ABCMdb

ABCC7 p.Met348Lys

ClinVar:	c.1043T>A , p.Met348Lys ? , not provided
CF databases:	c.1042A>G , p.Met348Val (CFTR1) ? , This mutation was identified in a CFTR gene mutation screening of 60 Patients with idiopathic chronic pancreatitis recruited from the region of North Rhine Westfalia in Germany. The entire coding region of the CFTR gene was sequenced. c.1043T>A , p.Met348Lys (CFTR1) ? , The mutation on the other chromosome is still unknown. This mutation was found on one chromosome while screening 56 Italian CF chromosomes. c.1043T>C , p.Met348Thr (CFTR1) ? , The mutation was detected by DGGE analysis and characterized by direct sequencing. We have seen it only twice, in over 1800 control chromosomes from Italian population.
Predicted by SNAP2:	A: D (71%), C: D (66%), D: D (85%), E: D (85%), F: D (63%), G: D (80%), H: D (80%), I: N (53%), K: D (85%), L: N (66%), N: D (71%), P: D (91%), Q: D (63%), R: D (85%), S: D (66%), T: D (75%), V: N (53%), W: D (80%), Y: D (75%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: N, G: D, H: D, I: N, K: D, L: N, N: D, P: D, Q: D, R: D, S: D, T: D, V: N, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Two buffer PAGE system-based SSCP/HD analysis: a g... Eur J Hum Genet. 1999 Jul;7(5):590-8. Liechti-Gallati S, Schneider V, Neeser D, Kraemer R
Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease.
Eur J Hum Genet. 1999 Jul;7(5):590-8., [PMID:10439967]

Abstract [show]
The large size of many disease genes and the multiplicity of mutations complicate the design of an adequate assay for the identification of disease-causing variants. One of the most successful methods for mutation detection is the single strand conformation polymorphism (SSCP) technique. By varying temperature, gel composition, ionic strength and additives, we optimised the sensitivity of SSCP for all 27 exons of the CFTR gene. Using simultaneously SSCP and heteroduplex (HD) analysis, a total of 80 known CF mutations (28 missense, 22 frameshift, 17 nonsense, 13 splicesite) and 20 polymorphisms was analysed resulting in a detection rate of 97.5% including the 24 most common mutations worldwide. The ability of this technique to detect mutations independent of their nature, frequency, and population specificity was confirmed by the identification of five novel mutations (420del9, 1199delG, R560S, A613T, T1299I) in Swiss CF patients, as well as by the detection of 41 different mutations in 198 patients experimentally analysed. We present a three-stage screening strategy allowing analysis of seven exons within 5 hours and analysis of the entire coding region within 1 week, including sequence analysis of the variants. Additionally, our protocol represents a general model for point mutation analysis in other genetic disorders and has already been successfully established for OTC deficiency, collagene deficiency, X-linked myotubular myopathy (XLMTM), Duchenne and Becker muscular dystrophy (DMD, BMD), Wilson disease (WD), Neurofibromatosis I and II, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, and defects in mitochondrial DNA. No other protocol published so far presents standard SSCP/HD conditions for mutation screening in different disease genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 The technique developed demonstrates excellent single-strand separation and non-radioactive visualisation on polyacrylamide gels, and is time-saving and directly Table 2 Known mutations identified in 198 CF patients analysed investigatively Exon (E) Number of CFTR mutations intron (I) chromosomes Patient`s nationality Highest prevalence ∆F508 E10 212 miscellaneous 3905insT E20 025 Swiss Swiss, Amish, Arcadian R553X E11 020 Swiss, German German 1717-1G->A I10 017 Swiss, Italian Italian N1303K E21 011 Swiss, French, Italian Italian W1282X E20 014 Swiss, Italian, Israelit Jewish-Askhenazi G542X E11 009 Swiss, Spanish, Italian Spanish 2347delG E13 008 Swiss R1162X E19 006 Swiss, Italian, Russian Italian 3849+10kbC->T I19 005 German, French R347P E07 004 Swiss T5 I08 004 Swiss R334W E07 003 Swiss Q525X E10 003 Swiss 3732delA E19 003 Swiss S1235R E19 003 Italian, Turkish G85E E03 002 Italian, Greek I148T E04 002 Austrian, Turkish French-Canadian 621+1G->T I04 002 French French-Canadian 1078delT E07 002 Swiss E585X E12 002 Italian 2176insC E13 002 Swiss, Italian 2789+5G->A I14b 002 Italian Spanish D1152H E18 002 Swiss, French 4016insT E21 002 Turkish Q39X E02 001 Swiss 394delTT E03 001 Swiss Nordic, Finnish R117H E04 001 Swiss A120T E04 001 Swiss G126D E04 001 Swiss 711+5G->A I05 001 Russian M348K E07 001 Italian L568F E12 001 Italian 2183AA->G E13 001 Italian Italian K710X E13 001 Swiss S945L E15 001 French 3272-26A.->G I17a 001 Swiss M1101K E17b 001 Swiss Huttite 3601-17C->T I18 001 Swiss R1158X E19 001 Swiss 4005+1G-A I20 001 Italian applicable to early diagnostic testing, carrier detection and prenatal diagnosis. Login to comment

[hide] CFTR gene mutations and male infertility. Andrologia. 2000 Mar;32(2):71-83. Stuhrmann M, Dork T
CFTR gene mutations and male infertility.
Andrologia. 2000 Mar;32(2):71-83., [PMID:10755189]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are a relatively frequent cause of male infertility. Depending on their molecular consequences, CFTR mutations may either result in typical cystic fibrosis (CF), one of the most common autosomal recessive disorders, which is characterized by chronic lung disease, pancreatic exocrine insufficiency, an increase in the concentration of sweat electrolytes and male infertility, due to obstructive azoospermia, or in atypical (often monosymptomatic) forms of CF such as congenital absence of the vas deferens (bi- or unilateral), bilateral ejaculatory duct obstruction or bilateral obstructions within the epididymides. All males with idiopathic obstructive azoospermia bear an increased risk for CF offspring. Couples requesting microsurgical epididymal sperm aspiration and in vitro fertilization, e.g. intracytoplasmic sperm injection, should be offered genetic counselling and molecular genetic analysis of the CFTR gene, if male infertility due to obstructive azoospermia is the underlying cause.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
239 Holsclaw DS, Perlmutter AD, Jockin H, Shwachman H (1971)Deltas CC, Boteva K, Georgiou A, Papageorgiou E, Georgiou Genital abnormalities in male patients with cystic fibrosis.C (1996) Description of a symptomless cystic fibrosis J Urol 106:568-574.L346P/M348K compound heterozygous Cypriot individ- Jarvi K, Zielenski J, Wilschanski M, Durie P, Buckspan M,ual. Login to comment

[hide] Prevalence of CFTR mutations in hypertrypsinaemia ... Clin Genet. 2001 Jan;59(1):42-7. Scotet V, De Braekeleer M, Audrezet MP, Lode L, Verlingue C, Quere I, Mercier B, Dugueperoux I, Codet JP, Moineau MP, Parent P, Ferec C
Prevalence of CFTR mutations in hypertrypsinaemia detected through neonatal screening for cystic fibrosis.
Clin Genet. 2001 Jan;59(1):42-7., [PMID:11168024]

Abstract [show]
Nowadays, most of the neonatal screening programs for cystic fibrosis (CF) combine the assay of immunoreactive trypsinogen (IRT) with the analysis of the most common mutations of the CFTR gene. The efficiency of this strategy is now well established, but the identification of heterozygotes among neonates with increased IRT is perceived as a drawback. We proposed to assess the heterozygosity frequency among the children with hypertrypsinaemia detected through the CF screening program implemented in Brittany (France) 10 years ago, to describe the CFTR mutations detected in them and to determine the frequency of the IVS8-5T variant. The molecular analysis relies, in our protocol, on the systematic analysis of three exons of the gene (7-10-11). A total of 160,019 babies were screened for CF in western Brittany between 1992 and 1998. Of the 1964 newborns with increased IRT (1.2%), 60 were CF and 213 were carriers. Heterozygosity frequency was 12.8%), i.e. 3 times greater than in the general population (3.9%; p < 10(-6)), Variability of mutations detected in carriers was greater than in CF children (21 mutations versus 10) and a high proportion of mild mutations or variants (A349V, R297Q, R347H, V317A, G544S, R553G, etc) was observed in carriers. The allelic frequency of the 5T (5.6%) was not significantly increased in this cohort. This study is consistent with previous ones in finding a significantly higher rate of heterozygotes than expected among neonates with hypertrypsinaemia. The strategy of screening used here allows to highlight the variability of mutations detected in heterozygotes and to show that severe mutations, as well as mild mutations, have been observed in neonates with hypertrypsinaemia. If there is no doubt that neonatal hypertrypsinaemia is associated with an elevated frequency of carriers, the underlying mechanisms remain obscure.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 We noted, among heterozygous children, a high proportion of mild mutations (R297Q, R347H, M348K, A349V, G544S) or for which the pathogenicity is yet impossible to determine (V317A, V322A, R553G). Login to comment

[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

[hide] Segregation analysis in cystic fibrosis at-risk fa... Prenat Diagn. 2004 Dec 15;24(12):981-3. D'Apice MR, Gambardella S, Russo S, Lucidi V, Nardone AM, Pietropolli A, Novelli G
Segregation analysis in cystic fibrosis at-risk family demonstrates that the M348K CFTR mutation is a rare innocuous polymorphism.
Prenat Diagn. 2004 Dec 15;24(12):981-3., 2004-12-15 [PMID:15614862]

Abstract [show]
OBJECTIVE: Cystic fibrosis (CF; OMIM# 219700) is caused by mutation in the CF transmembrane regulator (CFTR) gene. We investigate whether the (paternal) M348K mutation is a benign polymorphism or a disease-causing mutation in a patient clinically affected with CF, with the second (maternal) CFTR allele identified as N1303K. METHODS: The patient and his father were studied for the presence of mutations in the CFTR gene using the DHPLC system to analyze all CFTR exons. Amplicons showing an abnormal elution profile were sequenced. RESULTS: The CFTR gene from the healthy father has two mutations, M348K and G1244E. The affected son inherited only the G1244E paternal mutation from his father, and hence the two paternal mutations are trans and do not occur in the same CFTR gene. The patient's genotype is G1244E(paternal)/N1303K(maternal). This information was used to study an ongoing pregnancy of the couple, where the fetus inherited the same genotype as the affected proband and therefore is affected. CONCLUSION: M348K in the CFTR gene is not a mutation causing CF, but a rare polymorphism. These data are important for genetic counseling and prenatal diagnosis and illustrate the importance of full sequence data when studying rare mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 DOI: 10.1002/pd.1058 Segregation analysis in cystic fibrosis at-risk family demonstrates that the M348K CFTR mutation is a rare innocuous polymorphism Maria Rosaria D`Apice1 , Stefano Gambardella1 , Silvia Russo1 , Vincenzina Lucidi2 , Anna Maria Nardone3 , Adalgisa Pietropolli4 and Giuseppe Novelli1,3 * 1 Department of Biopathology and Imaging Diagnostic, Tor Vergata University, Rome, Italy 2 Bambino Ges`u Children`s Hospital, Rome, Italy 3 Department of Medical Laboratory, Section of Medical Genetics, Tor Vergata University, Rome, Italy 4 Department of Surgery, Section of Obstetrics and Gynaecology, Tor Vergata University, Rome, Italy Objective Cystic fibrosis (CF; OMIM# 219700) is caused by mutation in the CF transmembrane regulator (CFTR) gene. Login to comment
3 We investigate whether the (paternal) M348K mutation is a benign polymorphism or a disease-causing mutation in a patient clinically affected with CF, with the second (maternal) CFTR allele identified as N1303K. Login to comment
6 Results The CFTR gene from the healthy father has two mutations, M348K and G1244E. Login to comment
10 Conclusion M348K in the CFTR gene is not a mutation causing CF, but a rare polymorphism. Login to comment
26 This demonstrates that the M348K variation is not a causative CF mutation. Login to comment
28 Received: 30 April 2004 Revised: 7 October 2004 Accepted: 10 October 2004 M. R. D`APICE ET AL. 1 1 1 1 3 4 1 2 1 1 4 1 1 2 1 1 4 1 1 2 1 1 2 1I:1 II:1 II:2 I:2 G1244E M348K G1244E N1303K N1303K G1244E N1303K IVS8GT IVS17bCA IVS17bTA IVS8GT IVS17bCA IVS17bTA IVS8GT IVS17bCA IVS17bTA IVS8GT IVS17bCA IVS17bTA Figure 1-The reported family pedigree. Login to comment
30 Their asymptomatic father (I:1) shows the G1244E CF mutation and the M348K polymorphism; their mother (I:2) shows the N1303K mutation. Login to comment
36 Abnormal DHPLC patterns were observed for exons 7 and 20 (Figure 1), caused by nucleotide changes (T to A at position 1175, missense mutation M348K; G to A in position 3863, missense mutation G1244E). Login to comment
40 The M348K mutation was first reported by Audrezet et al. (1993) in a severely affected Italian patient with pancreatic insufficiency and lung involvement. Login to comment
41 However, in another report, Deltas et al. (1996) described a Cypriot individual without symptoms of CF who is compound heterozygous for L346P/M348K. Login to comment
44 Since the father has no symptoms of CF, and has the genotype M348/G1244E, M348K must be a rare polymorphism in the CFTR gene that is not disease-associated, at least in association with G1244E. Login to comment
45 If a patient with CF is shown to have the mutation M348K, as in this case, the gene should be scanned for other mutations. Login to comment
55 The M348K amino acid change is a rare polymorphism rather than a CF-causing mutation, as previously reported. Login to comment

[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]

Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 This test involved nine subjects from the infertile group, revealing the occurrence of the following rare mutations: E217G, T1054A, W356X, D443Y and 3667insTC in males and L997F and R297Q in females and 29 subjects from the control, in which we found: A1009T, D110Y, E826K, G1069R, G1130A, G194V, I556V, L320F, M348K, M82V, P1290T, R117C, R352W, R74W, S42F, S660T, S911R, S912L, T1086A, T582S, V920L and Y89C. Login to comment

[hide] Molecular evaluation of CFTR sequence variants in ... Int J Androl. 2005 Oct;28(5):284-90. Larriba S, Bonache S, Sarquella J, Ramos MD, Gimenez J, Bassas L, Casals T
Molecular evaluation of CFTR sequence variants in male infertility of testicular origin.
Int J Androl. 2005 Oct;28(5):284-90., [PMID:16128988]

Abstract [show]
Although the involvement of the CFTR gene has been well established in congenital agenesia of vas deferens, its role in non-obstructive (NOb) infertility is still a matter of debate. In order to definitively define the involvement of the CFTR gene in spermatogenic impairment and a potential synergistic contribution to known genetic and clinical factors, genetic variants in the entire coding sequence and the immediately flanking regions of the CFTR gene, along with a thorough clinical evaluation, were analysed in 83 NOb infertile patients and 87 clinically well-defined fertile individuals as controls. The results of our study showed no statistical difference between CFTR carrier frequency in the infertile and fertile population. Specifically, the IVS8-6(5T) allele carrier frequency was similar in NOb infertile patients when compared with fertile men, but it is noteworthy that, when fertile men were classified into having optimal and suboptimal fertility, no 5T allele was found among the 35 men with optimal fertility parameters. In conclusion, extensive CFTR analysis in infertile individuals and fertile population as adequate control definitively excludes the involvement of the CFTR gene variants in sperm production and stresses the importance of carefully identifying those individuals with obstructive defects, in whom CFTR screening will be beneficial.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 CFTR analysis We identified 14 different, potential disease-causing CFTR sequence variants, 11 of them are translated into missense amino acid changes (p.R75Q, p.P111L, p.R117H, p.I148T, p.R334W, p.M348K, p.G576A, p.R668C, p.D1270N, p.S1235R and p.S1426F), one deletion (p.F508del) and two alleles affecting exon splicing [IVS8-6(5T), c.1716G>A] in 30 of 83 infertile patients (Table 1) giving a frequency of 36.1%. Login to comment
72 Description of genetic abnormalities and other risk factors of infertile and fertile CFTR carrier individuals No. Phenotype CFTR genotype Associated factors Testicular histologya b c Infertile individuals 1 NOb (SO) p.R75Q No Severe hypospermatogenesis 2 NOb (SO) p.R75Q No nd 3 NOb (A) p.P111L AZFb,c del Sertoli cell only 4 NOb (A) p.R117H AZFc del Severe hypospermatogenesis 5 NOb (SO) p.I148T No Severe hypospermatogenesis 6 NOb (A) p.R334W No Primary spermatocyte arrest 7 NOb (SO) p.M348K UV grade III Primary spermatocyte arrest 8 NOb (A) p.F508del No Sertoli cell only 9 NOb (A) p.F508del No Primary spermatocyte arrest 10 NOb (A) p.G576A, p.R668C No Severe hypospermatogenesis, Leydig cell hyperplasia 11 NOb (SO) p.G576A, p.R668C No Primary spermatocyte arrest (unilateral) 12 NOb (SO) p.G576A, p.R668C No Severe hypospermatogenesis 13 NOb (A) p.R668C UC Sertoli cell-only (incomplete) 14 NOb (SO) p.D1270N No nd 15 NOb (SO) p.S1235R No Severe hypospermatogenesis 16 NOb (SO) p.S1426F* UC Sertoli cell only 17 NOb (A) (T)5-(TG)12 No Severe hypospermatogenesis, Sertoli cell only (80%) 18 NOb (A) (T)5-(TG)12 No Sertoli cell only 19 NOb (SO) (T)5-(TG)11 UV grade III Bilateral moderate hypospermatogenesis 20 NOb (SO) (T)5-(TG)11 UV grade II Severe hypospermatogenesis 21 NOb (A) (T)5-(TG)11 No nd 22 NOb (SO) c.1716 G>A Dysplasia SV Severe hypospermatogenesis, Sertoli cell only (95%) 23 NOb (A) c.1716 G>A No nd 24 NOb (A) c.1716 G>A No Primary spermatocyte arrest (bilateral) 25 NOb (SO) c.1716 G>A No Sertoli cell only (95%) 26 NOb (SO) c.1716 G>A No Severe hypospermatogenesis 27 NOb (SO) c.1716 G>A UV grade III Severe hypospermatogenesis 28 NOb (SO) c.1716 G>A No nd 29 NOb (SO) c.1716 G>A No nd 30 NOb (SO) c.1716 G>A AZFc del Severe hypospermatogenesis Fertile individuals 1 F1 p.R75Q No nd 2 F1 p.F508del No nd 3 F1 p.F508del No nd 4 F1 p.G576A, p.R668C/ c.1716 G>A No nd 5 F1 p.D836Y No nd 6 F1 p.S1235R/c.1716 G>A No nd 7 F1 c.1716 G>A No nd 8 F1 c.1716 G>A No nd 9 F1 c.1716 G>A No nd 10 F1 c.1716 G>A No nd 11 F1 c.1716 G>A No nd 12 F2 p.R75Q No nd the expected CF carrier frequency in the local population (Van der Ven et al., 1996; Larriba et al., 2001; Dohle et al., 2002) or with the general population (Jakubiczka et al., 1999; Pallares-Ruiz et al., 1999; Ravnik-Glavac et al., 2001) and not normospermic fertile individuals, the latter considered as adequate controls. Login to comment

[hide] Homozygous CFTR mutation M348K in a boy with respi... Eur J Pediatr. 2012 Jul;171(7):1039-46. doi: 10.1007/s00431-012-1672-1. Epub 2012 Jan 25. Hentschel J, Riesener G, Nelle H, Stuhrmann M, Schoner A, Sommerburg O, Fritzsching E, Mall MA, von Eggeling F, Mainz JG
Homozygous CFTR mutation M348K in a boy with respiratory symptoms and failure to thrive. Disease-causing mutation or benign alteration?
Eur J Pediatr. 2012 Jul;171(7):1039-46. doi: 10.1007/s00431-012-1672-1. Epub 2012 Jan 25., [PMID:22274833]

Abstract [show]
We report on a 6-month-old premature boy from consanguineous parents. He presented with respiratory distress, necrotizing enterocolitis and hyperbilirubinemia shortly after birth. Persisting respiratory symptoms and failure to thrive prompted cystic fibrosis diagnostics, which showed the lack of wild-type signal for the mutation R347P suggesting a homozygous deletion or an alteration different from the known mutation at this position. Sequencing of this region revealed the homozygous substitution 1175 T > A (HGVS: c.1043 T > A) in exon 7 resulting in the homozygous amino acid change M348K. This mutation has never been reported in homozygosity before. Computational analysis tools classified M348K as 'presumably disease causing.' In our patient, sweat testing and electrophysiological assessment of CFTR function in native rectal epithelium demonstrated normal Cl(-) secretion. Conclusion: We assume that the homozygous alteration M348K is a harmless variant rather than a CF-causing mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 ORIGINAL ARTICLE Homozygous CFTR mutation M348K in a boy with respiratory symptoms and failure to thrive. Login to comment
5 Sequencing of this region revealed the homozygous substitution 1175 T>A (HGVS: c.1043 T>A) in exon 7 resulting in the homozygous amino acid change M348K. Login to comment
7 Computational analysis tools classified M348K as 'presumably disease causing.` In our patient, sweat testing and electrophysiological assessment of CFTR function in native rectal epithelium demonstrated normal Cl- secretion. Login to comment
8 Conclusion: We assume that the homozygous alteration M348K is a harmless variant rather than a CF-causing mutation. Login to comment
11 M348K . Login to comment
16 We report on the first patient with homozygosity for the mutation M348K, with so far unknown clinical relevance. Login to comment
17 Until now, only three cases with heterozygote M348K mutation have been reported [3,5,6]. Login to comment
18 First detected in a severely affected patient carrying F508del on the other allele [3], M348K was classified as a disease-causing mutation. Login to comment
19 Likewise, M348K is listed as a 'disease-causing mutation` in the Human Genome Mutation Database [9] which is the basis for training of most of the prediction tools. Login to comment
22 In another publication, M348K was found together with the mutation L346P in a 48-year-old unaffected individual [6]. Login to comment
24 Therefore, the authors suggest that either L346P is dominant over M348K or that M348K is a J. Hentschel (*) :G. Riesener :H. Nelle :F. von Eggeling Institute of Human Genetics, Jena University Hospital, Kollegiengasse 10, 07743 Jena, Germany e-mail: julia.hentschel@mti.uni-jena.de J. Hentschel :J. Login to comment
28 The healthy father was found to be compound heterozygous for M348K and G1244E. Login to comment
30 Taken together, the clinical relevance of the M348K mutation remains unclear. Login to comment
62 PMut predictions are based on the use of neural networks, and the tool is trained using a Fig. 1 Original recordings of the effects of cAMP-dependent activation (IBMX/forskolin) and cholinergic activation (carbachol) on Vte and Rte in rectal tissues from a the patient (M348K/M348K) showing normal Cl- secretory responses (lumen-negative Vte responses), b a CF patient (1717- 1G→A/R764X) with no detectable Cl- secretion (lumen-positive Vte responses) and c a CF patient (F508del/R334W) expressing residual Cl- secretion, as evidenced by the attenuated lumen-negative Vte response and biphasic response to carbachol. Login to comment
72 The patient`s sample revealed a homozygous change T>A at the position 1175 (c.1043T>A) which results in amino acid replacement from methionine to lysine at codon 348 (M348K). Login to comment
74 M348K was not found in healthy controls and carbachol-induced Cl- secretion (Fig. 1b), whereas tissues from CF patients carrying at least one mutation with residual Cl- channel function (CFresidual) show attenuated cAMP-mediated Cl- secretory responses (previously published mean of CFresidual tissues: ΔIsc0-28.1±2.9 μA/cm2 [8]) followed by biphasic responses to carbachol (Fig. 1c). Login to comment
84 Codon 348 (ATG) was changed to AAG resulting in an amino acid change from methionine to lysine (M348K). Login to comment
85 Sequencing of parents and healthy elder brothers of the index patient revealed heterozygosity for M348K for all tested family members (Fig. 4). Login to comment
86 If one of the healthy brothers also had a homozygous M348K substitution, the alteration could have been easily classified as benign. Login to comment
87 M348K was not found in four sequenced control samples. Login to comment
90 Using the prediction tool PolyPhen2 [16], M348K was found to be 'probably damaging` (score 0.997). Login to comment
91 Also PMut [15] assessed the alteration M348K as 'pathological` with a score of 0.8245 (threshold for pathological alterations>0.5) and a confidence level of the prediction of 6 (00low, 90high confidence). Login to comment
96 3D structure of the CFTR protein illustrating the location of M6 (which harbours the M348K) within the MSD1 which forms the pore of the CFTR channel together with MSD2 further mutations and deletions, all 27 exons and flanking intronic regions of the CFTR gene were sequenced, and a MLPA analysis was performed, which revealed no further mutation in addition to the initially found M348K. Login to comment
97 Discussion This is the first report of a patient with a homozygous M348K CFTR mutation. Login to comment
101 Interestingly, this is inconsistent with previously evaluated prediction tools which classified the alteration M348K as 'presumably disease causing` or 'probably damaging`. Login to comment
106 Half of the detected mutations are associated with CF phenotype; for seven alterations (including M348K), the phenotype is not clear and investigations within the CFTR2 project are ongoing. Login to comment
112 Besides, tools were trained with published disease mutations and M348K mutation is listed as one. Login to comment
113 Taken together, our investigation suggests that the CFTR alteration M348K is a harmless variant rather than a CF-causing mutation. However, the question cannot finally be answered, whether the ongoing clinical problems like bronchial hyper reactivity and airway colonization with pathogens like MR S. aureus, H. influenzae and A. lwoffii are related to the changes in the CFTR gene or if they are due to premature birth. Login to comment
121 It could be speculated that a M348K mutation causes a decrease in CFTR function, but at the same time, a positive influence of modifiers results in residual function which can be measured via electrophysiology. Login to comment

[hide] Description of a symptomless cystic fibrosis L346P... Mol Cell Probes. 1996 Aug;10(4):315-8. Deltas CC, Boteva K, Georgiou A, Papageorgiou E, Georgiou C
Description of a symptomless cystic fibrosis L346P/M348K compound heterozygous Cypriot individual.
Mol Cell Probes. 1996 Aug;10(4):315-8., [PMID:8865181]

Abstract [show]
During the past few years we have been testing the hypothesis that Cyprus may have been spared many severe cystic fibrosis (CF) cases but not cystic fibrosis transmembrane conductance regulator (CFTR) mutations. We have been analysing by molecular methods patients with atypical mild phenotypes where CF enters the differential diagnosis. With this approach we identified a mutation, L346P, which in association with the severe mutation delta F508 or 1677delTA, confers a mild and atypical presentation. Recently, we identified another entirely symptomless 48-year-old individual, with genotype L346P/M348K. The fact that M348K was initially identified in a severely affected Italian patient strengthens the hypothesis that L346P, a putative mild mutation, is dominant over severe ones. One other explanation is that M348K is not a causative defect but a rare polymorphism. These findings have important implications for genetic counselling, especially when the counselling is sought by concerned couples for prenatal diagnostic purposes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Molecular and Cellular Probes (1996) 10, 315-318 Short Communication Description of a symptomless cystic fibrosis L346P/ M348K compound heterozygous Cypriot individual C. Constantinou Deltas,1 * Kalina Boteva,1 Andreas Georgiou,2 Elena Papageorgiou1 and Christina Georgiou3 1 The Cyprus Institute of Neurology and Genetics, 2 Nicosia General Hospital, and 3 Archbishop Makarios III Hospital, Nicosia, Cyprus (Received 12 January, Accepted 6 February 1996) During the past few years we have been testing the hypothesis that Cyprus may have been spared many severe cystic fibrosis (CF) cases but not cystic fibrosis transmembrane conductance regulator (CFTR) mutations. Login to comment
3 Recently, we identified another entirely symptomless 48-year-old individual, with genotype L346P/M348K. Login to comment
4 The fact that M348K was initially identified in a severely affected Italian patient strengthens the hypothesis that L346P, a putative mild mutation, is dominant over severe ones. Login to comment
5 One other explanation is that M348K is not a causative defect but a rare polymorphism. Login to comment
18 1677delTA and M348K. Login to comment
24 Both nonsense and missense mutations have been reportedthat substituted lysine for methionine (M348K). Login to comment
34 pothesis that suggests that severe mutations are recessive over mild mutations.8,10,13 In the three CypriotOur patient (III-7, see Fig. 1) had inherited the M348K mutation from his mother who belongs to a patients, the same L346P mutation, which is present in exon 7, in one of the transmembrane domains offamily of nine siblings. Login to comment
37 It is associated with three dif-dividual II-2, not only inherited the M348K mutation, most probably from her father, but was found to be ferent mutations, reportedly found in severely affected patients. Login to comment
40 However, M348K which is just oneto each of her two offspring. Login to comment
43 She is rather short, but her sister II-11 is also short and is only a carrier of one mild,8 whereas the most recent patient with genotype L346P/M348K has almost no symptomatology at themutation. Login to comment
52 However, onemajor findings other than failure to thrive, occasional electrolyte disturbances and some chest infections in other likely explanation for the symptomless status of the 48-year-old lady described in this report is thatone of the patients.8 So far we are not aware of additional patients from other populations carrying mutation M348K does not really affect the function L346P/M348K CF symptomless individual 317 293 255 38 118 17 NlaIII NlaIII1 428 Abolished by the M348K mutation L346P M348K [M348K/N] L346P/N M348K/N M348K/N M348K/N M348K/N N/N N/N 1 2 3 4 5 6 7 8 9 10 11 12 1 2 1 2 3 4 5 6 7 M348K/NM348K/N L346P/N N/N M348K/? Login to comment
54 M348K/L356P N/N I II III I-2 II-2 III-1 III-2 II-5 III-3 II-6 II-7 II-9 II-10 II-11 II-12 III-6 III-7 I-2 II-2 II-2 III-1 III-2 II-5 III-3 II-6 II-7 II-9 II-10 II-11 II-12 III-7 Fig. 1. Login to comment
56 The proband was individual III-7, and his maternal aunt II-2 was found to have inherited mutations M348K and L346P. Login to comment
59 In the presence of the mutation, the 428 bp DNA product is cleaved to fragments of 266 bp and 162 bp.8 M348K was tested by amplification of exon 7 and digestion with NIaIII. Login to comment

[hide] Tuning of CFTR chloride channel function by locati... Biophys J. 2012 Oct 17;103(8):1719-26. doi: 10.1016/j.bpj.2012.09.020. Epub 2012 Oct 16. El Hiani Y, Linsdell P
Tuning of CFTR chloride channel function by location of positive charges within the pore.
Biophys J. 2012 Oct 17;103(8):1719-26. doi: 10.1016/j.bpj.2012.09.020. Epub 2012 Oct 16., [PMID:23083715]

Abstract [show]
High unitary Cl(-) conductance in the cystic fibrosis transmembrane conductance regulator Cl(-) channel requires a functionally unique, positively charged lysine residue (K95) in the inner vestibule of the channel pore. Here we used a mutagenic approach to investigate the ability of other sites in the pore to host this important positive charge. The loss of conductance observed in the K95Q mutation was >50% rescued by substituting a lysine for each of five different pore-lining amino acids, suggesting that the exact location of the fixed positive charge is not crucial to support high conductance. Moving the positive charge also restored open-channel blocker interactions that are lost in K95Q. Introducing a second positive charge in addition to that at K95 did not increase conductance at any site, but did result in a striking increase in the strength of block by divalent Pt(NO(2))(4)(2-) ions. Based on the site dependence of these effects, we propose that although the exact location of the positive charge is not crucial for normal pore properties, transplanting this charge to other sites results in a diminution of its effectiveness that appears to depend on its location along the axis of the pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 After neutralization of this endogenous positive charge by the K95Q mutation, introduction of a positive charge at other sites (by mutagenesis to lysine) caused a significant increase in unitary conductance to between 51 5 1% (in K95Q/A349K; n &#bc; 10) and 77 5 1% (in K95Q/M348K; n &#bc; 12) of WT conductance (Fig. 2, A-C), suggesting that a positive charge located at other positions in the pore can effectively rescue the WT conductance phenotype. Login to comment
55 Additional mutations in a K95Q background to transplant the positive charge to pore-lining positions in TM1 (Q98K) or TM6 (I344K, V345K, M348K, and A349K) partially restored NPPB block (Fig. 3), although in no case was the block as strong as for the WT. Login to comment
56 The rank order of the apparent strength of NPPB block was WT > K95Q/V345K > K95Q/I344K > K95Q/Q98K ~ K95Q/ M348K ~ K95Q/A349K (Fig. 3 B). Login to comment
60 As shown in Fig. 4, block by Pt(NO2)4 2 was significantly strengthened in each of the mutants Q98K, I344K, V345K, M348K, and A349K, as well as in the previously unstudied S341K. Login to comment
61 At 0 mV membrane potential, the apparent Kd for Pt(NO2)4 2 block was in the rank order V345K (3.3 5 0.9 mM, n &#bc; 7) % I344K (4.5 5 0.7 mM, n &#bc; 6) < S341K (26.6 5 1.8 mM, n &#bc; 7) < M348K (80.9 5 7.2 mM, n &#bc; 5) % Q98K (95.4 5 11.0 mM, n &#bc; 6) % A349K (117.4 5 7.7 mM, FIGURE 2 Single-channel conductance is restored by moving the positive charge from K95. Login to comment
74 Blocker voltage dependence was also significantly changed in most mutants, with the effective blocker valence (zd) being significantly increased in M348K and significantly decreased in Q98K, V345K, and A349K (Fig. 4 F). Login to comment
90 However, although a single positive charge is necessary, the addition of a second positive charge to this region of the pore (as in the point mutants Q98K, I344K, V345K, M348K, and A349K) failed to increase conductance above WT levels (Fig. 2), as previously observed for S1141K (8). Login to comment
99 In fact, the addition of a second positive charge in Q98K, I344K, V345K, M348K, and A349K led to a small, but significant, decrease in conductance (Fig. 2 C). Login to comment
105 The weakening of blocker binding seen in K95Q is partially reversed by the second site mutations I344K and V345K, and to a lesser extent Q98K, M348K, and A349K. Login to comment
146 Again this appears to be a relatively nonsite-specific effect of positive charge, since all mutants studied (Q98K, S341K, I344K, V345K, M348K, and A349K) led to significant increase in apparent affinity of Pt(NO2)4 2 block (Fig. 4), as did S1141K (8). Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
270 The [M348K;S912X] (p. Login to comment
271 [Met348Lys; Ser912*]) complex allele was found in 2 patients (1 CF-PI and 1 CBAVD). Login to comment
370 991del5 c.859_863delAACTT CF-PI nd p.Asn287LysfsX19 L320V c.958T>G uncertain: CF-PI and/or CF-PS and/or CFTR-RD nd p.Leu320Val R334W c.1000C>T CF-PI,CF-PS CF-causing p.Arg334Trp R334L c.1001G>T CF-PS nd p.Arg334Leu T338I c.1013C>T CF-PS,CFTR-RD,CBAVD CF-causing p.Thr338Ile R347P c.1040G>C CF-PI,CF-PS CF-causing p.Arg347Pro R347H c.1040G>A CF-PS CF-causing p.Arg347His [M348K;S912X] c. Login to comment
371 [1043T>A;2735C>A] CF-PI M348K nd; S912X CF-causing p. Login to comment
372 [Met348Lys;Ser912*] [1249-8A>G;G576A;R668C] c. Login to comment

[hide] Timing of CFTR Pore Opening and Structure of Its T... Cell. 2015 Oct 22;163(3):724-33. doi: 10.1016/j.cell.2015.09.052. Epub 2015 Oct 22. Sorum B, Czege D, Csanady L
Timing of CFTR Pore Opening and Structure of Its Transition State.
Cell. 2015 Oct 22;163(3):724-33. doi: 10.1016/j.cell.2015.09.052. Epub 2015 Oct 22., [PMID:26496611]

Abstract [show]
In CFTR, the chloride ion channel mutated in cystic fibrosis (CF) patients, pore opening is coupled to ATP-binding-induced dimerization of two cytosolic nucleotide binding domains (NBDs) and closure to dimer disruption following ATP hydrolysis. CFTR opening rate, unusually slow because of its high-energy transition state, is further slowed by CF mutation DeltaF508. Here, we exploit equilibrium gating of hydrolysis-deficient CFTR mutant D1370N and apply rate-equilibrium free-energy relationship analysis to estimate relative timing of opening movements in distinct protein regions. We find clear directionality of motion along the longitudinal protein axis and identify an opening transition-state structure with the NBD dimer formed but the pore still closed. Thus, strain at the NBD/pore-domain interface, the DeltaF508 mutation locus, underlies the energetic barrier for opening. Our findings suggest a therapeutic opportunity to stabilize this transition-state structure pharmacologically in DeltaF508-CFTR to correct its opening defect, an essential step toward restoring CFTR function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Timing of Motion at Position 348 in the Pore Region (A) Inward single-channel currents of the cut-DR(D1370N) CFTR background construct (top trace) and of channels bearing mutations M348I, M348K, M348C, M348N, and M348A, respectively, in the same background. Currents were recorded at 80 mV, in symmetrical 140 mM Cl ; dashes on the left mark zero-current level. Login to comment
102 Interestingly, the M348K mutation only marginally affected gating (Figures 4A-4D) but increased the affinity for pore block by ATP, as reported by pronounced flickery block of single-channel currents in 10 mM ATP (Figure 4A), a bell-shaped ATP dose-dependence of macroscopic currents (Figure S1C, second blue bar), and a current overshoot upon ATP removal from macroscopic patches reflecting rapid unblock (Figure S2F). Login to comment
103 Of note, even for M348K, the macroscopic current relaxation time constant following ATP removal (i.e., tb in zero ATP; Figure S2F) remained comparable to steady-state tb: thus, even pronounced flickery block of M348K by 10 mM ATP does not delay pore closure, consistent with earlier demonstration that the gate, located on the extracellular side, can readily close while large organic anion blockers remain bound in the intracellular vestibule (Csana &#b4; dy and To &#a8; ro &#a8; csik, 2014). Login to comment