estimated frequency of 46%. Four other mutations have been detected, resulting in the identification of a total of 62.5% of mutations in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 Five other mutations were identified in the white population, G542X, R553X, S549N, 621+lGT and N1303K which together account for a further 3% of mutations (5). Login to comment
40 White and coloured patients with unidentified CF mutations were tested for 15 mutations including 394delTT, Q493X, 3272-26A G, 3120+1GA as well as 11 other mutations, R117H, R334W, G542X, G551D, R553X, 621+ 1GT, W1282X, N1303K, 1717-1GA, R1162X, 3849+10kbCT. Login to comment

[hide] Frequency of cystic fibrosis transmembrane conduct... Chest. 2001 Mar;119(3):762-7. Marchand E, Verellen-Dumoulin C, Mairesse M, Delaunois L, Brancaleone P, Rahier JF, Vandenplas O
Frequency of cystic fibrosis transmembrane conductance regulator gene mutations and 5T allele in patients with allergic bronchopulmonary aspergillosis.
Chest. 2001 Mar;119(3):762-7., [PMID:11243954]

Abstract [show]
STUDY OBJECTIVE: To assess the frequency of cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in patients with allergic bronchopulmonary aspergillosis (ABPA). DESIGN: Case-control study. All subjects in the study were screened for the presence of 13 mutations in the CFTR gene (R117H, 621 + 1G(-)>T, R334 W, Delta F508, Delta I507, 1717-1G(-)>A, G542X, R553X, G551D, R1162X, 3849 + 10kbC(-)>T, W1282X, and N1303K). Moreover, they were also screened for the presence of the 5T variant in intron 8. SETTING: University hospital and community-based hospital. PATIENTS: Twenty-one white patients with ABPA participated in the study. The presence of CFTR mutations was also investigated in 43 white subjects with allergic asthma who did not show sensitization to Aspergillus fumigatus and in 142 subjects seeking genetic counseling for diseases other than cystic fibrosis (CF). RESULTS: Six patients with ABPA were found to be heterozygous for one CFTR mutation, including Delta F508 (n = 2), G542X (n = 1), R1162X (n = 1), 1717-1G(-)>A (n = 1), and R117H (n = 1). The 5T allele was not detected in ABPA patients. None of the ABPA patients showed sweat chloride concentrations > 60 mEq/L. The frequency of CFTR mutation carriers was significantly higher in ABPA patients (6 of 21 patients; 28.5%) than in control asthmatic subjects (2 of 43 subjects; 4.6%; p = 0.01) and in subjects seeking genetic counseling (6 of 142 subjects; p < 0.001). CONCLUSION: These findings indicate that in patients without a clinical diagnosis of CF, CFTR gene mutations could be involved in the development of ABPA, in association with other genetic or environmental factors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 All subjects in the study were screened for the presence of 13 mutations in the CFTR gene (R117H, 621 ؉ 1G->T, R334 W, ⌬F508, ⌬I507, 1717-1G->A, G542X, R553X, G551D, R1162X, 3849 ؉ 10kbC->T, W1282X, and N1303K). Login to comment
42 Genomic DNA samples were screened for the following CFTR mutations: R117H/ exon 4, 621 ϩ 1G-ϾT/intron 4, R334 W/exon 7, ⌬F508/exon 10, ⌬I507/exon 10, 1717-1G-ϾA/intron 10, G542X/exon 11, R553X/ exon 11, G551D/exon 11, R1162X/exon 19, 3849 ϩ 10kbC-ϾT/ intron 19, W1282X/exon 20, and N1303K/exon 21. Login to comment

[hide] Genetic, andrological and clinical characteristics... Int J Androl. 2001 Apr;24(2):73-9. Attardo T, Vicari E, Mollica F, Grazioso C, Burrello N, Garofalo MR, Lizzio MN, Garigali G, Cannizzaro M, Ruvolo G, D'Agata R, Calogero AE
Genetic, andrological and clinical characteristics of patients with congenital bilateral absence of the vas deferens.
Int J Androl. 2001 Apr;24(2):73-9., [PMID:11298840]

Abstract [show]
The possibility of retrieving spermatozoa from the epididymis allows patients with congenital bilateral absence of the vas deferens (CBAVD) to father a child by means of assisted reproduction techniques. This has, however, increased the chance of transmitting a mutated allele of the cystic fibrosis transmembrane conductance regulator (CFTR) gene which increases the risk of generating offspring with cystic fibrosis (CF). Because of the increased heterogeneity of the CFTR locus, the study of a discrete number of mutations, as usually carried out in a diagnostic work-up, is unable to ascertain the presence of a mutation in a relatively high proportion of the patients screened. In an attempt to increase the chance of detecting the presence of CFTR gene abnormalities, 37 patients with CBAVD and one patient with congenital unilateral agenesis of the vas deferens (CUAVD) underwent an enlarged diagnostic protocol, which included screening for the most expected mutations of the CFTR gene in our population, evaluation of the five thymidine (5T) allelic variant, sweat test, respiratory function tests, evaluation of steatocrit, and an accurate evaluation of the history of the patient to search for symptoms commonly found in patients with CF. A single CFTR gene mutation was found in 18 patients (48.6%) with CBAVD and in the patient with CUAVD. The most frequent mutation observed was the Delta F508. Eleven patients (45.8%) had the 5T variant and in five of them it was not associated with any detectable mutation of the CFTR gene. Two female partners were found to be carriers of a mutation, whereas 5 (18.5%) had the 5T variant. As many as 71% of CBVAD patients had the simultaneous presence of at least two signs and/or symptoms suggestive of CF, albeit they were of mild intensity and the patients felt fit and healthy. In conclusion, these results suggested that some patients with CBAVD without CFTR gene mutation or 5T variant, even when their sweat test is negative, may show clinical suspicion of carrying a CFTR gene mutation and therefore are at risk of generating children affected by CF if the partner carries a mutation as well. The screening for mutations and a careful clinical examination may contribute to better identification of patients with CFTR-related CBAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
49 We investigated the following 11 CFTR mutations: DF508, G542X, R553X, N1303K, W1282X, R347P, L1077P, 2183AA ® G, 1717±1G > A, R1162X, and R117H. Login to comment

[hide] An alpha1-antitrypsin enhancer polymorphism is a g... Eur J Hum Genet. 2001 Apr;9(4):273-8. Henry MT, Cave S, Rendall J, O'Connor CM, Morgan K, FitzGerald MX, Kalsheker N
An alpha1-antitrypsin enhancer polymorphism is a genetic modifier of pulmonary outcome in cystic fibrosis.
Eur J Hum Genet. 2001 Apr;9(4):273-8., [PMID:11313771]

Abstract [show]
Lung disease is the direct cause of death in over 90% of cystic fibrosis (CF) patients. Excess neutrophil elastase is an important determinant of pulmonary disease in CF. alpha1-antitrypsin (AAT), also known as alpha1-proteinase inhibitor (alpha1PI) is a major modulator of elastase activity. We investigated the hypothesis that an enhancer polymorphism in the AAT gene would contribute to pulmonary prognosis in CF. Respiratory function, chest X-ray scores, bacterial colonisation and infective exacerbation were assessed to evaluate pulmonary disease severity in the CF group. Sixteen patients were found to have the 1237A allele, and 108 the more frequent G allele. Contrary to expectation, the patients with the 1237A allele were found to have better indices of pulmonary disease progression than those without, as indicated by less change in X-ray score (1237A: 0.2+/-0.1; 1237G: 1.2+/-0.1; P = 0.002) and fewer infective exacerbations (1237A: 2.8+/-0.6; 1237G: 4.6+/-0.3; P = 0.03) over the preceding 2 years. Also, a higher proportion of the 1237A (25%) than the 1237G (6.5%) were not colonised by Pseudomonas Aeruginosa (P = 0.04). Prospective monitoring of infections for a further 2 years confirmed a lesser propensity to infection in patients with the 1237A allele. These trends were also observed in a tightly matched sub-set of CF genotypes of similar age and sex, thus confirming that these effects were independent of the CF genotype. These results indicate that this AAT enhancer polymorphism is associated with better pulmonary prognosis in CF. Though the number of CF patients with the polymorphism is small, and these data need to be confirmed in larger studies, they suggest that a cautious approach should perhaps be taken to treatment of CF patients with supplemental AAT.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 Non DF 508 alleles in the two groups were: 1237A group: G551D (3); N1303K (2); R117H (1); R560T (1); Unknown (3). Login to comment
66 1237G group: G551D (10); R117H (3); R560T (3); D1507 (2); E60X (2); N1303K (1); 1717-1 (1); 621H (1); G542X (1); POL 400 (1); R352Q (1); RT0F (1); 621+G4T (1); Unknown (15). Login to comment
70 For subjects heterozygous for DF508, the second allele was matched as closely as possible and included the following: G551D, N1303K, R117H and R560T. Login to comment
81 infective exacerbations over 2 years 4.7+0.7 2.8+0.6 0.03 over 4 yearsb 10.5+1.8 4.5+1.1 0.006 FEV1 % predicted 55.5+7.4 67.5+5.5 NS at reference visit 2 years post 53.1+8.5 68.4+5.5 (n=14) 0.09 (NS) reference visitb a Non DF 508 alleles in the two groups were: 1237A group: G551D (3); R117H (1); R560T (1); N1303K (2); Unknown (3); 1237G group: G551D (4); R117H (1); R560T (1); 621+G4T (1); Unknown (3). Login to comment

[hide] Prevalence of cystic fibrosis mutations in Israeli... Genet Test. 2001 Spring;5(1):47-52. Orgad S, Neumann S, Loewenthal R, Netanelov-Shapira I, Gazit E
Prevalence of cystic fibrosis mutations in Israeli Jews.
Genet Test. 2001 Spring;5(1):47-52., [PMID:11336401]

Abstract [show]
The aim of this study was to evaluate the screening policies of cystic fibrosis (CF) in the Jewish population. The prevalence of mutations that account for CF in Israel have been defined in the past by determining the frequency of CF mutations in affected individuals. This study is a population-based study and is, therefore, different from previous patient-based studies. We found that the CF mutations D1152H, W1089X, and 405 + IG-->A were present in some ethnic groups in which no CF patients carrying these mutations were reported. These facts necessitate a reevaluation of the screening policy regarding the ethnic groups in Israel. We studied 9,430 healthy Jewish Israeli individuals of 36 countries of origin. The prevalence of CF mutations was 1:19, 1:19, 1:28, and 1:42 for the Ashkenazi, Sephardi, North African, and Eastern Jews, respectively. CF mutations were identified in 374 (4.0%) individuals. These included 173 (46.3%) carriers of the W1282X mutation; 110 (29.4%) found to carry delF508; 23 (6.1%) who carried G542X; 22 (5.9%) who carried 3849 + 10Kb (C-->T; 20 (5.3%) who carried D1152H; 10 (2.7%) who carried N1303K; 11 (2.9%) who carried 405 + IG-->A; 4 (1.1%) who carried W1089X; and one (0.3%) who carried S549R. No carriers were detected for the 1717-1G-->A, G85E, and T360K mutations, which were tested for in 7,383, 1,558, and 41 individuals, respectively.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 These were: delF508 (Kerem et al., 1989), W1282X (Vidaud et al., 1990), G542X, 1717-1G R A, S549R (Kerem et al., 1990), N1303K (Osborn et al., 1991), 3849 1 10Kb C R T (Highsmith et al., 1994), T359K/Q360K (Shoshani et al., 1992), G85E (Zielenski et al., 1991), 405 1 1G R A (Dork et al., 1993), W1089X (Shosani et al., 1994), and D1152H (Highsmith et al., 1993). Login to comment
40 THE CONSENSUS POLICY OF SCREENING OF CF MUTATIONS IN ETHNIC GROUPS OF ISRAELI JEWSa Buchara and Iran Georgia Libya Morocco Tunis Turkey Egypt Sephardi W1089X 1 1 1 G85E 1 1 405-1 G® A 1 1 1 S549R 1 1 D1152H 1 1 1 1 T360K 1 Individuals of all ethnic groups were screened for the mutations W1282X, delF508, G5429X, N1303K, 3849110Kb C® T and 1717-1G® A. Login to comment
45 There were 173 (46.3%) carriers of the W1282X mutation; 110 (29.4%) carriers of delF508; 23 (6.1%) carriers of G542X; 10 (2.7%) carriers of N1303K; and 22 (5.9%) carriers of 3849 1 10KbC R T. Twenty (5.3%) were found to carry D1152H; 11 (2.9%) carried 405 1 1G R A; 4 (1.1%) carried W1089X; and 1 (0.3%) carried S549R. No carriers were detected for the mutations 1717-1G R A, G85E, and T360K, which were tested for in 7,383, 1,436, and 41 individuals, respectively. Login to comment
52 Mutations tested for all individuals in the cohort North Total Ashkenazi Sephardi Africa Eastern number of Mutation no. 6850 no. 933 no. 1146 no. 468 carriers W1282X 142 17 8 6 173 delF508 86 12.25 11.5 0.25 110 G542X 20.25 0.5 1.75 0.5 23 N1303K 7.5 1.5 0.25 0.75 10 3849110Kb 17 2 2 1 22 C® T B. Mutations tested for individuals of non-Ashkenazi origin, mixed origin, and of spouses of carriers Type of Total number mutation Number tested Ashkenazi Sephardi North Africa Eastern of carriers D1152H Number tested 1,305 458.25 722.75 280 Carriers 11.5 4.5 3.5 0.5 20 405 Number tested 425.75 372 633.5 119 11G® A Carriers 0.5 1 9.5 0 11 W1089X Number tested 539.25 345 638.5 135 Carriers 2 0.5 1 0.5 4 S549R Number tested 534.5 385.5 686 110 Carriers 0 1 0 0 1 a Ethnic origin was classified according to the country of origin of the four grandparents of each individual. Each grandparent was calculated as contributing a quarter of his/her gene pool and these were summed up for each ethnic origin. Login to comment
74 Therefore, Ashkenazi Jews would have been tested for the five main mutationsonly: delF508,W1282X, G542X, N1303K, and 3849 1 10KbC R T. The mutations D1152H and W1089X would not have been included in the test panel in Ashkenazi Jews. Login to comment

[hide] Gastrointestinal, liver, and pancreatic involvemen... Pancreas. 2001 May;22(4):395-9. Modolell I, Alvarez A, Guarner L, De Gracia J, Malagelada JR
Gastrointestinal, liver, and pancreatic involvement in adult patients with cystic fibrosis.
Pancreas. 2001 May;22(4):395-9., [PMID:11345141]

Abstract [show]
BACKGROUND: The clinical prevalence of cystic fibrosis (CF) in adults continues to rise, with a consequent impact on adult gastroenterology practice. AIM: To characterize the gastrointestinal manifestations of CF in adult patients. PATIENTS AND METHODS: The clinical records of 89 adult CF patients treated at our institution from 1992 to 1999 were reviewed. Patients were distributed into two groups: group A (39 patients), which consisted of patients who were diagnosed with CF at when they were younger than 14 years old and who survived into adulthood; and group B (50 patients), who were diagnosed with CF at the age of 14 years or older. Data on CF genetic mutations, nutritional state, evidence of pulmonary, gastrointestinal, liver, or pancreatic involvement were collected for each patient. RESULTS: The most prevalent genetic mutation in our series was deltaF508, present in 50 patients (56.2%), 29 of whom belonged to group A and 21 who belonged to group B. In group A, the deltaF508 mutation was associated with exocrine pancreatic insufficiency (PI) in 26 of 29 patients (89.6%), whereas in group B it was associated with PI in only four patients (19%). Overall, PI was present in 33 of 39 patients (84.6%) in group A and in eight of 50 patients (16%) in group B. Four patients in group B had experienced previous episodes of acute pancreatitis; two of them had associated PI. Of the 89 patients, 12 (10 in group A) were malnourished. Malnutrition was invariably associated with PI. Hepatic and biliary tree abnormalities were particularly prevalent in patients in group A and was usually associated with PI. Intestinal manifestations were uncommon. CONCLUSIONS: Diagnosis of CF before the age of 14 years is associated with greater gastrointestinal compromise than diagnosis at an older age, particularly with regard to PI. CF carriers of the deltaF508 mutation have an increased risk of developing gastrointestinal manifestations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 In the remaining 14 patients, ⌬F508 was carried with G542X, R1162X, N1303K, L206W, 1717-1G>A, 711+1G>T, or an unidentified mutation. Login to comment
56 5T, G542X, R334W, N1303K, L206W, 3659-C, and G85E were identified in the remaining nine patients. Login to comment
64 Other genotypes present in our series ⌬F508/711+1G>T 2A 5T/5T 1B ⌬F508/5T 2B ⌬1507/- 1A ⌬F508/R117H 2B R1162X/1898+1G>A 1A ⌬F508/R1162X 1A 2183A/- 1A ⌬F508/N1303K 1A 1609-CA/1811+1.6kbA>G 1A ⌬F508/3272-26A>G 1B 1609-CA/R347P 1A ⌬F508/D836Y 1B Q890X/- 1A ⌬F508/1717-1G>A 1A R334W/- 1B G542X/W1282X 1A N1303K/2789+5G>A 1B G542X/2789+5G>A 1B 3659-C/- 1B G542X/P205S 1B G85E/- 1B G542X/D1270N 1B Negative 1A, 20B L206W/- 1B Unknown 2A creatic insufficiency was highly prevalent, affecting 33 patients (84.6%). Login to comment

[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]

Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 More strikingly, the five mutations reported to account for 97% of Ashkenazi Jewish chromosomes (⌬F508, G542X, W1282X, N1303K, and 3849 ϩ 10 kbCϾT)16 accounted for only 39/48 chromosomes in this study (81.3%). Login to comment

[hide] Induction of HSP70 promotes DeltaF508 CFTR traffic... Am J Physiol Lung Cell Mol Physiol. 2001 Jul;281(1):L58-68. Choo-Kang LR, Zeitlin PL
Induction of HSP70 promotes DeltaF508 CFTR trafficking.
Am J Physiol Lung Cell Mol Physiol. 2001 Jul;281(1):L58-68., [PMID:11404246]

Abstract [show]
The DeltaF508 cystic fibrosis transmembrane conductance regulator (CFTR) is a temperature-sensitive trafficking mutant that is detected as an immature 160-kDa form (band B) in gel electrophoresis. The goal of this study was to test the hypothesis that HSP70, a member of the 70-kDa heat shock protein family, promotes DeltaF508 CFTR processing to the mature 180-kDa form (band C). Both pharmacological and genetic techniques were used to induce HSP70. IB3-1 cells were treated with sodium 4-phenylbutyrate (4PBA) to promote maturation of DeltaF508 CFTR to band C. A dose-dependent increase in band C and total cellular HSP70 was observed. Under these conditions, HSP70-CFTR complexes were increased and 70-kDa heat shock cognate protein-CFTR complexes were decreased. Increased DeltaF508 CFTR maturation was also seen after transfection with an HSP70 expression plasmid and exposure to glutamine, an inducer of HSP70. With immunofluorescence techniques, the increased appearance of CFTR band C correlated with CFTR distribution beyond the perinuclear regions. These data suggest that induction of HSP70 promotes DeltaF508 CFTR maturation and trafficking.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
281 Whether this approach would also overcome the defects caused by other trafficking mutants such as N1303K, P574H, or G480C remains to be tested. Login to comment

[hide] The use of intraallelic variability for testing ne... Genetics. 2001 Jun;158(2):865-74. Slatkin M, Bertorelle G
The use of intraallelic variability for testing neutrality and estimating population growth rate.
Genetics. 2001 Jun;158(2):865-74., [PMID:11404347]

Abstract [show]
To better understand the forces affecting individual alleles, we introduce a method for finding the joint distribution of the frequency of a neutral allele and the extent of variability at closely linked marker loci (the intraallelic variability). We model three types of intraallelic variability: (a) the number of nonrecombinants at a linked biallelic marker locus, (b) the length of a conserved haplotype, and (c) the number of mutations at a linked marker locus. If the population growth rate is known, the joint distribution provides the basis for a test of neutrality by testing whether the observed level of intraallelic variability is consistent with the observed allele frequency. If the population growth rate is unknown but neutrality can be assumed, the joint distribution provides the likelihood of the growth rate and leads to a maximum-likelihood estimate. We apply the method to data from published data sets for four loci in humans. We conclude that the Delta32 allele at CCR5 and a disease-associated allele at MLH1 arose recently and have been subject to strong selection. Alleles at PAH appear to be neutral and we estimate the recent growth rate of the European population to be approximately 0.027 per generation with a support interval of (0.017-0.037). Four of the relatively common alleles at CFTR also appear to be neutral but DeltaF508 appears to be significantly advantageous to heterozygous carriers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
253 the recent growth rate of European populations is not TABLE 2 Parameters and results for the CFTR data sets p n N0 ␮ ϭ 0.0001 ␮ ϭ 0.0005 ␮ ϭ 0.001 ␮ ϭ 0.0005 Mutation (ϫ10-4 ) i So (ϫ103 ) (ϫ107 ) (single) (single) (double) (double) ⌬F508 132 2112 59 160.0 20.0 0.0 0.0 6.0 ϫ 10-73 6.3 ϫ 10-21 ⌬F508 132 2112 118 160.0 20.0 0.0 5.5 ϫ 10-91 4.4 ϫ 10-39 1.0 ϫ 10-4 G542X 6.8 116 9 170.6 5.82 8.9 ϫ 10-8 0.012 0.231 0.907 N1303K 5.6 59 7 105.3 5.18 5.9 ϫ 10-4 0.180 0.639 0.977 1717-1G-A 3.2 24 3 75.0 4.38 0.031 0.370 0.695 0.945 R1162X 2.2 68 4 309.1 5.18 3.4 ϫ 10-4 0.082 0.313 0.829 Definitions are as in Table 1, except the mutation rates. Login to comment
271 TABLE 3 Values of ␹2 ϭ -2 log(L0/L*) calculated as described in the text for each allele at CFTR compared to the rest ␮ ϭ 0.00028: ␮ ϭ 0.00028: ␮ ϭ 0.00084: ␮ ϭ 0.00084: Mutation So ϭ 59 So ϭ 118 So ϭ 59 So ϭ 118 ⌬F508 20.3 11.0 19.6 4.6 G542X 5.8 1.4 5.4 0.8 N1303K 8.4 3.8 7.9 3.0 1717-1G-A 3.4 0.5 3.5 1.0 R1162X 1.8 0.6 1.6 0 So was estimated by using a parsimony algorithm to infer because they depend on assumed values of parameters and on a simplified model of past population growth.the minimum number of mutations necessary to gener- The results for CFTR are compatible with those for PAHate the observed haplotypes. Login to comment

[hide] Analysis of the entire coding region of the cystic... Hum Mutat. 2001 Aug;18(2):166. Castellani C, Gomez Lira M, Frulloni L, Delmarco A, Marzari M, Bonizzato A, Cavallini G, Pignatti P, Mastella G
Analysis of the entire coding region of the cystic fibrosis transmembrane regulator gene in idiopathic pancreatitis.
Hum Mutat. 2001 Aug;18(2):166., [PMID:11462247]

Abstract [show]
Many Cystic Fibrosis (CF) carriers have been detected testing some subjects with chronic pancreatitis for a limited number of mutations. The aim of this study was to find out if some subjects with pancreatitis and a CFTR mutation actually carry another, undetected mutation. We screened for 18 CFTR mutations plus the CFTR intron 8 poly(T) tract length a population of 67 patients suffering from idiopathic either acute, or recurrent acute, or chronic pancreatitis. Three of them were diagnosed as affected by CF. Among the others, a subset of 14 (8 CFTR mutation carriers, 4 5T carriers, and 2 sweat chloride borderliners) was selected and analyzed by denaturing gradient gel electrophoresis. Six possibly CF-related mutations were detected: L997F and 3878delG were found in two of the subjects already carrying another mutation, S1235R and L997F in one patient carrying the 5T, and L997F and D614G in the two patients with borderline sweat chloride. Among the 14 selected cases a total of 11 patients carried at least one mutation, and three of them were compound heterozygotes. Though it is debatable whether these three individuals can be considered affected by CF, their pancreatitis is possibly a clinical manifestation of some CFTR-related disease. Hum Mutat 18:166, 2001.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 Genetic analysis Phase 1 - Patients were tested for the following mutations: F508del, I507del, R117H, R1162X, 2183AA>G, N1303K, 3849+10KbC>T, G542X, 1717-1G>A, R347P, R352Q, R553X, Q552X, G85E, 711+5G>A, W1282X, 3132delTG and 2789+5G>A, plus the CFTR intron 8 poly(T) tract length. Login to comment
63 PATIENT A B C Sex (m/f) f f f Age (yrs) 27 60 53 Pancreatitis ICP IRAP IRAP CFTR mutations R1162X 2789+5G→A N1303K R117H R553X PolyT Splice Variant 7/7 7/9 7/9 Sweat Cl- (mEq/l) 108 42 91.75 Sweat Na+ (mEq/l) 106.5 42.8 84.25 NPD n.a. Basal and activated positive Basal negative, activated positive CF-compatible anamnestical and clinical features Chronic cough Lobectomy for bronchiectasis; hemoptysis and bronchial artery embolization Lobar atelectasis Sputum culture Staphylococcus aureus; Pseudomonas aeruginosa Staphylococcus aureus Staphylococcus aureus; Pseudomonas aeruginosa FVC (% predicted) 94 107 118 FEV1 (% predicted) 79 93 116 FEF25-75 (% predicted) 45 49 127 Chest X-ray Chrispin-Norman score 4 3 5 X-ray mucosal thickening of paranasal sinuses Maxillary bilateral Frontal bilateral Maxillary right Weight Z-score -0.86 0.08 -0.53 Height Z-score -0.28 -0.45 -0.12 Pancreatic evaluation § * Pancreatic sufficiency Pancreatic sufficiency n.a. : not available § : duodenal outputs of bicarbonate, lipase, amylase, trypsin and chymotrypsin assessed by pancreatic stimulation test * : normal fecal chymotrypsin and 72-hour steatorrhea The medical history disclosed in 20/53 (37.7%) cases one or more signs and symptoms frequently found in CF: diabetes in 9, sinusitis in 8, chronic cough in 7, malnutrition in 1, monolateral seminal vesicle agenesis in 1, lobectomy secondary to bronchiectasis in 1 and lobar atelectasis in 1 subject. Login to comment
81 She is a compound heterozygote, carrying N1303K and R117H. Login to comment

[hide] XV-2c/KM-19 haplotype analysis of cystic fibrosis ... Am J Med Genet. 2001 Aug 15;102(3):277-81. Orozco L, Gonzalez L, Chavez M, Velazquez R, Lezana JL, Saldana Y, Villarreal T, Carnevale A
XV-2c/KM-19 haplotype analysis of cystic fibrosis mutations in Mexican patients.
Am J Med Genet. 2001 Aug 15;102(3):277-81., 2001-08-15 [PMID:11484207]

Abstract [show]
We analyzed 97 unrelated Mexican cystic fibrosis (CF) patients and their first-degree relatives to study the association of XV2C/TaqI/KM19/PstI haplotypes with CF mutations in this population. Haplotype phases could be established in 148 CF and 110 normal chromosomes, and haplotype distributions of normal and CF chromosomes differed significantly (P < 0.001). DeltaF508 and G542X mutations accounted for 56% of CF chromosomes and were found to be associated with haplotype B in 97.2% and 72.7% of chromosomes, respectively. The haplotype distribution of CF chromosomes carrying other rare and unknown mutations was similar to that of normal chromosomes (P > 0.05), haplotypes A and C being the most frequent. This is in accordance with the extensive heterogeneity and the spectrum of mutations reported in Mexican CF patients. We also report the haplotype distribution of all informative chromosomes bearing rare mutations; some were found to be associated with previously reported haplotypes, whereas others were found on different haplotypes. Recombination or recurrence of mutations may explain these different associations, although other intragenic markers must be used to better understand the origin and dispersion of CF mutations in our country. XK haplotype analysis allowed carrier detection among sibs in 24.3% of families, showing that this method may be useful for carrier detection in populations with high allelic heterogeneity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Among those found in more than one chromosome, S549N was associated only with haplotype A, N1303K only with haplotype B, DI507 only with D, and 2055del9!A only with A. Login to comment
54 This ®gure is much lower than in European populations (48.8%) where several mutations such as G551D, N1303K, and W1282X are relatively frequent and associated with haplotype B (EWGCFG, 1990; Castaldo et al., 1996]. Login to comment
65 Distribution of XK Haplotype on Chromosomes Bearing Uncommon Cystic Fibrosis (CF) Mutations A B C D S549N 4/4 DI507 3/3 N1303K 3/3 2055 del9!A 2/2 I148T 1/1 406-1G!A 1/1 R75X 1/1 I506T 1/1 935delA 1/1 2183AA!G 1/1 1924del7 1/1 G551S 1/1 1078delT 1/1 R117H 1/1 384910KbC!T 1/1 1716G!A 1/1 W1204X 1/1 W1098C 1/1 846delT 1/1 R75Q 1/1 W1069X 1/1 L558S 1/1 4160insGGGG 1/1 297-1G!A 1/1 Fig. Login to comment
88 In contrast, we identi®ed one 384910kbC!T chromosome associated with haplotype C, as previously reported in Israel [Sereth et al., 1993], but differing from the Pueblo Amerindians, where this mutation was associated with haplotype A; the 2183AA!G chromosome was associated with haplotype D, but had been previously found on a B haplotype in Italy; N1303K was found on three haplotype B chromosomes, whereas in southern Europe this mutation has been associated mainly with haplotype B, but also with haplotypes A, C, and D [Petreska et al., 1998; Castaldo et al., 1996; Borrego et al., 1994; Claustres et al., 1996]. Login to comment

[hide] Intron-8 polythymidine sequence in Australasian in... Eur Respir J. 2001 Jun;17(6):1195-200. Massie RJ, Poplawski N, Wilcken B, Goldblatt J, Byrnes C, Robertson C
Intron-8 polythymidine sequence in Australasian individuals with CF mutations R117H and R117C.
Eur Respir J. 2001 Jun;17(6):1195-200., [PMID:11491164]

Abstract [show]
Compound heterozygotes for a severe cystic fibrosis transmembrane conductance regulator (CFTR) mutation and the R117H or R117C mutation (R117H/C) have clinical presentations that vary from classic cystic fibrosis (CF) to an incidental genetic finding. The aim of this study was to assess the influence of the intron-8 polythvmidine sequence (IVS8) on the relationship between genotype and phenotype of individuals with R117H/C. All individuals with R117H/C known to CF clinics in Australia and New Zealand were retrospectively studied by collecting information on genotype, age, pancreatic status, sweat electrolytes, sputum microbiology and pulmonary function. Forty-one individuals (39 with R117H and two with R117C), 16 on an IVS8-5T background and 25 on an IVS8-7T background were identified. Twelve individuals presented clinically, four were siblings of known R117H/C compound heterozygotes and 25 were detected by newborn screening. Eleven of 14 of the IVS8-5T group (78%) with sweat chloride results available had sweat CI > 60 mmol x L(-1) compared to 5 (20%) of the R117H/7T group (Chi-squared=10.4, p=0.001). Two were pancreatic insufficient, both IVS8-5T. Two IVS8-5T individuals have recently died (aged 43 and 19) and of the 14 surviving IVS8-5T group, 11 (79%) are symptomatic compared to eight (32%) of the IVS8-7T individuals (Chi-squared=6.1, p=0.01). In conclusion, most individuals with R117H/C on a IVS8-5T background have an elevated sweat chloride and clinical cystic fibrosis, which in some cases is severe. Most individuals with R117H/C on an IVS8-7T background do not have clinical cystic fibrosis but should be followed for the development of clinical disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 Infants with a positive (w60 mmol?L-1 ) or borderline (40 - 60 mmol?L-1 ) sweat chloride and in whom there is an unidentified mutation are referred for an extended mutation analysis which includes: DF508, R117H, G551D, A455E, G542X, N1303K, W1282X, 1717-1, R560T, R347P, R334W, R1162X, S549N, 621z1, 3849z10CwT, and the IVS8 polythymidine sequence. Login to comment

[hide] A combined analysis of the cystic fibrosis transme... Mol Biol Evol. 2001 Sep;18(9):1771-88. Chen JM, Cutler C, Jacques C, Boeuf G, Denamur E, Lecointre G, Mercier B, Cramb G, Ferec C
A combined analysis of the cystic fibrosis transmembrane conductance regulator: implications for structure and disease models.
Mol Biol Evol. 2001 Sep;18(9):1771-88., [PMID:11504857]

Abstract [show]
Over the past decade, nearly 1,000 variants have been identified in the cystic fibrosis transmembrane conductance regulator (CFTR) gene in classic and atypical cystic fibrosis (CF) patients worldwide, and an enormous wealth of information concerning the structure and function of the protein has also been accumulated. These data, if evaluated together in a sequence comparison of all currently available CFTR homologs, are likely to refine the global structure-function relationship of the protein, which will, in turn, facilitate interpretation of the identified mutations in the gene. Based on such a combined analysis, we had recently defined a "functional R domain" of the CFTR protein. First, presenting two full-length cDNA sequences (termed sCFTR-I and sCFTR-II) from the Atlantic salmon (Salmo salar) and an additional partial coding sequence from the eastern gray kangaroo (Macropus giganteus), this study went further to refine the boundaries of the two nucleotide-binding domains (NBDs) and the COOH-terminal tail (C-tail), wherein NBD1 was defined as going from P439 to G646, NBD2 as going from A1225 to E1417, and the C-tail as going from E1418 to L1480. This approach also provided further insights into the differential roles of the two halves of CFTR and highlighted several well-conserved motifs that may be involved in inter- or intramolecular interactions. Moreover, a serious concern that a certain fraction of missense mutations identified in the CFTR gene may not have functional consequences was raised. Finally, phylogenetic analysis of all the full-length CFTR amino acid sequences and an extended set of exon 13--coding nucleotide sequences reinforced the idea that the rabbit may represent a better CF model than the mouse and strengthened the assertion that a long-branch attraction artifact separates the murine rodents from the rabbit and the guinea pig, the other Glires.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
100 Moreover, all of the 11 most common missense mutations or single-amino-acid deletions (i.e., F508del, G551D, N1303K, R117H, R347P, I507del, G85E, R560T, A455E, R334W, and S549N) identified in classic and atypical CF patients worldwide (http://www.genet.sickkids.on.ca/cftr) occur in stringently conserved residues across the 15 CFTR sequences. Login to comment

[hide] The S549R (T-->G) cystic fibrosis gene mutation. J Trop Pediatr. 2001 Aug;47(4):196-8. Dawson KP, Frossard PM
The S549R (T-->G) cystic fibrosis gene mutation.
J Trop Pediatr. 2001 Aug;47(4):196-8., [PMID:11523757]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 Sporadic examples of other mutations occur, such as homozygous examples of N1303K. Login to comment

[hide] Silicon-based biosensors for rapid detection of pr... Clin Chem. 2001 Oct;47(10):1894-900. Jenison R, La H, Haeberli A, Ostroff R, Polisky B
Silicon-based biosensors for rapid detection of protein or nucleic acid targets.
Clin Chem. 2001 Oct;47(10):1894-900., [PMID:11568116]

Abstract [show]
BACKGROUND: We developed a silicon-based biosensor that generates visual, qualitative results or quantitative results for the detection of protein or nucleic acid targets in a multiplex format. METHODS: Capture probes were immobilized either passively or covalently on the optically coated surface of the biosensor. Intermolecular interactions of the immobilized capture probe with specific target molecules were transduced into a molecular thin film. Thin films were generated by enzyme-catalyzed deposition in the vicinity of the surface-bound target. The increased thickness on the surface changed the apparent color of the biosensor by altering the interference pattern of reflected light. RESULTS: Cytokine detection was achieved in a 40-min multiplex assay. Detection limits were 4 ng/L for interleukin (IL)-6, 31 ng/L for IL1-beta, and 437 ng/L for interferon-gamma. In multianalyte experiments, cytokines were specifically detected with signal-to-noise ratios ranging from 15 to 80. With a modified optical surface, specificity was also demonstrated in a nucleic acid array with unambiguous discrimination of single-base changes in a 15-min assay. For homozygous wild-type and homozygous mutant samples, signal-to-noise ratios of approximately 100 were observed. Heterozygous samples yielded approximately equivalent signals for wild-type and mutant capture probes. CONCLUSIONS: The thin-film biosensor allows rapid, sensitive, and specific detection of protein or nucleic acid targets in an array format with results read visually or quantified with a charge-coupled device camera. This biosensor is suited for multianalyte detection in clinical diagnostic assays.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Capture sequences were as follows: For ⌬F508, the wild type was 5Ј-YAC AAC ACC AAA GAT GAT ATT TT-3Ј, and the mutant was 5Ј-YCC GAA ACA CCA ATG ATA TTT TC-3Ј For N1303K, the wild type was 5Ј-YAC GGA TCC AAG TTT TTT CTA A-3Ј, and the mutant was 5Ј-YAC GGA TCC AAC TTT TTT CTA A-3Ј For G551D, the wild type was 5Ј-YAA CTC GTT GAC CTC CAC TC-3Ј, and the mutant was 5Ј-YAA CTC GTT GAT CTC CAC TC-3Ј For G542X, the wild type was 5Ј-YAA CAC CTT CTC CAA GAA CTA TA-3Ј, and the mutant was 5Ј-XAA CAC CTT CTC AAA GAA CTA TA-3Ј antibody immobilization Capture antibodies were diluted to 2 mg/L in 0.1 mol/L sodium bicarbonate buffer, pH 9.3, and 200 nL was spotted using a Hamilton MP2200 pipetting robot equipped with a modified dispense head. Login to comment
79 Input concentrations for the probe sets was as follows: ⌬F508, 150 nmol/L for both the wild type and mutant; G542X, 75 nmol/L for the wild type and 750 nmol/L for the mutant; N1303K, 300 nmol/L for both the wild type and mutant; G551D, 150 nmol/L for both the wild type and mutant. Login to comment
119 One mutation, ⌬F508, is a 3-bp deletion, whereas the other three, G542X, G551D, and N1303K, are SNPs. Login to comment

[hide] Mutations of the cystic fibrosis gene in patients ... Am J Gastroenterol. 2001 Sep;96(9):2657-61. Truninger K, Malik N, Ammann RW, Muellhaupt B, Seifert B, Muller HJ, Blum HE
Mutations of the cystic fibrosis gene in patients with chronic pancreatitis.
Am J Gastroenterol. 2001 Sep;96(9):2657-61., [PMID:11569691]

Abstract [show]
OBJECTIVE: Several studies have reported an increased frequency of cystic fibrosis gene mutations in idiopathic but not in alcoholic chronic pancreatitis. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis has not been analyzed. The aim of our study was to determine the frequency of cystic fibrosis gene mutations in patients with chronic pancreatitis with long-term follow-up and to see whether patients with mutations have a clinically different natural course compared to those without mutations. METHODS: Eighty two patients with chronic pancreatitis and 11 patients with recurrent acute pancreatitis of our well defined pancreatitis cohort were screened for the 31 most common cystic fibrosis gene mutations. The impact of cystic fibrosis gene mutations on the long-term course of chronic pancreatitis was assessed. RESULTS: A cystic fibrosis gene mutation was detected in five of 49 patients with alcoholic chronic pancreatitis (10.2%; 2.3 times the expected frequency) and in three of 14 patients with idiopathic-juvenile chronic pancreatitis (21.4%; 4.8 times the expected frequency). No mutations were found in the remaining patients with chronic pancreatitis of rare causes, hereditary pancreatitis, and recurrent acute pancreatitis. The frequency of pancreatic calcifications was significantly higher in patients with alcoholic chronic pancreatitis without mutations. This result was not confirmed in patients with idiopathic-juvenile chronic pancreatitis. The duration of pain and the frequency of exocrine and endocrine insufficiency was comparable in both subgroups irrespective of the mutation status. CONCLUSION: Our data indicate a significantly increased frequency of cystic fibrosis gene mutations both in patients with alcoholic and idiopathic-juvenile chronic pancreatitis. The natural course was similar in patients with mutations compared to those without mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Using multiplex PCR, 15 genomic fragments were amplified which contain the following mutations: ⌬F508, ⌬I507, Q493X, V520F, 1717-1G3A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ϩ 10kbC3T, 3849 ϩ 4A3G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 ϩ 1G3T, R117H, Y122X, 711 ϩ 1G3T; 1078delT, R347P, R347H, R334W, A455E, 1898 ϩ 1G3A, 2183AA3G, 2789 ϩ 5G3A. Login to comment

[hide] Cystic fibrosis phenotype evaluation and paternity... Hum Reprod. 2001 Oct;16(10):2093-7. Josserand RN, Bey-Omar F, Rollet J, Lejeune H, Boggio D, Durand DV, Durieu I
Cystic fibrosis phenotype evaluation and paternity outcome in 50 males with congenital bilateral absence of vas deferens.
Hum Reprod. 2001 Oct;16(10):2093-7., [PMID:11574497]

Abstract [show]
BACKGROUND: Most infertile males with congenital bilateral absence of vas deferens (CBAVD) carry mutations on the cystic fibrosis transmembrane conductance regulator gene and may express mild cystic fibrosis (CF) symptoms. Barriers to paternity for these men can now be overcome by assisted reproduction. Our aims were to investigate the CF-related phenotype and clinical outcome for 50 patients with CBAVD seen at a CF adult centre between 1992 and 1999. METHODS AND RESULTS: The investigation of the patients included screening for 22 CF mutations and identification of the poly-T variant of intron 8, sweat testing, clinical investigation for CF-related extra-genital manifestations, and genetic counselling. CFTR mutations were detected on 56 alleles of the 50 patients. A total of 15 (30%) was compound heterozygote and 26 (52%) heterozygote. In all, 38% of the patients had a positive sweat test. Four patients were diagnosed with typical CF not detected previously. Twenty-one patients became fathers following ICSI (eight cases), artificial insemination by donor or IVF with sperm donor (seven cases) or through adoption (six cases). A mail survey allowed the identification of CF-related clinical symptoms. Information on the occurrence of CF-related symptoms was obtained for 58.5% of patients: in the absence of initial symptoms, no new clinical signs were reported. CONCLUSION: Patients diagnosed with CBAVD need genetic counselling before assisted reproduction. Even when no wish for paternity is expressed, CF gene screening should be associated with at least a sweat test and clinical evaluation because of possible mild forms of CF disease. Medical follow-up did not reveal any new symptoms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Leukocytes samples were analysed for a series of 22 CF mutations including the five most frequently encountered in our region (The CF Genotype Consortium, 1994): ∆F508, G542X, N1303K, 1717-G-A, 885E; and 17 others: R117H, R334W, R347H, R347P, 556delA, S549N, S549I, S549R, G551D, R553X, R560T, G1244E, S1255X, W1282X, R1283K, 3898ins C, D1270N. Login to comment

[hide] Analysis of exocrine pancreatic function in cystic... Eur J Clin Invest. 2001 Sep;31(9):796-801. Walkowiak J, Herzig KH, Witt M, Pogorzelski A, Piotrowski R, Barra E, Sobczynska-Tomaszewska A, Trawinska-Bartnicka M, Strzykala K, Cichy W, Sands D, Rutkiewicz E, Krawczynski M
Analysis of exocrine pancreatic function in cystic fibrosis: one mild CFTR mutation does not exclude pancreatic insufficiency.
Eur J Clin Invest. 2001 Sep;31(9):796-801., [PMID:11589722]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most common cause of exocrine pancreatic insufficiency in childhood. The aim of the present study is to evaluate the correlation between genotype and exocrine pancreatic insufficiency in CF patients. The special emphasis was put on the analysis of mild CFTR mutations. DESIGN: The study comprised 394 CF patients and 105 healthy subjects (HS). Elastase-1 concentrations were measured in all subjects. RESULTS: Severe pancreatic insufficiency was associated with the presence of two CFTR gene mutations (DeltaF508, N1303K, CFTR dele 2,3 (21kb), G542X, 1717-1G-A, R533X, W1282X, 621GT, 2183AAG, R560T, 2184insA and DeltaI507, G551D, 895T) and mild insufficiency with the presence of at least one mutation (R117H, 3171insC, A155P2, 138insL, 296 + 1G-A, E92GK, E217G, 2789 + 5G-A. 3849 + 1kbC-T/3849 + 1kbC-T) genotype resulted in high elastase-1-values. However, in case of patients with genotype DeltaF508/3849 + 10kbC-T, 1717-1GA/3849 + 10kbC-T as well as with DeltaF508/R334W, both high and low elastase-1 concentrations were found. Low E1 values were found in a patient with DeltaF508/R347P genotype. CONCLUSION: Patients who carry two 'severe' mutations develop pancreatic insufficiency, whereas those who carry at least one 'mild' usually remain pancreatic sufficient. However, the presence of one mild mutation does not exclude pancreatic insufficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Results Severe pancreatic insufficiency was associated with the presence of two CFTR gene mutations (DF508, N1303K, CFTR dele 2,3 (21kb), G542X, 1717±1G-A, R533X, W1282X, 621GT, 2183AAG, R560T, 2184insA and DI507, G551D, 895T) and mild insufficiency with the presence of at least one mutation (R117H, 3171insC, A155P2, 138insL, 296 1 1G-A, E92GK, E217G, 2789 1 5G-A. Login to comment
51 Results Among 394 genotyped CF patients, the following mutations on alleles were found (n): DF508 (464), 3849 1 10kbC-T (30), CFTR dele2,3(21 kB) (21), N1303K (15), G542X (12), 1717±1G-A (9), R533X (6), W1282X (6), 621 1 G-T (3), R117H (2), 3171insC (2), A155P2 (2), 2183AAG (2), R334W (2), 895T (2), 296 1 1G-A (2), E92GK (2), 138insL (1), E217G (1), 2789 1 5G-A (1), R347P (1), R560T (1), 2184insA (1), I507 (1), G551D (1). Login to comment
57 CFTR gene mutations were classified as `severe' (E1 , 96 mg g21 ) ± severely affecting pancreatic function (DF508, N1303K, CFTR dele 2,3 (21kb), G542X, 1717±1G-A, R533X, W1282X, 621 1 1G-T, 2183AAG, 895T, R560T, 2184insA, DI507, G551D) and `mild' (E1 . Login to comment
81 500 DF508/3849 1 10kbC-T (17) 1 4 1 6 5 DF508/CFTR dele2,3(21kb) (15) 9 4 2 DF508/N1303K (10) 7 3 DF508/1717±1G-A (7) 5 2 DF508/G542X (7) 4 2 1 DF508/W1282X (5) 4 1 DF508/R553X (3) 3 DF508/R334W (2) 1 1 DF508/2183AAG (2) 2 DF508/R117H (1) 1 DF508/621GT (1) 1 DF508/R347P (1) 1 DF508/2184insA (1) 1 DF508/DI507 (1) 1 3849 1 10kbC-T/3849 1 10kbC-T (3) 3 N1303K/CFTR dele2,3(21kb) (2) 1 1 1717±1G-A/3849 1 10kbC-T (2) 1 1 3171insC/A155P2 (2) 1 1 296 1 1G-A/E92GK (2) 2 R117H/138insL (1) 1 W1282X/3849 1 10kbC-T (1) 1 N1303K/3849 1 10kbC-T (1) 1 CFTR dele2,3(21kb)/3849 1 10kbC-T (1) 1 R553X/G542X (1) 1 621 1 1G-T/621 1 1G-T (1) 1 G542X/M (4) 2 2 CFTR dele 2,3(21kb)/M (1) 1 2 3849 1 10kbC-T/M (2) 1 1 R533X/M (2) 2 N1303K/M (2) 2 895T/M (2) 1 1 E217G/M (1) 1 G551D/M (1) 1 R560T/M (1) 1 2789 1 5G-A/M (1) 1 Total (109) 44 21 10 4 12 18 M, unidentified mutation. Login to comment
88 An international Cystic Fibrosis Genotype-Phenotype Consortium [25] evaluated DF508 homozygotes and seven of the most common DF508 compound heterozygotes (G542X, R553X, N1303K, W1282X, 1717±1G-A, 621 1 1GT, R117H). Login to comment
90 N1303K was found to be a severe mutation in addition to E827X, W846X, while 4382delA, 3272±26G-A and 3849 1 10kbCT were assessed as mild ones [8]. Login to comment

[hide] Improved detection of CFTR mutations in Southern C... Hum Mutat. 2001 Oct;18(4):296-307. Wong LJ, Wang J, Zhang YH, Hsu E, Heim RA, Bowman CM, Woo MS
Improved detection of CFTR mutations in Southern California Hispanic CF patients.
Hum Mutat. 2001 Oct;18(4):296-307., [PMID:11668613]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause cystic fibrosis (CF), a common autosomal recessive disease in Caucasians. The broad mutation spectrum varies among different patient groups. Current molecular diagnoses are designed to detect 80-97% of CF chromosomes in Caucasians and Ashkenazi Jews but have a much lower detection rate in Hispanic CF patients. Grebe et al. [1994] reported a 58% detection rate in Hispanic patients. Since then, there has been no large-scale, complete mutational analysis of Hispanic CF patients. In this study, the mutations in 62 Hispanic patients from southern California were investigated. The entire coding and flanking intronic regions of the CFTR gene were analyzed by temporal temperature gradient gel electrophoresis (TTGE) followed by sequencing to identify the mutations. Eleven novel mutations were discovered in this patient group: 3876delA, 406-1G>A, 935delA, 663delT, 3271delGG, 2105-2117del13insAGAAA, 3199del6, Q179K, 2108delA, 3171delC, and 3500-2A>T. Among the mutations, seven were out-of-frame insertions and deletions that result in truncated proteins, two were splice-site mutations, one was an in-frame 6 bp deletion, and one was a missense mutation that involved the non-conservative change of glutamine-179 to lysine. All patients presented severe classical clinical course with pancreatic insufficiency and poor growth, consistent with the nature of truncation mutation. The results indicate that TTGE screening following the analysis of recurrent mutations will substantially improve the mutation detection rate for Hispanic CF patients from southern California.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 Summary of Mutations Found in This Group of Hispanic Patients Exon or Number of Mutation intron chromosomes Frequency % Mutations detected before full gene analysis 91 73.38% 1 F508 10 64 51.6 2 G542X 11 5 4 3 3849+10kb C>T Intron 19 5 4 4 S549N 11 3 2.4 5 I148T 4 2 1.6 6 3120+1G>A 16 2 1.6 7 R334W 7 2 1.6 8 G551D 11 1 0.8 9 N1303K 21 1 0.8 10 W1282X 20 1 0.8 11 R1162X 19 1 0.8 12 G85E 3 1 0.8 13 W1089X 17b 1 0.8 14 Y1092X 17b 1 0.8 15 P205S 6a 1 0.8 Mutations detected by full gene screening 26 20.97% 16 R1066Ca 17b 2 1.6 17 1949del84 13 1 0.8 18 2184delA 13 1 0.8 19 Q98R 4 1 0.8 20 R75X 3 1 0.8 21 G1244E 20 1 0.8 22 3876delA 20 7 5.65 23 935delA 6b 2 1.6 24 406-1G>A Intron 2 2 1.6 25 3271delGG 17a 1 0.8 26 2105-2117del13insAGAAA 13 1 0.8 27 663delT 5 1 0.8 28 3171delC 17a 1 0.8 29 2108delA 13 1 0.8 30 Q179K 5 1 0.8 31 3199del6 17a 1 0.8 32 3500-2 A->T Intron 17b 1 0.8 Total identified 117 (177)b 94.35 (97.5)b Unidentified 7 (3)b 5.65 (2.5)b Total 124 (120)b 100 (100)b a This mutation was also detected by SSCP. Login to comment

[hide] Genetic risk factors in infertile men with severe ... Hum Reprod. 2002 Jan;17(1):13-6. Dohle GR, Halley DJ, Van Hemel JO, van den Ouwel AM, Pieters MH, Weber RF, Govaerts LC
Genetic risk factors in infertile men with severe oligozoospermia and azoospermia.
Hum Reprod. 2002 Jan;17(1):13-6., [PMID:11756355]

Abstract [show]
BACKGROUND: Male infertility due to severe oligozoospermia and azoospermia has been associated with a number of genetic risk factors. METHODS: In this study 150 men from couples requesting ICSI were investigated for genetic abnormalities, such as constitutive chromosome abnormalities, microdeletions of the Y chromosome (AZF region) and mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. RESULTS: Genetic analysis identified 16/150 (10.6%) abnormal karyotypes, 8/150 (5.3%) AZFc deletions and 14/150 (9.3%) CFTR gene mutations. An abnormal karyotype was found both in men with oligozoospermia and azoospermia: 9 men had a sex-chromosomal aneuploidy, 6 translocations were identified and one marker chromosome was found. Y chromosomal microdeletions were mainly associated with male infertility, due to testicular insufficiency. All deletions identified comprised the AZFc region, containing the Deleted in Azoospermia (DAZ) gene. CFTR gene mutations were commonly seen in men with congenital absence of the vas deferens, but also in 16% of men with azoospermia without any apparent abnormality of the vas deferens. CONCLUSIONS: A genetic abnormality was identified in 36/150 (24%) men with extreme oligozoospermia and azoospermia. Application of ICSI in these couples can result in offspring with an enhanced risk of unbalanced chromosome complement, male infertility due to the transmission of a Y-chromosomal microdeletion, and cystic fibrosis if both partners are CFTR gene mutation carriers. Genetic testing and counselling is clearly indicated for these couples before ICSI is considered.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 Twelve common mutations of the CFTR gene were tested (∆F508, A445E, G542X, 1717-1G→A, R553X, R117H, R1162X, N1303K, W1282X, 3659delC, E60X and S1251N). Login to comment

[hide] ATB(0)/SLC1A5 gene. Fine localisation and exclusio... Eur J Hum Genet. 2001 Nov;9(11):860-6. Larriba S, Sumoy L, Ramos MD, Gimenez J, Estivill X, Casals T, Nunes V
ATB(0)/SLC1A5 gene. Fine localisation and exclusion of association with the intestinal phenotype of cystic fibrosis.
Eur J Hum Genet. 2001 Nov;9(11):860-6., [PMID:11781704]

Abstract [show]
The Na+-dependent amino acid transporter named ATB(0) was previously found to be located in 19q13.3 by fluorescence in situ hybridisation. Genetic heterogeneity in the 19q13.2-13.4 region, syntenic to the Cystic Fibrosis Modulator Locus 1 (CFM1) in mouse, seemed to be associated to the intestinal phenotypic variation of cystic fibrosis (CF). We performed fine chromosomal mapping of ATB(0) on radiation hybrid (RH) panels G3 and TNG. Based on the most accurate location results from TNG-RH panel, mapping analysis evidenced that ATB(0) is localised between STS SHGC-13875 (D19S995) and STS SHGC-6138 in 19q13.3, that corresponds with the immediately telomeric/distal segment of the strongest linkage region within the human CFM1 (hCFM1) syntenic region. Regarding to the genomic structure and exon organisation, our results show that the ATB(0) gene is organised into eight exons. The knowledge of the genomic structure allowed us to perform an exhaustive mutational analysis of the gene. Evaluation of the possible implication of ATB(0) in the intestinal phenotype of CF was performed on the basis of the functional characteristics of the encoded protein, its apparent relevance to meconium ileus (MI) and position in relation to the hCFM1 syntenic region. We have analysed this gene in samples from CF patients with and without MI. Several sequence variations in the ATB(0) gene were identified, although none of them seemed to be related to the intestinal phenotype of CF. Even though no particular allele or haplotype in ATB(0) appears to be associated to CF-MI disease, new SNPs identified should be useful in segregation and linkage disequilibrium analyses in families affected by other disorders caused by the impairment of neutral amino acid transport.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
151 Statistical analysis showed that the higher incidence for P17A and the lower incidence for V512L observed in the general population Table 3 CFTR mutations of the CF patients under study with and without meconium ileus (MI) CF-non MI CF-MI CFTR mutations n CFTR mutations n F508del/R117H 2 F508del/F508del 7 F508del/R334W 3 F508del/L365P 1 F508del/R347P 1 F508del/G542X 1 F508del/621+1G4Ta 1 F508del/621+IG4Ta 1 F508del/M1101K 1 F508del/R1066C 1 F508del/1609delCAa 1 F508del/W1089X 1 F508del/2789+5G4Aa 3 F508del/R1162X 1 F508del/3849+10kbC4T 1 F508del/1609delCAa 1 G542X/G85E 1 F508del/Q1281X 1 G542X/V232D 1 F508del/1811+1.6kbA4G 1 G542X/1811+1.6kb A4Ga 1 F508del/2789+5G4Aa 1 G542X/2789+5G4A 1 F508del/2869insG 1 Q890X/L206W 1 F508del/unknown 1 1811+1.6kbA4G/P205S 1 I507del/I507del 1 R1162X/3272-26A4G 1 G542X/1078delT 1 N1303K/R347H 1 G542X/1811+1.6kbA4Ga 1 N1303K/A1006E+5T 1 S549R/CFTR50kbdel 1 2789+5G4A/405+1G4A 1 R1066C/R1066C 1 W1282X/712-1G4T 1 a CF patient with a sibling presenting identical CFTR genotype and discordance of intestinal phenotype. Login to comment

[hide] Cystic fibrosis mutation testing in Italy. Genet Test. 2001 Fall;5(3):229-33. Bombieri C, Pignatti PF
Cystic fibrosis mutation testing in Italy.
Genet Test. 2001 Fall;5(3):229-33., [PMID:11788089]

Abstract [show]
In Italy, Cystic fibrosis (CF) mutation frequency differences have been observed in different regions. In the northeastern Veneto and Trentino Alto Adige regions, a complete cystic fibrosis transmembrane conductance regulator (CFTR) gene screening in CF patients detected through a newborn screening program has identified about 90% of the mutations. In these two regions, the current detection rate using a CF screening panel containing the 16 most common mutations is 86.6%. CF mutations in some other Italian regions have not been so thoroughly analysed. Available data indicate that a more general national screening panel comprising 31 mutations may detect about 75% of all CF mutations in Italy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 CF MUTATIONS IDENTIFIED IN TWO ITALIAN REGIONS (VENETO AND TRENTINO ALTO ADIGE) Number of alleles Frequency Cumulative Mutation with mutation (%) frequency (%) DF508 107 47.6 47.56 R1162X 22 9.8 57.33 2183 AA ® G 21 9.3 66.67 N1303K 9 4.0 70.67 G542X 6 2.7 73.33 711 1 5 G ® A 6 2.7 76.00 1717-1 G ® A 5 2.2 78.22 G85E 3 1.3 79.56 R553X 3 1.3 80.89 2789 1 5 G ® A 3 1.3 82.22 Q552X 3 1.3 83.56 621 1 1 G ® T 2 0.9 84.44 W1282X 2 0.9 85.33 R347P 1 0.4 85.77 G551D 1 0.4 86.21 3849 1 10 Kb C ® T 1 0.4 86.67a 3132 del TG 2 0.9 87.54 2790-2 A ® G 2 0.9 88.43 457 TAT ® G 1 0.4 88.87 1717-8 G ® A 1 0.4 89.31 R709X 1 0.4 89.75 1898 1 3 A ® G 1 0.4 90.22 Total 203 90.22 Numbers refer to CFTR gene alleles carrying the specified mutation, over total tested alleles (n 5 225) from the affected subjects CF cohort, as indicated in the text (from Bonizzato et al., 1995). Login to comment
38 CF MUTATION PANEL (VENETO AND TRENTINO ALTO ADIGE ITALIAN REGIONS) DF508 R1162X 2183 AA ® G N1303K G542X 711 1 5 G ® A 1717-1 G ® A G85E R553X 2789 1 5 G ® A Q552X 621 1 1 G ® T W1282X R347P G551D 3849 1 10 Kb C ® T Note: Contrary to what is suggested for the U.S. population (Grody et al., 2001), R117H mutation (and its reflex IVS8-5T test) is not included in the panel because it is not commonly found in the Italian CF population (Bonizzato et al., 1995; Estivill et al., 1997; Rendine et al., 1997). Login to comment
44 CF GENE MUTATIONS IN ITALY Number of alleles Frequency Cumulative Mutation screened (%) frequency (%) DF508 3442 51.07 51.07 N1303K 3056 4.84 55.91 G542X 3082 4.83 60.75 2183 AA ® G 2596 2.66 63.41 R1162X 2580 2.42 65.83 1717-1 G ® A 2892 2.11 67.94 W1282X 2600 1.23 69.17 R553X 2882 1.15 70.31 T338I 2306 0.69 71.01 R347P 2642 0.61 71.61 711 1 5 G ® A 2454 0.57 72.18 G85E 1980 0.40 72.59 621 1 1 G ® T 2594 0.39 72.97 R334W 2366 0.30 73.27 R352Q 2112 0.24 73.50 S549N 2118 0.24 73.74 R347H 2184 0.18 73.92 L1077P 1840 0.16 74.09 R1158X 1878 0.16 74.25 541del C 1884 0.16 74.40 R1066H 1918 0.16 74.56 E585X 1922 0.16 74.72 Q552X 2172 0.14 74.86 D1152H 1824 0.11 74.97 2790-2 A ® G 1862 0.11 75.07 3132 del TG 1862 0.11 75.18 3667ins 4 1876 0.11 75.29 DI507 1914 0.10 75.39 1898 1 3 A ® G 1920 0.10 75.50 G1244E 1960 0.10 75.60 1784 del G 2052 0.10 75.69 From Rendine et al. (1997). Login to comment

[hide] Mutations that change the position of the putative... J Biol Chem. 2002 Jan 18;277(3):2125-31. Berger AL, Ikuma M, Hunt JF, Thomas PJ, Welsh MJ
Mutations that change the position of the putative gamma-phosphate linker in the nucleotide binding domains of CFTR alter channel gating.
J Biol Chem. 2002 Jan 18;277(3):2125-31., 2002-01-18 [PMID:11788611]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel is an ATP-binding cassette transporter that contains conserved nucleotide-binding domains (NBDs). In CFTR, the NBDs bind and hydrolyze ATP to open and close the channel. Crystal structures of related NBDs suggest a structural model with an important signaling role for a gamma-phosphate linker peptide that couples bound nucleotide to movement of an alpha-helical subdomain. We mutated two residues in CFTR that the structural model predicts will uncouple effects of nucleotide binding from movement of the alpha-helical subdomain. These residues are Gln-493 and Gln-1291, which may directly connect the ATP gamma-phosphate to the gamma-phosphate linker, and residues Asn-505 and Asn-1303, which may form hydrogen bonds that stabilize the linker. In NBD1, Q493A reduced the frequency of channel opening, suggesting a role for this residue in coupling ATP binding to channel opening. In contrast, N505C increased the frequency of channel opening, consistent with a role for Asn-505 in stabilizing the inactive state of the NBD. In NBD2, Q1291A decreased the effects of pyrophosphate without altering other functions. Mutations of Asn-1303 decreased the rate of channel opening and closing, suggesting an important role for NBD2 in controlling channel burst duration. These findings are consistent with both the bacterial NBD structural model and gating models for CFTR. Our results extend models of nucleotide-induced structural changes from bacterial NBDs to a functional mammalian ATP-binding cassette transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
160 The single-channel gating of CFTR-N1303K, a relatively frequent CF-associated mutation, showed a long burst duration and a long interburst interval (Fig. 8). Login to comment
168 between CFTR-N1303K and CFTR-K1250A, we examined the effect of PPi and ADP. Login to comment
169 The N1303K mutation prevented PPi-dependent stimulation of current and eliminated ADP-dependent current inhibition (Fig. 9). Login to comment
170 Pyrophosphate caused only a 26.9 Ϯ 18.6% (n ϭ 4) increase in current for the CFTR-N1303K channel, and ADP caused only a 3.2 Ϯ 6.8% (n ϭ 3) inhibition in current. Login to comment
180 Comparison of single-channel kinetics of CFTR-N1303K, CFTR-N1303H, CFTR-N1303I, and CFTR-N1303A. Login to comment
184 Pyrophosphate and ADP did not affect CFTR-N1303K. Login to comment
187 Addition of 4 mM PPi increased the burst duration of wild type CFTR but did not alter the burst duration of CFTR-N1303K. The addition of 1 mM ADP increased the interburst interval of CFTR but did not affect CFTR-N1303K. with mutation of the NBD1 Walker A lysine (9, 10, 22, 35). Login to comment
207 N1303K is a frequent CF-associated mutation that has been shown to affect channel processing (42). Login to comment

[hide] Association between genetically determined pancrea... Chest. 2002 Jan;121(1):73-80. Loubieres Y, Grenet D, Simon-Bouy B, Medioni J, Landais P, Ferec C, Stern M
Association between genetically determined pancreatic status and lung disease in adult cystic fibrosis patients.
Chest. 2002 Jan;121(1):73-80., [PMID:11796434]

Abstract [show]
STUDY OBJECTIVES: The association between genotype and phenotype in cystic fibrosis (CF) has been clearly established for pancreatic status, but not for lung disease. DESIGN: Retrospective study. SETTING: A respiratory unit of a teaching hospital. PATIENTS: We studied 51 adult CF patients for whom current data and genotype were available. Thirty-seven patients carried two severe mutations associated with pancreatic insufficiency phenotype (group S). Fourteen patients carried at least one mild (and dominant) mutation associated with pancreatic sufficiency phenotype (group M). MEASUREMENTS: We compared the course of the disease between the two groups, looking for a genotype/phenotype association for lung disease. RESULTS: The mean age of the population was 30 years. Patients with two severe mutations presented more severe disease with earlier onset (1.7 years vs 7.9 years, p = 0.0001). They presented with a more severe respiratory impairment, with a lower mean FEV(1) (29% of predictive value vs 58% of predictive value, p < 0.001); a higher Pseudomonas colonization rate (97% vs 57%, p < 0.01); a more frequent end-stage respiratory insufficiency, defined by a FEV(1) < 30% (73% vs 29%, p < 0.05); and a more marked yearly decline of FEV(1) (3% vs 1.4%, p < 0.001). By multivariate logistic regression analysis, carrying two severe mutations was the only independent predictor of a terminal respiratory insufficiency (relative risk, 6.75; 95% confidence interval, 1.79 to 26.50; p = 0.003). CONCLUSION: This study suggests that pulmonary disease appears to be associated with the severity of CF transmembrane regulator mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 The most frequent CF mutations usually found in the French population (⌬F508, ⌬I507, 1717-1G3A, G542X, G551D, R553X, W1282X, N1303K) were analyzed by polymerase chain reaction and allele-specific oligonucleotide with the INNO-LIPA CF2 kit (Innogenetics; Zwijnaarde, Belgium). Login to comment

[hide] Activation of ion secretion via proteinase-activat... Am J Physiol Gastrointest Liver Physiol. 2002 Feb;282(2):G200-10. Mall M, Gonska T, Thomas J, Hirtz S, Schreiber R, Kunzelmann K
Activation of ion secretion via proteinase-activated receptor-2 in human colon.
Am J Physiol Gastrointest Liver Physiol. 2002 Feb;282(2):G200-10., [PMID:11804840]

Abstract [show]
Proteinase-activated receptor (PAR) type 2 (PAR-2) has been shown to mediate ion secretion in cultured epithelial cells and rat jejunum. With the use of a microUssing chamber, we demonstrate the role of PAR-2 for ion transport in native human colonic mucosa obtained from 30 normal individuals and 11 cystic fibrosis (CF) patients. Trypsin induced Cl(-) secretion when added to the basolateral but not luminal side of normal epithelia. Activation of Cl(-) secretion by trypsin was inhibited by indomethacin and was further increased by cAMP in normal tissues but was not present in CF colon, indicating the requirement of luminal CF transmembrane conductance regulator. Effects of trypsin were largely reduced by low Cl(-), by basolateral bumetanide, and in the presence of barium or clotrimazole, but not by tetrodotoxin. Furthermore, trypsin-induced secretion was inhibited by the Ca(2+)-ATPase inhibitor cyclopiazonic acid and in low-Ca(2+) buffer. The effects of trypsin were almost abolished by trypsin inhibitor. Thrombin, an activator of PAR types 1, 3, and 4, had no effects on equivalent short-circuit currents. The presence of PAR-2 in human colon epithelium was confirmed by RT-PCR and additional experiments with PAR-2-activating peptide. PAR-2-mediated intestinal electrolyte secretion by release of mast cell tryptase and potentiation of PAR-2 expression by tumor necrosis factor-alpha may contribute to the hypersecretion observed in inflammatory processes such as chronic inflammatory bowel disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Testing of an additional panel of the 19 most prevalent CFTR mutations among the Caucasian population in Europe, including G542X, N1303K, 1717-1 GϾT, W1282X, G551D, R553X, R1162X, R334W, R117H, 621ϩ1GϾT, 3849ϩ10kbCϾT, 3659delC, 1078delT, R347P, A445E, S1251N, ⌬I507, 2183AAϾG, and E60X (ELUCIGENE CF20; AstraZeneca Diagnostics) failed to identify the second disease causing mutation in six CF patients. Login to comment

[hide] Genetic risk factors in chronic pancreatitis. J Gastroenterol. 2002 Jan;37(1):1-9. Teich N, Ockenga J, Keim V, Mossner J
Genetic risk factors in chronic pancreatitis.
J Gastroenterol. 2002 Jan;37(1):1-9., [PMID:11824793]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 Approximately 72% of patients with cystic fibrosis are homozygous or compound heterozygous for eight mutations of the CFTR gene on chromosome 7: delta F508, G542X, R553X, W1282X, N1303K, 621 ϩ 1GÆT, 1717-1GÆA, and R117H; whereas the deletion delta F508 alone accounts for about 66% of mutant cystic fibrosis alleles. Login to comment

[hide] Identification of a new cystic fibrosis transmembr... Eur Respir J. 2002 Feb;19(2):374-6. Spitzer E, Staab D, Hanke R, Wahn U, Grosse R
Identification of a new cystic fibrosis transmembrane regulator mutation in a severely affected patient.
Eur Respir J. 2002 Feb;19(2):374-6., [PMID:11866018]

Abstract [show]
By using a combination of multiplex polymerase chain reaction and allele-specific labelled probes, the oligo-ligation assay is designed to detect known cystic fibrosis transmembrane regulator mutations. This study shows that this assay may also be useful to detect new mutations. The second child of a family of Bosnic origin showed all the symptoms of intestinal and pulmonary manifestations of cystic fibrosis. No signal could be obtained for the allele-specific probe 1898+1G>A. This could be explained by a nearby localized sequence change that prevented polymerase chain reaction primers or oligonucleotide probes from binding to the target sequence. Indeed, sequence analysis revealed a new 1894G>T exchange (Glu587Stop). Both parents and the healthy brother carried this mutation. Thus, the index patient was homozygous for 1894G>T, which was inherited from both parents.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Discussion Studies carried out in southern European populations, including the former Yugoslavia, identified DF508, G542X, G551D, 621z1GwT, W1282X and N1303K as the most common CF mutations [6, 7]. Login to comment

[hide] Genetic and clinical features of false-negative in... Acta Paediatr. 2002;91(1):82-7. Padoan R, Genoni S, Moretti E, Seia M, Giunta A, Corbetta C
Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis.
Acta Paediatr. 2002;91(1):82-7., [PMID:11883825]

Abstract [show]
A study was performed on the delayed diagnosis of cystic fibrosis (CF) in infants who had false-negative results in a neonatal screening programme. The genetic and clinical features of false-negative infants in this screening programme were assessed together with the efficiency of the screening procedure in the Lombardia region. In total, 774,687 newborns were screened using a two-step immunoreactive trypsinogen (IRT) (in the years 1990-1992), IRT/IRT + delF508 (1993-1998) or IRT/IRT + polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) protocol (1998-1999). Out of 196 CF children born in the 10 y period 15 were false negative on screening (7.6%) and molecular analysis showed a high variability in the genotypes. The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E. In three patients no mutation was identified after denaturing gradient gel electrophoresis of the majority of CFTR gene exons. Conclusion: The clinical phenotypes of CF children diagnosed by their symptoms at different ages were very mild. None of them presented with a severe lung disease. The majority of them did not seem to have been damaged by the delayed diagnosis. The combination of IRT assay plus genotype analysis (1998-1999) appears to be a more reliable method of detecting CF than IRT measurement alone or combined with only the delF508 mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 The cystic brosis transmembrane regulator (CFTR) gene mutations identi ed were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 ‡ 10kbC ® T, 2789 ‡ 5G ® A, 5T-12TG and the novel mutation D110E. Login to comment
34 It was initially performed by polyacrylamide gel electrophoretic (PAGE) analysis for the delF508 mutation, and later by polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) (31 mutations: G85E, 621 ‡ 1G ® T, R117H, Y122X, 711 ‡ 1G ® T, 1078delT, R347P, R347H, R334W, A455E, 1898 ‡ 1G ® A, 2183-AA ® G, 2789 ‡ 5G ® A, DelF508, I507del, Q493X, V520F, 1717-1G ® A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ‡ 10kbC ® T, 3849 ‡ 4A ® G, R1162X, 3659delC, W1282X, 3905insT, N1303K) (14). Login to comment
40 Mutation Frequency (%) DelF508 54 N1303K 8 G542X 6.25 1717-1G ® A 2.50 R334W 1.75 2183AA ® G 1.50 R117H, L1077P, W1282X 1.25 D110E, R347P, E585X, 2789 ‡ 5G ® A 0.75 R352Q, R553X, R1066H, D1152H, R1158X, 1782delA, 1898 ‡ 1G ® A, 3659delC 0.50 G85E, R117L, G178R, D579G, H609R, Y1032C, V1153E, R1162X, 621 ‡ 1G ® T, 711 ‡ 1G ® T, 1845delAG o 1846delGA, 2143delT 0.25 Table2.Differencesinthethreestrategiesofneonatalscreening(audit1990-1999). Login to comment
70 Year of birth Patient Sex Age at diagnosis Genotype Sweat test (chloride mEq l¡1 ) 1990 1 BA F 8 mo DF508/2789 ‡ 5G ® A 74, 79 2 LG M 4 y ¡/¡ 84, 83 1991 3 BV F 6 y ¡/¡ a 61, 85, 70 4 CA F 8 y R1066C/D1152H 58, 59 5 CA F 8 y DF508/5T-TG12 65, 67 6 PS M 5 y N1303K/-a 41, 43, 55, 63, 85, 89 1992 7 AE F 1 y R334W/-a 57, 42, 78, 82 8 DA M 4 mo ¡/¡ 85, 101, 143, 9 FA M 1 y ¡/¡ a 70, 75, 98, 114 1993 10 CA F 7 y DF508/5T-TG12 45, 50 1995 11 BM M 3 y DF508/DF508 117, 123 1997 12 DG M 6 mo G542X/D110E 59, 88, 80, 70 13 DE F 2 y D1152H/3849 ‡ 10kbC ® T 31, 35 14 TL M 2 y ¡/¡ a 115, 136 1998 15 CM M 5 mo F1052V/A120T 20, 25 F: female; M: male. Login to comment
80 The CFTR alterations identi ed were D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 ‡ 10kbC ® T, 2789 ‡ 5G ® A, 5T-12TG and the new mutation D110E (19). Login to comment

[hide] The relationship between genotype and exercise tol... Am J Respir Crit Care Med. 2002 Mar 15;165(6):762-5. Selvadurai HC, McKay KO, Blimkie CJ, Cooper PJ, Mellis CM, Van Asperen PP
The relationship between genotype and exercise tolerance in children with cystic fibrosis.
Am J Respir Crit Care Med. 2002 Mar 15;165(6):762-5., 2002-03-15 [PMID:11897641]

Abstract [show]
The relationship between fitness and genotype in children with cystic fibrosis (CF) and at least one copy of the DeltaF508 mutation was examined. Genotype was classified according to the second CF mutation. Fitness was measured by peak aerobic capacity (using a modified Bruce protocol during treadmill exercise) and anaerobic power (using the Wingate test on a cycle ergometer). The class of cystic fibrosis transmembrane regulator proteins (CFTR) mutation was statistically related with aerobic capacity, peak anaerobic power, body mass index, lung function (forced expiratory volume in one second), and disease severity as measured by the Shwachman score. Patients with mutations causing defective CFTR production (Class I) or processing (Class II) had a significantly lower peak aerobic capacity (28.6 +/- 4.2 ml/kg/min and 31.7 +/- 5.4 ml/kg/min, respectively) than those with a mutation conferring defective regulation of CFTR (Class III) (43.9 +/- 6.4 ml/kg/min). The peak anaerobic power in subjects with mutations inducing decreased CFTR conduction (Class IV) or CFTR mRNA (Class V), were significantly higher (11.4 +/- 1.7 and 11.6 +/- 1.5 watts/kg, respectively) than children with Class I (9.7 +/- 1.4 watts/kg), Class II (9.8 +/- 1.4 watts/kg), or Class III (10.5 +/- 1.8 watts/kg) mutations. There were no statistically significant differences in the lung function of patients with the different mutations. These results indicate a relationship between CF genotype and some measures of fitness, the mechanisms of which remain to be determined.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 The most common mutation, ⌬F508 and the N1303K mutation belong to class II mutations and result in defects in protein processing. Login to comment
82 II ⌬F508 (36), W1282X (1) III G551D (10), N1303K (4), R560T (2), A559T (1) IV R117H (14), R347H (3) V 3849 ϩ 10KbC→T (7), 3120G→A (3) AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE VOL 165 2002 All patients were recruited from a single center, and the sample size of this study was large compared with previously published studies of exercise capacity in children with CF (21). Login to comment

[hide] Functional analysis of a vacuolar ABC transporter ... Mol Microbiol. 2002 Feb;43(3):571-84. Theiss S, Kretschmar M, Nichterlein T, Hof H, Agabian N, Hacker J, Kohler GA
Functional analysis of a vacuolar ABC transporter in wild-type Candida albicans reveals its involvement in virulence.
Mol Microbiol. 2002 Feb;43(3):571-84., [PMID:11929516]

Abstract [show]
ATP-driven transport proteins belonging to the ATP-binding cassette (ABC) superfamily perform important functions in cell metabolism and detoxification. Compounds can be actively transported across membranes, including the plasma membrane or organellar membranes. The vacuole is an important organelle in fungal cells required for compartmentalization of metabolites as well as toxic substances. Sequestration into the vacuole is often energy-dependent. We present the first isolation and molecular analysis of a vacuolar ABC transporter gene in the opportunistic fungal pathogen Candida albicans. The protein encoded by the MLT1 gene is highly similar to Multiple Drug Resistance-associated Protein (MRP)-like transporters of yeast and higher organisms that form the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR)/MRP subfamily of ABC transporters, a class of proteins so far not characterized in C. albicans. MLT1 expression is extensively growth phase-regulated, and gene transcripts are inducible by metabolic poisons. Gene replacement mutants generated in wild-type C. albicans with the dominant selection marker MPAR showed a profound reduction in virulence in a mouse peritonitis model that was reversed by complementation with an intact MLT1 gene. Hence, this report provides primary evidence for the involvement of vacuolar ABC transporters in fungal virulence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 Interestingly, a DF508 deletion or a N1303K mutation in CFTR is a cause for human cystic fibrosis. Login to comment
84 Deletion of F508 or a N1303K mutation in CFTR causes human cystic fibrosis. Login to comment

[hide] DHPLC screening of cystic fibrosis gene mutations. Hum Mutat. 2002 Apr;19(4):374-83. Ravnik-Glavac M, Atkinson A, Glavac D, Dean M
DHPLC screening of cystic fibrosis gene mutations.
Hum Mutat. 2002 Apr;19(4):374-83., [PMID:11933191]

Abstract [show]
Denaturing high performance liquid chromatography (DHPLC) using ion-pairing reverse phase chromatography (IPRPC) columns is a technique for the screening of gene mutations. In order to evaluate the potential utility of this assay method in a clinical laboratory setting, we subjected the PCR products of 73 CF patients known to bear CFTR mutations to this analytic technique. We used thermal denaturation profile parameters specified by the MELT program tool, made available by Stanford University. Using this strategy, we determined an initial analytic sensitivity of 90.4% for any of 73 known CFTR mutations. Most of the mutations not detected by DHPLC under these conditions are alpha-substitutions. This information may eventually help to improve the MELT algorithm. Increasing column denaturation temperatures for one or two degrees above those recommended by the MELT program allowed 100% detection of CFTR mutations tested. By comparing DHPLC methodology used in this study with the recently reported study based on Wavemaker 3.4.4 software (Transgenomic, Omaha, NE) [Le Marechal et al., 2001) and with previous SSCP analysis of CFTR mutations [Ravnik-Glavac et al., 1994] we emphasized differences and similarities in order to refine the DHPLC system and discuss the relationship to the alternative approaches. We conclude that the DHPLC method, under optimized conditions, is highly accurate, rapid, and efficient in detecting mutations in the CFTR gene and may find high utility in screening individuals for CFTR mutations. Hum Mutat 19:374-383, 2002. Published 2002 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X. Login to comment

[hide] Determination of the relative contribution of thre... Eur J Hum Genet. 2002 Feb;10(2):100-6. Audrezet MP, Chen JM, Le Marechal C, Ruszniewski P, Robaszkiewicz M, Raguenes O, Quere I, Scotet V, Ferec C
Determination of the relative contribution of three genes-the cystic fibrosis transmembrane conductance regulator gene, the cationic trypsinogen gene, and the pancreatic secretory trypsin inhibitor gene-to the etiology of idiopathic chronic pancreatitis.
Eur J Hum Genet. 2002 Feb;10(2):100-6., [PMID:11938439]

Abstract [show]
In the last 5 years, mutations in three genes, the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the pancreatic secretory trypsin inhibitor (PSTI) gene, have been found to be associated with chronic pancreatitis (CP). In this study, using established mutation screening methods, we systematically analysed the entire coding sequences and all exon/intron junctions of the three genes in 39 patients with idiopathic CP (ICP), with a view to evaluating the relative contribution of each gene to the aetiology of the disease. Our results demonstrate that, firstly, 'gain-of-function' mutations in the PRSS1 gene may occasionally be found in an obvious ICP subject. Secondly, presumably 'loss-of-function' mutations in the PSTI gene appear to be frequent, with a detection rate of at least 10% in ICP and, finally, abnormal CFTR alleles are common: at least 20% of patients carried one of the most common CFTR mutations, and about 10% of patients were compound heterozygotes, having at least one 'mild' allele. Thus, in total, about 30% of ICP patients carried at least one abnormal allele in one of the three genes, and this is the most conservative estimate. Moreover, a trans-heterozygous state with sequence variations in the PSTI/CFTR genes was found in three patients. However, an association between the 5T allele in intron 8 of the CFTR gene and ICP remains unproven.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 `Gain-of-function' PRSS1 mutations are rare in ICP While PRSS1 mutations are often found in patients with hereditary pancreatitis, they can also be identified in subjects with ICP, albeit with an exceptionally low Table 1 Sequence variations identified in the PRSS1, PSTI, and CFTR genes in 39 patients with ICP CFTR Patient PRSS1 PSTI Mutant PolyT 1 ± a ± ± 7T/7T 2 ± ± F508del/R352Q 9T/7T 3 ± ± F508del/P5L 9T/7T 4 ± ± c.4575+2G4A 9T/7T 5 ± ± ± 7T/7T 6 ± N34Sb ± 7T/7T 7 ± ± ± 7T/5T 8 ± ± F508del/Q1476X 9T/7T 9 ± ± ± 7T/7T 10 ± ± ± 7T/7T 11 ± ± ± 7T/7T 12 ± ± ± 7T/7T 13 ± ± V562I 7T/5T 14 ± ± 2C4A W1282X 7T/5T 15 ± ± IVS3-6T4C 7T/7T 16 R122H ± ± 7T/7T 17 ± ± ± 9T/7T 18 ± ± ± 7T/5T 19 ± ± ± 7T/7T 20 ± N34S/N34S ± 7T/7T 21 ± ± ± 9T/5T 22 ± ± ± 7T/7T 23 ± ± E217G/A1136T 9T/7T 24 ± ± ± 7T/7T 25 ± ± ± NDc 26 ± ± ± ND 27 ± N34S IVS18 ± 20T4C 9T/7T 28 ± ± F508del 9T/7T 29 ± ± ± 7T/7T 30 ± ± N1303K ND 31 ± ± G542X 9T/7T 32 ± ± ± 7T/5T 33 ± ± F508del 9T/7T 34 ± ± 41G4Ad ± 7T/7T 35 ± ± ± 9T/7T 36 ± ± ± 9T/7T 37 ± ± ± 7T/7T 38 ± N34S L967S 7T/7T 39 ± ± ± 7T/5T a Indicates two wild alleles. Login to comment

[hide] Towards the pharmacogenomics of cystic fibrosis. Pharmacogenomics. 2002 Jan;3(1):75-87. Sangiuolo F, D'Apice MR, Bruscia E, Lucidi V, Novelli G
Towards the pharmacogenomics of cystic fibrosis.
Pharmacogenomics. 2002 Jan;3(1):75-87., [PMID:11966405]

Abstract [show]
Cystic fibrosis (CF) is the most common lethal recessive genetic disease affecting children in Europe and the US. CF is a multiorgan disease and may present a variety of clinical symptoms, like chronic obstructive lung disease, exocrine pancreatic insufficiency (PI) and elevated sweat chloride concentration. CF mutations have also been found in other related clinical diseases such as congenital bilateral absence of the vas deferens (CBAVD), disseminated bronchiectasis and chronic pancreatitis. These clinical overlaps pose etiopathogenetic, diagnostic and therapeutic questions. Despite stunning advances in genomic technologies and drug discovery, drug therapy often improves disease symptoms but does not cure the disease. One of the main causes of this failure in CF cure may be attributable to genetic variability and to the scarce knowledge of CF biochemistry. Therefore, knowing the genotype of a patient might help improve drug efficacy, reduce toxicity and suggests innovative genomic-based therapy approaches.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 Gentamicin Neomicin (G418) Class II Mutations that fail to be properly processed to a matureglycosylatedform and transported to the apical membrane ∆F508 N1303K P574H A455E PI Defective CFTR processing and trafficking. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Clin Exp Allergy. 2002 May;32(5):756-61. Eaton TE, Weiner Miller P, Garrett JE, Cutting GR
Cystic fibrosis transmembrane conductance regulator gene mutations: do they play a role in the aetiology of allergic bronchopulmonary aspergillosis?
Clin Exp Allergy. 2002 May;32(5):756-61., [PMID:11994102]

Abstract [show]
BACKGROUND: Previous work suggests that cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations may be implicated in the aetiology of allergic bronchopulmonary aspergilosis (ABPA). OBJECTIVE: To compare the frequency of CF gene mutations in asthmatics with ABPA of varying severity with asthmatics who were skin prick test (SPT)-positive to Aspergillus fumigatus (Af) without evidence of ABPA and asthmatics SPT-negative to Af. METHODS: Thirty-one Caucasian patients with ABPA were identified, together with asthmatics SPT positive to Af without evidence of ABPA (n = 23) and SPT negative to Af (n = 28). Genomic DNA was tested for 16 CF mutations accounting for approximately 85% of CF alleles in Caucasian New Zealanders. RESULTS: Four (12.9%) ABPA patients were found to be carriers of a CF mutation (DeltaF508 n = 3, R117H n = 1), one (4.3%) asthmatic SPT positive to Af without ABPA (DeltaF508), and one (3.6%) asthmatic SPT negative to Af (R117H). All patients with a CF mutation had normal sweat chloride (< 40 mM). There was no significant difference between the frequency of CF mutations in the ABPA patients and asthmatics without ABPA. However, the frequency of CF mutations in the ABPA patients was significantly different (P = 0.0125) to the expected carrier rate in the general population. CONCLUSION: These results lend further support to a possible link between CF mutations and ABPA.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Cystic ®brosis mutation analysis Genomic DNA samples were screened for 16 CF mutations utilizing allelic-speci®c oligonucleotide (ASO) hybridization; ÁF508, ÁI507, R117H, W1282X, 621 IG3T, R334W, R347P, A455E, 1717-IG3A, G542X, 5549N, G551D, R553X, R560T, N1303K and 3849 10KC3T. Login to comment

[hide] Complete screening of the CFTR gene in Argentine c... Clin Genet. 2002 Mar;61(3):207-13. Visich A, Zielenski J, Castanos C, Diez G, Grenoville M, Segal E, Barreiro C, Tsui LC, Chertkoff L
Complete screening of the CFTR gene in Argentine cystic fibrosis patients.
Clin Genet. 2002 Mar;61(3):207-13., [PMID:12000363]

Abstract [show]
In order to establish the nature and the distribution of mutations causing cystic fibrosis (CF) in 220 unrelated Argentine families, the present authors conducted an extensive molecular analysis of the CF transmembrane regulator (CFTR) gene. First, a direct mutation analysis of 13 common mutations was done, enabling the detection of 319 out of 440 CF alleles (72.52%). Then an exhaustive screening of the entire coding region and the adjacent sequences of the CFTR gene was performed in all patients carrying at least one unidentified CF allele using the multiplex heteroduplex analysis assay followed by direct DNA sequencing. Thirty-nine different CF mutations, including five previously undescribed mutations (i.e. L6V, Y362X, 1353insT, 2594delGT and 2686insT) and two novel polymorphisms (i.e. 1170G/C and 3315A/C) were identified. As a result, the overall detection rate increased by up to 83.45%. Besides DeltaF508, only five mutations showed frequencies higher than 1%. In addition, a total of 49% of the mutations were rare because they were found in only one CF family. This wide spectrum of CF mutations is in agreement with the heterogeneous ethnic origin of the Argentine population. The data obtained here may have important consequences for the development of adequate strategies for the molecular diagnosis of CF in Argentina.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Screening for DF508 and 12 other known mutations DF508 and 11 other frequent mutations (i.e. DI507, G551D, R553X, S549N, S549I, R1162X, 1811π1.6KbA»T, G542X, 1717-1G»A, 208 W1282X and N1303K) were detected as previously described (5). Login to comment
56 Frequency of cystic fibrosis transmembrane regulator mutations in the Argentine population: 440 chromosomes analysed Mutation Localization Chromosome Number Percentage DF508 Exon 10 258 58.64 G542X Exon 11 18 4.10 W1282X Exon 20 12 2.73 N1303K Exon 21 12 2.73 R334W Exon 7 5 1.14 1717-1G»A Intron 10 5 1.14 3849π10KbC»T Intron 19 4 0.91 1811π1.6KbA»G Intron 11 4 0.91 IVS8-5T Intron 8 4 0.91 G85E Exon 3 3 0.68 621π1G»T Intron 4 3 0.68 2789π5G»A Intron 14b 3 0.68 DI507 Exon 10 3 0.68 2184delA Exon 13 2 0.45 2566insT Exon 13 2 0.45 2686insT Exon 14a 2 0.45 3659delC Exon 19 2 0.45 R1162X Exon 19 2 0.45 4016insT Exon 21 2 0.45 2789π2insA Intron 14b 2 0.45 L6V Exon 1 1 0.23 297π2A»G Intron 2 1 0.23 W57X Exon 3 1 0.23 R75Q Exon 3 1 0.23 Q220X Exon 6a 1 0.23 Y362X Exon 7 1 0.23 D426C Exon 9 1 0.23 1460delAT Exon 9 1 0.23 1353insT Exon 9 1 0.23 1782delA Exon 11 1 0.23 R553X Exon 11 1 0.23 S549R Exon 11 1 0.23 1898π3A»G Intron 12 1 0.23 2594delGT Exon 13 1 0.23 2183AA»G Exon 13 1 0.23 I1027T Exon 17a 1 0.23 R1066C Exon 17b 1 0.23 G1061R Exon 17b 1 0.23 4005-1G»A Intron 20 1 0.23 Total 367 83.45 209 nificant differences were observed among the compared populations (Table2). Login to comment
83 Only five other mutations (i.e. G542X, W1282X, N1303K, 1717-1G»A and R334W) showed frequencies higher than 1%, while approximately half the mutations (49%) were rare since they were found in only one CF family. Login to comment
99 They have established the group of CF mutations (i.e. DF508, G542X, W1282X, N1303K, 1717-1G»A and R334W) that should be considered in screening programmes based on both IRT and DNA analysis to obtain at least 70% sensitivity. Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 Mutations that fall into this category include: 1) G542X, of single origin, associated with the ancient Phoenicians [Loirat et al., 1997], 2) N1303K, also of single origin, and linked to ancient Mediterranean populations, and 3) G551D, also of single origin [Cashman et al., 1995], having been associated with the ancient Celtic tribes [Macek et al., 1991]. Login to comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment
110 Germany ∆F508 (71.8%) 1789+5G→A (0.9%) 87.6 76.7 17 5662/1316 Dörk et al. [1992]; Dörk et al. R553X (2.0%) 3272-26A→G (0.9%) [1994]; Tümmler et al. [1996]; N1303K (1.8%) W1282X (0.7%) Estivill et al. [1997]; Dörk et G542X (1.2%) 2143delT (0.7%) al. [2000] R347P (1.2%) 1078delT (0.6%) CFTRdele2,3 (1.2%) 2183AA→G (0.6%) 3849+10KbC→T (1.0%) 2184insA (0.6%) G551D (0.9% 3659delC (0.6%) 1717-1G→A (0.9%) Greece ∆F508 (52.9%) 3272-26A→G (0.8%) 82.2 67.6 22 2097/718 Kanavakis et al. [1995]; Estivill 621+1G→T (5.0%) R1070Q (0.8%) et al. [1997]; Tzetis et al. G542X (4.1%) W496X (0.7%) [1997]; Macek et al. [2002] N1303K (3.3%) 621+3A→G (0.7%) 2183AA→G (1.8%) ∆I507 (0.7%) 2789+5G→A (1.7%) W1282X (0.7%) E822X (1.6%) 574delA (0.7%) R117H (1.2%) 1677delTA (0.7%) R334W (1.1%) A46D (0.6%) R1158X (1.0%) 3120+1G→A (0.6%) G85E (1.0%) G551D (0.5%) Hungary ∆F508 (54.9%) W1282X (1.8%) 68.3 46.6 9 1133/976 CFGAC [1994]; Estivill et al. 1717-1G→A (1.9%) G542X (1.7%) [1997]; Macek et al. [2002] R553X (2.1%) N1303K (1.3%) Y1092X (1.8%) G551D (1.0%) S1196X (1.8%) Ireland ∆F508 (70.4%) G542X (1.0%) 82.1 67.4 7 801/509 CFGAC [1994]; Estivill et al. G551D (5.7%) 621+1G→T (0.8%) [1994] R117H (2.4%) 1717-1G→A (0.6%) R560T (1.2%) Italy ∆F508 (50.9%) ∆I507 (0.65%) 60.3 36.4 9 3524 Estivill et al. [1997] (total) G542X (3.1%) W1282X (0.62%) 1717-1G→A (1.6%) Y122K (0.59%) N1303K (1.4%) G551D (0.53%) R553X (0.94%) Italy ∆F508 (47.6%) R553X (1.3%) 87.1 75.9 15 225 Bonizzato et al. [1995] (Northeast) R1162X (9.8%) 2789+G→A (1.3%) 2183AA→G (9.3%) Q552X (1.3%) N1303K (4.0%) 621+1G→T (0.9%) G542X (2.7%) W1282X (0.9%) 711+5G→A (2.7%) 3132delTG (0.9%) 1717-1G→A (2.2%) 2790-2A→G (0.9%) G85E (1.3%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS583 Italy ∆F508 (56.4%) 711+1G→T (1.3%) 85.7 73.4 13 660/396 Castaldo et al. [1996]; Castaldo (southern) N1303K (6.8%) G1244E (1.3%) et al. [1999] G542X (5.7%) R1185X (1.3%) W1282X (3.8%) L1065P (1.3%) 1717-1G→A (2.3%) R553X (1.1%) 2183AA→G (1.9%) I148T (0.7%) 4016insT (1.8%) Latvia 1) DF508 (58.3%) 4) CFTRdele2,3 (2.8%) - - 6 36 Dörk et al. [2000]; Macek et al. 2) 3849+10KbC®T (8.3%) 5) W1282X (2.8%) [2002] 3) N1303K (5.6%) 6) 394delTT (2.8%) Lithuania ∆F508 (31.0%) N1303K (2.0%) 39.0 15.2 4 94 Dörk et al. [2000]; Macek et al. R553X (4.0%) CFTRdele2,3 (2.0%) [2002] Macedonia ∆F508 (54.3%) 711+3A→G (1.0%) 69.2 47.9 12 559/226 Petreska et al. [1998]; Dörk et G542X (4.2%) 3849G→A (1.0%) al. [2000]; Macek et al. N1303K (2.0%) 2184insA (0.9%) [2002] CFTRdele2,3 (1.3%) 457TAT→G (0.7%) 621+1G→T (1.3%) V139E (0.7%) 611-1G→T (1.2%) 1811+1G→C (0.6%) Netherlands ∆F508 (74.2%) R1162X (0.9%) 86.8 75.3 9 3167/1442 Gan et al. [1995]; Estiville et al. A455E (4.7%) S1251N (0.9%) [1997]; Collee et al. [1998] G542X (1.8%) N1303K (0.9%) 1717-1G→A (1.5%) W1282X (0.7%) R553X (1.2%) Norway ∆F508 (60.2%) G551D (1.2%) 69.8 48.7 6 410/242 Schwartz et al. [1994]; Estivill 394delTT (4.2%) G542X (0.6%) et al. [1997] R117H (3.0%) N1303K (0.6%) Poland ∆F508 (57.1%) CFTRdele2,3 (1.8%) 73.5 54.0 11 4046/1726 CFGAC [1994]; Estivill et al. 3849+10Kb C→T (2.7%) R560T (1.5%) [1997]; Dörk et al [2000]; G542X (2.6%) W1282X (0.7%) Macek et al. [2002] 1717-1G→A (2.4%) ∆I507 (0.5%) R553X (1.9%) G551D (0.5%) N1303K (1.8%) Portugal ∆F508 (44.7%) R334W (0.7%) 49.7 24.7 5 739/454 CFGAC [1994]; Estivill et al. G542X (1.6%) N1303K (0.7%) [1997] R1066C (2.0%) Romania ∆F508 (36.6%) G542X (1.4%) 51.5 26.5 11 224/74 CFGAC [1994]; Estivill et al. 2043delG (2.0%) R553X (1.4%) [1997]; Popa et al. [1997]; W1282X (1.7%) G576X (1.4%) Macek et al. [2002] 1717-2A→G (1.4%) 1898+1G→A (1.4%) I148T (1.4%) 2183AA→G (1.4%) 621+1G→T (1.4%) Russia ∆F508 (54.4%) 552insA (0.9%) 70.7 50.0 12 5073/2562 CFGAC [1994]; Estivill et al. CFTRdele2,3 (5.0%) G542X (0.9%) [1997]; Dörk et al. [2000]; R553X (3.5%) R334W (0.9%) Macek et al. [2002] 2183AA→G (1.3%) 1677delTA (0.8%) W1282X (1.0%) Y122X (0.5%) 394delTT (1.0%) 1367del5 (0.5%) (Continued) BOBADILLAETAL. Login to comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment
112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL. Login to comment
113 Mexico ∆F508 (41.6%) G551S (0.5%) 75.5 57.0 35 374/194 Orozco et al.[1993]; Villalobos- G542X (5.6%) 1078delT (0.5%) Torres et al. [1997]; Liang et al. ∆I507 (2.5%) Y1092X (0.5%) [1998]; Orozco et al. [2000] S549N (1.9%) R117H (0.5%) N1303K (1.7%) G85E (0.5%) R75X (1.5%) 1716G→A (0.5%) 406-1G→A (1.5%) W1204X (0.5%) I148T (1.5%) W1098C (0.5%) 3849+10KbC→T (1.5%) 846delT (0.5%) 621+1G→T (1.2%) P750L (0.5%) 2055del9→A (1.0%) V754M (0.5%) 935delA (1.0%) R75Q (0.5%) I506T (1.0) W1096X (0.5%) 3199del6 (1.0%) L558S (0.5%) 2183AA→G (1.0%) 4160insGGGG (0.5%) G551D (0.5%) 297-1G→A (0.5%) R553X (0.5%) H199Y (0.5%) 1924del7 (0.5%) United States ∆F508 (68.6%) R553X (0.9%) 79.7 63.5 10 25048 Cystic Fibrosis Foundation (total) G542X (2.4%) 621+1G→T (0.9%) [1998] G551D (2.1%) 1717-1G→A (0.7%) W1282X (1.4%) 3849+10KbC→T (0.7%) N1303K (1.3%) R117H (0.7%) United States ∆F508 (48.0%) S1255X (1.4%) 77.3 59.8 16 160/148 Carles et al. [1996]; Macek et al. (African 3120+1G→A (12.2%) 444delA (0.7%) [1997]; Dörk et al. [1998]; American) 2307insA (2.0%) R334W (0.7%) Friedman et al. [1998] A559T (2.0%) ∆I507 (0.7%) R553X (2.0%) 1717-1G→A (0.7%) ∆F311 (2.0%) G542X (0.7%) G480C (1.4%) S549N (0.7%) 405+3A→C (1.4%) G551D (0.7%) United States 1) L1093P - - 1 2 Yee et al. [2000] (Cherokee) United States Non-French: French: Non- Non- Non- Non- Bayleran et al. [1996] (Maine) ∆F508 (82.0%) ∆F508 (58%) French: French: French: French: G542X (2.6%) 711+1G→T (8.3%) 95.3 90.8 11 191 G551D (2.6%) I148T (4.2%) French: French: French: French: N1303K (2.1%) A455E (4.2%) 80.3 64.5 8 72 R560T (1.0%) 1717-1G→A (1.4%) Total: 621+1G→T (1.0%) G85E (1.4%) 263 711+1G→T (1.0%) 621+1G→T (1.4%) R117H (1.0%) Y1092X (1.4%) 1717-1G→A (1.0%) G85E (0.5%) W1282X (0.5%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS589 United States ∆F508 (46.0%) R334W (1.6%) 58.5 34.2 7 129 Grebe et al. [1994] (SW Hispanic) G542X (5.4%) W1282X (0.8%) 3849+10KbC→T (2.3%) R553X (0.8%) R1162X (1.6%) United States 1) R1162X - - 3 17 Mercier et al. [1992] (SW Native 2) D648V American) 3) G542X United States 1) R1162X 3) G542X - - 4 16 Mercier et al. [1994] (Zuni Pueblo) 2) 3849+10KbC®T 4) D648V Venezuela ∆F508 (29.6%) G542X (3.7%) 33.3 11.1 2 54 Restrepo et al. [2000] Other Regions Australia ∆F508 (76.9%) 621+1G→T (1.1%) 88.7 78.7 8 761/464 CFGAC [1994] G551D (4.5%) N1303K (0.9%) G542X (2.8%) W1282X (0.6%) R553X (1.3%) R117H (0.6%) East Asia 1) 1898+1G®T 2) 1898+5G®T - - 2 28 Suwanjutha et al. [1998] Hutterite 1) M1101K (69.0%) 2) DF508 (31.0%) - - 2 32 Zielenski et al. [1993] Brethren New Zealand ∆F508 (78.0%) N1303K (1.9%) 87.4 76.4 5 636 CFGAC [1994] G551D (4.4%) 621+1G→T (1.1%) G542X (2.0%) *This table presents the mutation panels for all regions investigated in this study. Login to comment
169 The mutation N1303K is another CFTR allele that has a similar distribution patterns as G542X, and may also have been introduced via the Mediterranean route (Table 1). Login to comment
193 The top 10 list for the United States (Table 1) includes five CFTR alleles found in populations with distinct ethnic ancestries, i.e., G542X, G551D, W1282X, N1303K, and 3849+10KbC→T. Login to comment
213 Ideal Recommended CFTR Mutation Screening Panel for 2001 Neonatal Screening in the USA* Location Estimated Mutation in CFTRa percentageb Reason for inclusion DF508 Exon 10 68.6% CFF registry, >1%, Pan-European G542X Exon 11 2.4% CFF registry, >1%, Mediterranean G551D Exon 11 2.1% CFF registry, >1%, Celtic W1282X Exon 20 1.4% CFF registry, >1%, Ashkenazi Jew N1303K Exon 21 1.3% CFF registry, >1%, Mediterranean R553X Exon 11 0.9% CFF registry, >0.5%, Hispanic 621+1G®T Intron 4 0.9% CFF registry, >0.5%, multi-ethnic 1717-1G®A Intron 10 0.7% CFF registry, >0.5%, Italian 3849+10KbC®T Intron 19 0.7% CFF registry, >0.5%, Hispanic R117Hc Exon 4 0.7% CFF registry, >0.5% 1898+1G→T Intron 12 0.4% CFF registry, >0.1%, East Asian DI507 Exon 10 0.3% CFF registry, >0.1%, Hispanic 2789+5G®A Intron 14b 0.3% CFF registry, >0.1% G85E Exon 3 0.3% CFF registry, >0.1% R347P Exon 7 0.2% CFF registry, >0.1% R334W Exon 7 0.2% CFF registry, >0.1%, multi-ethnic R1162X Exon 19 0.2% CFF registry, >0.1%, multi-ethnic R560T Exon 11 0.2% CFF registry, >0.1% 3659delC Exon 19 0.2% CFF registry, >0.1% A455E Exon 9 0.2% CFF registry, >0.1% 2184delA Exon 13 0.1% CFF registry, >0.1% S549N Exon 11 0.1% CFF registry, >0.1%, multi-ethnic 711+1G®T Intron 5 0.1% CFF registry, >0.1% R75X Exon 3 0.2% Hispanic 406-1G→A Intron 3 0.2% Hispanic I148T Exon 4 0.2% Hispanic, French 2055del9→A Exon 13 0.1% Hispanic 935delA Exon 6b 0.1% Hispanic I506T Exon 10 0.1% Hispanic 3199del6 Exon 17a 0.1% Hispanic 2183AA→G Exon 13 0.1% Hispanic 3120+1G®A Intron 16 1.5% African American, Arabian 2307insA Exon 13 0.2% African American A559T Exon 11 0.2% African American ∆F311 Exon 7 0.2% African American G480C Exon 10 0.2% African American 405+3A→C Intron 3 0.2% African American S1255X Exon 20 0.2% African American L1093P Exon 17b Undetermined Native American D648V Exon 13 Undetermined Native American I1234V Exon 19 Undetermined Arabian linkage S549R Exon 11 Undetermined Arabian linkage 1898+5G→T Intron 12 Undetermined East Asian linkage CFTRdele2,3 Exons 2,3 Undetermined Eastern European linkage (Slavic) Y1092X Exon 17b Undetermined French linkage 394delTT Exon 3 Undetermined Nordic linkage Y569D Exon 12 Undetermined Pakistani linkage 3905insT Exon 20 Undetermined Swiss linkage (also: Amish, Acadian, Mennonite) 1898+1G®A Intron 12 Undetermined Welsh linkage M1101k Exon 17b Undetermined Hutterite ancestry *This table presents the top 50 mutations in the USA based on the Cystic Fibrosis Foundation CF Registry data from 1997 [Cystic Fibrosis Foundation, 1998], and data generated during our investigation. Login to comment

[hide] Development and evaluation of a PCR-based, line pr... Clin Chem. 2002 Jul;48(7):1121-3. Wang X, Myers A, Saiki RK, Cutting GR
Development and evaluation of a PCR-based, line probe assay for the detection of 58 alleles in the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
Clin Chem. 2002 Jul;48(7):1121-3., [PMID:12089190]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Amplicon Size, bp Mutations (polymorphisms) Exon 13 598 2307 insA Intron 8, exon 09 548 A455E, 5T (7/9 T polymorphism) Exon 10 482 G480C, ⌬I507, ⌬F508 (F508C, I507V, I506V polymorphisms) Intron 10, exon 11 433 1717-1G3A, G542X, G551D, R553X, A559T, R560T Exon 19 420 R1162X, 3659delC Exon 21 397 N1303K Exon 20 359 S1255X, W1282X Exon 07 328 1078delT, R334W, R347P Exon 04, intron 4 288 R117H, 621ϩ1G3T Intron 14b 248 2789ϩ5G3A Intron 19 237 3849ϩ10kbC3T Exon 03 210 G85E, 405ϩ3A3C Intron 5 166 711ϩ1G3T Intron 16 139 3120ϩ1G3A Clinical Chemistry 48, No. Login to comment
88 The genotypes of each sample are as follows: lane 1, ϩ/ϩ (ϩ is the wild type); lane 2, 5T, R117H/3659delC; lane 3, G542X/ϩ; lane 4, I506V/ϩ; lane 5, I507V/ϩ; lane 6, F508C/⌬F508; lane 7, G85E/⌬F508; lane 8, 405ϩ3A3C/3120ϩ1G3C; lane 9, R117H/ϩ; lane 10, 621ϩ1G3T/⌬F508; lane 11, 711ϩ1G3T/⌬F508; lane 12, 1078delT/ϩ; lane 13, R334W/⌬F508; lane 14, R347P/⌬F508; lane 15, A455E/ϩ; lane 16, G480C/⌬F508; lane 17, ⌬I507/ϩ; lane 18, ⌬F508/ϩ; lane 19, 1717-1G3A/ϩ; lane 20, G542X/ϩ; lane 21, G551D/⌬F508; lane 22, R553X/ϩ; lane 23, R560T/⌬F508; lane 24, G551D/A559T; lane 25, 2307insA/ϩ; lane 26, 2789ϩ5G3A/⌬F508; lane 27, 3120ϩ1G3A/⌬F508; lane 28, R1162X/R1162X; lane 29, 3659delC/⌬F508; lane 30, 3849ϩ10kbC3T/⌬F508; lane 31, S1255X/⌬F508; lane 32, W1282X/G542X; lane 33, N1303K/ϩ. Login to comment

[hide] Predicting the risk of cystic fibrosis with abnorm... Am J Med Genet. 2002 Jun 15;110(2):109-15. Muller F, Simon-Bouy B, Girodon E, Monnier N, Malinge MC, Serre JL
Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases.
Am J Med Genet. 2002 Jun 15;110(2):109-15., 2002-06-15 [PMID:12116247]

Abstract [show]
Hyperechogenic fetal bowel is prenatally detected by ultrasound during the second trimester of pregnancy in 0.1-1.8% of fetuses. It has been described as a normal variant but has often been associated with severe diseases, notably cystic fibrosis (CF). The aim of our study was to determine the risk of CF in a prospective study of 641 fetuses with ultrasonographically abnormal fetal bowel and the residual risk when only one mutation is detected in the fetus. Fetal cells and/or parental blood cells were screened for CFTR mutations. Two screening steps were used, the first covering the mutations most frequently observed in French CF patients (mutation detection rate of 70-90%) and, when a CF mutation was detected, a DGGE-sequencing strategy. We observed a 3.1% risk of CF when a digestive tract anomaly was prenatally observed at routine ultrasound examination. The risk was higher when hyperechogenicity was associated with bowel dilatation (5/29; 17%) or with the absence of gall bladder (2/8; 25%). The residual risk of CF was 11% when only one CF mutation was detected by the first screening step, thereby justifying in-depth screening. Mutations associated with severe CF (DeltaF508 mutation) were more frequently observed in these ultrasonographically and prenatally detected CF cases. However, the frequency of heterozygous cases was that observed in the normal population, which demonstrates that heterozygous carriers of CF mutations are not at increased risk for hyperechogenic bowel. In conclusion, fetal bowel anomalies indicate a risk of severe cystic fibrosis and justify careful CFTR molecular analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 A, N1303K, W1282X), oligonucleotide ligation assay with the CF-OLA kit (PE-Biosystems, Foster City, CA) (31 mutations detected: DF508, DI507, Q493X, V520F, 1717-1G ! Login to comment
50 G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 þ 1G ! Login to comment

[hide] Hyperechogenic bowel loops and meconium ileus in a... Prenat Diagn. 2002 Jul;22(7):636-7. Orgad S, Berkenstadt M, Achiron R, Yahav Y, Gazit E, Barkai G, Loewenthal R
Hyperechogenic bowel loops and meconium ileus in a fetus carrying the D1152H and G542X cystic fibrosis CFTR mutations.
Prenat Diagn. 2002 Jul;22(7):636-7., [PMID:12124706]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Ashkenazi Jews were tested in the past only for F508del, W1282X, G542X, N1303K and 3849+10KbC>T of the cystic fibrosis transmembrane conductance regulator (CFTR) gene (Kerem et al., 1995, 1997; Abeliovich et al., 1992, 1996). Login to comment

[hide] Screening for cystic fibrosis in newborn infants: ... J Med Screen. 2002;9(2):60-3. Corbetta C, Seia M, Bassotti A, Ambrosioni A, Giunta A, Padoan R
Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population.
J Med Screen. 2002;9(2):60-3., [PMID:12133923]

Abstract [show]
OBJECTIVE: To assess the performance of a two tier neonatal screening programme (IRT/DNA/IRT) for cystic fibrosis, based on immunoreactive trypsinogen (IRT) followed by direct cystic fibrosis transmembrane conductance regulator (CFTR) gene analysis (based on a panel of up to 31 mutations) in hypertrypsinaemic newborn infants and to compare it with a previous screening protocol. SETTING: The study comprised all the newborn infants in the period 1 October 1998 to 31 December 1999 in the Lombardia region, north western Italy. METHODS: The screening strategy consisted of an immunoreactive trypsinogen assay from dried blood spots, a polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (PCR-OLA), and a sequence code separation. RESULTS: 104 609 newborn infants were screened. 1457 hypertrypsinaemic infants (1.39%) were analysed with the PCR-OLA assay. 18 newborn homozygotes or compound heterozygotes for CFTR mutations were identified and referred to the cystic fibrosis (CF) centre at a mean age of 3 weeks. 125 infants presenting only one mutation were recalled for a sweat test: a diagnosis of CF was made in 13 infants, and parents of 112 neonates identified as carriers (1:13) received genetic counselling. The remaining 1314 hypertrypsinaemic newborn infants were recalled for IRT retesting and 177 were referred for a sweat test because the second IRT measurement was above the cut off value. Among this group a further two infants were diagnosed with CF (1.1%) leading to a CF prevalence of 1:3170. CONCLUSIONS: This strategy resulted in an early and accurate diagnosis of CF. The IRT/DNA/IRT protocol with an OLA assay was shown to be useful in an Italian population with a genetic heterogeneity, leading to the identification of 94% of infants with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
266 Mutations identified by the assay are G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183-AA→G, 2789+5G→A, delF508, I507del, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, and N1303K. Login to comment
280 Genotypes are shown in table 1: 18% of our patients were delF508 homozygotes, 15% were homozygotes for other CFTR alleles (N1303K, 2183AA→G, 1717-1G→A, R334W, G542X), 21% were compound heterozygotes, and a further 43% were heterozygotes. Login to comment
285 The CFTR mutations identified and their frequencies among carriers were as follows: delF508 (72 chromosomes, 64.2%), N1303K (12, 10.7%), R117H (9, 8%), G542X (7, 6.25%), R347H, R1162X, 2789+5G→A (2 alleles each, 1.8%), 1898+1G→A, 1717-1G→A, W1282X, 2183-AA→G, 621+1G→T, and 3849+10kbC→T (1, 0.9%). Login to comment
310 Since 1998, in our CF centre, an expanded DNA CFTR gene analysis and repeat sweat test after 6-12 months of life have been performed in hypertrypsinaemic Table 1 Genotypes of 33 patients with CF identified in the 15 month period Two CFTR mutations identified (18 patients) by PCR/OLA: ∆F508/∆F508 6 N1303K/N1303K 2 ∆F508/N1303K 3 R334W/R334W 1 ∆F508/G542X 2 G542X/G542X 1 ∆F508/3659delC 1 2183AA→G/ 2183AA→G 1 ∆F508/R1162X 1 One CFTR mutation identified (13 patients) by PCR/OLA: ∆F508/D1152H* 1 ∆F508/Y1032C* 1 ∆F508/R1066H* 1 ∆F508/UN 6 ∆F508/R1066C* 1 W1282X/L1077P* 1 ∆F508/D579G* 1 G85E/UN 1 No CFTR mutation identified (two patients) by PCR/OLA: 711+3A→G*/UN 1 D110E*/D110E* 1 *CFTR alleles identified by analysis by denaturing gradient gel electrophoresis and sequencing. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment
34 The mutations in the 25 mutation panel were: ∆F508, G542X, N1303K, G551D, W1282X, 1717-1G→A, R553X, 621ϩ1G→T, R1162X, 2183AA→G, R117H, ∆I507, R560T, 3849ϩ10kbC→T, S549N, S549I, S549R, R1283M, R1283K, R553G, R560K, R117L, 1774delCT, 1811ϩ1G→C, and 4006-61del14. Login to comment
35 ACMG 25 mutation panel (ACMG25): The following mutations are the recommended core mutations for general population CF carrier screening by American College of Medical Genetics (ACMG) (Grody, et al 2001): ∆F508, G542X, N1303K, G551D, W1282X, 1717-1G→A, R553X, 621ϩ1G→T, R1162X, R117H, ∆I507, 1898ϩ1G→A, G85E, R347P, A455E, R560T, R334W, 3849ϩ10kbC→T, 3659delC, 1078delT, 2789ϩ5G→A, 711ϩ1G→T, 2184delA, 3120ϩ1G→A and I148T. Login to comment
86 CFTR mutations in 92 men with congenital bilateral absence of vas deferens Mutations CFTR mutation panels CF25 CF25 ϩ 5T ACMG25 ACMG25 ϩ 5T CF100 Mutations detected in ∆F508 39 39 39 39 39 CF25 mutation panel R117H 4 4 4 4 4 W1282X 4 4 4 4 4 G551D 3 3 3 3 3 G542X 1 1 1 1 1 N1303K 1 1 1 1 1 IVS8-polyT IVS8-5T 33 33 33 Additional mutations L206W 3 detected not in CF25 D1270N 2 mutation panel 1154InsTC 1 3272-26A→G 1 A455E 1 1 1 R334W 1 1 1 Q890X 1 Total 14 52 85 54 87 95 respectively, in the total number of patients with at least one mutation. Login to comment
91 CFTR genotypes in 92 men with congenital bilateral absence of vas deferens Genotypesa CFTR mutation panelsb CF25 CF25 ϩ 5T ACMG25 ACMG25 ϩ 5T CF100 Two mutations ∆F508/5T 16 16 16 W1282X/5T 4 4 4 ∆F508/R117Hc 3 3 3 3 3 G542X/5T 1 1 1 G551D/5T 1 1 1 ∆F508/L206W 2 ∆F508/A455E 1 1 1 ∆F508/3272-26A→G 1 Q890X/5T 1 L206W/5T 1 D1270N/D1270N 1 5T/5T 1 1 1 Sub-total 3 26 4 27 33 One mutation ∆F508/ϩ 36 20 35 19 16 5T/ϩ 9 9 7 G551D/ϩ 3 2 3 2 2 G542X/ϩ 1 1 R117H/ϩ 1 1 1 1 1 N1303K/ϩ 1 1 1 1 1 W1282X/ϩ 4 4 R334W/ϩ 1 1 1 1154InsTC/ϩ 1 Sub-total 46 33 46 33 29 Total (%) 49 (53.3) 59 (64.1) 50 (54.3) 60 (65.2) 62 (67.4) No mutation (%) 43 (46.7) 33 (35.9) 42 (45.7) 32 (34.8) 30 (32.6) aMutations L206W, 3272-26A→G, Q890X, D1270N, 1154InsTC and 5T are not in either CF25 and ACMG25 panels, while A455E and R334W are not in CF25, but are part of ACMG25 panel. Login to comment

[hide] Multiplex sequence variation detection throughout ... Mol Hum Reprod. 2002 Sep;8(9):880-6. Vrettou C, Tzetis M, Traeger-Synodinos J, Palmer G, Kanavakis E
Multiplex sequence variation detection throughout the CFTR gene appropriate for preimplantation genetic diagnosis in populations with heterogeneity of cystic fibrosis mutations.
Mol Hum Reprod. 2002 Sep;8(9):880-6., [PMID:12200467]

Abstract [show]
Cystic fibrosis (CF) is one of the most important genetic diseases requiring prevention programmes. Preimplantation genetic diagnosis (PGD) represents an alternative to prenatal diagnosis, and is especially appropriate for couples with an unsuccessful reproductive history. For clinical application, protocols must be optimized to minimize PCR failure, allelic drop-out (ADO) and contamination, while simultaneously detecting a wide spectrum of CF genotypes. We have developed a flexible multiplex PCR protocol allowing analysis of sequence variations in any combination amongst seven CFTR gene exons (4, 10, 11, 13 in two parts, 14b, 17b and 21) by nested PCR and denaturing gradient gel electrophoresis analysis, along with analysis of a fluorescently labelled intragenic microsatellite (IVS8CA). The experiments were carried out on 390 single lymphocytes from three CF patients, one heterozygote and one non-CF individual. PCR efficiency of the exons ranged from 90 to 100%, and ADO from 0 to 3.8%. IVS8CA was co-amplified with a PCR efficiency of 92.4 and 10.8% ADO. The present method overcomes the need for separate assays for each CFTR gene mutation. Additionally, it facilitates analysis of any informative linked polymorphic sequence variation (within the seven exons) along with analysis of a microsatellite, which is useful (when informative) for minimizing misdiagnosis and/or indirect diagnosis. This method proved robust and flexible for diagnosing diverse CF genotype combinations in single cells.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
24 cells PCR ADO/total polymorphism (length bp) amplified product (%) cells (%) Patient 1 F508del 25 (196) 10 50 47 (94.0) 0/47 (0) 621 ϩ 1G→T 23 (192) 4 48 (96.0) 1/48 (2.1) Patient 2 N1303K 25 (196) 21 85 80 (94.1) 3/80 (3.8) 2789 ϩ 5G→A 18 (182) 14b 85 (100) 2/85 (2.4) Patient 3 E822X 17 (180) 13 part b 80 72 (90.0) 1/72 (1.4) F1052V 18 (182) 17b 75 (93.8) 2/75 (2.6) Heterozygotea 1719-9T→C 17 (180) 11 75 75 (100.0) 0/75 (0) R668C 13 part a Normal allele 18 (182) 74 (98.7) 1/74 (1.4) Microsatellite 290 268 (92.4) 29/268 (10.8) IVS8CA aIndividual heterozygote for D565G mutation in exon 12 (not included in assay) had two polymorphisms in cis to D565G (1719-9T→C in exon 11 and R668C in exon 13 part a), which were also in cis with 17 CA repeats in IVS8. Login to comment

[hide] Spatial and temporal distribution of cystic fibros... Hum Genet. 2002 Sep;111(3):247-54. Epub 2002 Aug 1. Scotet V, Gillet D, Dugueperoux I, Audrezet MP, Bellis G, Garnier B, Roussey M, Rault G, Parent P, De Braekeleer M, Ferec C
Spatial and temporal distribution of cystic fibrosis and of its mutations in Brittany, France: a retrospective study from 1960.
Hum Genet. 2002 Sep;111(3):247-54. Epub 2002 Aug 1., [PMID:12215837]

Abstract [show]
Cystic fibrosis (CF) is the most common severe inherited disorder that affects children in Caucasian populations. The aim of this study was to define the spatial and temporal distribution of CF and its mutations in Brittany (western France) where the frequency of the disease is high. We retrospectively registered all CF patients born in Brittany since 1960 by cross-checking various data sources (e.g. medical care centres, genetics laboratories, hospital archives). Councils were contacted so that the place of residence of patients at birth could be determined. Moreover, the spectrum of CF transmembrane conductance regulator (CFTR) mutations and their spatial distribution across Brittany were determined. A total of 520 patients was registered in this study. The incidence of CF was assessed according to administrative (department, district) and diocesan divisions of Brittany and its evolution analysed over four decades. The incidence of CF was 1/2630, with a west/east gradient that was confirmed over time (Finistere: 1/2071 vs Ille-et-Vilaine: 1/3286). At present, the incidence of CF is decreasing, mainly as a result of prenatal diagnosis. An excellent mutation detection rate of 99.7% was obtained. Western Brittany presented a specific spectrum of mutations: 1078delT (9.4% of mutated alleles in the diocese of Cornouaille), G551D (7.7% in the diocese of Leon), 4005+1G-->A (2.9% in Cornouaille) and W846X (1.5% in western Brittany). On the other hand, the eastern region showed a spectrum more similar to the overall picture in France as a whole. This study enabled a precise measurement of the incidence of CF in Brittany to be obtained. The high frequency of the CFTR mutated alleles may result from founder effects and genetic drifts. Moreover, the study brings together the regional specificities of the CFTR gene and highlights disparities that exist in this part of France, both in incidence and in mutation distribution. These are attributable to different degrees of isolation and of population movements between the eastern and western parts of the region. Given that this is the first time that such a detailed study of the CFTR gene has been performed on a large population, this heightened knowledge of the epidemiology of CF in Brittany should provide a basis for the improvement of diagnostic strategies and refinement of genetic counselling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 His genotype was ∆F508/∆F508 Mutation Exon Basse-Bretagne Haute-Bretagne Brittanya ∆F508 10 446 75.6% 224 73.7% 672 75.0% 1078delT 7 31 5.3% 3 1.0% 34 3.8% G551D 11 21 3.6% 12 3.9% 33 3.7% N1303K 21 3 0.5% 9 3.0% 12 1.3% W846X 14a 9 1.5% 1 0.3% 10 1.1% 2789+5G→A 14b 3 0.5% 6 2.0% 9 1.0% 1717-1G→A 11 5 0.8% 3 1.0% 8 0.9% Y1092X 17b 1 0.2% 6 2.0% 7 0.8% 4005+1G→A 20 6 1.0% 1 0.3% 7 0.8% E60X 3 3 0.5% 3 1.0% 6 0.7% 621+1G→T 4 3 0.5% 3 1.0% 6 0.7% R347H 7 6 1.0% 0 0.0% 6 0.7% S492F 10 2 0.3% 3 1.0% 5 0.6% G542X 11 4 0.7% 1 0.3% 5 0.6% 3272-26A→G 17b 2 0.3% 3 1.0% 5 0.6% R117H 4 3 0.5% 1 0.3% 4 0.4% G91R 3 3 0.5% 0 0.0% 3 0.3% ∆I507 10 1 0.2% 2 0.7% 3 0.3% R553X 11 3 0.5% 0 0.0% 3 0.3% W1282X 20 2 0.3% 1 0.3% 3 0.3% A72D 3 0 0.0% 2 0.7% 2 0.2% G85E 3 0 0.0% 2 0.7% 2 0.2% F311L 7 0 0.0% 2 0.7% 2 0.2% 1221delCT 7 2 0.3% 0 0.0% 2 0.2% R560K 11 0 0.0% 2 0.7% 2 0.2% 2622+1G→A 13 2 0.3% 0 0.0% 2 0.2% S945L 15 0 0.0% 2 0.7% 2 0.2% I1234V 19 2 0.3% 0 0.0% 2 0.2% G1249R 20 2 0.3% 0 0.0% 2 0.2% 3905insT 20 2 0.3% 0 0.0% 2 0.2% Unidentified - 3 0.5% 0 0.0% 3 0.3% Total - 590 65.7% 304 34.3% 896 100% IVS17bTA, IVS17bCA) of Irish, Scottish, English, Breton and Czech subjects who were carriers of this mutation, and showed that all these alleles carried a unique haplotype (16-7-17), testifying to the Celtic origin of this mutation (Cashman et al. 1995). Login to comment
164 The distribution and the frequency of some mutations observed in the east of Brittany are close to those observed at the national level (2789+5G→A, N1303K, ∆I507). Login to comment

[hide] Demographics of the UK cystic fibrosis population:... Eur J Hum Genet. 2002 Oct;10(10):583-90. McCormick J, Green MW, Mehta G, Culross F, Mehta A
Demographics of the UK cystic fibrosis population: implications for neonatal screening.
Eur J Hum Genet. 2002 Oct;10(10):583-90., [PMID:12357328]

Abstract [show]
The objective was to determine the composition of the Cystic Fibrosis (CF) Population attending specialist UK CF centres in terms of age, gender, age at diagnosis, genotype and ethnicity. With the planned introduction of the national CF screening programme in the UK, cystic fibrosis transmembrane regulator (CFTR) mutations were compared between different ethnic groups enabling a UK-specific frequency of mutations to be defined. Data were analysed from the patient biographies held in the UK CF Database (see www.cystic-fibrosis.org.uk). The currently registered population of 5,274 CF patients is 96.3% Caucasian with a male preponderance that significantly increases with age. The majority of the 196 non-Caucasian CF patients are from the Indian Subcontinent (ISC), of which one in 84 UK CF patients are of Pakistani origin. The commonest CFTR mutation, deltaF508, is found in 74.1% of all CF chromosomes. In the Caucasian CF population, 57.5% are deltaF508 homozygotes but the UK ISC CF population with only 24.7%, has significantly fewer deltaF508 homozygotes patients (95% confidence interval (CI) 0.2-0.4). The distribution of Caucasian patients with deltaF508/deltaF508, deltaF508/Other and Other/Other does not fit the expected distribution with a Hardy-Weinberg model unless those patients without a detected mutation are excluded (P<0.001). The UK CF Database has shown the UK CF population to have distinct characteristics separate from the North American and European CF Registries. The ISC group contains many mutations not recognised by current genetic analysis, and one in four ISC patients have no CFTR mutations identified. The CFTR analysis proposed for the screening programme would detect 96% of patients registered in the database, but is unlikely to achieve the desired >80% detection rates in the ethnic minority groups. Screen-positive, non-Caucasian infants without an identifiable CFTR mutation should be referred for a sweat test and genetic counselling when serum trypsinogen concentrations remain elevated after birth.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 It is envisaged that the proposed screening programme will be based on a three-stage protocol.6 In Table 3 Genotypes of the UK CF Caucasian and ISC populations Percentage of Percentage of genotyped UK CF genotyped UK CF Caucasian population ISC population Genotype n=4753 (%) n=78 (%) DF508/DF508 57.5 24.7 DF508/Unknown 11.5 3.5 DF508/G551D 5.1 0.0 DF508/G542X 2.8 0.0 Unknown/Unknown 2.7 27.1 DF508/621+1G?T 2.0 1.2 DF508/R117H 2.0 0.0 DF508/1898+1G?A 1.0 0.0 DF508/1717-G?A 0.9 0.0 DF508/N1303K 0.8 0.0 DF508 DI507 0.8 0.0 DF508/R553X 0.6 0.0 DF508/R560T 0.6 0.0 DF508/Q493X 0.5 0.0 G551D/Unknown 0.4 0.0 Other/Other 2.8 15.3* DF508/Other 6.7 0.0 Y569D/Y569D 0.0 8.2 L218X/L218X 0.0 3.5 1161delC/1161delC 0.0 3.5 R709X/V456A 0.0 2.4 G542X/G542X 0.4 2.4 Other/Unknown 1.0 3.5 The shaded areas represent the commonest genotypes in the ISC population. Login to comment
85 Table 4 The commonest CFTR mutations in the UK Genotypes UK CF population Genotyped UK Caucasian CF Genotyped UK CF ISC (n=9866 chromosomes) population (n=9506 chromosomes) population (n=156 chromosomes) CFTR mutation gene frequency per 1000 genes gene frequency per 1000 genes gene frequency per 1000 genes DF508 741.0 752.0 294.9 G551D 33.7 34.3 12.8 G542X 18.5 18.4 25.6 R117H 12.5 12.7 0.0 621+1G?T 12.7 12.7 6.4 1717-1G?A 5.8 5.8 0.0 1898+1G?A 5.7 5.9 0.0 N1303K 5.6 5.4 0.0 DI507 4.8 5.0 0.0 R560T 4.2 4.3 0.0 R553X 3.3 3.4 0.0 1154insTC 3.2 3.3 0.0 Q493X 2.8 2.9 0.0 3659delC 2.8 2.9 0.0 E60X 2.4 2.4 0.0 W1282X 2.7 2.7 0.0 P67L 2.1 2.1 0.0 G85E 2.1 2.0 0.0 V520F 1.6 1.7 0.0 1078delT 1.3 1.4 0.0 Y569D 1.5 0.0 96.2 L218X 0.6 0.0 38.5 1161delC 0.7 0.1 38.5 R1162X 0.9 0.6 19.2 R709X 0.4 0.2 12.8 3849+10kbC?T 1.2 0.8 19.2 S549R* 0.6 0.0 0.0 *S549R mutations appear in the non-Caucasian but not the ISC subgroup. Login to comment
97 In North America, DF508 accounts for 71.2%, with G542X (2.4%), G551D (2.4%), W1282X (1.4%), N1303K (1.3%) and R553X (0.9%).8 Genotype frequencies in CF have previously been shown to fit a Hardy - Weinberg model in a smaller regional UK study.9 In the current study, we find that the genotype frequencies only satisfy the Hardy-Weinberg equilibrium provided we exclude those without an identified CFTR mutation in the Other/Other category. Login to comment
101 When compared with a European CFTR geographic distribution,10 the UK CF patients possess a greater proportion of DF508, G551D and 621+1G?T mutations, and a smaller proportion of G542X, N1303K, W1282X and R1162X mutations. Login to comment
102 In France, the five most common genotypes were DF508/DF508 (47.8%), DF508 /G542X (3.4%), DF508/N1303K (2.7%), DF508 /1717-1G?A (2.1%) and DF508/2789+5G?A (1.5%) (Desgeorges M, personal communication) which is different to the commonest genotypes found in the UK population (Table 3). Login to comment
103 N1303K and G542X occur at a frequency of around 5% in Italy.11 In Germany, a study of 658 CF families revealed mutation frequencies of R553X (1.8%), N1303K (1.3%), G542X (1.1%), G551D (0.8%) and R347P (0.8%).12 The frequency of CFTR mutations recorded for just over 1000 patients for the Irish CF Database include G551D in 7%, R117H in 2% and DF508 in 72% of patients.13 In the white South African population, a paper based on 192 patients found that DF508 accounts for 76% of the mutations with 3272-26A?G (4%), 394delTT (3.6%) and G542X (1.3%) the other most common mutations.14 It is suggested that the 3272-26A?G and 394delTT mutations are more common due to a founder effect in white South Africans of European descent. Login to comment

[hide] Correction of G551D-CFTR transport defect in epith... Br J Pharmacol. 2002 Oct;137(4):504-12. Zegarra-Moran O, Romio L, Folli C, Caci E, Becq F, Vierfond JM, Mettey Y, Cabrini G, Fanen P, Galietta LJ
Correction of G551D-CFTR transport defect in epithelial monolayers by genistein but not by CPX or MPB-07.
Br J Pharmacol. 2002 Oct;137(4):504-12., [PMID:12359632]

Abstract [show]
1. This study compares the effect of three chemically unrelated cystic fibrosis transmembrane conductance regulator (CFTR) activators on epithelial cell monolayers expressing the G551D-CFTR mutant. 2. We measured Cl(-) transport as the amplitude of short-circuit current in response to the membrane permeable cAMP analogue 8-(4-chlorophenylthio)adenosine-3'-5'-cyclic monophosphate (CPT-cAMP) alone or in combination with a CFTR opener. The correction of G551D-CFTR defect was quantified by comparison with maximal activity elicited in cells expressing wild type CFTR. To this end we used Fisher rat thyroid (FRT) cells transfected with wild type or G551D CFTR, and primary cultures of human nasal epithelial cells. 3. In both types of epithelia, cAMP caused activation of Cl(-) transport that was inhibited by glibenclamide and not by 4,4'-diisothiocyanato-stilbene-2,2'-disulfonic acid. After normalising for CFTR expression, the response of FRT-G551D epithelia was 1% that of wild type monolayers. 4. Addition of genistein (10-200 micro M), but not of 8-cyclopentyl-1,3-dipropylxanthine (CPX, 1-100 micro M) or of the benzo[c]quinolizinium MPB-07 (10-200 micro M) to FRT-G551D epithelia pre-treated with cAMP, stimulated a sustained current that at maximal genistein concentration corresponded to 30% of the response of wild type epithelia. 5. The genistein dose-response curve was bell-shaped due to inhibitory activity at the highest concentrations. The dose-dependence in G551D cells was shifted with respect to wild type CFTR so that higher genistein concentrations were required to observe activation and inhibition, respectively. 6. On human nasal epithelia the correction of G551D-CFTR defective conductance obtained with genistein was 20% that of wild type. The impressive effect of genistein suggests that it might correct the Cl(-) transport defect on G551D patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 The second mutation is presently unknown, but is not one of the 15 most frequent mutations found in the CF patients of Northeast Italy, namely F508del, I507del, R1162X, 2183AA4G, N1303K, 3849+10KbC4T, G542X, 1717-1G4A, R553X, Q552X, G85E, 711+5G4A, 3132delTG, 2789+5G4A, W1282X. Login to comment

[hide] The I148T CFTR allele occurs on multiple haplotype... Genet Med. 2002 Sep-Oct;4(5):319-23. Rohlfs EM, Zhou Z, Sugarman EA, Heim RA, Pace RG, Knowles MR, Silverman LM, Allitto BA
The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis.
Genet Med. 2002 Sep-Oct;4(5):319-23., [PMID:12394343]

Abstract [show]
PURPOSE: To determine whether intragenic changes modulate the cystic fibrosis (CF) phenotype in individuals who are positive for the I148T allele. METHODS: The genes from individuals who carried at least one copy of the I148T allele were analyzed for additional changes that may be acting as genetic modifiers. RESULTS: Seven of eight individuals with a known or suspected diagnosis of CF who carried I148T in combination with a severe CF mutation also carried 3199del6. Eight apparently healthy adult individuals who were compound heterozygous for I148T and a severe CF mutation or homozygous for I148T did not carry the deletion ( = 0.0014). The I148T allele occurs on at least three haplotypes: an IVS-8 9T background, a 7T background, or a 9T + 3199del6 background. The 3199del6 allele was not identified in 386 non-CF chromosomes. CONCLUSIONS: It is concluded that I148T occurs on at least three haplotypes and the complex allele I148T + 9T + 3199del6 is associated with a classic CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 Diagnostic testing of individuals affected with CF, or suspected of having CF, identified eight individuals who were compound heterozygous for a severe mutation (⌬F508, N1303K, or Q890X) and I148T (Table 2). Login to comment
77 Table 2 3199del6 analysis in patients with a known or suspected diagnosis of CF and compound heterozygous for I148T and a severe CF mutation Indiv no. Indication for testing Ethnicity Age (yr) Mutation 1 Mutation 2 Intron 8 poly(T) 3199del6 17 Suspected CF NEC 4 ⌬F508 I148T 9, 9 pos 18 Suspected CF Caucasian, N. American 1 ⌬F508 I148T 9, 9 pos 19 Affected CF NEC Ͻ1 N1303K I148T 9, 9 pos 20 Suspected CF NEC 5 ⌬F508 I148T 9, 9 nega 22 Affected CF NEC 14 ⌬F508 I148T 9, 9 pos 39 Pancreatic steatorrhea NEC 3 ⌬F508 I148T 9, 9 pos 41 Suspected CF Hispanic 10 Q890X I148T 7, 9 pos 42 Affected CF NEC 20 ⌬F508 I148T 9, 9 pos NEC, Northern European Caucasian. Login to comment

[hide] Standards and guidelines for CFTR mutation testing... Genet Med. 2002 Sep-Oct;4(5):379-91. Richards CS, Bradley LA, Amos J, Allitto B, Grody WW, Maddalena A, McGinnis MJ, Prior TW, Popovich BW, Watson MS, Palomaki GE
Standards and guidelines for CFTR mutation testing.
Genet Med. 2002 Sep-Oct;4(5):379-91., [PMID:12394352]

Abstract [show]
One mission of the ACMG Laboratory Quality Assurance (QA) Committee is to develop standards and guidelines for clinical genetics laboratories, including cytogenetics, biochemical, and molecular genetics specialties. This document was developed under the auspices of the Molecular Subcommittee of the Laboratory QA Committee by the Cystic Fibrosis (CF) Working Group. It was placed on the "fast track" to address the preanalytical, analytical, and postanalytical quality assurance practices of laboratories currently providing testing for CF. Due to the anticipated impact of the ACMG recommendation statement endorsing carrier testing of reproductive couples, it was viewed that CF testing would increase in volume and that the number of laboratories offering CF testing would also likely increase. Therefore, this document was drafted with the premise of providing useful information gained by experienced laboratory directors who have provided such testing for many years. In many instances, "tips" are given. However, these guidelines are not to be interpreted as restrictive or the only approach but to provide a helpful guide. Certainly, appropriately trained and credentialed laboratory directors have flexibility to utilize various testing platforms and design testing strategies with considerable latitude. We felt that it was essential to include technique-specific guidelines of several current technologies commonly used in laboratories providing CF testing, since three of the four technologies discussed are available commercially and are widely utilized. We take the view that these technologies will change, and thus this document will change with future review.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Depending upon the ethnic group, these mutation frequencies may be difficult to obtain (Table 1).5-7 CF 2.8.1 The most common mutations in the Ashkenazi Jewish population have been described.8-10 These include W1282X, ⌬F508, G542X, N1303K, and 3849 ϩ 10 kbCϾT. Login to comment
307 ⌬F508 R553X R1162X 2184delA 3120ϩ1GϾA ⌬I507 G542X G551D W1282X N1303K 621ϩ1GϾT R117H 1717-1GϾA A455E R560T G85E R334W R347P 711ϩ1GϾT 1898ϩ1GϾA 1078delT 3849ϩ10kbCϾT 2789ϩ5GϾA 3659delC I148T CF 3.3.2 Inclusion of the common R117H mutation in the test panel screens for CBAVD as well as for CF: The phenotypic consequences of the R117H mutation are modulated in cis by the 5/7/9T polypyrimidine tract in intron 8 such that R117H/7T is associated with CBAVD and R117H/5T is associated with CF.34 Moreover, the 5T allele is associated as a trans mutation in CBAVD.35 It is recommended that the 5/7/9T variant be excluded from the routine carrier screen but tested as a reflex for carriers shown to be heterozygous for the R117H mutation. Login to comment

[hide] Splice mutation 1811+1.6kbA>G causes severe cystic... J Med Genet. 2002 Nov;39(11):e73. Reboul MP, Bieth E, Fayon M, Biteau N, Barbier R, Dromer C, Desgeorges M, Claustres M, Bremont F, Lacombe D, Iron A
Splice mutation 1811+1.6kbA>G causes severe cystic fibrosis with pancreatic insufficiency: report of 11 compound heterozygous and two homozygous patients.
J Med Genet. 2002 Nov;39(11):e73., [PMID:12414835]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 Genotype-phenotype data are available especially for common genotypes,2 but information remains scarce or lacking for genotypes of compound heterozygotes with a rare mutation and homozygotes for a rare mutation.3 Among rare CFTR gene mutations, 1811+1.6kbA>G is practically absent in CF patients from other parts of France, but it is not rare in patients genotyped in the south west of France, occurring in fourth place after F508del, G542X, and N1303K. Login to comment
140 RESULTS The results of genotyping the 13 CF patients carrying the mutation 1811+1.6kbA>G were: two homozygotes for 1811+1.6kbA>G/1811+1.6kbA>G and 11 compound heterozygotes for 1811+1.6kbA>G and for another CFTR mutation, that is, F508del (n=6), N1303K (n=2), G542X (n=1), 2183 AA>G (n=1), and W1063X (n=1). Login to comment
148 Key points • The splice mutation 1811+1.6kbA>G of the CFTR gene is the fourth most frequent mutation (after F508del, G542X, and N1303K) in CF patients from the south west of France. Login to comment
160 Some of them are always responsible for a unique phenotype that can be either CF-PI (for instance, the case of N1303K in class II, G551D in class III, and R1066C in class IV), or CF-PS (for instance, the case of G551S in class III) or CBVAD for D1152H (class IV). Login to comment

[hide] Survey of CF mutations in the clinical laboratory. BMC Clin Pathol. 2002 Nov 19;2(1):4. Huber K, Mirkovic B, Nersesian R, Myers A, Saiki R, Bauer K
Survey of CF mutations in the clinical laboratory.
BMC Clin Pathol. 2002 Nov 19;2(1):4., 2002-11-19 [PMID:12437773]

Abstract [show]
BACKGROUND: Since it is impossible to sequence the complete CFTR gene routinely, clinical laboratories must rely on test systems that screen for a panel of the most frequent mutations causing disease in a high percentage of patients. Thus, in a cohort of 257 persons that were referred to our laboratory for analysis of CF gene mutations, reverse line probe assays for the most common CF mutations were performed. These techniques were evaluated as routine first-line analyses of the CFTR gene status. METHODS: DNA from whole blood specimens was extracted and subjected to PCR amplification of 9 exons and 6 introns of the CFTR gene. The resulting amplicons were hybridised to probes for CF mutations and polymorphisms, immobilised on membranes supplied by Roche Molecular Systems, Inc. and Innogenetics, Inc. Denaturing gradient gel electrophoresis and sequencing of suspicious fragments indicating mutations were done with CF exon and intron specific primers. RESULTS: Of the 257 persons tested over the last three years (referrals based on 1) clinical symptoms typical for/indicative of CF, 2) indication for in vitro fertilisation, and 3) gene status determination because of anticipated parenthood and partners or relatives affected by CF), the reverse line blots detected heterozygote or homozygote mutations in the CFTR gene in 68 persons (26%). Eighty-three percent of those affected were heterozygous (47 persons) or homozygous (10 persons) for the DeltaF508 allele. The only other CF-alleles that we found with these tests were the G542X allele (3 persons), the G551D allele (3 persons), the 3849+10kb C-T allele (2 persons) the R117H allele (2 persons) and the 621+1G-T allele (1 person).Of the fifteen IVS8-5T-polymorphisms detected in intron 8, seven (47%) were found in males referred to us from IVF clinics. These seven 5T-alleles were all coupled with a heterozygous DeltaF508 allele, they make up 35% of the males with fertility problems (20 men) referred to us. CONCLUSIONS: In summary, the frequency of CF chromosomes in the cohort examined with these tests was 26%, with the DeltaF508 allele affecting 83% of the CF chromosomes. It is a substantial improvement for routine CF diagnostics to have available a test system for 30 mutations plus the polypyrimidine length variants in intron 8. Our results show that this test system allows a routine first-line analyses of the CFTR gene status.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 F508C, I507V, I506V polymorphism exon 11 1717-1G → A, G542X, S549N, G551D, R553X, R560T exon 20 W1282X exon 21 N1303K intron 19 3849+10kb C → T Innogenetics assay: exon 3 394delTT, G85E, E60X exon/intron 4 621+1G-T, R117H exon 7 1078delT, R347P, R334W exon 13 2143delT, 2183AA-G, 2184delA exon 19 R1162X, 3659delC intron 5 711+5G-A intron8/exon 9 A455E,, 5T,7T,9T intron 14b 2789+5G-A intron 19 3849+10kb C-T Table 2: Genotypes of patients with mutations, final results Group 1) (patients with symptoms typical for/indicative of CF) No. Login to comment

[hide] Highest heterogeneity for cystic fibrosis: 36 muta... Am J Med Genet. 2002 Dec 1;113(3):250-7. Kilinc MO, Ninis VN, Dagli E, Demirkol M, Ozkinay F, Arikan Z, Cogulu O, Huner G, Karakoc F, Tolun A
Highest heterogeneity for cystic fibrosis: 36 mutations account for 75% of all CF chromosomes in Turkish patients.
Am J Med Genet. 2002 Dec 1;113(3):250-7., 2002-12-01 [PMID:12439892]

Abstract [show]
We analyzed the CFTR locus in 83 Turkish cystic fibrosis patients to identify mutations, haplotypes, and the carrier frequency in the population. We detected 36 different mutations in 125 (75%) of the total 166 CF chromosomes. Seven novel mutations were identified: four missense (K68E, Q493P, E608G, and V1147I), two splice-site (406 -3T > C and 3849 +5G > A), and one deletion (CFTRdele17b,18). The data showed that the Turkish population has the highest genetic heterogeneity at the CFTR locus reported so far. The results of this thorough molecular analysis at the CFTR locus of a population not of European descent shows that CF is not uncommon in all such populations. The large number of mutations present, as well as the high heterogeneity in haplotypes associated with the mutations suggests that most of the mutations have persisted for a long time in the population. Consistently, the carrier frequency is assessed to be high, indicating that the disease in the population is ancient.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Haplotypes Associated With the Mutations Identified in 83 Turkish CF Patients* Mutation Total number of alleles Number of alleles Number of patients Haplotypes Homo Hetero DF508 39 (23.5) 6 7 23 M 28 13 1 0 1 6 7 23 M 30 13 1 0 1 6 9 23 M 31 13 1 0 1 6 7 23 M 31 13 11 4 3 6 7 23 M 7 17 2 0 2 6 7 16 M 31 13 3 1 1 6 7 17 M 31 13 17 5 7 6 7 17 M 32 13 3 1 1 1677delTA 12 (7.2) 7 7 16 V 30 13 12 5 2 2183AA > G 7 (4.2) 7 7 16 M 30 13 1 0 1 7 9 16 M 31 13 4 2 0 7 7 16 M 32 13 2 1 0 G542X 6 (3.6) 6 7 23 M 32 13 6 3 0 F1052V 5 (3.0) 6 7 17 M 7 13 4 1 2 7 5 17 M 7 17 1 0 1 W1282X 5 (3.0) 7 7 17 M 7 17 4 1 2 7 7 17 M 7 18 1 0 1 E92K 4 (2.4) 7 7 16 V 46 13 3 1 1 7 7 17 V 46 13 1 0 1 1525 À 1G > A 4 (2.4) 7 7 17 M 7 17 4 2 0 2789 þ 5G > A 4 (2.4) 7 9 17 M 7 17 3 1 1 7 5 17 M 7 17 1 0 1 N1303K 4 (2.4) 7 7 23 M 31 13 2 0 2 6 7 22 M 30 13 1 0 1 6 7 23 M 30 13 1 0 1 A46D 3 (1.8) 6 9 23 M 31 13 1 0 1 6 7 23 M 31 13 2 1 0 2184insA 3 (1.8) 7 5 17 V 30 13 1 0 1 7 7 16 V 30 13 2 0 2 R1070Q 3 (1.8) 7 7 16 M 31 13 1 0 1 7 7 17 M 31 13 2 0 2 Q493Pa 2 (1.2) 6/7 5 16 M 46 13 2 1 0 3849 þ 5G > Aa 2 (1.2) 7 7 16 M 31 13 2 1 0 CFTRdele17b,18a 2 (1.2) 6 9 16 V - - 2 1 0 K68Ea 1 (0.6) 6 9 17 M 7 13 1 0 1 R74W 1 (0.6) 6 7 16 M 32 16 1 0 1 306delTAGA 1 (0.6) 7 7 16 M 7 17 1 0 1 D110H 1 (0.6) 7 9 16 V 30 13 1 0 1 I125T 1 (0.6) 6 7 23 V 7 16 1 0 1 406 À 3T > Ca 1 (0.6) 7 7 16 V 33 17 1 0 1 I148T 1 (0.6) 6/7 7 16/17 M 7 17/23 1 0 1 621 þ 1G > T 1 (0.6) 6 7 21 V 31 13 1 0 1 R347P 1 (0.6) 7 9 17 V 30 13 1 0 1 S466X 1 (0.6) 7 7 23 M 33 13 1 0 1 L571S 1 (0.6) 7 7 16 V 29 13 1 0 1 1717 À 1G > A 1 (0.6) 7 9 17 M 7 16 1 0 1 E608Ga 1 (0.6) 7 9 16 M/V 29/31 13 1 0 1 2043delG 1 (0.6) 7 9 17 M 7 17 1 0 1 P1013L 1 (0.6) 6 5 16 M 21 18 1 0 1 R1066L 1 (0.6) 7 7 17 M 7 13 1 0 1 3129del4 1 (0.6) 7 7 16 V 29 13 1 0 1 V1147Ia 1 (0.6) 6 7 17 M 33 17 1 0 1 S1235R 1 (0.6) 6 7 17 M 39 13 1 0 1 CFTRdele2,3 1 (0.6) 7 7 16 V 33 13 1 0 1 Total 125 (75) 125 32 61 *The order of the polymorphisms is IVS6GATT, Tn, IVS8CA, M470V, IVS17BTA and IVS17BCA. Login to comment

[hide] Genes in the vicinity of CFTR modulate the cystic ... Hum Genet. 2003 Jan;112(1):1-11. Epub 2002 Oct 3. Mekus F, Laabs U, Veeze H, Tummler B
Genes in the vicinity of CFTR modulate the cystic fibrosis phenotype in highly concordant or discordant F508del homozygous sib pairs.
Hum Genet. 2003 Jan;112(1):1-11. Epub 2002 Oct 3., [PMID:12483292]

Abstract [show]
Cystic fibrosis (CF) is the most common severe autosomal recessive disease among Caucasians and is caused by lesions within the cystic fibrosis transmembrane conductance regulator ( CFTR) gene. The variability of CF disease severity suggests the effect of modifying factors. Thirty-four highly concordant and highly discordant F508del homozygous sib pairs, who have been selected out of a group of 114 pairs for extreme disease phenotypes by nutritional and pulmonary status, were typed at single nucleotide polymorphisms (SNPs) and short tandem repeat polymorphisms (STRPs) in the 24-cM CFTR-spanning region between D7S525 and D7S495. Allele frequencies differed significantly at D7S495, located within a 21-cM distance 3' of CFTR, comparing concordant mildly affected, concordant severely affected and discordant sib pairs, as judged by hypothesis-free permutation analysis by Monte Carlo simulation. A rare haplotype of two SNPs within the leptin gene promotor was found exclusively among the concordant mildly affected pairs. All concordant sib pairs shared the paternal F508del chromosome between CFTR and D7S495, whilst the cohort of discordant sib pairs inherited equal proportions of recombined and non-recombined parental chromosomes. We conclude that disease manifestation in CF is modulated by loci in the partially imprinted region 3' of CFTR that determine stature, food intake and energy homeostasis, such as the Silver-Russel-Syndrome candidate gene region and LEP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 The frequent CFTR mutations, F508del, N1303K, and G542X, are associated with several intragenic STRP haplotypes, but occur on the same flanking SNP haplotype (Dörk et al. 1992; Sereth et al. 1993; Morral et al. 1993; Cuppens et al. 1994; Morral et al. 1996). Login to comment

[hide] A clinical perspective of cystic fibrosis and new ... Am J Med Genet A. 2003 Jan 30;116A(3):262-7. Kulczycki LL, Kostuch M, Bellanti JA
A clinical perspective of cystic fibrosis and new genetic findings: relationship of CFTR mutations to genotype-phenotype manifestations.
Am J Med Genet A. 2003 Jan 30;116A(3):262-7., 2003-01-30 [PMID:12503104]

Abstract [show]
The present report describes several aspects of the relationship of mutations in the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene to phenotype expression of the disease including several clinical vignettes from the authors' experience. The genotype-phenotype relationships in CF are complex, and are affected by many factors, including pollution, smoking, bacterial infection, malnutrition, and certain therapeutic agents. The number of CFTR mutations is growing continuously and rapidly, and more than 1,000 mutations have been discovered so far. From a genetic point of view, the deltaF508 mutation is not only the most frequently encountered but also the most severe genetic lesion for homozygotes. The great clinical variability observed in patients with CF, particularly the severity of lung disease, involvement of the pancreas, and male infertility, are beginning to be better understood through the knowledge, although incomplete, of CFTR mutations and their phenotype expressions. This knowledge has had very significant research and clinical applications in all dimensions of the CF problem. It has not only contributed to the enhancement of better diagnosis and clinical management, but it also has opened new and unanticipated lines of investigation and research.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 At the age of 60, genetic testing indicated two mutations H1282X (severe) and A 445E (mild), confirming the CF diagnosis as a compound heterzygote with normal alleles for D F508, -G551D, -R553X, -G542X, and N1303K [Kulczycki et al., 1998]. Login to comment

[hide] Cystic fibrosis carrier screening: issues in imple... Genet Med. 2002 Nov-Dec;4(6):407-9. Watson MS, Desnick RJ, Grody WW, Mennuti MT, Popovich BW, Richards CS
Cystic fibrosis carrier screening: issues in implementation.
Genet Med. 2002 Nov-Dec;4(6):407-9., [PMID:12509709]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 Among five individuals with CF and with ⌬F508 or N1303K mutation and I148T, four had I148T on a background of 9T and 3199del6. Login to comment

[hide] Cystic fibrosis transmembrane regulator gene mutat... J Trop Pediatr. 2002 Dec;48(6):348-50. Eskandarani HA
Cystic fibrosis transmembrane regulator gene mutations in Bahrain.
J Trop Pediatr. 2002 Dec;48(6):348-50., [PMID:12521276]

Abstract [show]
A genotypic study was undertaken to characterize the cystic fibrosis transmembrane regulator gene mutations (CFTR) in the Bahraini cystic fibrosis (CF) population using a polymerase chain reaction-based direct gene test to search for 15 common CF mutations amongst Arabs. During the period October 2000 to May 2001, 19 patients (12 males and seven females; aged at time of study between 4 months and 14 years with a mean age of 5.4 +/- 4.3 years) from 13 families were recruited in the study. Patients were diagnosed as having CF, based on a typical clinical picture and sweat chloride levels > 60 mmol/l and were screened for CFTR mutations. The rate of consanguinity among the families was 77 per cent. Eight mutations were detected in 21 of the 26 alleles examined. The overall detection rate was approximately 81 per cent. The allele frequency of the eight mutations was estimated to be approximately 73 per cent. There was no specific phenotypic pattern that correlated with a specific genotype. All families except two were of Bahraini origin. Of the eight mutations detected, four were common among Bahrainis (2043delG > 548A --> T > 4041C --> G = deltaF508, in order of decreasing frequency), accounting for 66 per cent of the Bahraini CF alleles. However, we also detected four different heterozygous mutations, namely: 1161delC, 1756G -->T, 3120 + 1G --> A, and 3661A --> T, accounting for 16 per cent of the Bahraini CF alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 Isolation and PCR amplification of genomic DNA Genomic DNA was extracted from leucocytes according to standard procedures.10 PCR amplification of DNA was performed by preparation of a 50-µl reaction mixture that contained appropriate primers using standard protocols.4 Mutation analysis All patients were screened for 15 common mutations amongst Arabs by restriction enzyme digestion analysis with appropriate enzymes according to specific protocols4,5 and/or using the amplification refractory mutation system (ARMS-PCR) technique.11 These mutations were: 406-2A→G (intron 3), 425del42 (exon 4), 475G→T (exon 4), 548A→T (exon 4), 1161delC (exon 7), 1548delG (exon10), F508 (exon 10), G542X (exon 11), 2043delG (exon 13), 3120+1G→A (intron 16), 3661A→T (exon 19), 3849+10KbC→T (intron 19), I1234V (exon 19), W1282X (exon 20), and N1303K (exon 21). Login to comment

[hide] Extensive sequencing of the cystic fibrosis transm... Genet Med. 2003 Jan-Feb;5(1):9-14. Strom CM, Huang D, Chen C, Buller A, Peng M, Quan F, Redman J, Sun W
Extensive sequencing of the cystic fibrosis transmembrane regulator gene: assay validation and unexpected benefits of developing a comprehensive test.
Genet Med. 2003 Jan-Feb;5(1):9-14., [PMID:12544470]

Abstract [show]
PURPOSE: To develop a sequencing assay for the gene to identify mutations in patients with cystic fibrosis (CF). METHODS: An automated assay format was developed to sequence all exons and splice junctional sequences, the promotor region, and parts of introns 11 and 19. RESULTS: After validating the assay using 20 known samples, DNA of seven patients, four of whom were heterozygous for a known CF mutation, was sequenced. Known CF mutations were detected in seven of the eight chromosomes, and a novel missense mutation was detected in the eighth. In addition, this assay allowed 14 ambiguous results obtained using the Roche CF gold strips to be resolved. Three false-positive diagnoses were prevented; a different mutation at the same codon was identified in two patients and confirmation was provided in the remaining nine cases. CONCLUSIONS: Sequencing of the gene provides important information for CF patients and is a valuable adjunct to a carrier screening program to resolve ambiguities in panel testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Table 2 Mutant samples used for validation of sequencing assay Mutation expected wt/wt (3 patients) delta F508/wt (2 patients) R117H/wt (3 patients) 2789 ϩ 5 G 3 A/2789 ϩ 5 G 3 A (both parents confirmed carriers) R117H/delta F508 (2 patients) delta F508/I148T delta F508/R1066C delta F508/3848 ϩ 10 kb C 3 T delta F508/G542X R117H/I148T (2 patients) 2307 delA/N1303K deltaF 508/711 ϩ 1 G 3 T deltaF 508/1898 ϩ 1 G 3 A G551D/N1303K 2789 ϩ 5G3A. Login to comment

[hide] Cystic fibrosis mutation frequencies in an Irish p... Clin Genet. 2003 Feb;63(2):121-5. Devaney J, Glennon M, Farrell G, Ruttledge M, Smith T, Houghton JA, Maher M
Cystic fibrosis mutation frequencies in an Irish population.
Clin Genet. 2003 Feb;63(2):121-5., [PMID:12630958]

Abstract [show]
The incidence of cystic fibrosis (CF) at birth in Ireland is 1/1461. Neonate CF genetic testing is not routinely performed in Ireland. Currently, screening is only carried out where there is clinical evidence or a family history to suggest disease. Here we report the frequencies of common CF mutations occurring in an Irish population composed of samples collected from western, mid-western and southern regions of Ireland. Rarer CF mutations were also identified in a selected number of CF patients. In addition, a number of polymorphisms were identified, some of which are reported to be functionally and phenotypically important.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 In a selected cohort of 40 patients, six other common ABCC7 mutations were screened for, using PCR-REA: R347P, A455E, R1162X, 384910kbC> T, W1282X and N1303K. Login to comment
27 Samples (n 40) were screened using an in-house optimized protocol to screen for six additional mutations (R347P, A455E, R1162X, 3849 10kbC > T, W1282X and N1303K). Login to comment

[hide] Chronic pancreatitis and cystic fibrosis. Gut. 2003 May;52 Suppl 2:ii31-41. Witt H
Chronic pancreatitis and cystic fibrosis.
Gut. 2003 May;52 Suppl 2:ii31-41., [PMID:12651880]

Abstract [show]
Recent discoveries of trypsinogen and trypsin inhibitor mutations in patients with chronic pancreatitis (CP) support the hypothesis that an inappropriate activation of pancreatic zymogens to active enzymes within the pancreatic parenchyma starts the inflammatory process. Current data suggest that CP may be inherited dominant, recessive, or complex as a result of mutations in the above mentioned or yet unidentified genes. Evaluation of patients with CP should include genetic testing. Cystic fibrosis (CF) is an autosomal recessive inherited disorder caused by mutations in the CF transmembrane conductance regulator (CFTR) gene and is characterised by pancreatic insufficiency and chronic bronchopulmonary infection. The progression and severity of pulmonary disease differs considerably between people with identical CFTR mutations and does not seem to correlate with the type or class of the CFTR mutation. The identification of further disease modifying genetic factors will increase the pathophysiological understanding and may help to identify new therapeutic targets.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
430 Nucleus Class I defective protein synthesis (R553X, W1282X, 3950delT) Class II abnormal processing/trafficking (del508, N1303K) Class VI defective regulation of other ion channels (del508, G551D) Class V reduced synthesis (3849+10kbC>T) Class IV decreased conductance (R117H, R347P, D1152H) Class III defective activation (G551D) I II VI V III IV RD ATP Endoplasmic reticulum NBD NBD Golgi mutations result in a decreased amount of functional protein by abnormal splicing or reduced trafficking. Login to comment

[hide] Longitudinal follow-up of exocrine pancreatic func... J Pediatr Gastroenterol Nutr. 2003 Apr;36(4):474-8. Walkowiak J, Nousia-Arvanitakis S, Agguridaki C, Fotoulaki M, Strzykala K, Balassopoulou A, Witt M, Herzig KH
Longitudinal follow-up of exocrine pancreatic function in pancreatic sufficient cystic fibrosis patients using the fecal elastase-1 test.
J Pediatr Gastroenterol Nutr. 2003 Apr;36(4):474-8., [PMID:12658038]

Abstract [show]
BACKGROUND: A progressive decline in pancreatic function is possible in cystic fibrosis (CF) patients with exocrine pancreatic sufficiency. The secretin-cholecystokinin test is invasive and not acceptable as a repeatable procedure for children. Steatorrhea, conversely, has low sensitivity. Therefore, the aim of the present study was to evaluate the usefulness of the noninvasive fecal elastase-1 (E1) test for the longitudinal assessment of exocrine pancreatic function (EPF) in pancreatic-sufficient (PS) CF patients. METHODS: One hundred eighty-four CF patients were included in the study. In all subjects, E1 concentrations and fecal fat excretion were measured. PS patients were followed for 5 years. RESULTS: At the beginning of the study, 35 (19.0%) CF patients were PS, and 32 (17.4%) had normal E1 concentrations. Longitudinal measurements of E1 concentrations in PS patients with CF demonstrated stable enzyme output in 27 and gradual decrease in 8. The decrease was rapid in five infant patients and gradual in three older patients. The decrease of E1 concentrations preceded the appearance of steatorrhea in all eight subjects. CONCLUSIONS: The decline of EPF in patients with CF appears more frequently during the first months and years of life. However, late PS to pancreatic-insufficient (PI) conversion is also possible. The appearance of maldigestion is preceded by the decrease of fecal E1 concentration. Thus, the fecal E1 test is a helpful screening tool for the longitudinal assessment of declining EPF in PS patients with CF to demonstrate pancreatic deterioration. In suspected patients, fecal fat excretion should be assessed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 RESULTS Among the patients studied, the following mutations of the CFTR gene were present (n): ⌬F508 (223), 621+G-T (10), N1303K (9), 3849+10kbC-T (6), G542X (5), CFTRdele2,3(21kB) (4), E822X (4), 1717-1G-A (3), E836X (3), G1069-L88X (2), R533X (1), G85E (1), 1677delTA (1), G1069R (1), 1525-1G-A (1), and 2789+5G-A (1). Login to comment

[hide] Clinical characteristics and genotype analysis of ... Clin Otolaryngol Allied Sci. 2003 Apr;28(2):125-32. Cimmino M, Cavaliere M, Nardone M, Plantulli A, Orefice A, Esposito V, Raia V
Clinical characteristics and genotype analysis of patients with cystic fibrosis and nasal polyposis.
Clin Otolaryngol Allied Sci. 2003 Apr;28(2):125-32., [PMID:12680831]

Abstract [show]
The prevalence of nasal polyps in a group of paediatric patients with cystic fibrosis was prospectively studied in comparison with a control group with cystic fibrosis but without polyps. Clinical variables, including pulmonary function tests, skin testing and mucociliary transport, were carried out in both groups, as well as genotype analysis. Endoscopic intranasal evaluation identified polyps in 29 of 89 patients (33%). Statistical analysis revealed that patients with nasal polyposis had better pulmonary function, a higher rate of Pseudomonas aeruginosa colonization, more hospitalizations, and more prevalence of allergy to Aspergillus fumigatus than did the comparison group. We found no statistically different genotype distribution between the polyposis and the control group. However, it can be emphasized that the prevalence of the compound heterozygous genotype is higher in the nasal polyposis group than in controls. Our observations suggest that other genetic and environmental factors could play an important role in the development of nasal polyposis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 Analysis of mutations in the CFTR gene as tested by the multiplex polymerase chain reaction (PCR), followed by the reverse dot-blot technique, which searches for 29 of the most frequent mutations (DF508, N1303K, G542X, W1282X, 1717±1 G-A, R553X, 2183 AA-G, DI507, G551D, R560T, 3849 10kbC > T, R1162X, 3659delC, 3905insT, G85E, 621 1GT, R117H, R347P, R334W, A455E, 2789 5GA, Q552X, S1251N, 3905insT, 394delTT, E60X, 2143delT, 2184delA, 711 5G > A), and by ASO dot-blot for the following mutations: I148T, R1158X, 4016 1T, G1244E G >A.26 Statistical analysis was performed using multivariate analysis, by forward stepwise comparison; it was done to ®nd out which of the examined characteristics could be associated (P < 0.01) to nasal polyposis. Login to comment
91 Frequency (percentage) of compound heterozygous genotypes by nasal polyposis status in patients with cystic fibrosis Group with nasal polyposis (n 15) Comparison group (n 20) DF508/G542X 2 (13.33) 2 (10) DF508/N1303K 2 (13.33) 4 (20) DF508/AA2183G 1 (6.67) 0 DF508/IG1717 1 (6.67) 1 (5) DF508/W1282X 1 (6.67) 1 (5) DF508/unspecified 8 (53.33) 12 (60) their study group included patients with nasal polyposis that required surgery. Login to comment

[hide] Spatial patterns of cystic fibrosis mutation spect... Eur J Hum Genet. 2003 May;11(5):385-94. Lao O, Andres AM, Mateu E, Bertranpetit J, Calafell F
Spatial patterns of cystic fibrosis mutation spectra in European populations.
Eur J Hum Genet. 2003 May;11(5):385-94., [PMID:12734544]

Abstract [show]
Cystic fibrosis (CF) is the most frequent severe recessive disorder in European populations. We have analyzed its mutation frequency spectrum in 94 European, North African and SW Asian populations taken from the literature. Most major mutations as well as the incidence of CF mutations showed clinals patterns as demonstrated by autocorrelogram analysis. More importantly, measures of mutation diversity did also show clinal patterns, with mutation spectra being more diverse in southern than in northern Europe. This increased diversity would imply roughly a three-fold long-term effective population size in southern than in northern Europe. Distances were computed among populations based on their CF mutation frequencies and compared with distances based on other genic regions. CF-based distances correlated with mtDNA but not with Y-chromosome-based distances, which may be a consequence of the relatively homogeneous CF mutation frequencies in European populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 The correlations with Y-chromosome-based Table 1 94 middle Eastern, North African and European populations used in the analysis Population 2N F508del G542X G551D N1303K W1282X Rare Other Unknown Hmax Ymax Incidence Referencesa Austria 592 0.660 0.022 0.012 0.005 0.002 0.064 0.019 0.216 0.562 0.96 49 Belgium 646 0.752 0.025 0.002 0.028 0.012 0.053 0.046 0.082 0.430 0.56 50 Bulgaria 208 0.654 0.034 0.000 0.067 0.000 0.096 0.067 0.082 0.563 0.97 51 Crete 26 0.462 0.077 0.000 0.038 0.000 0.231 0.038 0.154 0.785 2.87 Czech Republic 584 0.697 0.021 0.034 0.026 0.005 0.051 0.021 0.146 0.512 0.78 Denmark 678 0.872 0.006 0.001 0.010 0.001 0.034 0.035 0.040 0.239 0.23 0.000210 Great Britain 0.000414b North England 4111 0.772 0.008 0.023 0.005 0.001 0.032 0.011 0.148 0.403 0.50 Scotland 1167 0.751 0.033 0.061 0.003 0.003 0.033 0.023 0.093 0.430 0.56 0.000504 South England 3679 0.769 0.020 0.029 0.005 0.002 0.032 0.009 0.133 0.407 0.51 Wales 372 0.659 0.024 0.030 0.005 0.000 0.134 0.065 0.083 0.557 0.94 Estonia 25 0.640 0.000 0.000 0.000 0.000 0.160 0.080 0.120 0.577 1.02 Former Yugoslavia 203 0.700 0.030 0.000 0.010 0.005 0.039 0.069 0.148 0.506 0.76 Finland 52 0.462 0.019 0.000 0.000 0.000 0.288 0.019 0.212 0.713 1.90 France 0.000232 Alsace 126 0.595 0.024 0.000 0.016 0.008 0.040 0.008 0.310 0.646 1.38 Aquitaine 116 0.612 0.034 0.000 0.017 0.000 0.043 0.009 0.284 0.626 1.26 Auvergne 102 0.725 0.039 0.000 0.029 0.010 0.020 0.000 0.176 0.474 0.67 Burgundy 168 0.702 0.024 0.000 0.006 0.000 0.060 0.006 0.202 0.507 0.77 Brittany 582 0.744 0.009 0.024 0.017 0.003 0.064 0.002 0.137 0.444 0.60 0.000343 Centre 218 0.716 0.050 0.000 0.023 0.000 0.023 0.000 0.188 0.486 0.71 Champagne 182 0.665 0.049 0.000 0.016 0.000 0.055 0.005 0.209 0.556 0.94 Franche-Comt ´ e 118 0.746 0.085 0.000 0.085 0.025 0.059 0.000 0.000 0.431 0.56 Languedoc 90 0.700 0.022 0.011 0.033 0.000 0.044 0.000 0.189 0.511 0.78 Llimousin 44 0.545 0.023 0.000 0.068 0.000 0.023 0.023 0.318 0.705 1.83 Loire Valley 308 0.737 0.006 0.019 0.013 0.003 0.032 0.000 0.188 0.457 0.63 Lorraine 286 0.717 0.031 0.000 0.000 0.000 0.042 0.000 0.210 0.486 0.70 Lower Normandie 174 0.644 0.017 0.023 0.017 0.000 0.069 0.000 0.230 0.585 1.06 Midi-Pyr ´ en ´ ees 114 0.649 0.035 0.000 0.018 0.009 0.018 0.000 0.272 0.580 1.03 Nord 468 0.660 0.019 0.004 0.015 0.002 0.053 0.006 0.239 0.563 0.97 Paris Region 830 0.643 0.027 0.007 0.010 0.012 0.035 0.000 0.266 0.585 1.06 Picardie 200 0.650 0.040 0.000 0.040 0.010 0.080 0.000 0.180 0.574 1.01 Poitou 100 0.770 0.030 0.000 0.020 0.000 0.020 0.000 0.160 0.408 0.51 Provence- Cote d`Azur 178 0.674 0.028 0.000 0.051 0.017 0.028 0.006 0.197 0.544 0.89 Rhone-Alpes 668 0.668 0.036 0.001 0.027 0.009 0.018 0.009 0.232 0.552 0.92 Upper Normandie 248 0.645 0.020 0.008 0.012 0.004 0.048 0.004 0.258 0.584 1.05 Germany Baden-W ¨ urttemberg 59 0.763 0.000 0.000 0.034 0.000 0.051 0.102 0.051 0.412 0.52 Bavaria 177 0.740 0.017 0.017 0.000 0.000 0.040 0.011 0.175 0.453 0.62 Berlinc 132 0.773 0.015 0.000 0.023 0.000 0.038 0.015 0.136 0.403 0.50 Bremend 74 0.689 0.014 0.014 0.000 0.000 0.054 0.014 0.216 0.528 0.84 Lower Saxony 198 0.803 0.005 0.005 0.015 0.000 0.015 0.030 0.126 0.355 0.41 North-Rhine/ Westphalia 174 0.736 0.006 0.006 0.000 0.006 0.069 0.034 0.144 0.458 0.63 Saxonye 83 0.639 0.012 0.012 0.024 0.000 0.036 0.036 0.241 0.594 1.10 Rhineland-Palatinaf 59 0.525 0.017 0.000 0.051 0.000 0.085 0.068 0.254 0.721 1.99 Greece Ipiros/Ionian Islands 46 0.609 0.000 0.000 0.043 0.000 0.087 0.043 0.217 0.632 1.30 Peloponese/Attica 89 0.573 0.000 0.022 0.045 0.000 0.146 0.045 0.169 0.667 1.52 Thesalia/Macedonia/ Thrace 61 0.672 0.066 0.000 0.033 0.000 0.033 0.082 0.115 0.543 0.89 Hungary 57 0.439 0.018 0.000 0.018 0.018 0.070 0.018 0.421 0.811 3.43 Italy Abruzzo 66 0.500 0.061 0.000 0.091 0.076 0.030 0.000 0.242 0.739 2.19 Basilicata 75 0.467 0.107 0.000 0.067 0.027 0.067 0.013 0.253 0.769 2.61 Calabria 149 0.430 0.034 0.000 0.047 0.020 0.054 0.034 0.383 0.813 3.46 distances were similar (r ¼ 0.147, P ¼ 0.116 and after controlling for geographical distance r ¼ 0.054, P ¼ 0.296). Login to comment
68 Table 1 (continued) Population 2N F508del G542X G551D N1303K W1282X Rare Other Unknown Hmax Ymax Incidence Referencesa Campania 223 0.610 0.040 0.000 0.067 0.018 0.040 0.004 0.220 0.623 1.25 Emilia-Romagna 242 0.541 0.058 0.000 0.025 0.008 0.050 0.000 0.318 0.704 1.82 0.000170 Friuli 24 0.375 0.125 0.000 0.042 0.042 0.083 0.083 0.250 0.855 4.85 Lazio 236 0.462 0.030 0.000 0.093 0.013 0.034 0.013 0.356 0.778 2.75 Liguria 44 0.591 0.114 0.000 0.023 0.000 0.045 0.000 0.227 0.646 1.38 Lombardia 399 0.499 0.038 0.000 0.038 0.010 0.090 0.050 0.276 0.743 2.24 Marche 144 0.389 0.056 0.000 0.083 0.014 0.063 0.007 0.389 0.841 4.29 Molise 27 0.481 0.037 0.000 0.074 0.000 0.037 0.000 0.370 0.775 2.70 Piemonte 117 0.675 0.034 0.000 0.000 0.000 0.043 0.017 0.231 0.544 0.89 Puglia 245 0.543 0.053 0.000 0.073 0.000 0.041 0.012 0.278 0.698 1.77 Sardegna 141 0.582 0.057 0.000 0.028 0.000 0.028 0.142 0.163 0.641 1.35 Sicilia 387 0.525 0.062 0.000 0.034 0.023 0.067 0.021 0.269 0.719 1.97 Toscana 191 0.508 0.042 0.000 0.037 0.010 0.031 0.005 0.366 0.740 2.21 Trentino 113 0.513 0.027 0.009 0.009 0.009 0.204 0.053 0.177 0.718 1.96 Umbria 37 0.676 0.081 0.000 0.027 0.000 0.027 0.000 0.189 0.545 0.90 Veneto 552 0.449 0.014 0.000 0.031 0.000 0.188 0.033 0.284 0.785 2.87 0.000370 Ireland Republic of Ireland 509 0.727 0.010 0.069 0.004 0.000 0.037 0.014 0.139 0.467 0.65 0.000684 Northern Ireland 876 0.619 0.021 0.045 0.001 0.000 0.063 0.047 0.205 0.612 1.19 0.000553 52 Israel 367 0.322 0.054 0.000 0.030 0.362 0.065 0.082 0.084 0.754 2.39 0.000304 Lebanon 40 0.350 0.000 0.000 0.100 0.200 0.025 0.225 0.100 0.794 3.04 0.000390 53 Netherlands 1442 0.744 0.013 0.001 0.009 0.007 0.072 0.019 0.135 0.444 0.60 0.000252 Norway 168 0.667 0.006 0.012 0.006 0.000 0.071 0.000 0.238 0.555 0.93 0.000152 Poland 444 0.662 0.023 0.007 0.020 0.002 0.043 0.020 0.223 0.560 0.96 Portugal Faro/Beja 25 0.680 0.000 0.000 0.000 0.000 0.040 0.000 0.280 0.547 0.90 Lisboag 100 0.480 0.030 0.000 0.000 0.000 0.080 0.060 0.350 0.767 2.57 Setubal/Evora 33 0.485 0.000 0.000 0.000 0.000 0.121 0.091 0.303 0.767 2.57 Russia 445 0.618 0.007 0.002 0.004 0.004 0.031 0.031 0.301 0.617 1.22 0.000051 Slovakia 254 0.559 0.075 0.000 0.035 0.016 0.075 0.016 0.224 0.680 1.62 Spain Andalucı´a 314 0.538 0.086 0.013 0.013 0.013 0.083 0.096 0.159 0.694 1.73 Arago´n 65 0.523 0.031 0.000 0.015 0.000 0.123 0.138 0.169 0.708 1.86 Castilla la Mancha 69 0.478 0.058 0.000 0.043 0.000 0.014 0.029 0.377 0.771 2.63 Paı´s Valencia` 125 0.464 0.104 0.000 0.056 0.000 0.096 0.040 0.240 0.771 2.63 Castilla Leo´n/ La Rioja 187 0.604 0.048 0.000 0.011 0.000 0.102 0.107 0.128 0.623 1.24 54 Catalonia 109 0.642 0.055 0.000 0.037 0.009 0.083 0.064 0.110 0.582 1.05 0.000187 Extremadura 63 0.460 0.048 0.000 0.016 0.000 0.079 0.127 0.270 0.776 2.72 Galicia 93 0.624 0.097 0.000 0.011 0.000 0.161 0.075 0.032 0.596 1.11 Madrid 51 0.510 0.059 0.020 0.039 0.000 0.059 0.020 0.294 0.742 2.23 Murcia 40 0.250 0.125 0.000 0.025 0.025 0.175 0.200 0.200 0.889 6.74 Basque Country 31 0.710 0.000 0.000 0.000 0.000 0.065 0.097 0.129 0.497 0.74 Sweden 165 0.733 0.006 0.000 0.000 0.000 0.103 0.085 0.073 0.448 0.60 0.000130 Switzerland 95 0.432 0.032 0.000 0.011 0.000 0.263 0.168 0.095 0.732 2.11 Tunisia 78 0.179 0.090 0.000 0.064 0.026 0.128 0.115 0.397 0.941 14.51 55 Turkey 263 0.274 0.038 0.000 0.042 0.004 0.087 0.114 0.441 0.907 8.44 56 Ukraine 396 0.543 0.000 0.005 0.000 0.000 0.018 0.000 0.434 0.706 1.84 57 Total 29131 0.674 0.025 0.015 0.017 0.009 0.053 0.024 0.182 0.586 1.06 N, sample size (in number of CF chromosomes); F508del, G542X, G551D, 1303K, and W1282X, relative frequencies of the main mutations; rare, relative frequency of mutations not listed in Table 2 of reference 58; other, relative frequency of mutations listed in Table 2 of reference 58. unknown, fraction of chromosomes asociated to disease bearing unidentified mutations. Login to comment

[hide] Analysis of cystic fibrosis transmembrane conducta... Am J Med Genet A. 2003 Jul 1;120A(1):72-6. Timmreck LS, Gray MR, Handelin B, Allito B, Rohlfs E, Davis AJ, Gidwani G, Reindollar RH
Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina.
Am J Med Genet A. 2003 Jul 1;120A(1):72-6., 2003-07-01 [PMID:12794695]

Abstract [show]
The relationship between cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations and congenital absence of the uterus and vagina (CAUV) was examined. CFTR mutations have previously been associated with congenital bilateral absence of the vas deferens (CBAVD). CBAVD is caused by a disruption in the vas deferens, a Wolffian duct derivative. Because the embryologic development of the Mullerian ducts directly depends on the prior normal development of the Wolffian ducts, the same gene products may be necessary for normal embryologic development of both ductal systems. This study evaluated the role of CFTR mutations in the development of CAUV. DNA samples from 25 patients with CAUV were tested for the presence of 33 of the most common CFTR mutations. Protein-coding DNA fragments from the CFTR gene were amplified in vitro by the polymerase chain reaction (PCR) and analyzed for mutations using allele-specific oligonucleotide (ASO) probes. Two patients were heterozygous for CFTR mutations. One was heterozygous for the W1282X mutation and the other was heterozygous for the DeltaF508 mutation. The incidence of the 33 CFTR mutations found in the patients with CAUV (8%) was twice that found in the general population (4%), but much less than the incidence of CFTR mutations in men with CBAVD (80%). This data suggests that it is unlikely for CFTR mutations to cause CAUV in females as they cause CBAVD in some males. Furthermore, the data suggest that CAUV in females may be the same disorder as CBAVD in males who do not have CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 CFTR Gene Mutations Tested DF508 R334W Y1092X 5T variant Y122X R347H G542X S549R 3,849 þ 4 G551D 3,849 þ 10 kb 2,789 þ 5 W1282X R553X 711 þ 1 3,905 þ T 621 þ 1 1,898 þ 1 N1303K 1,717À1 R1162X R117H 1078dT A455E D1507 Q493X 218dA R347P V520F G85E R560T S549N 3659dC Wolffian duct must occur at a time when the Mu¨llerian duct is no longer dependent on the Wolffian duct for development. Login to comment

[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]

Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X2: 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Login to comment
19 This spectrum is noteworthy because it includes a main mutation, accounting for 70% of the mutated alleles world-wide (the deletion F508del), four other mutations observed with a frequency over 1% (G542X: 2.4%, G551D: 1.6%, N1303K: 1.3%, W1282X: 1.2%) and a multitude of private abnormalities (Tsui, 2003). Login to comment
44 Firstly, the National Centre for Medical Genetics, Dublin performed an analysis of the most common CFTR mutations, using the ARMS test (Ferrie et al., 1992), which enables the detection of the following mutations: F508del, R117H, I507del, G542X, G551D, R560T, N1303K, R352Q, 1717-1G>A and 621+1G>T. Login to comment
50 Dublin Centre 1262 CF alleles 35 mutations F508del 76.5% G551D 6.5% R117H 3.0% R560T 2.4% 621+1G>T 1.7% Cork Area 278 CF alleles 10 mutations F508del 81.3% G551D 9.7% R117H 1.4% Brittany 778 CF alleles 62 mutations F508del 74.8% G551D 3.7% 1078delT 3.6% N1303K 1.4% W846X2 1.0% 1717-1G>A 1.0% Statistical analysis We determined the spectrum of the CFTR mutations identified in the three cohorts of patients and compared their respective frequencies by a Chi square test. Login to comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment
72 In Brittany, the four mutations found with a frequency above 1% were: 1078delT (3.6%), N1303K (1.4%), W846X2 (TGGàTGA) (1.0%) and 1717-1G>A (1.0%). Login to comment
76 Number Frequency Number Frequency 1652_1655del 3 bp F508del 384 75.6% 196 73.1% 582 74.8% 1784G>A G551D 17 3.3% 12 4.5% 29 3.7% 1078delT 25 4.9% 3 1.1% 28 3.6% 4041C>G N1303K 3 0.6% 8 3.0% 11 1.4% 2670G>A W846X2 7 1.4% 1 0.4% 8 1.0% 1717-1G>A 5 1.0% 3 1.1% 8 1.0% 3408C>A Y1092X 1 0.2% 6 2.2% 7 0.9% 2789+5G>A 2 0.4% 4 1.5% 6 0.8% 4005+1G>A 5 1.0% 1 0.4% 6 0.8% 310G>T E60X 3 0.6% 2 0.7% 5 0.6% 621+1G>T 2 0.4% 3 1.1% 5 0.6% 1172G>A R347H 5 1.0% 5 0.6% 1756G>T G542X 4 0.8% 1 0.4% 5 0.6% 482G>A R117H 3 0.6% 1 0.4% 4 0.5% 3272-26A>G 2 0.4% 2 0.7% 4 0.5% 1648_1653delATC I507del 1 0.2% 2 0.7% 3 0.4% 1789C>T R553X 3 0.6% 3 0.4% 3978G>A W1282X 2 0.4% 1 0.4% 3 0.4% Unidentified Unidentified 3 0.6% 3 0.4% Total Total 508 100.0% 268 100.0% 778 100.0% Basse-Bretagne Haute-Bretagne Brittany * Amino acid change Nucleotide change Table 3: Distribution of the Main CFTR Nutations Observed in the Irish Cohorts (Dublin and Cork) The 62 mutations detected in Brittany combined to give 81 different genotypes in CF patients. Login to comment
98 Number Frequency Number Frequency 1652_1655del 3 bp F508del 966 76.5% 226 81.3% 1192 77.4% 1784G>A G551D 82 6.5% 27 9.7% 109 7.1% 482G>A R117H 38 3.0% 4 1.4% 42 2.7% 1811G>C R560T 30 2.4% 2 0.7% 32 2.1% 621+1G>T 21 1.7% 21 1.4% 1648_1653delATC I507del 10 0.8% 1 0.4% 11 0.7% 1717-1G>A 9 0.7% 9 0.6% 1756G>T G542X 8 0.6% 8 0.5% 1187G>A R352Q 3 0.2% 2 0.7% 5 0.3% 1461ins4 5 0.4% 5 0.3% 4041C>G N1303K 5 0.4% 5 0.3% 310G>T E60X 4 0.3% 4 0.3% 1690G>T V520F 4 0.3% 4 0.3% 3007delG 4 0.3% 4 0.3% 3272-26A>G 2 0.2% 2 0.7% 4 0.3% 386G>A G85E 3 0.2% 3 0.2% 3849+10kbC>T 3 0.2% 3 0.2% Unidentified Unidentified 41 3.2% 11 4.0% 52 3.4% Total Total 1262 100.0% 278 100.0% 1540 100.0% Dublin cohort Cork cohort Ireland Amino acid change Nucleotide change We noted similar high frequencies of the F508del and G551D mutations in the three cohorts studied. Login to comment
115 We concluded that western Brittany presented a specific mutation spectrum (1078delT, G551D, 4005+1G>A, W846X2), whereas the eastern part of the region showed a spectrum of mutations more similar to that generally observed in France (N1303K, Y1092X, 2789+5G>A, etc). Login to comment

[hide] Molecular consequences of cystic fibrosis transmem... Gut. 2003 Aug;52(8):1159-64. Ahmed N, Corey M, Forstner G, Zielenski J, Tsui LC, Ellis L, Tullis E, Durie P
Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas.
Gut. 2003 Aug;52(8):1159-64., [PMID:12865275]

Abstract [show]
BACKGROUND AND AIMS: We tested the hypothesis that the actual or predicted consequences of mutations in the cystic fibrosis transmembrane regulator gene correlate with the pancreatic phenotype and with measures of quantitative exocrine pancreatic function. METHODS: We assessed 742 patients with cystic fibrosis for whom genotype and clinical data were available. At diagnosis, 610 were pancreatic insufficient, 110 were pancreatic sufficient, and 22 pancreatic sufficient patients progressed to pancreatic insufficiency after diagnosis. RESULTS: We identified mutations on both alleles in 633 patients (85.3%), on one allele in 95 (12.8%), and on neither allele in 14 (1.9%). Seventy six different mutations were identified. The most common mutation was DeltaF508 (71.3%) followed by G551D (2.9%), G542X (2.3%), 621+1G-->T (1.2%), and W1282X (1.2%). Patients were categorized into five classes according to the predicted functional consequences of each mutation. Over 95% of patients with severe class I, II, and III mutations were pancreatic insufficient or progressed to pancreatic insufficiency. In contrast, patients with mild class IV and V mutations were consistently pancreatic sufficient. In all but four cases each genotype correlated exclusively with the pancreatic phenotype. Quantitative data of acinar and ductular secretion were available in 93 patients. Patients with mutations belonging to classes I, II, and III had greatly reduced acinar and ductular function compared with those with class IV or V mutations. CONCLUSION: The predicted or known functional consequences of specific mutant alleles correlate with the severity of pancreatic disease in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
309 Table 2 Genotype classification according to the functional consequences of CFTR gene mutations Pancreatic status Class I Class II Class III Class IV Class V PS F1 , 875+1G→C(2) F, F (1) F, G551D (1) F, R117H (11) F,3849+10kbC→T (5) F, G85E2 (1) F, R347H (3) F,3272-26A→G (4) F, S1251N (2) F,A445E (3) F, D614G (1) F,P574H (2) F, R347P (1) F,3120G>A (1) R117H,R117H (1) F, 5T (8) F, L1335P (1) F,2789+5G→A (1) F,P67L (1) F,R347P/R347H (1) F,V232D(2) R334W, R334W(1) PS→PI F,3659delC (1) F,F (15) F,G551D (1) F, I1234V (1) F,2184insA (1) F,R560T (1) PI F, G542X (27) F,F (365) F, G551D (28) F, 621+1G→T (13) F, R560T (7) F,R553X (7) F, N1303K (9) F, R1162X (6) F,L1077P (2) F, 3659delC (5) F, I48T (1) F, 1717-1G→A (5) F,A559T (1) F, W1282X (5) F, G85E2 (2) F, 711+1G→T (5) G551D,G551D(1) F,2184delA(4) F,H199R (1) W1282X,W1282X (4) F,I1072T(1) F,Y1092X (3) F,S549 (R75Q) (1) F,556delA (3) F, Q493X (3) F,4016InsT (3) F, 3120+1G→A (2) F, G551D/R553X (2) F,Q814X(2) F,1154insTC (2) F,441delA (1) F, 4326delTC (1) F,Q552X(1) F,3007delG (1) F,2184insA (1) F, 4010del4 (1) F,3905insT (1) F,1078delT(1) F,E1104X (1) F,3876delA (1) F,4374+1G→T (1) F,E585X (1) F, E60X (1) CFTR, cystic fibrosis transmembrane regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment

[hide] Detection of cystic fibrosis mutations by peptide ... Clin Chem. 2003 Aug;49(8):1318-30. Malehorn DE, Telmer CA, McEwen SB, An J, Kinsey AD, Retchless AC, Mason C, Vieta WM, Jarvik JW
Detection of cystic fibrosis mutations by peptide mass signature genotyping.
Clin Chem. 2003 Aug;49(8):1318-30., [PMID:12881448]

Abstract [show]
BACKGROUND: The diversity of genetic mutations and polymorphisms calls for the development of practical detection methods capable of assessing more than one patient/one nucleotide position per analysis. METHODS: We developed a new method, based on peptide mass signature genotyping (PMSG), for the detection of DNA mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Exons of the gene were amplified, cloned, and expressed in Escherichia coli as peptide fusions, in natural as well as unnatural reading frames. Peptide analytes were purified by immobilized metal affinity chromatography and analyzed by matrix-assisted, laser desorption/ionization time-of-flight mass spectrometry. Synthetic and natural DNA samples with the 25 mutations recommended for CFTR carrier screening (Grody et al. Genet Med 2001;3:149-54) were assessed using the PMSG test for the CFTR gene. RESULTS: Peptide analytes ranged from 6278 to 17 454 Da and varied 30-fold in expression; highly expressing peptides were observed by electron microscopy to accumulate as inclusion bodies. Peptides were reliably recovered from whole-cell lysates by a simple purification method. CFTR mutations caused detectable changes in resulting mass spectrometric profiles, which were >95% reliably detected in blinded testing of replicate synthetic heterozygous DNA samples. Mutation detection was possible with both sample pooling and multiplexing. The PMSG CFTR test was used to determine compound heterozygous mutations in DNA samples from cystic fibrosis patients, which were confirmed by direct DNA sequencing. CONCLUSIONS: The PMSG test of the CFTR gene demonstrates unique capabilities for determining the sequence status of a DNA target by sensitively monitoring the mass of peptides, natural or unnatural, generated from that target.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
138 ⌬b 3 R Y 9863.78 G85E SerϾPhe 9923.90 Y 60.12 4.1 R N 7047.69 R117H AlaϾVal 7075.76 N 28.07 4.2 R Y 11161.32 lI48T AsnϾSer 11134.32 Y -27.00 621ϩ1 GϾT TyrϾTAA 6513.09 N -4648.23 5 R Y 11081.45 711ϩ1 GϾT ThrϾAsn 11094.48 Y 13.03 7.1 R N 7383.08 1078⌬T frameshift 9201.10 Y 1818.02 7 R Y 12233.9 R334W ArgϾGln 12205.87 Y -28.03 R347P ArgϾGly 12134.79 Y -99.11 9 F Y 14049.68 A455E AlaϾGlu 14107.74 Y 58.06 10.2 R Y 10525.57 ⌬I507 ⌬ Asp 10410.50 Y -115.07 ⌬F508 ⌬ Asp & LysϾAsn 10396.43 Y -129.14 11.2 F Y 11173.32 1717-1 GϾA GlyϾArg 11272.46 Y 99.14 G542X TrpϾLeu 11100.27 Y -73.05 G551D no change 11173.32 Y 0.00 R553X ThrϾMet 11203.42 Y 30.10 R560T no change 11173.32 Y 0.00 11 F N 8465.27 1717-1 GϾA no change 8465.27 N 0.00 G542X GlyϾTGA 6584.17 N -1881.10 G551D GlyϾAsp 8523.33 N 58.06 R553X ArgϾTGA 7541.18 N -924.09 R560T ArgϾThr 8410.21 N -55.06 12 F Y 10372.51 1898ϩ1 GϾA GlyϾAsp 10430.57 Y 58.06 13.2A R Y 10103.23 2184⌬A frameshift 8726.91 N -1376.32 14B R Y 9291.17 2789ϩ5 GϾA LeuϾPhe 9325.21 Y 34.04 16 F N 9398.67 3120ϩ1 GϾA ValϾIle 9412.72 N 14.05 19 F Y 17455.96 R1162X ArgϾTGA 6280.13 N -11175.83 3659⌬C frameshift 9650.06 N -7805.90 19i F Y 9699.9 3849ϩ10kB CϾT ArgϾTGA 7131.04 N -2568.86 20 F N 11125.48 W1282X TrpϾTGA 9370.40 N -1755.08 21 F Y 11183.44 N1303K AsnϾLys 11197.54 Y 14.10 a Denotes the directionality of exonic sequence when expressed as peptide. Login to comment
181 The heterozygous mutations depicted are as follows: (A), exon 3 wt/G85E; (B), exon 4.1 wt/R117H; (C), exon 4.2 wt/I148T; (D), exon 4.2 wt/621 ؉ 1G>T; (E), exon 5 wt/711 ؉ 1G>T; (F), exon 7.1 wt/1078⌬T; (G), exon 7 wt/R334W; (H), exon 7 wt/R347P; (I), exon 9 wt/A455E; (J), exon 10.2 wt/⌬I507; (K), exon 10.2 wt/⌬F508; (L), exon 11.2 wt/1717-1G>A; (M), exon 11 wt/G542X; (N), exon 11 wt/G551D; (O), exon 11 wt/R553X; (P), exon 11 wt/R560T; (Q), exon 12 wt/1898 ؉ 1G>A; (R), exon 13.2A wt/2184⌬A; (S), exon 14B wt/2789 ؉ 5G>A; (T), exon 16 wt/3120 ؉ 1G>A; (U), exon 19 wt/R1162X; (V), exon 19 wt/3659⌬C; (W), intron 19 wt/3849 ؉ 10kbC>T; (X), exon 20 wt/W1282X; (Y), exon 21 wt/N1303K. typical yield of purified protein was 1-30 ␮g/test well, depending on the analyte species. Login to comment

[hide] Atypical cystic fibrosis--diagnostic and managemen... J R Soc Med. 2003;96 Suppl 43:2-10. Wallis C
Atypical cystic fibrosis--diagnostic and management dilemmas.
J R Soc Med. 2003;96 Suppl 43:2-10., [PMID:12906319]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
176 She was found to have a disease-associated mutation in each CFTR gene (N1303K and R117H associated with the 7T variant in intron 8). Login to comment

[hide] Mutation analysis of the cystic fibrosis transmemb... Eur J Hum Genet. 2003 Sep;11(9):687-92. Perri F, Piepoli A, Stanziale P, Merla A, Zelante L, Andriulli A
Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis.
Eur J Hum Genet. 2003 Sep;11(9):687-92., [PMID:12939655]

Abstract [show]
Susceptibility to alcoholic chronic pancreatitis (ACP) could be genetically determined. Mutations in cationic trypsinogen (PRSS1), cystic fibrosis transmembrane conductance regulator (CFTR), and serine protease inhibitor, Kazal type 1 (SPINK1) genes have been variably associated with both the hereditary and the idiopathic form of chronic pancreatitis (CP). Our aim was to analyze the three genes in ACP patients. Mutational screening was performed in 45 unrelated ACP patients and 34 patients with alcoholic liver disease (ALD). No mutation of PRSS1 was found in ACP and ALD patients. Three mutations of CFTR were detected in four ACP patients with a prevalence (8.9%) not significantly different from that observed (3.0%) in ALD patients and from that expected (3.2%) in our geographical area. Neither compound heterozygotes for CFTR nor trans-heterozygotes for CFTR/SPINK1 were found. One ACP patient (2.2%) was found to carry the most common mutation (N34S) of SPINK1 compared to none of the ALD patients (P=NS). In five other patients (two with ACP and three with ALD) other rare variants, including P55S, were found. In contrast with the hereditary and the idiopathic forms of CP, in which mutations of PRSS1, CFTR, and SPINK1 genes may occur, ACP is still a "gene(s)-orphan" disease. The supposed genetic susceptibility to ACP relies on other yet unknown gene(s) which could affect the alcohol metabolism or modulate the pancreatic inflammatory response to alcohol abuse.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Mutation screening of the CFTR gene The 31 most frequent mutations (F508del, I507del, G551D, G542X, N1303K, 1717-1G4A, W1282X, R553X, R347P, R347H, R334W, 3849+10kb C4T, R117H, 621+1G4T, A455E, S549N, R560T, S549R, V520F, Q493X, 3849+ 4A4G, 1078delT, R1162X, 3659delC, 3905insT, Y122X, 2183delAA4G, 2789+5G4A, 1898+1G4A, 711+1G4T, and G85E) were examined with the polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (OLA, Applied Biosystems, Foster City, CA, USA) and finally a sequence-coded separation.