ABCC7 p.Thr338Ile
| Admin's notes: | Class II-III (maturation defect, gating defect) Veit et al. |
| ClinVar: |
c.1012A>G
,
p.Thr338Ala
?
, not provided
c.1013C>T , p.Thr338Ile D , Pathogenic |
| CF databases: |
c.1013C>T
,
p.Thr338Ile
D
, CF-causing ; CFTR1: A nucleotide change C->T at position 1145 which causes the replacement of a Threonine by Isoleucine residue in codon 338 of exon 7.
c.1012A>G , p.Thr338Ala (CFTR1) ? , This mutation was identified in one Iranian CBAVD patient. |
| Predicted by SNAP2: | A: D (85%), C: D (91%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (53%), K: D (95%), L: D (95%), M: D (95%), N: D (91%), P: D (95%), Q: D (95%), R: D (95%), S: D (91%), V: D (85%), W: D (95%), Y: D (95%), |
| Predicted by PROVEAN: | A: N, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: N, P: N, Q: D, R: D, S: N, V: N, W: D, Y: D, |
[switch to compact view]
Comments [show]
[hide] Detection of five rare cystic fibrosis mutations p... Clin Chem. 1999 Jul;45(7):957-62. Castaldo G, Fuccio A, Cazeneuve C, Picci L, Salvatore D, Raia V, Scarpa M, Goossens M, Salvatore F
Detection of five rare cystic fibrosis mutations peculiar to Southern Italy: implications in screening for the disease and phenotype characterization for patients with homozygote mutations.
Clin Chem. 1999 Jul;45(7):957-62., [PMID:10388469]
Abstract [show]
BACKGROUND: The search for the eight most frequent mutations (i.e., DeltaF508, G542X, W1282X, N1303K, 1717-1G-->A, R553X, 2183AA-->G, and I148T) by allele-specific oligonucleotide dot-blot analysis revealed 78% of 396 cystic fibrosis alleles in Southern Italy. The observation of frequent haplotypes on the unidentified cystic fibrosis alleles suggested that a few mutations could account for a large number of unidentified alleles. METHODS: We screened most of the coding sequence of the cystic fibrosis transmembrane regulator gene by denaturing gradient gel electrophoresis to determine the spectrum of these mutations in 68 unrelated cystic fibrosis patients bearing one or both unidentified mutations. RESULTS: The screening revealed five mutations, R1158X, 711+1G-->T, 4016insT, L1065P, and G1244E, each of which had a frequency of 1.3-1.8% (7% collectively). The 7% increase in the detection rate (85% vs 78%) reduces by >50% the residual risk of being cystic fibrosis carriers for couples who had tested negative by molecular analysis. We therefore designed a second allele-specific oligonucleotide set to analyze the five mutations. Among the patients analyzed, one patient homozygous for the L1065P mutation expressed a mild pulmonary and intestinal form of the disease with pancreatic insufficiency. Two other patients, homozygous for mutations R1158X and 4016insT, both expressed a severe cystic fibrosis phenotype. CONCLUSIONS: Five cystic fibrosis mutations are peculiar to patients from Southern Italy. The method described for their analysis is efficient, inexpensive, and can be semi-automated by use of a robotic workstation. The results obtained in patients from Southern Italy may have an impact on laboratories in other countries, given the large migrations of populations from Southern Italy to other countries in the last two centuries.
Comments [show]
None has been submitted yet.
No. Sentence Comment
24 Clinical Chemistry 45:7 957-962 (1999) Molecular Diagnostics and Genetics T338I is typical among Sardinians (5), and 2183AA3G and R1162X are frequent in Northeastern Italy (5).
X
ABCC7 p.Thr338Ile 10388469:24:76
status: NEW95 Several mutations highly frequent in Northern Italy (R1162X and 711ϩ5G3A) have not been detected in Southern Italy, neither has T338I, which is peculiar to Sardinia (5).
X
ABCC7 p.Thr338Ile 10388469:95:134
status: NEW[hide] Two buffer PAGE system-based SSCP/HD analysis: a g... Eur J Hum Genet. 1999 Jul;7(5):590-8. Liechti-Gallati S, Schneider V, Neeser D, Kraemer R
Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease.
Eur J Hum Genet. 1999 Jul;7(5):590-8., [PMID:10439967]
Abstract [show]
The large size of many disease genes and the multiplicity of mutations complicate the design of an adequate assay for the identification of disease-causing variants. One of the most successful methods for mutation detection is the single strand conformation polymorphism (SSCP) technique. By varying temperature, gel composition, ionic strength and additives, we optimised the sensitivity of SSCP for all 27 exons of the CFTR gene. Using simultaneously SSCP and heteroduplex (HD) analysis, a total of 80 known CF mutations (28 missense, 22 frameshift, 17 nonsense, 13 splicesite) and 20 polymorphisms was analysed resulting in a detection rate of 97.5% including the 24 most common mutations worldwide. The ability of this technique to detect mutations independent of their nature, frequency, and population specificity was confirmed by the identification of five novel mutations (420del9, 1199delG, R560S, A613T, T1299I) in Swiss CF patients, as well as by the detection of 41 different mutations in 198 patients experimentally analysed. We present a three-stage screening strategy allowing analysis of seven exons within 5 hours and analysis of the entire coding region within 1 week, including sequence analysis of the variants. Additionally, our protocol represents a general model for point mutation analysis in other genetic disorders and has already been successfully established for OTC deficiency, collagene deficiency, X-linked myotubular myopathy (XLMTM), Duchenne and Becker muscular dystrophy (DMD, BMD), Wilson disease (WD), Neurofibromatosis I and II, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, and defects in mitochondrial DNA. No other protocol published so far presents standard SSCP/HD conditions for mutation screening in different disease genes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
20 The distribution of analysed known mutations is similar to that of the total number of mutations in the entire CFTR gene: missense mutations account for 35% (G27E, G85E, R117H, A120T, I148T, H199Y, R334W, T338I, R347P, R347H, A455E, M718K, S5449N, S5449I, G551D, R560T, R560S, S945L, S977P, I1005R, R1066C, R1070Q, M1101K, D1152H, S1235R, R1283M, N1303K, N1303H), followed by 28% of frameshift mutations (175delC, 394delTT, 457TAT- > G, 905delG, 1078delT, I507, F508, 1609delCA, 1677delTA, 2143delT, 2176insC, 218delA, 2184insA, 2869insG, 3659delC, 3732delA, 3821delT, 3905insT, 4016insT, 4172delGC, 4382delA), 21% of nonsense mutations (Q30X, Q39X, Q220X, W401X, Q525X, G542X, Q552X, R553X, V569X, E585X, K710X, R792X, Y1092X, R1162X, S1255X, W1282X, E1371X), and 16% of splice site mutations (621 + 1G- > T, 711 + 1G- > T, 711 + 5G- > A, 1717-1G- > A, 1898 + 1G- > A, 1898 + 5G- > T, 2789 + 5G- > A, 3271 + 1G- > A, 3272-26A- > G, 3601-17T- > C, 3849 + 4A- > G, 3849 + 10kbC- > T, 4374 + 1G- > T).
X
ABCC7 p.Thr338Ile 10439967:20:205
status: NEW44 Three mutations (R1066C, M1101K, E1371X) could only be identified after restriction enzyme digestion of the amplification product, and five mutations (711 + 1G- > T, R347H, T338I, Y1092X, S1255X) were discovered in the uncut, but not in the digested, PCR product.
X
ABCC7 p.Thr338Ile 10439967:44:173
status: NEW[hide] CFTR gene mutations and male infertility. Andrologia. 2000 Mar;32(2):71-83. Stuhrmann M, Dork T
CFTR gene mutations and male infertility.
Andrologia. 2000 Mar;32(2):71-83., [PMID:10755189]
Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are a relatively frequent cause of male infertility. Depending on their molecular consequences, CFTR mutations may either result in typical cystic fibrosis (CF), one of the most common autosomal recessive disorders, which is characterized by chronic lung disease, pancreatic exocrine insufficiency, an increase in the concentration of sweat electrolytes and male infertility, due to obstructive azoospermia, or in atypical (often monosymptomatic) forms of CF such as congenital absence of the vas deferens (bi- or unilateral), bilateral ejaculatory duct obstruction or bilateral obstructions within the epididymides. All males with idiopathic obstructive azoospermia bear an increased risk for CF offspring. Couples requesting microsurgical epididymal sperm aspiration and in vitro fertilization, e.g. intracytoplasmic sperm injection, should be offered genetic counselling and molecular genetic analysis of the CFTR gene, if male infertility due to obstructive azoospermia is the underlying cause.
Comments [show]
None has been submitted yet.
No. Sentence Comment
269 Leoni G, Pitzalis S, Podda R, Zanda M, Silvetti M, Caocci Goshen R, Augarten A, Rahat A, Hurwitz A, Darvasi A, Kerem BS (1997) The molecular basis of partial penetranceL, Cao A, Rosatelli MC (1995) A specific cystic fibrosis mutation (T338I) associated with the phenotype of isolated of splicing mutations in cystic fibrosis.
X
ABCC7 p.Thr338Ile 10755189:269:235
status: NEW[hide] Effect of genistein on native epithelial tissue fr... Br J Pharmacol. 2000 Aug;130(8):1884-92. Mall M, Wissner A, Seydewitz HH, Hubner M, Kuehr J, Brandis M, Greger R, Kunzelmann K
Effect of genistein on native epithelial tissue from normal individuals and CF patients and on ion channels expressed in Xenopus oocytes.
Br J Pharmacol. 2000 Aug;130(8):1884-92., [PMID:10952679]
Abstract [show]
The flavonoid genistein has been shown to activate a Cl(-) conductance in various cell types expressing CFTR. We examined if similar effects can be observed when genistein is applied to native ex vivo tissues from human respiratory tract and rectum. We further compared the effects when genistein was applied to oocytes of Xenopus laevis expressing CFTR. In oocytes, both wtCFTR and DeltaF508-CFTR were activated by genistein while both cyclic AMP (K(v)LQT1) and Ca(2+) (SK4) activated K(+) channels were inhibited at high concentrations of genistein. Biopsies from nasal polyps and rectal mucosa were obtained from normal individuals (non-CF) and CF patients and in the presence of amiloride (10 micromol l(-1); mucosal side) the effects of genistein were assessed using a perfused Ussing chamber. In non-CF airway epithelia, genistein (50 micromol l(-1); mucosal side) increased lumen negative I(sc) but had no additional effects on tissues pre-stimulated with IBMX and forskolin (100 micromol l(-1) and 1 micromol l(-1); both sides). In non-CF rectal biopsies, in the presence of amiloride (10 micromol l(-1); mucosal side) and indomethacin (10 micromol l(-1); basolateral side), genistein increased lumen negative I(sc) and enabled cholinergic (carbachol; CCH, 100 micromol l(-1); basolateral side) stimulation of Cl(-) secretion indicating activation of luminal CFTR Cl(-) channels. However, after stimulation with IBMX/forskolin, genistein induced opposite effects and significantly inhibited CCH activated I(sc). In CF airway and intestinal tissues genistein failed to induce Cl(-) secretion. Thus, genistein is able to activate luminal CFTR Cl(-) conductance in non-CF tissues and mutant CFTR in oocytes. However, additional inhibitory effects on basolateral K(+) conductance and missing effects in native CF tissues do not support the use for pharmacological intervention in CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
30 In all CF patients from whom rectal biopsies were studied DNA analysis was carried out for the following CFTR mutations: DF508; R117H and S108F in exon 4; R347P, R347H, I336K and T338I in exon 7; S549N, G551D, R553X, G542X, Q552X, 1717-1 G?A in exon 11; W1282X and 3905insT in exon 20; N1303K in exon 21 and 3849+10kB C?T in intron 19.
X
ABCC7 p.Thr338Ile 10952679:30:179
status: NEW[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]
Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.
Comments [show]
None has been submitted yet.
No. Sentence Comment
87 These were G91R, 711 ϩ 5GϾA, T338I, 712-1GϾT, Q359K/T360K, 1161delC, 1609delCA, S549I, Q552X, 1949del84, 1989 ϩ 5GϾT, S1251N, and R1283M.
X
ABCC7 p.Thr338Ile 11388756:87:41
status: NEW105 Examples include 394delTT (identified in only two U.S. Caucasian alleles, although it has a frequency of 1.1-28.8% in Northern Eu- rope5), T338I (not identified in the United States, although it has a frequency of 9.9% in Sardinia and nearly 0.1% in Italy5), and 1609delCA (not identified in 434 Southern or mixed European Caucasian alleles and 74 Hispanic alleles, although it has a frequency of 4.1% in the east of Spain5).
X
ABCC7 p.Thr338Ile 11388756:105:139
status: NEW[hide] Cystic fibrosis mutation testing in Italy. Genet Test. 2001 Fall;5(3):229-33. Bombieri C, Pignatti PF
Cystic fibrosis mutation testing in Italy.
Genet Test. 2001 Fall;5(3):229-33., [PMID:11788089]
Abstract [show]
In Italy, Cystic fibrosis (CF) mutation frequency differences have been observed in different regions. In the northeastern Veneto and Trentino Alto Adige regions, a complete cystic fibrosis transmembrane conductance regulator (CFTR) gene screening in CF patients detected through a newborn screening program has identified about 90% of the mutations. In these two regions, the current detection rate using a CF screening panel containing the 16 most common mutations is 86.6%. CF mutations in some other Italian regions have not been so thoroughly analysed. Available data indicate that a more general national screening panel comprising 31 mutations may detect about 75% of all CF mutations in Italy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
32 Within the northern regions, the western and eastern mutation frequency distributions were remarkably distinct: the western part being characterized by mutation 171721G R A, and the eastern part by mutations R1162X, 2183AA R G, and 71115G R A. Moreover, the island of Sardinia showed the presence of mutation T338I, which was absent from other European CF alleles.
X
ABCC7 p.Thr338Ile 11788089:32:309
status: NEW44 CF GENE MUTATIONS IN ITALY Number of alleles Frequency Cumulative Mutation screened (%) frequency (%) DF508 3442 51.07 51.07 N1303K 3056 4.84 55.91 G542X 3082 4.83 60.75 2183 AA ® G 2596 2.66 63.41 R1162X 2580 2.42 65.83 1717-1 G ® A 2892 2.11 67.94 W1282X 2600 1.23 69.17 R553X 2882 1.15 70.31 T338I 2306 0.69 71.01 R347P 2642 0.61 71.61 711 1 5 G ® A 2454 0.57 72.18 G85E 1980 0.40 72.59 621 1 1 G ® T 2594 0.39 72.97 R334W 2366 0.30 73.27 R352Q 2112 0.24 73.50 S549N 2118 0.24 73.74 R347H 2184 0.18 73.92 L1077P 1840 0.16 74.09 R1158X 1878 0.16 74.25 541del C 1884 0.16 74.40 R1066H 1918 0.16 74.56 E585X 1922 0.16 74.72 Q552X 2172 0.14 74.86 D1152H 1824 0.11 74.97 2790-2 A ® G 1862 0.11 75.07 3132 del TG 1862 0.11 75.18 3667ins 4 1876 0.11 75.29 DI507 1914 0.10 75.39 1898 1 3 A ® G 1920 0.10 75.50 G1244E 1960 0.10 75.60 1784 del G 2052 0.10 75.69 From Rendine et al. (1997).
X
ABCC7 p.Thr338Ile 11788089:44:305
status: NEW[hide] Spectrum of mutations in the CFTR gene of patients... Genet Test. 2001 Fall;5(3):235-42. Strandvik B, Bjorck E, Fallstrom M, Gronowitz E, Thountzouris J, Lindblad A, Markiewicz D, Wahlstrom J, Tsui LC, Zielenski J
Spectrum of mutations in the CFTR gene of patients with classical and atypical forms of cystic fibrosis from southwestern Sweden: identification of 12 novel mutations.
Genet Test. 2001 Fall;5(3):235-42., [PMID:11788090]
Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CFTR gene. The spectrum of CFTR mutations varies between populations and depends on different factors, such as ethnic background and geographical location. The extensive CFTR mutation screening of 129 patients with classical or atypical CF from the south-western region of Sweden revealed the presence of 37 CFTR mutations, including 12 novel alleles. The overall mutation detection rate in this study population was 92%, the highest among all tested regions in Sweden. Eight mutations with a frequency above 1% (DeltaF508, 394delTT, R117C, 3659delC, E60X, 1112delT, R764X, and 621 + 1G --> T) accounted for 78% of CF chromosomes and have been recommended for inclusion in the CFTR mutation screening panel for molecular diagnosis of CF in this region. The multiple occurrence of specific CFTR alleles less common than the predominant DeltaF508 mutation (394delTT, R117C, 3659delC) allowed for genotype-phenotype comparisons and revealed consistent relationships between these mutations and disease severity.
Comments [show]
None has been submitted yet.
No. Sentence Comment
27 MUTATIONS IDENTIFIED IN 258 CHROMOSOMES IN THE CF POPULATION ATTENDING THE SOUTH-WESTERN SWEDISH CF CENTRE Location in the Frequency of Mutation gene, exon Number of mutations mutation (%) Homozygotes Heterozygotes DF508 10 161 62.4 56 49 394delTT 3 13 5.0 3 7 R117C 4 7 2.7 7 3659delC 19 5 1.9 5 E60X 3 4 1.6 4 1112delT 7 4 1.6 1 2 R764X 13 4 1.6 1 2 621 1 1G ® T 4 3 1.2 3 G551D 11 2 0.8 2 I506L 10 2 0.8 2 N1088D (R75Q) 17b 2 0.8 2 Q1238X 19 2 0.8 2 R117H (IVS8-5T) 4 2 0.8 2 V603F (IVS8-5T) 13 2 0.8 2 1716G ® A 10 2 0.8 2 R75Q 3 2 0.8 2 R533X 11 1 0.4 1 2329A ® G Promoter 1 0.4 1 297-3 C ® A 2 1 0.4 1 Y161D 4 1 0.4 1 994del9 Exon/intron 6b 1 0.4 1 1154insTC 7 1 0.4 1 W361R 7 1 0.4 1 T338I 7 1 0.4 1 1249-5A ® G Intron 7 1 0.4 1 1717-2A ® G Intron 10 1 0.4 1 R560T 11 1 0.4 1 E1401X 23 1 0.4 1 3126del4 17a 1 0.4 1 S945L 15 1 0.4 1 R668C 13 1 0.4 1 2622 1 2del6 Intron 13 1 0.4 1 R1162Q Exon 19 1 0.4 1 3849 1 10kbC ® T Intron 19 1 0.4 1 R74W Exon 3 1 0.4 1 2363C ® T Promoter 1 0.4 1 IVS8-5Ta Intron 8 1 0.4 1 Unidentified 20 7.8 Total 258 100 61 116 The new mutations are displayed in bold.
X
ABCC7 p.Thr338Ile 11788090:27:711
status: NEW[hide] Predictors of deterioration of lung function in cy... Pediatr Pulmonol. 2002 Jun;33(6):483-91. Schaedel C, de Monestrol I, Hjelte L, Johannesson M, Kornfalt R, Lindblad A, Strandvik B, Wahlgren L, Holmberg L
Predictors of deterioration of lung function in cystic fibrosis.
Pediatr Pulmonol. 2002 Jun;33(6):483-91., [PMID:12001283]
Abstract [show]
The severity of lung disease in cystic fibrosis (CF) may be related to the type of mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, and to environmental and immunological factors. Since pulmonary disease is the main determinant of morbidity and mortality in CF, it is important to identify factors that can explain and predict this variation. The aim of this longitudinal study of the whole Swedish CF population over age 7 years was to correlate genetic and clinical data with the rate of decline in pulmonary function. The statistical analysis was performed using the mixed model regression method, supplemented with calculation of relative risks for severe lung disease in age cohorts.The severity of pulmonary disease was to some extent predicted by CFTR genotype. Furthermore, the present investigation is the first long-term study showing a significantly more rapid deterioration of lung function in patients with concomitant diabetes mellitus. Besides diabetes mellitus, pancreatic insufficiency and chronic Pseudomonas colonization were found to be negative predictors of pulmonary function. In contrast to several other reports, we found no significant differences in lung function between genders. Patients with pancreatic sufficiency have no or only a slight decline of lung function with age once treatment is started, but an early diagnosis in this group is desirable.
Comments [show]
None has been submitted yet.
No. Sentence Comment
88 Furthermore, the inferred values for FEV1 and VC at age 5 years (the intercepts) were significantly lower TABLE 1- Allele Frequencies of 10 Most Common CFTR Mutations in Swedish CF Population Mutation Allele frequency (%) DF508 67.9 394delTT 7.1 3659delC 6.4 S945L 1.2 R117C 1.0 R117H 0.55 T338I 0.55 G551D 0.55 R553X 0.55 I506L 0.41 compared with those in the other CF patients (63.4% and 68.2% vs. 89% and 93.3%).
X
ABCC7 p.Thr338Ile 12001283:88:290
status: NEW121 TABLE 3CFTR Mutations Associated With Pancreatic Sufficiency in Swedish CF Population Y109C S549I/S549I Y109N S945L R117C N1088D À R75Q R117H G1244E L206W 711 þ 3A !G T338I 1249 À 5A !G A455E 2789 þ 5G !
X
ABCC7 p.Thr338Ile 12001283:121:177
status: NEW[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]
Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL.
X
ABCC7 p.Thr338Ile 12007216:111:1370
status: NEW[hide] Genotype-phenotype correlation in cystic fibrosis:... Am J Med Genet. 2002 Jul 22;111(1):88-95. Salvatore F, Scudiero O, Castaldo G
Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes.
Am J Med Genet. 2002 Jul 22;111(1):88-95., 2002-07-22 [PMID:12124743]
Abstract [show]
More than 1,000 mutations have been identified in the cystic fibrosis (CF) transmembrane regulator (CFTR) disease gene. The impact of these mutations on the protein and the wide spectrum of CF phenotypes prompted a series of Genotype-Phenotype correlation studies. The CFTR genotype is invariably correlated with pancreatic status-in about 85% of cases with pancreatic insufficiency and in about 15% of cases with pancreatic sufficiency. The correlations between the CFTR genotype and pulmonary, liver, and gastrointestinal expression are debatable. The heterogeneous phenotype in CF patients bearing the same genotype or homozygotes for nonsense mutations implicated environmental and/or genetic factors in the disease. However, the discordant phenotype observed in CF siblings argued against a major role of environmental factors and suggested that genes other than CFTR modulate the CF phenotype. A locus that modulates gastrointestinal expression was identified in mice and subsequently in humans. By analyzing nine CF patients discordant for meconium ileus we were able to show that this locus had a dominant effect. Moreover, in a collaborative study we found a higher rate of polymorphisms in beta-defensin genes 1 and 2 in CF patients and in controls. In another multicenter study mutations in alpha-1 antitrypsin (A1AT) and mannose binding lectin genes were found to be independent risk factors for liver disease in CF patients. The body of evidence available suggests that the variegated CF phenotype results from complex interactions between numerous gene products.
Comments [show]
None has been submitted yet.
No. Sentence Comment
18 Several mutations are frequent in specific populations: W1282X among Ashkenazi [Shoshani et al., 1992], 2143delT in Germany [Dork et al., 1994], Y122X in Iceland [Chevalier-Porst et al., 1994], T338I in Sardinia, and 2183AA > G and R1162X in Northeast Italy [Rendine et al., 1997].
X
ABCC7 p.Thr338Ile 12124743:18:194
status: NEW46 A series of mutations usually associated with pancreatic sufficiency have been identified and defined as ''mild`` with reference to pancreatic status [Kerem et al., 1989c]: G85E, G91R, R117H, E193K, P205S, R334W, T338I, R347H, R347L, R347P, R352Q, A455E, S492F, S549N, P574H, D579G, 711 þ 5 G > A, C866Y, F1052V, H1054D, R1066H, R1068H, H1085R, D1152H, S1159P, S1251N, F1286S, G1349D, 2789 þ 5 G > A, and 3849 þ 10kb C > T [Dean et al., 1990; Cutting et al., 1990a; Cremonesi et al., 1992; Highsmith et al., 1994].
X
ABCC7 p.Thr338Ile 12124743:46:213
status: NEW[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]
Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997).
X
ABCC7 p.Thr338Ile 12151438:20:681
status: NEW[hide] Mutation analysis of the cystic fibrosis transmemb... Eur J Hum Genet. 2003 Sep;11(9):687-92. Perri F, Piepoli A, Stanziale P, Merla A, Zelante L, Andriulli A
Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis.
Eur J Hum Genet. 2003 Sep;11(9):687-92., [PMID:12939655]
Abstract [show]
Susceptibility to alcoholic chronic pancreatitis (ACP) could be genetically determined. Mutations in cationic trypsinogen (PRSS1), cystic fibrosis transmembrane conductance regulator (CFTR), and serine protease inhibitor, Kazal type 1 (SPINK1) genes have been variably associated with both the hereditary and the idiopathic form of chronic pancreatitis (CP). Our aim was to analyze the three genes in ACP patients. Mutational screening was performed in 45 unrelated ACP patients and 34 patients with alcoholic liver disease (ALD). No mutation of PRSS1 was found in ACP and ALD patients. Three mutations of CFTR were detected in four ACP patients with a prevalence (8.9%) not significantly different from that observed (3.0%) in ALD patients and from that expected (3.2%) in our geographical area. Neither compound heterozygotes for CFTR nor trans-heterozygotes for CFTR/SPINK1 were found. One ACP patient (2.2%) was found to carry the most common mutation (N34S) of SPINK1 compared to none of the ALD patients (P=NS). In five other patients (two with ACP and three with ALD) other rare variants, including P55S, were found. In contrast with the hereditary and the idiopathic forms of CP, in which mutations of PRSS1, CFTR, and SPINK1 genes may occur, ACP is still a "gene(s)-orphan" disease. The supposed genetic susceptibility to ACP relies on other yet unknown gene(s) which could affect the alcohol metabolism or modulate the pancreatic inflammatory response to alcohol abuse.
Comments [show]
None has been submitted yet.
No. Sentence Comment
34 Other seven mutations, frequently observed in Italian CF patients (Q552X; 711+5G4A; 2790-2A4G; S589N; T338I; 1898+3A4G, and 1717-8G4A), were examined by sequencing.
X
ABCC7 p.Thr338Ile 12939655:34:102
status: NEW[hide] Association between serum oncofetal antigens CA 19... Acta Paediatr. 2003 Nov;92(11):1267-71. Gronowitz E, Pitkanen S, Kjellmer I, Heikinheimo M, Strandvik B
Association between serum oncofetal antigens CA 19-9 and CA 125 and clinical status in patients with cystic fibrosis.
Acta Paediatr. 2003 Nov;92(11):1267-71., [PMID:14696845]
Abstract [show]
In cystic fibrosis (CF), mucus plugging in the airways and in the gastrointestinal tract leads to severe morbidity and mortality. The mucin-associated antigens CA 19-9 and CA 125 are markers of gastrointestinal malignancy, and CA 19-9 has also been reported in association with pulmonary function in CF. AIM: To test whether these antigens might serve as markers for the severity of pulmonary and gastrointestinal disease in CF. METHODS: In 99 patients, aged 1 to 48 y, serum levels of CA 19-9 and CA 125 were measured by RIA and ELISA and related to clinical data. RESULTS: Patients with severe mutations had significantly increased serum levels of CA 125, indicating an association with a more severe CF phenotype. This was further supported by the association with lung function, chronic pulmonary colonization of Pseudomonas aeruginosa and pancreatic insufficiency. CA 19-9 was also shown to be associated with lung function and Ps. aeruginosa colonization. No gastrointestinal malignancy was found in our patients despite very high values of CA 19-9 in some patients. During a 5-y follow-up, the very high serum levels of CA 19-9 decreased along with improved general condition of the patients. CONCLUSION: Increased serum levels of CA 125 in CF patients were associated with severe cystic fibrosis transmembrane conductance regulator mutations and a severe phenotype. Both antigens were associated with pseudomonas colonization and lung function and CA 125 also with pancreatic insufficiency. The estimates of CA 19-9 are hampered by the influence of the Lewis histo-blood group system on the synthesis of CA 19-9.
Comments [show]
None has been submitted yet.
No. Sentence Comment
45 The remaining 23 patients had at least one mild (I506L, R117C, S945L, T338I, W301R, 3849 10KBC → T, 1249-5 → G, R117H, R75Q), moderate (G551D, R560T, V603F) or unknown mutation.
X
ABCC7 p.Thr338Ile 14696845:45:70
status: NEW[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]
Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).
Comments [show]
None has been submitted yet.
No. Sentence Comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency.
X
ABCC7 p.Thr338Ile 15084222:89:1599
status: NEW[hide] Genotype/phenotype correlation of the G85E mutatio... Eur Respir J. 2004 May;23(5):679-84. Decaestecker K, Decaestecker E, Castellani C, Jaspers M, Cuppens H, De Boeck K
Genotype/phenotype correlation of the G85E mutation in a large cohort of cystic fibrosis patients.
Eur Respir J. 2004 May;23(5):679-84., [PMID:15176679]
Abstract [show]
In this European study, the phenotype in 68 patients, homozygous or compound heterozygous for the G85E mutation, was investigated. Each index case was compared with two cystic fibrosis (CF) patients from the same clinic, matched for age and sex: one with pancreatic sufficiency (PS) and one with pancreatic insufficiency (PI). When comparing 31 G85E/F508del and F508del/F508del patients, there were no differences in median age at diagnosis, mean sweat chloride value, most recent weight for height, most recent forced expiratory volume in one second % predicted, prevalence of chronic Pseudomonas aeruginosa colonisation and typical CF complications. However, PI was less frequent in the G85E/F508del group. Comparison of 55 G85E patients (with second mutation known and not classified as mild) with PS controls (n=44) showed that the G85E patients had a significantly higher sweat chloride, more often failure to thrive at diagnosis, higher prevalence of PI, worse current weight for height, higher prevalence of chronic P. aeruginosa colonisation and liver cirrhosis. Pulse-chase experiments revealed that G85E cystic fibrosis transmembrane conductance regulator failed to mature on a M470 as well as on a V470 background. Therefore, G85E is a class II mutation. Although there is variability in its clinical presentation, G85E mutation results in a severe phenotype.
Comments [show]
None has been submitted yet.
No. Sentence Comment
92 - Cystic fibrosis transmembrane conductance regulator genotypes of patients in the three study groups G85E PI PS Genotype Subjects n Genotype Subjects n Genotype Subjects n G85E/F508del# 34 F508del# /F508del# 58 F508del# /unknown 15 G85E/unknown 8 F508del# /unknown 2 F508del# /3849z10 kbCRT} 5 G85E/G542X# 5 F508del# /1717-1GR A 1 F508del# /R117H} 3 G85E/W1282X# 4 F508del# /N1303K# 1 T338I/L1065P 2 G85E/I507del# 3 F508del*/H139R 1 E585X/3272-26ARG} 2 G85E/R1162X# 3 F508del# /R1066C # 1 2183AARG/2789z5GRA 2 G85E/2183AARG 2 F508del# /G542X# 1 F508del# /711z5GRA 1 G85E/G85E 1 F508del# /712-1GRT 1 F508del# /D1152H} 1 G85E/E585X# 1 F508del# /621z1GRT 1 F508del# /1898z3ARG 1 G85E/711z1GRT# 1 F508del# /1898z1 1 F508del# /R347H} 1 G85E/712-1GRT# 1 Total 68 F508del# /2789z5GRA 1 G85E/621z1GRT# 1 2789z5GRA/?
X
ABCC7 p.Thr338Ile 15176679:92:386
status: NEW[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]
Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.
Comments [show]
None has been submitted yet.
No. Sentence Comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene.
X
ABCC7 p.Thr338Ile 15371903:35:428
status: NEW[hide] Comprehensive cystic fibrosis mutation epidemiolog... Ann Hum Genet. 2005 Jan;69(Pt 1):15-24. Castaldo G, Polizzi A, Tomaiuolo R, Cazeneuve C, Girodon E, Santostasi T, Salvatore D, Raia V, Rigillo N, Goossens M, Salvatore F
Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population.
Ann Hum Genet. 2005 Jan;69(Pt 1):15-24., [PMID:15638824]
Abstract [show]
We screened the whole coding region of the cystic fibrosis transmembrane regulator (CFTR) gene in 371 unrelated cystic fibrosis (CF) patients from three regions of southern Italy. Forty-three mutations detected 91.5% of CF mutated chromosomes by denaturing gradient gel electrophoresis analysis, and three intragenic CFTR polymorphisms predicted a myriad of rare mutations in uncharacterized CF chromosomes. Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711 + 1G > T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Several mutations frequently found in northern Italy (e.g., R1162X, 711 + 5G > T) and northern Europe (e.g., G551D, I507del and 621 + 1G > T) are absent from the studied population. The I148T-3195del6 complex allele was present in two CF chromosomes, whereas I148T was present in both alleles (as a single mutation) in another CF patient and in five CF carriers; this could result from crossover events. The haplotype analysis of three intragenic polymorphisms (IVS8CA, IVS17bTA and IVS17bCA) compared with data from other studies revealed that several mutations (3849 + 10kbC > T, 1717-1G > A, E585X, 3272-26G > A, L558S, 2184insA and R347P) originated from multiple events, whereas others (R1158X and S549R) could be associated with one or more intragenic recombinant events. Given the large population migration from southern Italy, knowledge of the CF molecular epidemiology in this area is an important contribution to diagnosis, counselling and interlaboratory quality control for molecular laboratories worldwide.
Comments [show]
None has been submitted yet.
No. Sentence Comment
14 Most mutations are "private," but some are frequent in specific regions or ethnic groups (Estivill et al. 1997): 2143delT in Germany (Dork et al. 1992), W1282X among Ashkenazim (Shoshani et al. 1992), Y122X in Reunion Island (Chevalier-Porst et al. 1992), 2183AA>G and R1162X in northeast Italy and T338I in Sardinia (Rendine et al. 1997).
X
ABCC7 p.Thr338Ile 15638824:14:301
status: NEW84 Similarly, 1717-1G>A is more frequent in north-western Italy (5-6%) than in southern Italy (about 2.0% in our population), and T338I, Table 2 Mutations linked to a single haplotype, characteryzed at the level of three CFTR intragenic loci (IVS8CA, IVS17bTA, IVS17bCA) by the indication of the repeats number.
X
ABCC7 p.Thr338Ile 15638824:84:127
status: NEW[hide] Cystic fibrosis carriers have higher neonatal immu... Am J Med Genet A. 2005 Jun 1;135(2):142-4. Castellani C, Picci L, Scarpa M, Dechecchi MC, Zanolla L, Assael BM, Zacchello F
Cystic fibrosis carriers have higher neonatal immunoreactive trypsinogen values than non-carriers.
Am J Med Genet A. 2005 Jun 1;135(2):142-4., 2005-06-01 [PMID:15832355]
Abstract [show]
Following cystic fibrosis (CF) neonatal screening implementation, a high frequency of heterozygotes has been reported among neonates with elevated immunoreactive trypsinogen (IRT) and normal sweat chloride levels. We studied the relationship between normal IRT values and CF heterozygosity: 10,000 neonates were screened for CF by IRT measurement and tested for 40 CF mutations; the 294 carriers detected were coupled with newborns negative to the same genetic testing, and the two groups' IRT levels compared. Heterozygotes had higher IRT levels than their controls (mean 35.32 vs. 27.58 microg/L, P<0.001). Even within normal trypsinogen range, the probability of being a CF carrier increases with neonatal IRT concentration.
Comments [show]
None has been submitted yet.
No. Sentence Comment
40 Distribution and Classification of the Tested Mutations in the Normal IRT Heterozygote Population Under Study Mutations Type of mutation Class of mutation Number of cases F508del Severe II 161 N1303K Severe II 19 G542X Severe I 19 711 þ 5G > A - V 15 R117H Mild IV 13 R1162X Severe I 13 R553X Severe I 11 G85E - IV 8 2183AA > G Severe I 8 1717-1G > A Severe I 8 R334Q Mild - 4 Q552X Severe I 4 W1282X Severe I 3 2789 þ 5G > A Mild V 2 1898 þ 3A > G Mild V 2 T338I Mild IV 1 R709X Severe I 1 R347H Mild IV 1 3849 þ 10KbC > T Mild V 1 Total 294 Other tested mutations: 1078delTn1609delCAn1717-8g/an394delTTn457TAT> Gn541delCn621 þ 1g/tn711 þ 1g/tnA559TnDI507nG551DnR1158XnR334Wn R347PnR352QnS549InS549NnS549Ra/cn2790-2G > An1811 þ 1.2KbA > G; 711þ5G > A and G85E not categorized in type of mutation; R334Q not categorized in class of mutation.
X
ABCC7 p.Thr338Ile 15832355:40:473
status: NEW[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]
Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.
Comments [show]
None has been submitted yet.
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C !
X
ABCC7 p.Thr338Ile 15880796:58:284
status: NEW[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2003 Dec;24(6):629-38. Gallati S
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2003 Dec;24(6):629-38., [PMID:16088579]
Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene, which encodes a protein expressed in the apical membrane of exocrine epithelial cells. CFTR functions principally as a cyclic adenosine monophosphate (cAMP)-induced chloride channel and appears capable of regulating other ion channels. Mutations affect CFTR through a variety of molecular mechanisms, which can produce little or no functional gene product at the apical membrane. More than 1000 different disease-causing mutations within the CFTR gene have been described. The potential of a mutation to contribute to the phenotype depends on its type, localization in the gene, and the molecular mechanism as well as on interactions with secondary modifying factors. Genetic testing can confirm a clinical diagnosis of CF and can be used for infants with meconium ileus, for carrier detection in individuals with positive family history and partners of proven CF carriers, and for prenatal diagnostic testing if both parents are carriers. Studies of clinical phenotype in correlation with CFTR genotype have revealed a very complex relationship demonstrating that some phenotypic features are closely determined by the underlying mutations, whereas others are modulated by modifier genes, epigenetic mechanisms, and environment.
Comments [show]
None has been submitted yet.
No. Sentence Comment
50 In effect, virtually no func- Table 2 Unusually Common Cystic Fibrosis Mutations in Specific Populationsa Total Exon/ Number Number Frequency Mutation Intron Ethnic Origin Observed Screened (%) 296+12T→C intron 02 Pakistani 02 24 8.33 E60X exon 03 Belgian 06 394 1.52 G91R exon 03 French 04 266 1.50 394delTT exon 03 Scandinavian 78 1588 4.91 457TAT→G exon 04 Austrian 04 334 1.20 Y122X exon 04 Réunion Island 14 29 48.27 I148T exon 04 French Canadian 06 66 9.09 711+5G→A intron 05 Italian (North East) 06 225 2.67 1078delT exon 07 Celtic 27 475 5.68 1161delC exon 07 Pakistani 02 24 8.33 T338I exon 07 Italian, Sardinian 04 86 4.65 Q359K/T360K exon 07 Georgian Jews 07 8 87.50 R347H exon 07 Turkish 04 134 2.98 1609delCA exon 10 Spanish 03 96 3.12 1677delTA exon 10 Bulgarian 05 222 2.25 S549I exon 11 Arabs 02 40 5.00 Q552X exon 11 Italian (North East) 03 225 1.33 A559T exon 11 African-American 02 79 2.53 1811+1.2kbA→G intron 11 Spanish 22 1068 2.06 1898+5G→T intron 12 Chinese 03 10 30.00 1949del84 exon 13 Spanish 02 136 1.47 2143delT exon 13 Russian 04 118 3.39 2183AA→G exon 13 Italian (North East) 21 225 9.33 2184insA exon 13 Russian 03 118 2.54 3120+1G→A intron 16 African-American 14 112 12.50 3272-26A→G intron 17a Portugese, French 06 386 1.55 R1066C exon 17b Portugese 05 105 4.76 R1070Q exon 17b Bulgarian 04 166 2.41 Y1092X exon 17b French Canadian, 11 725 1.52 French M1101K exon 17b Hutterite 22 32 68.75 3821delT exon 19 Russian 03 118 2.54 S1235R exon 19 French (South) 04 340 1.18 S1251N exon 20 Dutch, Belgian 11 792 1.39 S1255X exon 20 African-American 02 79 2.53 3905insT exon 20 Swiss 45 982 4.58 Amish, Arcadian 13 86 15.12 W1282X Exon 20 Jewish-Ashkenazi 50 95 52.63 R1283M exon 20 Welsh 03 183 1.64 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/.
X
ABCC7 p.Thr338Ile 16088579:50:615
status: NEW[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]
Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.
Comments [show]
None has been submitted yet.
No. Sentence Comment
47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T.
X
ABCC7 p.Thr338Ile 16126774:47:243
status: NEW[hide] Direct interaction with filamins modulates the sta... J Clin Invest. 2007 Feb;117(2):364-74. Epub 2007 Jan 18. Thelin WR, Chen Y, Gentzsch M, Kreda SM, Sallee JL, Scarlett CO, Borchers CH, Jacobson K, Stutts MJ, Milgram SL
Direct interaction with filamins modulates the stability and plasma membrane expression of CFTR.
J Clin Invest. 2007 Feb;117(2):364-74. Epub 2007 Jan 18., [PMID:17235394]
Abstract [show]
The role of the cystic fibrosis transmembrane conductance regulator (CFTR) as a cAMP-dependent chloride channel on the apical membrane of epithelia is well established. However, the processes by which CFTR is regulated on the cell surface are not clear. Here we report the identification of a protein-protein interaction between CFTR and the cytoskeletal filamin proteins. Using proteomic approaches, we identified filamins as proteins that associate with the extreme CFTR N terminus. Furthermore, we identified a disease-causing missense mutation in CFTR, serine 13 to phenylalanine (S13F), which disrupted this interaction. In cells, filamins tethered plasma membrane CFTR to the underlying actin network. This interaction stabilized CFTR at the cell surface and regulated the plasma membrane dynamics and confinement of the channel. In the absence of filamin binding, CFTR was internalized from the cell surface, where it prematurely accumulated in lysosomes and was ultimately degraded. Our data demonstrate what we believe to be a previously unrecognized role for the CFTR N terminus in the regulation of the plasma membrane stability and metabolic stability of CFTR. In addition, we elucidate the molecular defect associated with the S13F mutation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
278 In an individual with S13F paired with a known mild mutation, T338I, elevated sweat chloride was the only clinical manifestation (31).
X
ABCC7 p.Thr338Ile 17235394:278:62
status: NEW[hide] Airway nitric oxide in patients with cystic fibros... Chest. 2007 Jun;131(6):1857-64. Epub 2007 Mar 30. Keen C, Olin AC, Edentoft A, Gronowitz E, Strandvik B
Airway nitric oxide in patients with cystic fibrosis is associated with pancreatic function, Pseudomonas infection, and polyunsaturated fatty acids.
Chest. 2007 Jun;131(6):1857-64. Epub 2007 Mar 30., [PMID:17400678]
Abstract [show]
BACKGROUND: Airway nitric oxide (NO) is low or normal in cystic fibrosis (CF) patients. This may affect bacterial status since NO has antimicrobial properties. Arachidonic acid (AA), which is increased in the serum and airways of CF patients, has been shown to reduce NO levels. The aim of this study was to investigate whether airway NO level correlates with genotype and pancreatic function, and whether low airway NO level is associated with bacterial infection and increased serum AA level in CF patients. METHOD: Nasal NO (nNO) and exhaled NO (eNO) were measured according to the European Respiratory Society/American Thoracic Society standard in 59 CF patients aged 7 to 55 years, 80% of whom were pancreatic insufficient (PI) and 51% were chronically infected with Pseudomonas aeruginosa. RESULTS: PI CF patients had significantly lower nNO levels than pancreatic-sufficient (PS) patients. Airway NO level did not correlate with lung function or inflammatory parameters. PI patients chronically infected with P aeruginosa had significantly lower nNO levels than noninfected PI patients. nNO level correlated inversely with the AA/docosahexaenoic acid ratio, and eNO with the essential fatty acid (FA) deficiency index, which is the ratio between mead acid and AA. CONCLUSIONS: CF patients with PI, which is associated with more severe genotypes, had lower airway NO levels than patients with PS. Low NO level was correlated to chronic P aeruginosa infection, and an association was found between airway NO level and the abnormal serum phospholipid FA pattern.
Comments [show]
None has been submitted yet.
No. Sentence Comment
30 Patients in group 3 were heterozygous for mutations dF508 and V603F, R560T, or 621 ϩ 1G-T; group 4 patients were heterozygous for mutations dF508, 3659del C, or 394delTT and a mutation linked to a "mild" phenotype (eg, N1088D, R117C, R117H, R75Q, R658X, S945L, 1154insTC, or T338I).
X
ABCC7 p.Thr338Ile 17400678:30:281
status: NEW[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]
Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.
Comments [show]
None has been submitted yet.
No. Sentence Comment
48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT.
X
ABCC7 p.Thr338Ile 19897426:48:170
status: NEW97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction.
X
ABCC7 p.Thr338Ile 19897426:97:405
status: NEW[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]
Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.
Comments [show]
None has been submitted yet.
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure).
X
ABCC7 p.Thr338Ile 20059485:64:104
status: NEW[hide] Identification of the second CFTR mutation in pati... Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26. Giuliani R, Antonucci I, Torrente I, Grammatico P, Palka G, Stuppia L
Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols.
Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26., [PMID:20657600]
Abstract [show]
Congenital bilateral absence of vas deferens (CBAVD) is a manifestation of the mildest form of cystic fibrosis (CF) and is characterized by obstructive azoospermia in otherwise healthy patients. Owing to the availability of assisted reproductive technology, CBAVD patients can father children. These fathers are at risk of transmitting a mutated allele of the CF transmembrane conductance regulator (CFTR) gene, responsible for CF, to their offspring. The identification of mutations in both CFTR alleles in CBAVD patients is a crucial requirement for calculating the risk of producing a child with full-blown CF if the female partner is a healthy CF carrier. However, in the majority of CBAVD patients, conventional mutation screening is not able to detect mutations in both CFTR alleles, and this difficulty hampers the execution of correct genetic counselling. To obtain information about the most represented CFTR mutations in CBAVD patients, we analysed 23 CBAVD patients, 15 of whom had a single CFTR mutation after screening for 36 mutations and the 5T allele. The search for the second CFTR mutation in these cases was performed by using a triplex approach: (i) first, a reverse dot-blot analysis was performed to detect mutations with regional impact; (ii) next, multiple ligation-dependent probe amplification assays were conducted to search for large rearrangements; and (iii) finally, denaturing high-performance liquid chromatography was used to search for point mutations in the entire coding region. Using these approaches, the second CFTR mutation was detected in six patients, which increased the final detection rate to 60.8%.
Comments [show]
None has been submitted yet.
No. Sentence Comment
58 INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator.
X
ABCC7 p.Thr338Ile 20657600:58:380
status: NEW70 In both cases, the second detected mutation was T338I, which consists of a T-to-C change in exon 7, nucleotide 1145.
X
ABCC7 p.Thr338Ile 20657600:70:48
status: NEW81 Patient First-level CFTR screening CFTR Italian MLPA analysis DHPLC analysis Final genotype (36 mutations + 5T allele) regional kit 1 [delta]F508/5T - - - [delta]F508/5T 2 [delta]F508/5T - - - [delta]F508 /5T 3 [delta]F508/5T - - - [delta]F508/5T 4 [delta]F508/5T - - - [delta]F508/5T 5 [delta]F508 /5T - - - [delta]F508/5T 6 G542X/5T - - - [delta]F508/5T 7 G542X/5T - - - [delta]F508/5T 8 W1282X/5T - - - W1282X/5T 9 [delta]F508/wt [delta]F508/T338I - - [delta]F508/T338I 10 [delta]F508/wt [delta]F508/wt [delta]F508/wt [delta]F508/wt [delta]F508/wt 11 5T/wt 5T/T338I - - 5T/T338I 12 5T/wt 5T/wt 5T/del ex1 - 5T/del ex1 13 5T/wt 5T/wt 5T/del ex19 - 5T/del ex19 14 5T/wt 5T/wt 5T/wt 5T/2811G/T 5T/2811G/T 15 5T/wt 5T/wt 5T/wt 5T/I105N 5T/I105N 16 5T/wt 5T/wt 5T/wt 5T/wt 5T/wt 17 5T/wt 5T/wt 5T/wt 5T/wt 5T/wt 18 5T/wt 5T/wt 5T/wt 5T/wt 5T/wt 19 5T/wt 5T/wt 5T/wt 5T/wt 5T/wt 20 5T/wt 5T/wt 5T/wt 5T/wt 5T/wt 21 5T/wt 5T/wt 5T/wt 5T/wt 5T/wt 22 5T/wt 5T/wt 5T/wt 5T/wt 5T/wt 23 5T/wt 5T/wt 5T/wt 5T/wt 5T/wt Detection rate 8/23 (34.8%) 2/15 (13.3%) 2/13 (15.3%) 2/11 (18.1%) 14/23 (60.8%) Abbreviations: CFTR, cystic fibrosis transmembrane conductance regulator; DHPLC, denaturing high-performance liquid chromatography; MLPA, multiple ligation-dependent probe amplification; wt, wildtype.
X
ABCC7 p.Thr338Ile 20657600:81:498
status: NEWX
ABCC7 p.Thr338Ile 20657600:81:523
status: NEWX
ABCC7 p.Thr338Ile 20657600:81:626
status: NEWX
ABCC7 p.Thr338Ile 20657600:81:642
status: NEW106 In two patients, the mutation was detected by using reverse dot-blot analysis (T338I).
X
ABCC7 p.Thr338Ile 20657600:106:79
status: NEW111 The missense T338I mutation, detected in two patients by the Italian Regional kit, is typical of the Sardinia region, where it accounts for about 10% of all the mutated CFTR alleles [25].
X
ABCC7 p.Thr338Ile 20657600:111:13
status: NEW114 Because no data are available regarding the frequency of this mutation in the Abruzzo population, it was not possible to exclude that T338I is also a common mutation in this region.
X
ABCC7 p.Thr338Ile 20657600:114:134
status: NEW115 When present in compound heterozygosity with a severe CFTR mutation, the T338I mutation has been reported to cause a mild form of CF characterized by isolated hypotonic dehydration [26].
X
ABCC7 p.Thr338Ile 20657600:115:73
status: NEW118 Thus, the T338I mutation can be considered as a mild CFTR mutation.
X
ABCC7 p.Thr338Ile 20657600:118:10
status: NEW[hide] Comprehensive description of CFTR genotypes and ul... Hum Genet. 2011 Apr;129(4):387-96. Epub 2010 Dec 24. de Becdelievre A, Costa C, Jouannic JM, LeFloch A, Giurgea I, Martin J, Medina R, Boissier B, Gameiro C, Muller F, Goossens M, Alberti C, Girodon E
Comprehensive description of CFTR genotypes and ultrasound patterns in 694 cases of fetal bowel anomalies: a revised strategy.
Hum Genet. 2011 Apr;129(4):387-96. Epub 2010 Dec 24., [PMID:21184098]
Abstract [show]
Fetal bowel anomalies may reveal cystic fibrosis (CF) and the search for CF transmembrane conductance regulator (CFTR) gene mutations is part of the diagnostic investigations in such pregnancies, according to European recommendations. We report on our 18-year experience to document comprehensive CFTR genotypes and correlations with ultrasound patterns in a series of 694 cases of fetal bowel anomalies. CFTR gene analysis was performed in a multistep process, including search for frequent mutations in the parents and subsequent in-depth search for rare mutations, depending on the context. Ultrasound patterns were correlated with the genotypes. Cases were distinguished according to whether they had been referred directly to our laboratory or after an initial testing in another laboratory. A total of 30 CF fetuses and 8 cases compatible with CFTR-related disorders were identified. CFTR rearrangements were found in 5/30 CF fetuses. 21.2% of fetuses carrying a frequent mutation had a second rare mutation, indicative of CF. The frequency of CF among fetuses with no frequent mutation was 0.43%. Correlation with ultrasound patterns revealed a significant frequency of multiple bowel anomalies in CF fetuses. The results emphasize the need to search for rearrangements in the diagnosis strategy of fetal bowel anomalies. The diagnostic value of ultrasound patterns combining hyperechogenic bowel, loop dilatation and/or non-visualized gallbladder reveals a need to revise current strategies and to offer extensive CFTR gene testing when the triad is diagnosed, even when no frequent mutation is found in the first-step analysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
166 [T338I] c.[1657C[T]?
X
ABCC7 p.Thr338Ile 21184098:166:1
status: NEW277 Eight fetuses were found with a genotype compatible with CFTR-RD, and 1 CF fetus with the mild T338I (p.Thr338Ile, c.1013C[T) CF mutation, thereby illustrating that fetal bowel anomalies not only reveal classical CF but also mild forms of the disease, as observed in newborn screening for CF (Narzi et al. 2007; Roussey et al. 2007; Thauvin-Robinet et al. 2009).
X
ABCC7 p.Thr338Ile 21184098:277:95
status: NEWX
ABCC7 p.Thr338Ile 21184098:277:104
status: NEW[hide] Preconceptional identification of cystic fibrosis ... J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22. Coiana A, Faa' V, Carta D, Puddu R, Cao A, Rosatelli MC
Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program.
J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22., [PMID:21429822]
Abstract [show]
BACKGROUND: In Sardinia the mutational spectrum of CFTR gene is well defined. A mutation detection rate of 94% can be achieved by screening for 15 CFTR mutations with a frequency higher than 0.5%. The efficiency of this molecular test suggests that Sardinians may represent a suitable population for a preconceptional screening. METHODS: Five hundred couples of Sardinia descent were screened for 38 mutations using a semi-automated reverse-dot blot and PCR-gel electrophoresis assays. This mutation panel included the 15 most frequent CF alleles in Sardinia. RESULTS: We identified 38 CF carriers, revealing an overall frequency of 1/25 (4%). The most common CF allele was the p.Thr338Ile (T338I) (65%), followed by the p.Phe508del (F508del) (22.5%). We also identified one couple at risk and an asymptomatic female homozygote for the p.Thr338Ile allele. CONCLUSIONS: In spite of the low number of the couples tested, the results herein reported demonstrate the efficacy and efficiency of the preconceptional screening program and the high participation rate of the Sardinian population (99%).
Comments [show]
None has been submitted yet.
No. Sentence Comment
6 The most common CF allele was the p.Thr338Ile (T338I) (65%), followed by the p.Phe508del (F508del) (22.5%).
X
ABCC7 p.Thr338Ile 21429822:6:36
status: NEWX
ABCC7 p.Thr338Ile 21429822:6:47
status: NEW80 The most common CF allele was the p.Thr338Ile (T338I) (65%), followed by the p.Phe508del (F508del) (22.5%).
X
ABCC7 p.Thr338Ile 21429822:80:36
status: NEWX
ABCC7 p.Thr338Ile 21429822:80:47
status: NEW88 Mutation nomenclaturea Alleles (%) T338I (p.Thr338Ile) 26 (65.0) F508del (p.Phe508del) 9 (22.5) N1303K (p.Asn1303Lys) 1 (2.5) 2183AANG (c.2051_2052delAAinsG) 1 (2.5) 621+1GNT (c.489+1GNT) 1 (2.5) exon 2 del (c.54-5811_164+2187del8108ins182) 1 (2.5) R347P (p.Arg347Pro) 1 (2.5) The 3849+10kbCNT (c.3717+12191CNT), G85E (p.Gly85Glu), 2789+5GNA (c.2657+5GNA), W1282X (p.Trp1282X), G1244E (p.Gly1244Glu), 711+5GNA (c.579+5GNA), 711+1GNT (c.579+1GNA), 4016insT (p.Ser1297PhefsX5), G542X (p.Gly542X), 1717-1GNA (c.1585-1GNA), R553X (p.Arg553X), Q552X (p.Gln552X), G551D (p.Gly551Asp), S549R (ANC) (p.Ser549Arg), I507del (p.Ile507del), F508C (p.Phe508Cys), I502T (p.Ile502Thr), 1706del17 (p.Gln525LeufsX37), 1677delTA (p.Tyr515X), R117H (p.Arg117His), D1152H (p.Asp1152His), L1065P (p.Leu1065Pro), R1066H (p.Arg1066His), L1077P (p.Leu1077Pro), 4382delA (p.Glu1418ArgfsX14), R1162X (p.Arg1162X), R1158X (p.Arg1158X), 1259 insA (p.Gln378AlafsX4), 852del22 (p.Gly241GlufsX13), S912X (p.Ser912X), and 991del5bp (p.Asn287LysfsX19) mutations included in the CF panel were not detected in the population tested.
X
ABCC7 p.Thr338Ile 21429822:88:35
status: NEWX
ABCC7 p.Thr338Ile 21429822:88:44
status: NEW92 An asymptomatic 43 year old female homozygous for the p. Thr338Ile (T338I) allele was also identified (Table 3) whose parents, both T338I heterozygotes, were first cousins.
X
ABCC7 p.Thr338Ile 21429822:92:57
status: NEWX
ABCC7 p.Thr338Ile 21429822:92:68
status: NEWX
ABCC7 p.Thr338Ile 21429822:92:132
status: NEW121 Our study showed that the most frequent mutation in Sardinia is the p.Thr338Ile (T338I) (65%), a mild mutation previously described by our group in Sardinian CF patients either in homozygous state (11 patients) or in compound heterozygous state with other severe mutations (18 patients) [16,17].
X
ABCC7 p.Thr338Ile 21429822:121:70
status: NEWX
ABCC7 p.Thr338Ile 21429822:121:81
status: NEW124 Patients homozygous for the T338I mutation are often asymptomatic otherwise showing a very mild phenotype.
X
ABCC7 p.Thr338Ile 21429822:124:28
status: NEW125 Clinical manifestation of patient compound heterozygotes for T338I and other severe mutation are slightly more severe ranging from isolated azoospermia, with or without CBAVD, to mild CF phenotype characterized by a mild to moderate pulmonary involvement.
X
ABCC7 p.Thr338Ile 21429822:125:61
status: NEW127 Moreover seven patients belonging from both groups (3 patients T338I/T338I, 2 patients T338I/F508del, 1 patient T338I/ 2183AANG, 1 patient T338I/R1066H), affected by azoospermia with no other CF symptoms, were occasionally identified when they requested CF genetic test for assisted reproduction technologies (ART) (Rosatelli, personal communication).
X
ABCC7 p.Thr338Ile 21429822:127:63
status: NEWX
ABCC7 p.Thr338Ile 21429822:127:69
status: NEWX
ABCC7 p.Thr338Ile 21429822:127:87
status: NEWX
ABCC7 p.Thr338Ile 21429822:127:112
status: NEWX
ABCC7 p.Thr338Ile 21429822:127:139
status: NEW128 There is statistically significant difference between the frequency of the p.Thr338Ile (T338I) allele (65%), highlighted in the present study, and the findings of our previous study on Sardinian CF patients (19.3%) (p=0.0001) [12].
X
ABCC7 p.Thr338Ile 21429822:128:77
status: NEWX
ABCC7 p.Thr338Ile 21429822:128:88
status: NEW132 c Genotype: p.Thr338Ile (T338I) homozygote.
X
ABCC7 p.Thr338Ile 21429822:132:14
status: NEWX
ABCC7 p.Thr338Ile 21429822:132:25
status: NEW134 As alluded above, this discrepancy is likely due to the mild phenotype of patient p.Thr338Ile (T338I) homozygotes or compound heterozygotes which can escape a diagnosis.
X
ABCC7 p.Thr338Ile 21429822:134:84
status: NEWX
ABCC7 p.Thr338Ile 21429822:134:95
status: NEW136 In the counseling session, patients as well as couples at risk should be exhaustively informed about the asymptomatic or mild phenotype of the T338I allele.
X
ABCC7 p.Thr338Ile 21429822:136:143
status: NEW7 We also identified one couple at risk and an asymptomatic female homozygote for the p.Thr338Ile allele.
X
ABCC7 p.Thr338Ile 21429822:7:86
status: NEW[hide] Cystic fibrosis carrier testing in an ethnically d... Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7. Rohlfs EM, Zhou Z, Heim RA, Nagan N, Rosenblum LS, Flynn K, Scholl T, Akmaev VR, Sirko-Osadsa DA, Allitto BA, Sugarman EA
Cystic fibrosis carrier testing in an ethnically diverse US population.
Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7., [PMID:21474639]
Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) and the frequency of specific disease-causing mutations vary among populations. Affected individuals experience a range of serious clinical consequences, notably lung and pancreatic disease, which are only partially dependent on genotype. METHODS: An allele-specific primer-extension reaction, liquid-phase hybridization to a bead array, and subsequent fluorescence detection were used in testing for carriers of 98 CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations among 364 890 referred individuals with no family history of CF. RESULTS: One in 38 individuals carried one of the 98 CFTR mutations included in this panel. Of the 87 different mutations detected, 18 were limited to a single ethnic group. African American, Hispanic, and Asian individuals accounted for 33% of the individuals tested. The mutation frequency distribution of Caucasians was significantly different from that of each of these ethnic groups (P < 1 x 10(1)). CONCLUSIONS: Carrier testing using a broad mutation panel detects differences in the distribution of mutations among ethnic groups in the US.
Comments [show]
None has been submitted yet.
No. Sentence Comment
131 Four mutations (p.S1255X, p.G330X, c.313delA, p.S364P) were identified only in African Americans, 8 mutations (p.G178R, p.T338I, c.262_ 263delTT, p.M1101K, c.442delA, p.K710X, p.P574H, p.Q1238X)wereidentifiedonlyinCaucasians,and3mu- tations (c.580-1GϾT, c.531delT, p.Q890X) were identified only in Hispanics.
X
ABCC7 p.Thr338Ile 21474639:131:122
status: NEW[hide] Mild cystic fibrosis mutations in Southern Sweden ... Clin Genet. 1998 May;53(5):383-6. Schaedel C, Andersson AM, Kristoffersson AC, Kornfalt R, Lannefors L, Holmberg L
Mild cystic fibrosis mutations in Southern Sweden with special reference to S549I and T338I.
Clin Genet. 1998 May;53(5):383-6., [PMID:9660057]
Abstract [show]
In this study of cystic fibrosis (CF) gene mutations in Southern Sweden we found missense mutations in 12 out of 110 patients. These patients, as a group, differed from deltaF508 homozygotes by a higher frequency of pancreatic sufficiency and an older age at diagnosis as has been indicated in previous studies. In addition, lung function (vital capacity (VC) and forced expiratory volume in 1 s (FEV1)) tended to be better although the difference did not reach statistical significance (p = 0.13 for FEV1). For two mutations, S549I and T338I, our results differed from earlier reports. In our experience, S549I confers a milder phenotype and T338I a more severe one than previously reported. We conclude that each mutation should be treated separately when trying to correlate genotype with phenotype.
Comments [show]
None has been submitted yet.
No. Sentence Comment
16 Here we compare the clinical picture in a group of patients with missense mutations or the 5T allele with that in AF508 homozygotes and, especially, describe the features in the S549I and T338I mutations, for which our experience differs from earlier reports.
X
ABCC7 p.Thr338Ile 9660057:16:188
status: NEW36 The most frequent ones were T338I (5), R117C (3) and R117H (2), accounting for 2.2, 1.4and 0.9% of the C F alleles, respectively.
X
ABCC7 p.Thr338Ile 9660057:36:28
status: NEW42 Five patients from three unrelated families had the genotype T338I/AF508.
X
ABCC7 p.Thr338Ile 9660057:42:61
status: NEW66 However, they differ with respect to the T338I and S549I mutations.
X
ABCC7 p.Thr338Ile 9660057:66:41
status: NEW67 T3381, the substitution of isoleucine for threonine at position 338 of the CFTR protein, has previously been found only in patients of Sardinian descent (9-1 1).
X
ABCC7 p.Thr338Ile 9660057:67:27
status: NEW71 The possibility that the variation in clinical severity in our patients could be explained by the presence of the 5T polymorphism on the T338I allele was ruled out.
X
ABCC7 p.Thr338Ile 9660057:71:137
status: NEW83 In conclusion, our study extends clinical data for two CF gene deficiencies T338I and S549I.
X
ABCC7 p.Thr338Ile 9660057:83:76
status: NEW[hide] Non-pore lining amino acid side chains influence a... J Physiol. 1998 Oct 1;512 ( Pt 1):1-16. Linsdell P, Zheng SX, Hanrahan JW
Non-pore lining amino acid side chains influence anion selectivity of the human CFTR Cl- channel expressed in mammalian cell lines.
J Physiol. 1998 Oct 1;512 ( Pt 1):1-16., 1998-10-01 [PMID:9729613]
Abstract [show]
1. The effects of individually mutating two adjacent threonine residues in the sixth membrane-spanning region (TM6) of the cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel on permeation properties were examined using patch clamp recording from mammalian cell lines stably expressing human CFTR. 2. A number of mutations of T338 significantly affected the permeation properties of the channel. Increases and decreases in single channel conductance were observed for different mutants. Anion selectivity was strongly affected, with no two channel variants sharing the same selectivity sequence. Several mutations led to strong inward rectification of the macroscopic current-voltage relationship. The effects of these mutations on permeation properties were correlated with the size of the amino acid side chain substituted, rather than its chemical nature. 3. Most mutations of T339 resulted in a lack of functional channel expression and apparent misprocessing of the protein. One mutant, T339V, was characterized in detail; its permeation properties were significantly altered, although these effects were not as strong as for T338 mutations. 4. These results suggest an important role for T338 in controlling the permeation properties of the CFTR Cl- channel. It is suggested that mutation of this residue alters the interaction between permeating anions and the channel pore via an indirect effect on the orientation of the TM6 helix.
Comments [show]
None has been submitted yet.
No. Sentence Comment
94 However, clear single channel currents were never resolved for T338N, T338V or T338I, either in CHO cell patches or in patches excised from BHK cells selected using a lower concentration of MTX (20 ìÒ), at potentials as hyperpolarized as -100 mV (data not shown).
X
ABCC7 p.Thr338Ile 9729613:94:79
status: NEW101 We attempted to make some estimate of the conductance of T338N, T338V and T338I channels by analysing the increase in current noise associated with macroscopic current activation (Fig. 5).
X
ABCC7 p.Thr338Ile 9729613:101:74
status: NEW111 In contrast to wild-type, activation of macroscopic T338I (Fig. 5C and D) and T338N and T338V (data not shown) Cl¦ currents was associated with only a very small increase in noise.
X
ABCC7 p.Thr338Ile 9729613:111:52
status: NEW112 Analysis of current variance (e.g. Fig. 5D) yielded chord conductances at -50 mV of 0·23 ± 0·02 pS (n = 4) for T338N, 0·36 ± 0·10 pS (n = 5) for T338V, and 0·17 ± 0·04 pS (n = 5) for T338I.
X
ABCC7 p.Thr338Ile 9729613:112:228
status: NEW121 T338I gave only very small currents when intracellular Cl¦ was replaced by other anions, such that accurate measurement of Vrev was not possible, and therefore the selectivity of this mutant was not studied further.
X
ABCC7 p.Thr338Ile 9729613:121:0
status: NEW123 Estimation of unitary current amplitude from macroscopic current noise A and C, activation of macroscopic CFTR current at -50 mV is associated with a large increase in current noise for wild-type (A), but a much smaller increase in noise for T338I (C).
X
ABCC7 p.Thr338Ile 9729613:123:242
status: NEW193 The conductance of different T338 mutants varied over almost two orders of magnitude (Fig. 6), although the low conductances estimated for T338N, T338V and T338I should be considered rough approximations only.
X
ABCC7 p.Thr338Ile 9729613:193:156
status: NEW195 The central portion of TM6 containing both of these key amino acids (T338 and S341) may therefore be the region where conductance is mainly determined. The low conductance of T338I could also explain why this mutation is associated with CF (Saba et al. 1993), although partial misprocessing (Fig. 1C) may also play a role.
X
ABCC7 p.Thr338Ile 9729613:195:175
status: NEW207 All single channel conductances reported in this paper were measured at hyperpolarized potentials; conductance of the mutant channels T338N, T338V and T338I might be significantly lower at depolarized potentials (Fig. 2).
X
ABCC7 p.Thr338Ile 9729613:207:151
status: NEW[hide] Validation of double gradient denaturing gradient ... Clin Chem. 1999 Jan;45(1):35-40. Cremonesi L, Carrera P, Fumagalli A, Lucchiari S, Cardillo E, Ferrari M, Righetti SC, Zunino F, Righetti PG, Gelfi C
Validation of double gradient denaturing gradient gel electrophoresis through multigenic retrospective analysis.
Clin Chem. 1999 Jan;45(1):35-40., [PMID:9895335]
Abstract [show]
Among established techniques for the identification of either known or new mutations, denaturing gradient gel electrophoresis (DGGE) is one of the most effective. However, conventional DGGE is affected by major drawbacks that limit its routine application: the different denaturant gradient ranges and migration times required for different DNA fragments. We developed a modified version of DGGE for high-throughput mutational analysis, double gradient DGGE (DG-DGGE), by superimposing a porous gradient over the denaturant gradient, which maintains the zone-sharpening effect even during lengthy analyses. Because of this innovation, DG-DGGE achieves the double goals of retaining full effectiveness in the detection of mutations while allowing identical run time conditions for all fragments analyzed. Here we use retrospective analysis of a large number of well-characterized mutations and polymorphisms, spanning all predicted melting domains and the whole genomic sequence of three different genes--the cystic fibrosis transmembrane conductance regulator (CFTR), the beta-globin, and the p53 genes--to demonstrate that DG-DGGE may be applied to the rapid scanning of any sequence variation.
Comments [show]
None has been submitted yet.
No. Sentence Comment
31 Mutations and polymorphisms analyzed in the CFTR gene. Position Denaturant gradient Mutation Exon 1 40-90% 125G/Ca,b M1V (A3G at 133) 175insT 182delT Exon 3 10-60% W57G (T3G at 301) 356G/Aa G85E (G3A at 386) Exon 4 20-70% R117H (G3A at 482) 541delC 621ϩ1G3T I148T (T3C at 575) Exon 5 20-70% E193K (G3A at 709) Intron 5 20-70% 711ϩ3A3G Exon 7 20-70% 1078delT R334W (C3T at 1132) T338I (C3T at 1145) R347P (G3C at 1172)b R347H (G3A at 1172) R352Q (G3A at 1187) Exon 10 20-70% M470V (1540A/G)a ⌬F508 (del 3 bp at 1652) Intron 10 10-60% 1717-1G3A Exon 11 10-60% G542X (G3T at 1756) 1784delG R553X (C3T at 1789) Exon 12 10-60% D579G (A3G at 1868) E585X (G3T at 1885) Intron 12 10-60% 1898ϩ3A3G Exon 13 30-80% 2183AA3G E730X (G3T at 2320) L732X (T3G at 2327) 2347delG Exon 14a 10-60% T854T (2694T/G)a V868V (2736G/A)a Intron 14b 30-80% 2789ϩ5G3A Exon 15 20-70% M952I (G3C at 2988)b Exon 17a 20-70% L997F (G3C at 3123)b Exon 17b 20-70% F1052V (T3G at 3286) R1066C (C3T at 3328) R1066H (G3A at 3329) A1067T (G3A at 3331) Exon 18 20-70% D1152H (G3C at 3586)b Exon 19 30-80% R1158X (C3T at 3604) Exon 20 20-70% S1251N (G3A at 3384) W1282X (G3A at 3978) Exon 21 20-70% N1303K (C3G at 4041)b Exon 22 30-80% G1349D (G3A at 4178) 4382delA Exon 24 30-80% Y1424Y (4404C/T)a a Polymorphism.
X
ABCC7 p.Thr338Ile 9895335:31:390
status: NEW[hide] CFTR mutation combinations producing frequent comp... Hum Mutat. 2012 Nov;33(11):1557-65. doi: 10.1002/humu.22129. Epub 2012 Jul 2. El-Seedy A, Girodon E, Norez C, Pajaud J, Pasquet MC, de Becdelievre A, Bienvenu T, des Georges M, Cabet F, Lalau G, Bieth E, Blayau M, Becq F, Kitzis A, Fanen P, Ladeveze V
CFTR mutation combinations producing frequent complex alleles with different clinical and functional outcomes.
Hum Mutat. 2012 Nov;33(11):1557-65. doi: 10.1002/humu.22129. Epub 2012 Jul 2., [PMID:22678879]
Abstract [show]
Genotype-phenotype correlations in cystic fibrosis (CF) may be difficult to establish because of phenotype variability, which is associated with certain CF transmembrane conductance regulator (CFTR) gene mutations and the existence of complex alleles. To elucidate the clinical significance of complex alleles involving p.Gly149Arg, p.Asp443Tyr, p.Gly576Ala, and p.Arg668Cys, we performed a collaborative genotype-phenotype correlation study, collected epidemiological data, and investigated structure-function relationships for single and natural complex mutants, p.[Gly576Ala;Arg668Cys], p.[Gly149Arg;Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala;Arg668Cys]. Among 153 patients carrying at least one of these mutations, only three had classical CF and all carried p.Gly149Arg in the triple mutant. Sixty-four had isolated infertility and seven were healthy individuals with a severe mutation in trans, but none had p.Gly149Arg. Functional studies performed on all single and natural complex mutants showed that (1) p.Gly149Arg results in a severe misprocessing defect; (2) p.Asp443Tyr moderately alters CFTR maturation; and (3) p.Gly576Ala, a known splicing mutant, and p.Arg668Cys mildly alter CFTR chloride conductance. Overall, the results consistently show the contribution of p.Gly149Arg to the CF phenotype, and suggest that p.[Arg668Cys], p.[Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala;Arg668Cys] are associated with CFTR-related disorders. The present study emphasizes the importance of comprehensive genotype-phenotype and functional studies in elucidating the impact of mutations on clinical phenotype. Hum Mutat 33:1557-1565, 2012. (c) 2012 Wiley Periodicals, Inc.
Comments [show]
None has been submitted yet.
No. Sentence Comment
105 [2002C>T;3718-2477C>T] p.Gln689X 2 CSD Nasal polyposis 14 y,16 y NA, 29 p.[Gly576Ala;Arg668Cys] NI 3 IP 35-39 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 IP Bronchitis 49 y NA p.[Gly576Ala;Arg668Cys] p.PheF508del 1 IP 42 y NA p.[Gly576Ala;Arg668Cys] p.Arg668Cys 1 IP NA NA p.[Gly576Ala;Arg668Cys] c.1210_34TG[12]T[5] 4 IP 19-69 y NA p.[Gly576Ala;Arg668Cys] NI 1 Cholestasis 60 y NA p.[Gly576Ala;Arg668Cys] c.1584G>A 33 CBAVD 27-50 y 9-82 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 2 CBAVD 30 y,36 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.2051_2052delAAinsG 1 CBAVD 34 y 72 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Trp1282X 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 CBAVD 35 y 65-66 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Ser549Asn 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.3605delA 1 CBAVD 30 y 41-69 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gln1411X 1 CBAVD 31 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg347His 3 CBAVD 29 y, 34 y, NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gly542X 1 CBAVD 35 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.946delT 1 CBAVD 26 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.4242_4242+1delGGinsT 1 CBAVD 41 y 31 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg117His 1 CBAVD 32 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr338Ile 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Glu379Lys 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Met1137Val 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr1246Ile 2 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 CBAVD 34 NA p.[Gly576Ala;Arg668Cys] p.Asn1303Lys 8 CBAVD 30-42 y NA p.[Gly576Ala;Arg668Cys] NI 1 CBAVD 27 y NA p.Arg668Cys p.Phe508del 1 CBAVD 30 y NA p.Arg668Cys NI 1 CUAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 1 CUAVD NA NA p.[Gly576Ala;Arg668Cys] NI 1 CUAVD Renal agenesis NA NA p.[Gly576Ala;Arg668Cys] NI 1 Hypofertility (not CBAVD) CF carrier`s partner NA NA p.[Gly576Ala;Arg668Cys] p.Asp1152His 1 FBA Mild CF considered possible, 2 older brothers with the same genotype, one with a very mild phenotype, the other being asymptomatic 22 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 FBA TOP for de novo chromosomal translocation; not CF 21 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg31Cys 1 FBA Not CF at birth 28 wg <30 p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Unknown outcome 23 wg NA p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Not CF at birth 21 wg <30 p.[Gly576Ala;Arg668Cys] p.Trp846X (Continued) Table 1.
X
ABCC7 p.Thr338Ile 22678879:105:1249
status: NEW[hide] Phenotype-optimized sequence ensembles substantial... Hum Mutat. 2012 Aug;33(8):1267-74. doi: 10.1002/humu.22110. Epub 2012 May 22. Masica DL, Sosnay PR, Cutting GR, Karchin R
Phenotype-optimized sequence ensembles substantially improve prediction of disease-causing mutation in cystic fibrosis.
Hum Mutat. 2012 Aug;33(8):1267-74. doi: 10.1002/humu.22110. Epub 2012 May 22., [PMID:22573477]
Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) mutation is associated with a phenotypic spectrum that includes cystic fibrosis (CF). The disease liability of some common CFTR mutations is known, but rare mutations are seen in too few patients to categorize unequivocally, making genetic diagnosis difficult. Computational methods can predict the impact of mutation, but prediction specificity is often below that required for clinical utility. Here, we present a novel supervised learning approach for predicting CF from CFTR missense mutation. The algorithm begins by constructing custom multiple sequence alignments called phenotype-optimized sequence ensembles (POSEs). POSEs are constructed iteratively, by selecting sequences that optimize predictive performance on a training set of CFTR mutations of known clinical significance. Next, we predict CF disease liability from a different set of CFTR mutations (test-set mutations). This approach achieves improved prediction performance relative to popular methods recently assessed using the same test-set mutations. Of clinical significance, our method achieves 94% prediction specificity. Because databases such as HGMD and locus-specific mutation databases are growing rapidly, methods that automatically tailor their predictions for a specific phenotype may be of immediate utility. If the performance achieved here generalizes to other systems, the approach could be an excellent tool to help establish genetic diagnoses.
Comments [show]
None has been submitted yet.
No. Sentence Comment
153 Of the 103 test-set mutations, two CF-neutral mutations had a score higher than one standard deviation above the mean (G550R and R933G), and two CF-causing mutations had scores lower than one standard deviation below the mean (G85V and T338I); these four mutations were consistently the most difficult to accurately rank with our method.
X
ABCC7 p.Thr338Ile 22573477:153:236
status: NEW[hide] The K+ channel opener 1-EBIO potentiates residual ... PLoS One. 2011;6(8):e24445. Epub 2011 Aug 31. Roth EK, Hirtz S, Duerr J, Wenning D, Eichler I, Seydewitz HH, Amaral MD, Mall MA
The K+ channel opener 1-EBIO potentiates residual function of mutant CFTR in rectal biopsies from cystic fibrosis patients.
PLoS One. 2011;6(8):e24445. Epub 2011 Aug 31., [PMID:21909392]
Abstract [show]
BACKGROUND: The identification of strategies to improve mutant CFTR function remains a key priority in the development of new treatments for cystic fibrosis (CF). Previous studies demonstrated that the K(+) channel opener 1-ethyl-2-benzimidazolone (1-EBIO) potentiates CFTR-mediated Cl(-) secretion in cultured cells and mouse colon. However, the effects of 1-EBIO on wild-type and mutant CFTR function in native human colonic tissues remain unknown. METHODS: We studied the effects of 1-EBIO on CFTR-mediated Cl(-) secretion in rectal biopsies from 47 CF patients carrying a wide spectrum of CFTR mutations and 57 age-matched controls. Rectal tissues were mounted in perfused micro-Ussing chambers and the effects of 1-EBIO were compared in control tissues, CF tissues expressing residual CFTR function and CF tissues with no detectable Cl(-) secretion. RESULTS: Studies in control tissues demonstrate that 1-EBIO activated CFTR-mediated Cl(-) secretion in the absence of cAMP-mediated stimulation and potentiated cAMP-induced Cl(-) secretion by 39.2+/-6.7% (P<0.001) via activation of basolateral Ca(2)(+)-activated and clotrimazole-sensitive KCNN4 K(+) channels. In CF specimens, 1-EBIO potentiated cAMP-induced Cl(-) secretion in tissues with residual CFTR function by 44.4+/-11.5% (P<0.001), but had no effect on tissues lacking CFTR-mediated Cl(-) conductance. CONCLUSIONS: We conclude that 1-EBIO potentiates Cl(-)secretion in native CF tissues expressing CFTR mutants with residual Cl(-) channel function by activation of basolateral KCNN4 K(+) channels that increase the driving force for luminal Cl(-) exit. This mechanism may augment effects of CFTR correctors and potentiators that increase the number and/or activity of mutant CFTR channels at the cell surface and suggests KCNN4 as a therapeutic target for CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 CFabsent CFresidual CFTR genotype Number of individuals CFTR genotype Number of individuals F508del/F508del 10 F508del/Y161C 1 F508del/W57X 1 F508del/V232D 1 F508del/G85E 3 F508del/R334W 2 F508del/120del23 1 F508del/T338I 1 F508del/182delT 1 F508del/I1234V 1 F508del/G542X 1 F508del/3272-26 A.G 1 F508del/A561E 1 F508del/3849+10 kb C.T 1 F508del/Y1092X 1 F508del/4005 +5727 A.G 1 F508del/N1303K 1 F508del/G576A 1 F508del/1525-1 G.A 2 N1303K/R334W 1 F508del/Q39X 1 F1052V/M1137R 1 F508del/Q552X 1 1898+3 A.G/ 1898+3 A.G 1 G85E/G85E 1 R334W/3199del6 1 Q552X/R1162X 1 R334W/X 1 A561E/A561E 2 dele2,3/X 1 R764X/1717-1 G.A 1 R1158X/2183AA.G 1 R1158X/R560T 1 doi:10.1371/journal.pone.0024445.t001 luminal and basolateral surfaces of the epithelium were perfused continuously with a solution of the following composition (mmol/ L): NaCl 145, KH2PO4 0.4, K2HPO4 1.6, D-glucose 5, MgCl2 1, Ca-gluconate 1.3, pH 7.4, at 37uC.
X
ABCC7 p.Thr338Ile 21909392:46:216
status: NEW[hide] Borderline sweat test: Utility and limits of genet... Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24. Seia M, Costantino L, Paracchini V, Porcaro L, Capasso P, Coviello D, Corbetta C, Torresani E, Magazzu D, Consalvo V, Monti A, Costantini D, Colombo C
Borderline sweat test: Utility and limits of genetic analysis for the diagnosis of cystic fibrosis.
Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24., [PMID:19318035]
Abstract [show]
OBJECTIVE: The sweat test remains the gold standard for the diagnosis of Cystic Fibrosis (CF) even despite the availability of molecular analysis of Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR). We investigated the relationship between CFTR mutation analysis and sweat chloride concentration in a cohort of subjects with borderline sweat test values, in order to identify misdiagnosis of CF. DESIGN AND METHODS: In the period between March 2006 and February 2008 we performed 773 sweat tests in individuals referred for suspect CF. Ninety-one subjects had chloride values in the border-line range. Clinicians required CFTR gene complete scanning on 66 of them. RESULTS: The mean value of sweat chloride in the DNA negative subjects was lower than in those with at least one CFTR mutation. Our data indicate that 39 mEq/l is the best sensitivity trade off for the sweat test with respect to genotype. CONCLUSIONS: To optimise diagnostic accuracy of reference intervals, it may be useful to modify from 30 to 39 mEq/l the threshold for sweat chloride electrolytes.
Comments [show]
None has been submitted yet.
No. Sentence Comment
59 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported.
X
ABCC7 p.Thr338Ile 19318035:59:1661
status: NEW57 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported.
X
ABCC7 p.Thr338Ile 19318035:57:1661
status: NEW[hide] A haplotype framework for cystic fibrosis mutation... J Mol Diagn. 2006 Feb;8(1):119-27. Elahi E, Khodadad A, Kupershmidt I, Ghasemi F, Alinasab B, Naghizadeh R, Eason RG, Amini M, Esmaili M, Esmaeili Dooki MR, Sanati MH, Davis RW, Ronaghi M, Thorstenson YR
A haplotype framework for cystic fibrosis mutations in Iran.
J Mol Diagn. 2006 Feb;8(1):119-27., [PMID:16436643]
Abstract [show]
This is the first comprehensive profile of cystic fibrosis transmembrane conductance regulator (CFTR) mutations and their corresponding haplotypes in the Iranian population. All of the 27 CFTR exons of 60 unrelated Iranian CF patients were sequenced to identify disease-causing mutations. Eleven core haplotypes of CFTR were identified by genotyping six high-frequency simple nucleotide polymorphisms. The carrier frequency of 2.5 in 100 (1 in 40) was estimated from the frequency of heterozygous patients and suggests that contrary to popular belief, cystic fibrosis may be a common, under-diagnosed disease in Iran. A heterogeneous mutation spectrum was observed at the CFTR locus in 60 cystic fibrosis (CF) patients from Iran. Twenty putative disease-causing mutations were identified on 64 (53%) of the 120 chromosomes. The five most common Iranian mutations together represented 37% of the expected mutated alleles. The most frequent mutation, DeltaF508 (p.F508del), represented only 16% of the expected mutated alleles. The next most frequent mutations were c.1677del2 (p.515fs) at 7.5%, c.4041C>G (p.N1303K) at 5.6%, c.2183AA>G (p.684fs) at 5%, and c.3661A>T (p.K1177X) at 2.5%. Three of the five most frequent Iranian mutations are not included in a commonly used panel of CF mutations, underscoring the importance of identifying geographic-specific mutations in this population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
94 The mutation p.G85E has been shown to reduce gene activity by altering the tertiary structure of the CFTR channel;31 p.R334W leads to loss of conductivity of the large conductance channel of CFTR;32 p.T338I is a mutation in the sixth transmembrane segment of the MSD1 domain; p.L467F and p.I506T are mutations in the first nucleotide binding domain (NBD1); and p.N1303K is a mutation in the second nucleotide binding domain (NBD2) of the CFTR protein.
X
ABCC7 p.Thr338Ile 16436643:94:201
status: NEW95 Both domains are conserved in the ATP-binding cassette transporters.33 In addition, mutations p.D110H, p.R334W, p.T338I, p.L467F, and p.P1013L altered predicted exon splicing enhancer motifs in the CFTR gene, suggesting that they may have a deleterious effect on splicing.
X
ABCC7 p.Thr338Ile 16436643:95:114
status: NEW111 of Patients Total alleles* Associated haplotype Global distributionHom Het Exon 1 c.134TϾC M1T 1 1 Rare Exon 3 c.386GϾA G85E 1 1 Global Exon 4 c.460GϾC D110H 1 1 H2 Europe Exon 7 c.1132CϾT R334W 1 1 H2 Global Exon 7 c.1145CϾT T338I 1 1 Europe Intron 9 c.1525-1GϾA Mis-splicing 1 1 H8 Pakistan Exon 10 c.1529CϾG S466X 1 2 H4 Germany Exon 10 c.1531CϾT L467F 1 1 Rare Exon 10 c.1649TϾC I506T 1 2 H8 Lebanon Exon 10 c.1652del3† ⌬F508 6 7 19 H5 Global Exon 10 c.1677delTA 515fs 4 1 9 H1 Europe Exon 11 c.1756GϾT G542X 1 1 H5 Global Exon 12 c.1821CϾA Y563X 2 2 Europe Exon 13 c.2183AAϾG 684fs 3 6 H3 Europe Exon 17a c.3170CϾT P1013L 1 1 Turkey Exon 19 c.3616CϾT R1162X 2 2 H2 Germany Exon 19 c.3661AϾT K1177X 1 1 3 H2 Bahrain Intron 20 c.4005ϩ1GϾA Mis-splicing 1 2 H2 Europe Exon 21 c.4041CϾG N1303K 3 1 7 H5 Global Exon 23 c.4363CϾT Q1412X 1 1 Rare *A total of 64 (53%) of the 120 expected alleles were observed.
X
ABCC7 p.Thr338Ile 16436643:111:256
status: NEW[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]
Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.
Comments [show]
None has been submitted yet.
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS.
X
ABCC7 p.Thr338Ile 16049310:51:1836
status: NEW150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide.
X
ABCC7 p.Thr338Ile 16049310:150:4668
status: NEWX
ABCC7 p.Thr338Ile 16049310:150:4713
status: NEW[hide] CFTR Cl- channel function in native human colon co... Gastroenterology. 2004 Oct;127(4):1085-95. Hirtz S, Gonska T, Seydewitz HH, Thomas J, Greiner P, Kuehr J, Brandis M, Eichler I, Rocha H, Lopes AI, Barreto C, Ramalho A, Amaral MD, Kunzelmann K, Mall M
CFTR Cl- channel function in native human colon correlates with the genotype and phenotype in cystic fibrosis.
Gastroenterology. 2004 Oct;127(4):1085-95., [PMID:15480987]
Abstract [show]
BACKGROUND & AIMS: Cystic fibrosis (CF) is caused by over 1000 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and presents with a widely variable phenotype. Genotype-phenotype studies identified CFTR mutations that were associated with pancreatic sufficiency (PS). Residual Cl- channel function was shown for selected PS mutations in heterologous cells. However, the functional consequences of most CFTR mutations in native epithelia are not well established. METHODS: To elucidate the relationships between epithelial CFTR function, CFTR genotype, and patient phenotype, we measured cyclic adenosine monophosphate (cAMP)-mediated Cl- secretion in rectal biopsy specimens from 45 CF patients who had at least 1 non-DeltaF508 mutation carrying a wide spectrum of CFTR mutations. We compared CFTR genotypes and clinical manifestations of CF patients who expressed residual CFTR-mediated Cl- secretion with patients in whom Cl- secretion was absent. RESULTS: Residual anion secretion was detected in 40% of CF patients, and was associated with later disease onset (P < 0.0001), higher frequency of PS (P < 0.0001), and less severe lung disease (P < 0.05). Clinical outcomes correlated with the magnitude of residual CFTR activity, which was in the range of approximately 12%-54% of controls. CONCLUSIONS: Specific CFTR mutations confer residual CFTR function to rectal epithelia, which is related closely to a mild disease phenotype. Quantification of rectal CFTR-mediated Cl- secretion may be a sensitive test to predict the prognosis of CF disease and identify CF patients who would benefit from therapeutic strategies that would increase residual CFTR activity.
Comments [show]
None has been submitted yet.
No. Sentence Comment
78 Relationship Between the CFTR Genotype and Cl- Channel Function in Native Rectal Epithelia CFTR genotype Number of individuals Sweat Cl-concentration (mmol/L)a cAMP-mediated response Carbachol-induced plateau response or maximal lumen-negative response Isc-cAMP (A/cm2) Cl- secretion (% of control) Isc-carbachol (A/cm2) Cl- secretion (% of control) Cl- secretion absent R1162X/Q552X 1 71 17.1 0 0.7 0 W1282X/3121-2AϾG 1 112 1.9 0 0.6 0 1898 ϩ 1G Ͼ T/1609delCA 2b 114, 118 25.4, 13.4 0, 0 0, 0.7 0, 0 ⌬F508/Q39X 2b 127, 129 2.6, 4.4 0, 0 1.7, 3.7 0, 0 ⌬F508/G542X 1 102 29.0 0 6.6 0 ⌬F508/R553X 3 112, 102, 109 13.1, 4.5, 23.8 0, 0, 0 1.5, 4.4, 1.0 0, 0, 0 ⌬F508/E585X 1 115 1.4 0 1.1 0 ⌬F508/Q637X 1 100 2.9 0 1.2 0 ⌬F508/Y1092X 1 119 0.0 0 -0.3 0 ⌬F508/120del23c 1 72 20.1 0 3.3 0 ⌬F508/182delT 1 116 10.8 0 5.2 0 ⌬F508/3905insT 2 88, 96 8.4, 5.6 0, 0 2.3, -1.1 0, 1 ⌬F508/V520F 1 68 1.2 0 1.7 0 ⌬F508/A561E 3 113, 146, 100 17.0, 17.0, 16.0 0, 0, 0 2.1, 1.5, 3.7 0, 0, 0 ⌬F508/R1066C 1 138 0.0 0 0.0 0 ⌬F508/N1303K 3 100, 117, 94 1.7, 4.1, 1.5 0, 0, 0 -0.6, 2.2, 0.8 0, 0, 0 A561E/A561E 2 101, 116 6.6, 2.0 0, 0 7.3, 3.3 0, 0 Residual Cl- secretiond G542X/I148N 1 75 -50.1 54 -22.2 12 1898 ϩ 3A Ͼ G/1898 ϩ 3A Ͼ G 1 82 -36.8 39 -12.9 7 ⌬F508/3272-26A Ͼ G 1 116 -17.8 19 -27.2 14 ⌬F508/S108F 1 118 -15.8 17 -12.3 7 ⌬F508/R117H 1 90 -35.9 38 -207.7 109 ⌬F508/Y161Cc 1 44 -35.1 37 -45.9 25 ⌬F508/P205S 1 80 -23.3 25 -10.4 5 ⌬F508/V232D 1 120 -16.9 18 -26.9 14 ⌬F508/R334W 1 92 -22.1 23 -21.1 11 ⌬F508/R334W 1 101 -24.5 26 -37.4 20 ⌬F508/T338I 1 73 -44.4 47 -79.4 42 ⌬F508/G576A 1 40 -16.9 18 -115.5 61 ⌬F508/I1234V 1 113 -13.6 15 -8.6 5 G576A/G85E 1 95 -26.1 28 -61.6 32 F1052V/M1137R 1 47 -36.7 39 -146.6 77 M1101K/M1101K 1 94 -11.1 12 -4.8 3 S1159F/S1159F 1 67 -47.9 51 -38.7 21 N1303K/R334W 1 91 -30.3 32 -47.7 25 NOTE. CFTR Cl- channel function was determined in rectal epithelia from Cl- secretory responses induced by IBMX/forskolin (Isc-cAMP) and after co-activation with carbachol (Isc-carbachol).
X
ABCC7 p.Thr338Ile 15480987:78:1753
status: NEW101 Functional Classification and Protein Location of CFTR Mutations Mutation type Severe mutations (protein location) Mild mutations (protein location) Missense V520F, A561E (NBD1) G85E (MSD1, TM1) R1066C (MSD2, CL4) S108F, R117H (MSD1, EL1) N1303K (NBD2) I148N, Y161Ca (MSD1, CL1) P205S (MSD1, TM3) V232D (MSD1, TM4) R334W, T338I (MSD1, TM6) G576A (NBD1) I1234V (NBD2) F1052V, M1101K (MSD2, CL4) M1137R (MSD2, TM12) S1159F (pre-NBD2) Splice 1898 ϩ 1G Ͼ T (R domain) 1898 ϩ 3A Ͼ G (R domain) 3121-2A Ͼ G (MSD2, TM9) 3272-26A Ͼ G (MSD2, TM10) Single amino acid deletion ⌬F508 (NBD1) Nonsense Q39X (N-terminus) G542X, Q552X, R553X, E585X (NBD1) Q637X (R domain) Y1092X (MSD2, CL4) R1162X (pre-NBD2) W1282X (NBD2) Frameshift 120del23a 182delT (N-terminus) 1609delCA (NBD1) 3905insT (NBD2) NOTE. Severe mutation, Cl- secretion absent; mild mutation, residual cAMP-mediated Cl- secretion.
X
ABCC7 p.Thr338Ile 15480987:101:322
status: NEW125 According to our functional data, 3121-2AϾG, 1898ϩ1GϾT, and V520F constitute severe mutations, whereas 1898ϩ3AϾG, I148N, Y161C, V232D, T338I, I1234V, and S1159F confer residual CFTR Cl- channel function (Table 1).
X
ABCC7 p.Thr338Ile 15480987:125:165
status: NEW[hide] Cystic fibrosis presenting as metabolic alkalosis ... J Cyst Fibros. 2004 Jun;3(2):135-6. Salvatore D, Tomaiuolo R, Abate R, Vanacore B, Manieri S, Mirauda MP, Scavone A, Schiavo MV, Castaldo G, Salvatore F
Cystic fibrosis presenting as metabolic alkalosis in a boy with the rare D579G mutation.
J Cyst Fibros. 2004 Jun;3(2):135-6., [PMID:15463898]
Abstract [show]
We report on a 10-month-old boy with hypotonic dehydration and metabolic alkalosis. Sweat test was borderline and genetic analysis was negative for common mutations. Analysis of the whole coding regions of the CFTR gene revealed the rare mutation D579G in homozygosity.
Comments [show]
None has been submitted yet.
No. Sentence Comment
17 Indeed, there are several reports about a mild CF phenotype of isolated hypotonic dehydration, associated with specific CFTR mutations, such as T338I, D110E and D110H [6-8].
X
ABCC7 p.Thr338Ile 15463898:17:144
status: NEW[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]
Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
108 g D44G, 300delA, W57X, 405+1G>A, D110H, E116K, 541del4, 542del7, L137R, 621+2T>G, I175V, H199R, H199Y, C225X, V232D, Q290X, E292X, G314V, T338I, 1221delCT, W401X, Q452P, I502T, 1716+2T>C, G544S, R560S, A561E, V562I, Y569D, 1898+3A>G, 1898+5G>A, G628R(G>A), 2143delT, G673X, R851X, Q890X, S977F, 3129del4, 3154delG, 3271+1G>A, G1061R, R1066L, R1070W, 3601-17T>C, S1196X, 3732delA, G1249R, 3898insC, 4374+1G>A, del25kb.
X
ABCC7 p.Thr338Ile 10923036:108:138
status: NEW171 CFTR Mutation Genotypes Identified Both in Cystic Fibrosis (CF) and in Congenital Bilateral Absence of the Vas Deferens (CBAVD) CF CBAVD F508del/5T 3 143 F508del/2789+5G>A 53 1 F508del/3272-26A>G 17 4 F508del/R117H* 10 39 F508del/R117C 2 2 F508del/L206W 12 4 F508del/R347H 10 5 F508del/R347L 1 1 F508del/D443Y 1 5 F508del/Y569C 1 1 F508del/P574H 3 1 F508del/G628R(G>A) 2 1 F508del/V920M 1 1 F508del/R1070W 2 3 F508del/D1152H 6 8 F508del/S1235R 3 1 F508del/T1246I 1 1 F508del/D1270N+R74W 2 3 F508delN1303I 1 1 3659delC/R347H 1 1 G542X/T338I 2 2 R347H/R1066H 1 1 *The only case with CF whose alleles at IVS8(T)n were reported had mutation R117H associated with a 5T allele.
X
ABCC7 p.Thr338Ile 10923036:171:534
status: NEW[hide] Rapid characterization of the variable length poly... Hum Mutat. 1997;10(2):108-15. Friedman KJ, Heim RA, Knowles MR, Silverman LM
Rapid characterization of the variable length polythymidine tract in the cystic fibrosis (CFTR) gene: association of the 5T allele with selected CFTR mutations and its incidence in atypical sinopulmonary disease.
Hum Mutat. 1997;10(2):108-15., [PMID:9259194]
Abstract [show]
The CFTR intron 8 variable length polythymidine tract modulates the cystic fibrosis (CF) phenotype associated with the mutation R117H. To explore whether other mutations reside on multiple intron 8 backgrounds with discernible impacts on phenotype, we developed an allele-specific PCR assay to characterize this locus. Our approach types samples rapidly without the use or radioisotopes. Polythymidine alleles were identified for mutations either associated with a wide range of clinical phenotypes (R117H, R347P, G85E, D1152H, R334W, 2789 + 5 G > A, 3849 + 10kb C > T), and/or located at hypermutable CpG loci (R117H, 3845 + 10kb C > T, R553X, R334W, S945L and R75Q). R117H was detected in cis with each of three alleles (5T, 7T, 9T) at the intron 8 locus. The novel R117H-9T association was detected in a 10-month African-American male with borderline-to-mildly elevated sweat chloride values (approximately 50-66 mEq/L). All other mutations studied were associated with 7T except 3849 + 10kb C > T, which was detected on both 7T and 9T backgrounds, but not 5T. Three individuals with a delta F508/3849 + 10kb C > T genotype were 9T,9T and had pancreatic sufficiency and normal sweat chloride values, whereas 15 others who carried 3849 + 10kb C > T on a 7T background had variable pancreatic function (sufficient, n = 12, insufficient, n = 3), and variable sweat chloride values (normal, n = 12, elevated, n = 3). Surprisingly, when not associated with known CFTR mutations, 5T was detected with elevated frequency among individuals with sinopulmonary disease of ill-defined etiology, but with some characteristics of variant CF. In summary, the 5T allele was not found in cis with CF-causing mutations besides R117H, but an elevated 5T allele frequency in variant CF patients suggests 5T may be associated with disease in some situations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
133 An additional report of isolated hypotonic dehydration in association with another CFTR mutation, T338I (Leoni et al., 1995), is further evidence that specific CFTR mutations may give rise to this phenotype.
X
ABCC7 p.Thr338Ile 9259194:133:98
status: NEW[hide] Search for mutations in pancreatic sufficient cyst... Hum Genet. 1995 Sep;96(3):312-8. Brancolini V, Cremonesi L, Belloni E, Pappalardo E, Bordoni R, Seia M, Russo S, Padoan R, Giunta A, Ferrari M
Search for mutations in pancreatic sufficient cystic fibrosis Italian patients: detection of 90% of molecular defects and identification of three novel mutations.
Hum Genet. 1995 Sep;96(3):312-8., [PMID:7544319]
Abstract [show]
A cohort of 31 cystic fibrosis patients showing pancreatic sufficiency and bearing an unidentified mutation on at least one chromosome was analyzed through denaturing gradient gel electrophoresis of the whole coding region of the cystic fibrosis transmembrane conductance regulator gene, including intron-exon boundaries. Three new and 19 previously described mutations were detected. The combination of these with known mutations detected by other methods, allowed the characterization of mutations on 56/62 (90.3%) chromosomes. Among those identified, 17 can be considered responsible for pancreatic sufficiency, since they were found in patients carrying a severe mutation on the other chromosome. Among these presumed mild mutations, eight were detected more than once, R352Q being the most frequent in this sample (4.83%). Intragenic microsatellite analysis revealed that the six chromosomes still bearing unidentified mutations are associated with five different haplotypes. This may indicate that these chromosomes bear different mutations, rarely occurring among cystic fibrosis patients, further underlying the molecular heterogeneity of the genetic defects present in patients having pancreatic sufficiency.
Comments [show]
None has been submitted yet.
No. Sentence Comment
42 The remaining 19 included R352Q (Cremonesi et al. 1992) (three chromosomes), G85E (Zielenski et al. 1991a), Dl152H (High- Fig. 1 A-C Direct sequencing of PCR products from three cystic fibrosis patients (CF) carrying the W57G (A), E193K (B) and D579G (C) mutations, in parallel with control samples (C) displaying normal sequences (N/N) smith et al., personal communication to the CF Genetic Analysis Consortium), R1066H (Ferec et al. 1992), T338I (Saba et al. 1993), 711 +5G--+A (Gasparini et al., personal communication to the CF Genetic Analysis Consortium), M1V (Cheadle et al. 1993), R334W (Gasparini et al. 1991) (two chromosomes each), 4382delA (Claustres et al. 1993), R1158X (Ronchetto et al. 1992), F1052V (Mercier et al. 1993), G1349D (Beaudet et al. 1991), 1898+3A-+G (Cremonesi et al. 1992), $549N (Cutting et al. 1990), 711+ 3A-->G (Petreska et al. 1994), R347P (Dean et al. 1990), 2789+5G--+A (Highsmith et al. 1990), R1066C (Fanen et al. 1992) and S1251N (K~ilin et al. 1992) (one chromosome each).
X
ABCC7 p.Thr338Ile 7544319:42:442
status: NEW70 (UN yet unidentified mutation) Patient Genotype after Genotype at the end number preliminary screening of the analysis UN/UN M1V/4382delA 1717-1G---~A/UN 1717-1G---~A/R1066H AF508/UN AF508/D579G UN/UN M1V/UN AF508/UN AF508/UN UN/UN T338I/R1158X UN/UN G85E/71 I+5G---~A UN/UN D1152H/UN AF508/UN AF508/UN AF508/UN AF508/3849+ 10kbC---~T UN/UN 711+3A---~G/UN AF508/UN AF508/F1052V UN/UN R352Q/W57G UN/UN 1898+3A----~G/UN AF508/UN AF508/711+5G--~A G542X/UN G542X/DI 152H AF508/UN AF508/E193K 1717-1G---~A/UN 1717-1G---~A/2789+5A---)G AF508/UN AF508/G1349D AF508/UN AF508/G85E AF508/UN AF508/R347P AF508/UN AF508/R352Q AF508/UN AF508/R352Q AF508/UN AF508/S549N G542X/UN G542X/R1066H AF508/UN AF508/T338I AF508/UN AF508/R334W AF508/UN AF508/R334W AF508/UN AF508/S1251N AF508/UN AF508/R1066C AF508/UN AF508/D579G results) while the remaining three haplotypes had been found in association with other rare mutations, which were excluded by DGGE analysis in these patients (Table 3).
X
ABCC7 p.Thr338Ile 7544319:70:232
status: NEWX
ABCC7 p.Thr338Ile 7544319:70:693
status: NEW85 In total, among the mutations detected in our PS patients, 17 (D579G, E193K, F1052V, 711+5G---~A, G1349D, G85E, R347R R352Q, $549N, 2789+5A---~G, D1152H, R1066H, R334W, T338I, 3849+10kbC---~T, S1251N, R1066C) have been detected in compound heterozygosity with a mutation already classified as severe (AF508, 1717-1G--~A, G542X) and thus can be considered as presumably mild.
X
ABCC7 p.Thr338Ile 7544319:85:169
status: NEW86 Of these mutations, seven (G85E, EI93K, 711+5G--qA, R347P, R334W, R352Q, T338|) are located in the first transmembrane (I TM) domain, five (2789+ 5A---~G, RI066H, F1052V, D1152H, R1066C) in the second transmembrane (II TM) domain, four in the nucleo- R334W R347P R352Q T338I E193K 711+.E G85E 1 2 3 4 D579G G->A I S 549N 5 6a 6b 7 8 9 10 11 12 13 3849+11 !11 !
X
ABCC7 p.Thr338Ile 7544319:86:269
status: NEW91 Conversely, other presumably mild mutations such as R352Q (three chromosomes), and G85E, Dl152H, 711+5G--~A, R1066H, T338I, R334W, D579G (two chromosomes each), are more frequently detected in the PS cohort, accounting in total for 27.4% of chromosomes.
X
ABCC7 p.Thr338Ile 7544319:91:117
status: NEW93 Screening for only eight presumed mild mutations (R352Q, R1066H, G85E, Dl152H, 711+5G---~A, T338I, R334W and D579G) in addition to the predominant four severe mutations (AF508, G542X, 1717-1G-+A and N1303K), would have allowed the identification of 64.5% of the molecular defects in our patients having PS.
X
ABCC7 p.Thr338Ile 7544319:93:92
status: NEW[hide] Two novel mutations in the transmembrane domains o... Hum Mol Genet. 1993 Oct;2(10):1739-40. Saba L, Leoni GB, Meloni A, Faa V, Cao A, Rosatelli MC
Two novel mutations in the transmembrane domains of the CFTR gene in subjects of Sardinian descent.
Hum Mol Genet. 1993 Oct;2(10):1739-40., [PMID:7505693]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
4 In molecular screening for CF defects in Sardinians, carried out by DGGE analysis of exons 4 - 7 - 1 0 - 1 1 - 14a-15- 17b-20-21, we identified two novel mutations: a C - T transversionat nt 1145 (T338I) and a C-A transversion at nt 2867 (S912X).
X
ABCC7 p.Thr338Ile 7505693:4:197
status: NEW10 The T338I mutation was found in four unrelated CF patients, of whom two had on the other chromosome the AF508 mutation and two an unknown mutation.
X
ABCC7 p.Thr338Ile 7505693:10:4
status: NEW11 The analysis of two extragenic markers (XV-2c and KM 19) revealed that all four T338I alleles carried the same haplotype B (KM19/PstI = 2; XV2c/TaqI = 1) (7).
X
ABCC7 p.Thr338Ile 7505693:11:80
status: NEW12 All patients with the T338I mutation were pancreatic sufficient (PS).
X
ABCC7 p.Thr338Ile 7505693:12:22
status: NEW14 In the two patients with the T338I/AF508 compound heterozygosity, the disease manifested at 6 months of age with hyponatremia, hypochloremia and metabolic alkalosis, and at 2 years of age with failure to thrive and poor weight gain respectively.
X
ABCC7 p.Thr338Ile 7505693:14:29
status: NEW15 The two patients compound heterozygotes for T338I/unknown mutation are adults suffering only from recurrent bronchopulmonary infections.
X
ABCC7 p.Thr338Ile 7505693:15:44
status: NEW19 Likewise, in the T338I mutation the encoded amino acid switched from apolar to polar (Thr--De), presumably producing an alteration of the pore of the channel formed by the transmembrane segment.
X
ABCC7 p.Thr338Ile 7505693:19:17
status: NEW[hide] A 96-well formatted method for exon and exon/intro... Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5. Lucarelli M, Narzi L, Piergentili R, Ferraguti G, Grandoni F, Quattrucci S, Strom R
A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene.
Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5., [PMID:16635477]
Abstract [show]
Full genotypic characterization of subjects affected by cystic fibrosis (CF) is essential for the definition of the genotype-phenotype correlation as well as for the enhancement of the diagnostic and prognostic value of the genetic investigation. High-sensitivity diagnostic methods, capable of full scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, are needed to enhance the significance of these genetic assays. A method for extensive sequencing of the CFTR gene was optimized. This method was applied to subjects clinically positive for CF and to controls from the general population of central Italy as well as to a single subject heterozygous for a mild mutation and with an uncertain diagnosis. Some points that are crucial for the optimization of the method emerged: a 96-well format, primer project and purification, and amplicon purification. The optimized method displayed a high degree of diagnostic sensitivity; we identified a subset of 13 CFTR mutations that greatly enhanced the diagnostic sensitivity of common methods of mutational analysis. A novel G1244R disease causing mutation, leading to a CF phenotype with pancreatic sufficiency but early onset of pulmonary involvement, was detected in the subject with an uncertain diagnosis. Some discrepancies between our results and previously published CFTR sequence were found.
Comments [show]
None has been submitted yet.
No. Sentence Comment
139 In this work, we found a limited subset of 13 mutations (not included in the PCR/OLA/SCS assay) in 7 CFTR exons, significantly improving the sensitivity of standard assays: D110H, R117C, and H139R (exon 4); R334L, T338I, and A349V (exon 7); S549R(A->C) (exon 11); Y849X (exon 14a); L997F (exon 17a); L1065P, R1066C, and L1077P (exon 17b); and G1244E (exon 20).
X
ABCC7 p.Thr338Ile 16635477:139:214
status: NEW[hide] The genetic background of osteoporosis in cystic f... J Cyst Fibros. 2006 Dec;5(4):229-35. Epub 2006 May 18. Castellani C, Malerba G, Sangalli A, Delmarco A, Petrelli E, Rossini M, Assael BM, Mottes M
The genetic background of osteoporosis in cystic fibrosis: association analysis with polymorphic markers in four candidate genes.
J Cyst Fibros. 2006 Dec;5(4):229-35. Epub 2006 May 18., [PMID:16713399]
Abstract [show]
BACKGROUND: Reduced Bone Mass Density (BMD) is frequent in Cystic Fibrosis (CF). Potentially, other genes than the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene may contribute to the bone phenotype variability in CF patients. METHODS: Four candidate genes likely associated with BMD variability were studied: the vitamin D receptor (VDR) gene, the estrogen receptor alpha (ESR1), the calcitonin receptor (CALCR) and the type I alpha 1 collagen (COL1A1) gene. A complete bone and CF evaluation was obtained for 82 subjects (39 m, 43 f): 15 had normal BMD (group 1), 46 were osteopenic (group 2), and 21 were osteoporotic (group 3). RESULTS: No statistical difference was found among the three groups for age, sex, pancreatic status, and vertebral fractures, nor for any of the biochemical markers. Weight, Body Mass Index (BMI), and FEV1, scored significantly worse in the two groups with the lowest T score. The CFTR mutations R1162X and F508del were more frequent in patients with lower BMD (p=0.044 and p=0.071). There was no significant difference in the distribution of the five marker genotypes among the 3 groups defined according to the unadjusted or adjusted (BMI and FEV1) BMD T score. No significant correlation was found between the VDR, CALCR, or COL1A1 gene polymorphisms and reduced BMD values. The individual ESR1 PvuII-XbaI haplotype C-A is associated to elevated u-calcium levels whereas the haplotype T-A is associated to lower values (p=0.00251). CONCLUSIONS: There was no evidence that the genes under study, with the possible exception of ESR1 gene variants, may modulate bone phenotype in CF.
Comments [show]
None has been submitted yet.
No. Sentence Comment
74 CFTR analysis Patients selected for the study had been characterized previously for CFTR mutations with a reverse dot blot (RDB) Table 1 Anthropometric and CF-associated variables in normal, osteopenic and osteoporotic patients Group 1 normal bone density Group 2 osteopenia Group 3 osteoporosis Statistical evaluation Numerosity 15/82 46/82 21/82 - Mean age (years) 27.73T4.19 26.71T5.93 28.1T9.51 NS Males/females 9/6 19/27 11/10 NS CFTR genotype F508del/UK: 3 UK/ UK: 3 F508del/ F508del: 2 F508del/ G542X: 2 F508del/ R553X: 2 1717-1G> AvW1282X: 1 F508del/ N1303K: 1 G542X/UK: 1 F508del/F508del: 6 UK/UK: 5 F508del/ UK: 3 2183AA>G/UK: 3 2789+5G> A /UK: 3 F508del/N1303K: 3 F508del / R1162X: 3 F508del/2183AA>G: 2 N1303K/ N1303K: 2 R1162X/R1162X: 2 R1162X/ 2183AA>G: 2 2183AA>G/G542X: 1 F508del/ 1898+3A>G: 1 F508del/2789+5G> A: 1 F508del/711+5G>A: 1 F508del/ Q353X: 1 I507del/R1162X: 1 Q552X/ UK: 1 N1303K/G542X: 1 R1162X/3849+ 10KbC>T: 1 R1162X/711+5G>A: 1 T338I/ UK: 1 R553X/UK: 1 F508del/F508del: 4 F508del/ UK: 3 F508del/N1303K: 2 UK/ UK: 2 2789+5G>A/2789+5G> A: 1 F508del/1898+3A>G: 1 F508del/ 2183AA>G: 1 F508del/3849+10KbC> T: 1 F508del/G542X: 1 F508del/ R1066H: 1 F508del/R1162X: 1 Q552X/: 1 R352Q/: 1 R553X/UK: 1 Weight (kg) 61.7T5.89 56.5T8.25 48.9T9.40 p <0.0001 BMI 22.6T1.3 20.3T2.7 18T2.9 p <0.0001 PS/PI 3/12 10/36 7/14 NS FEV1% predicted 52.33T16.73 49.82T21.44 37.1T21.07 p =0.0205 NS = not significant.
X
ABCC7 p.Thr338Ile 16713399:74:960
status: NEW[hide] PGD for cystic fibrosis patients and couples at ri... Reprod Biomed Online. 2013 May;26(5):420-30. doi: 10.1016/j.rbmo.2013.01.006. Epub 2013 Jan 29. Rechitsky S, Verlinsky O, Kuliev A
PGD for cystic fibrosis patients and couples at risk of an additional genetic disorder combined with 24-chromosome aneuploidy testing.
Reprod Biomed Online. 2013 May;26(5):420-30. doi: 10.1016/j.rbmo.2013.01.006. Epub 2013 Jan 29., [PMID:23523379]
Abstract [show]
Preimplantation genetic diagnosis (PGD) for inherited disorders is presently applied for more than 300 different conditions. The most frequent PGD indication is cystic fibrosis (CF), the largest series of which is reviewed here, totalling 404 PGD cycles. This involved testing for 52 different CFTR mutations with almost half of the cases (195/404 cycles) performed for DeltaF508 mutation, one-quarter (103/404 cycles) for six other frequent mutations and only a few for the remaining 45 CFTR mutations. There were 44 PGD cycles performed for 25 CF-affected homozygous or double-heterozygous CF patients (18 male and seven female partners), which involved testing simultaneously for three mutations, resulting in birth of 13 healthy CF-free children and no misdiagnosis. PGD was also performed for six couples at a combined risk of producing offspring with CF and another genetic disorder. Concomitant testing for CFTR and other mutations resulted in birth of six healthy children, free of both CF and another genetic disorder in all but one cycle. A total of 96 PGD cycles for CF were performed with simultaneous aneuploidy testing, including microarray-based 24-chromosome analysis, as a comprehensive PGD for two or more conditions in the same biopsy material.
Comments [show]
None has been submitted yet.
No. Sentence Comment
42 [1075C>A; 1079C>A] p.[Gln359Lys; Thr360Lys] Exon 8 1 1 1 4 1 1 R297Q c.890G>A p.Arg297Gln Exon 8 1 1 1 2 0 0 R347P c.1040G>C p.Arg347Pro Exon 8 3 5 2 4 1 1 T338I c.1013C>T p.Thr338Ile Exon 8 1 1 1 2 1 1 DF508 c.1521_1523delCTT p.Phe508del Exon 11 130 195 172 345 88 (4) 92 DI507 c.1519_1521delATC p.Ile507del Exon 11 1 5 5 11 2 1 Q493R c.1478A>G p.Gln493Arg Exon 11 5 5 2 2 2 2 1717-1G-A c.1585-1G>A - Intron 11 6 10 9 18 6 8 G542X c.1624G>T p.Gly542X Exon 12 14 17 15 34 10 10 G551S c.1651G>A p.Gly551Ser Exon 12 1 1 1 2 1 1 G551D c.1652G>A p.Gly551Asp Exon 12 12 22 19 33 7 8 I556V c.1666A>G p.Ile556Val Exon 12 1 2 2 4 1 1 R553X c.1657C>T p.Arg553X Exon 12 3 4 2 4 0 0 R560T c.1679G>C p.Arg560Thr Exon 12 1 1 1 2 1 2 1898+1G-A c.1766 &#b1; 1G>A - Intron 13 1 1 1 2 1 1 2184delA c.2052delA p.Lys684AsnfsX38 Exon 14 1 1 0 0 0 0 G622D c.1865G>A p.Gly622Asp Exon 14 1 1 1 3 0 0 N703S c.2108A>G p.Asn703Ser Exon 14 1 2 2 3 2 2 S737F c.2210C>T p.Ser737Phe Exon 14 1 1 0 0 0 0 2622+1G-A c.2490 &#b1; 1G>A - Intron 14 1 5 5 13 1 1 2752-26A-G c.2620-26A>G - Intron 15 1 2 2 4 0 0 2789+5G-A c.2657 &#b1; 5G>A - Intron 16 3 5 4 8 0 0 3120G-A c.2988G>A - Exon 18 2 2 1 2 1 0 3067-72del c.3067_3072del p.Ile1023_Val1024del Exon 19 1 1 1 1 0 0 I1027T c.3080T>C p.Ile1027Thr Exon 19 1 1 1 1 0 0 L997F c.2991G>C p.Leu997Phe Exon 19 1 2 2 4 1 (1) 0 M1028R c.3083T>G p.Met1028Arg Exon 19 1 1 1 2 1 2 F1052V c.3154T>G p.Phe1052Val Exon 20 1 1 0 0 0 0 Y1092X c.3276C>A p.Tyr1092X Exon 20 1 2 1 2 1 1 A1136T c.3406G>A p.Ala1136Thr Exon 21 1 2 1 2 1 0 D1152H c.3454G>C p.Asp1152His Exon 21 3 7 7 15 1 1 3659 del C c.3528delC p.Lys1177SerfsX15 Exon 22 2 4 3 7 3 3 R1162X c.3484C>T p.Arg1162X Exon 22 1 3 2 5 2 2 S1235R c.3705T>G p.Ser1235Arg Exon 22 2 3 3 5 2 1 3849+10kbC>T c.3717 &#b1; 12191C>T - Intron 22 2 4 4 5 0 0 W1282X c.3846G>A p.Trp1282X Exon 23 15 20 20 42 11 11 N1303K c.3909C>G p.Asn1303Lys Exon 24 9 12 11 24 4 5 Q1352H c.4056G>C p.Gln1352His Exon 25 1 1 1 1 1 1 Total 265 404 345 685 172 (6a ) 175 Values are n unless otherwise stated.
X
ABCC7 p.Thr338Ile 23523379:42:156
status: NEWX
ABCC7 p.Thr338Ile 23523379:42:174
status: NEW[hide] Cystic fibrosis transmembrane conductance regulato... PLoS One. 2013 Apr 17;8(4):e61176. doi: 10.1371/journal.pone.0061176. Print 2013. Schippa S, Iebba V, Santangelo F, Gagliardi A, De Biase RV, Stamato A, Bertasi S, Lucarelli M, Conte MP, Quattrucci S
Cystic fibrosis transmembrane conductance regulator (CFTR) allelic variants relate to shifts in faecal microbiota of cystic fibrosis patients.
PLoS One. 2013 Apr 17;8(4):e61176. doi: 10.1371/journal.pone.0061176. Print 2013., [PMID:23613805]
Abstract [show]
INTRODUCTION: In this study we investigated the effects of the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene variants on the composition of faecal microbiota, in patients affected by Cystic Fibrosis (CF). CFTR mutations (F508del is the most common) lead to a decreased secretion of chloride/water, and to mucus sticky secretions, in pancreas, respiratory and gastrointestinal tracts. Intestinal manifestations are underestimated in CF, leading to ileum meconium at birth, or small bowel bacterial overgrowth in adult age. METHODS: Thirty-six CF patients, fasting and under no-antibiotic treatment, were CFTR genotyped on both alleles. Faecal samples were subjected to molecular microbial profiling through Temporal Temperature Gradient Electrophoresis and species-specific PCR. Ecological parameters and multivariate algorithms were employed to find out if CFTR variants could be related to the microbiota structure. RESULTS: Patients were classified by two different criteria: 1) presence/absence of F508del mutation; 2) disease severity in heterozygous and homozygous F508del patients. We found that homozygous-F508del and severe CF patients exhibited an enhanced dysbiotic faecal microbiota composition, even within the CF cohort itself, with higher biodiversity and evenness. We also found, by species-specific PCR, that potentially harmful species (Escherichia coli and Eubacterium biforme) were abundant in homozygous-F508del and severe CF patients, while beneficial species (Faecalibacterium prausnitzii, Bifidobacterium spp., and Eubacterium limosum) were reduced. CONCLUSIONS: This is the first report that establishes a link among CFTR variants and shifts in faecal microbiota, opening the way to studies that perceive CF as a 'systemic disease', linking the lung and the gut in a joined axis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
37 Patient Sex Age (years) CFTR allele, = CFTR allele, R Criterion I(a) Criterion II (1 = severe, 0 = mild)(b) Pancreatic status(d) FEV1% BMI 1 M 17 F508del M1V 2 (1) 1 65 17.91 2 F 23 F508del Y569D 2 (1) 0 97 18.66 3 (s1)(c) F 20 P1013L F508del 2 (0) 0 87 18.67 4 M 11 F508del L997F (without R117L) 2 0 0 110 21.33 5 (s1)(c) M 11 P1013L F508del 2 (0) 0 100 23.14 6 M 8 R553X F508del 2 1 0 80 15.87 7 M 3 F508del unknown 2 (0) 0 nd nd 8 F 33 F508del F508del 1 1 1 73 18.61 9 M 10 F508del L1077P 2 1 0 94 19.79 10 M 9 F508del G542X 2 1 1 100 16.00 11 F 9 4167delCTAAGCC L1065P 3 nd 1 76 14.57 12 F 14 R117C (without (TG)12T5) F508del 2 0 0 94 18.44 13 F 11 F508del 991del5 2 1 1 109 17.80 14 M 42 (TG)12T5 F508del 2 0 0 106 23.78 15 (s2)(c) M 9 F508del F508del 1 1 1 82 15.45 16 M 10 F508del R347P 2 (0) 0 89 15.91 17 (s2)(c) F 6 F508del F508del 1 1 1 110 15.20 18 (s3)(c) M 39 2789+5G.A N1303K 3 nd 0 105 19.33 19 (s3)(c) F 41 2789+5G.A N1303K 3 nd 0 80 19.47 20 F 26 N1303K W1282X 3 nd 1 90 19.57 21 M 7 CFTRdele2,3 (21 kb) N1303K 3 nd 1 107 12.85 22 F 9 F508del L997F (without R117L) 2 0 0 113 25.21 23 M 7 P5L W1282X 3 nd 0 89 22.31 24 M 9 2789+5G.A F508del 2 (1) 1 97 15.60 25 F 2 F508del F508del 1 1 1 nd nd 26 F 32 N1303K N1303K 3 nd 1 107 21.22 27 M 14 L1065R T338I 3 nd 0 116 21.50 28 M 12 711+3A.G S549R(A.C) 3 nd 0 97 20.00 29 M 13 unknown R117H (without (TG)12T5) 3 nd 0 104 19.36 30 M 14 F508del G542X 2 1 1 84 21.87 31 F 13 F508del F508del 1 1 1 85 18.00 32 F 41 2789+5G.A N1303K 3 nd 1 84 21.08 33 F 21 L1065P F508del 2 (0) 0 62 18.29 34 F 50 D1152H F508del 2 (0) 0 63 23.74 35 M 29 F508del 2790-2A.G 2 (1) 0 92 24.46 36 F 45 unknown W1282X 3 nd 0 69 23.42 a (Hm = 1; Ht = 2; N = 3).
X
ABCC7 p.Thr338Ile 23613805:37:1264
status: NEW135 Some of them are characteristic of certain ethnic groups, such as W1282X in the original Jews of Central Europe, 3659delC in Sweden and, to come to the Italian reality, T338I in Sardinia, 2183AA.G and R1162X in Northern Italy [1,5].
X
ABCC7 p.Thr338Ile 23613805:135:169
status: NEW[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]
Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.
Comments [show]
None has been submitted yet.
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1.
X
ABCC7 p.Thr338Ile 23891399:44:87
status: NEW64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations.
X
ABCC7 p.Thr338Ile 23891399:64:1542
status: NEW74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2.
X
ABCC7 p.Thr338Ile 23891399:74:379
status: NEWX
ABCC7 p.Thr338Ile 23891399:74:872
status: NEW82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org).
X
ABCC7 p.Thr338Ile 23891399:82:2781
status: NEW87 Similarly, the baseline chloride transport and ivacaftor response were higher for mutant CFTR forms with mild defects in channel conductance (30-84% of normal; D110H-, R347H, and R352Q-CFTR) [17-19], compared with those with severe defects in CFTR channel conductance (undetectable R334W- and T338I-CFTR) [9,20].
X
ABCC7 p.Thr338Ile 23891399:87:293
status: NEW92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3.
X
ABCC7 p.Thr338Ile 23891399:92:1026
status: NEWX
ABCC7 p.Thr338Ile 23891399:92:1217
status: NEW[hide] Mechanisms of CFTR functional variants that impair... PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul. LaRusch J, Jung J, General IJ, Lewis MD, Park HW, Brand RE, Gelrud A, Anderson MA, Banks PA, Conwell D, Lawrence C, Romagnuolo J, Baillie J, Alkaade S, Cote G, Gardner TB, Amann ST, Slivka A, Sandhu B, Aloe A, Kienholz ML, Yadav D, Barmada MM, Bahar I, Lee MG, Whitcomb DC
Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.
PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul., [PMID:25033378]
Abstract [show]
CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.
Comments [show]
None has been submitted yet.
No. Sentence Comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results.
X
ABCC7 p.Thr338Ile 25033378:269:512
status: NEW[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]
Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
346 First, almost all CF-causing mutations involving residues located in the MSD transmembrane segments are encountered in MSD1 and generally concern positions lining the pore (G85E, E92K, D110H, P205S, R334W, I336K, T338I, S341P, R347H/R347P, and R352Q) (Fig. 7a).
X
ABCC7 p.Thr338Ile 25287046:346:213
status: NEW[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]
Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17].
X
ABCC7 p.Thr338Ile 25304080:59:374
status: NEW79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%.
X
ABCC7 p.Thr338Ile 25304080:79:338
status: NEW[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]
Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.
Comments [show]
None has been submitted yet.
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve.
X
ABCC7 p.Thr338Ile 25674778:15:1811
status: NEW[hide] Mutation analysis of PRSS1, SPINK1 and CFTR gene i... Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287. Sisman G, Tugcu M, Ayla K, Sebati O, Senturk H
Mutation analysis of PRSS1, SPINK1 and CFTR gene in patients with alcoholic and idiopathic chronic pancreatitis: A single center study.
Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287., [PMID:25835118]
Abstract [show]
BACKGROUND/AIMS: A relation between some genetic mutations and chronic pancreatitis (CP) has been reported. However, the relation of genetic mutation to alcoholic CP (ACP) and idiopathic CP (ICP) still remains controversial. In this study, we investigated the prevalence of protease serine 1 (PRSS1), serine protease inhibitor, Kazal type 1 (SPINK1) SPINK1 and cystic fibrosis transmembrane conductance regulator (CFTR) mutations in ACP and ICP patients in Turkey. MATERIALS AND METHODS: Forty-one patients with ACP and 38 patients with ICP were enrolled, and 35 healthy individuals served as controls. The PRSS1 and SPINK1 mutations were investigated by the polymerase chain reaction (PCR)-restriction fragment-length polymorphism (RFLP) technique. The CFTR mutation was examined with PCR direct sequencing. RESULTS: The mean ages of the ACP, ICP and healthy control groups were 53.2, 40.4 and 46.3 years, respectively. A CFTR F508 mutation was detected as a heterozygote in one (2.4%) patient with ACP. In the ICP and control populations, PRSS1, SPINK1 and CFTR mutations were not detected. CONCLUSION: This study shows that PRSS1, SPINK1 and CFTR mutations do not play a role in ACP and ICP patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
45 DNA samples were multiplied by multiplex PCR with a CF 22Mut and CF 14Mut+Tn strip assay kit which has 36 common mutations of the CFTR gene (DF508, DI507, F508C, I502T, 1706del17, 1677del TA, G542X, 1717-1G>A, R553X, Q552X, G551D, S549R(A>C), N1303K, 4016insT, R1162X, R1158X, W1282X, G1244E, 2789+5G>A, 2183AA>G, 711+5G>A, 711+1G>T, G85E, 3849+10kbC>T, 621+1G>T, R117H, D1152H, L1065P, R1066H, L1077P, 4382delA, 1259insA, 852del22, R347P, T338I, S912X and Allele5T-7T-9T).
X
ABCC7 p.Thr338Ile 25835118:45:440
status: NEW[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]
Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.
Comments [show]
None has been submitted yet.
No. Sentence Comment
370 991del5 c.859_863delAACTT CF-PI nd p.Asn287LysfsX19 L320V c.958T>G uncertain: CF-PI and/or CF-PS and/or CFTR-RD nd p.Leu320Val R334W c.1000C>T CF-PI,CF-PS CF-causing p.Arg334Trp R334L c.1001G>T CF-PS nd p.Arg334Leu T338I c.1013C>T CF-PS,CFTR-RD,CBAVD CF-causing p.Thr338Ile R347P c.1040G>C CF-PI,CF-PS CF-causing p.Arg347Pro R347H c.1040G>A CF-PS CF-causing p.Arg347His [M348K;S912X] c.
X
ABCC7 p.Thr338Ile 25910067:370:215
status: NEWX
ABCC7 p.Thr338Ile 25910067:370:264
status: NEW424 The three actually discrepant alleles were L997F (p.Leu997Phe), without the R117L (p.Arg117Leu) in cis, L206W (p.Leu206Trp) and T338I (p.Thr338Ile).
X
ABCC7 p.Thr338Ile 25910067:424:128
status: NEWX
ABCC7 p.Thr338Ile 25910067:424:137
status: NEW428 | M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 A G E N O T Y P I C - O R I E N T E D V I E W O F C F T R G E N E T I C S The T338I (p.Thr338Ile) is classified in the CFTR2 study as CF-causing.
X
ABCC7 p.Thr338Ile 25910067:428:123
status: NEWX
ABCC7 p.Thr338Ile 25910067:428:132
status: NEW[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]
Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.
Comments [show]
None has been submitted yet.
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance.
X
ABCC7 p.Thr338Ile 26014425:79:881
status: NEWX
ABCC7 p.Thr338Ile 26014425:79:899
status: NEW[hide] Murine and human CFTR exhibit different sensitivit... Am J Physiol Lung Cell Mol Physiol. 2015 Oct 1;309(7):L687-99. doi: 10.1152/ajplung.00181.2015. Epub 2015 Jul 24. Cui G, McCarty NA
Murine and human CFTR exhibit different sensitivities to CFTR potentiators.
Am J Physiol Lung Cell Mol Physiol. 2015 Oct 1;309(7):L687-99. doi: 10.1152/ajplung.00181.2015. Epub 2015 Jul 24., [PMID:26209275]
Abstract [show]
Development of therapeutic molecules with clinical efficacy as modulators of defective CFTR includes efforts to identify potentiators that can overcome or repair the gating defect in mutant CFTR channels. This has taken a great leap forward with the identification of the potentiator VX-770, now available to patients as "Kalydeco." Other small molecules with different chemical structure also are capable of potentiating the activity of either wild-type or mutant CFTR, suggesting that there are features of the protein that may be targeted to achieve stimulation of channel activity by structurally diverse compounds. However, neither the mechanisms by which these compounds potentiate mutant CFTR nor the site(s) where these compounds bind have been identified. This knowledge gap partly reflects the lack of appropriate experimental models to provide clues toward the identification of binding sites. Here, we have compared the channel behavior and response to novel and known potentiators of human CFTR (hCFTR) and murine (mCFTR) expressed in Xenopus oocytes. Both hCFTR and mCFTR were blocked by GlyH-101 from the extracellular side, but mCFTR activity was increased with GlyH-101 applied directly to the cytoplasmic side. Similarly, glibenclamide only exhibited a blocking effect on hCFTR but both blocked and potentiated mCFTR in excised membrane patches and in intact oocytes. The clinically used CFTR potentiator VX-770 transiently increased hCFTR by approximately 13% but potentiated mCFTR significantly more strongly. Our results suggest that mCFTR pharmacological sensitivities differ from hCFTR, which will provide a useful tool for identifying the binding sites and mechanism for these potentiators.
Comments [show]
None has been submitted yet.
No. Sentence Comment
306 However, recent data indicating that VX-770 potentiates channels bearing multiple disease-causing mutations, spread across CFTR, and that VX-770 potentiates one mutant but not another one in the same domain (for example, VX-770 potentiated TM mutants T338I- and R347H- but not S341P- and E92K-CFTR and potentiated cytoplasmic loop mutants E193K- and K1060T- but not R1066M- and L1065P-CFTR) do not support this conclusion (30, 38).
X
ABCC7 p.Thr338Ile 26209275:306:251
status: NEW[hide] Cystic Fibrosis Transmembrane Conductance Regulato... J Biol Chem. 2015 Sep 18;290(38):22891-906. doi: 10.1074/jbc.M115.665125. Epub 2015 Jul 30. Corradi V, Vergani P, Tieleman DP
Cystic Fibrosis Transmembrane Conductance Regulator (CFTR): CLOSED AND OPEN STATE CHANNEL MODELS.
J Biol Chem. 2015 Sep 18;290(38):22891-906. doi: 10.1074/jbc.M115.665125. Epub 2015 Jul 30., [PMID:26229102]
Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is a member of the ATP-binding cassette (ABC) transporter superfamily. CFTR controls the flow of anions through the apical membrane of epithelia. Dysfunctional CFTR causes the common lethal genetic disease cystic fibrosis. Transitions between open and closed states of CFTR are regulated by ATP binding and hydrolysis on the cytosolic nucleotide binding domains, which are coupled with the transmembrane (TM) domains forming the pathway for anion permeation. Lack of structural data hampers a global understanding of CFTR and thus the development of "rational" approaches directly targeting defective CFTR. In this work, we explored possible conformational states of the CFTR gating cycle by means of homology modeling. As templates, we used structures of homologous ABC transporters, namely TM(287-288), ABC-B10, McjD, and Sav1866. In the light of published experimental results, structural analysis of the transmembrane cavity suggests that the TM(287-288)-based CFTR model could correspond to a commonly occupied closed state, whereas the McjD-based model could represent an open state. The models capture the important role played by Phe-337 as a filter/gating residue and provide structural information on the conformational transition from closed to open channel.
Comments [show]
None has been submitted yet.
No. Sentence Comment
139 In addition, I336K and T338I are known among CFTR disease-causing mutations (82, 83).
X
ABCC7 p.Thr338Ile 26229102:139:23
status: NEW
admin on 2016-08-19 15:16:22