ABCMdb

ABCC7 p.Arg334Leu

ClinVar:	c.1000C>T , p.Arg334Trp D , Pathogenic c.1001G>T , p.Arg334Leu ? , not provided c.1001G>A , p.Arg334Gln ? , not provided
CF databases:	c.1000C>T , p.Arg334Trp D , CF-causing ; CFTR1: This mutation has been found in two Spanish CF chromosomes. One of the patients has the [delta]F508 mutation in the other chromosome and the other patient does not. We have not found this mutation on 30 normal chromosomes with the same haplotype, and in 88 CF chromosomes without the [delta]F508, and in 24 with the [delta]F508. The mutation destroys a MapI site and is easily identified by agarose gel electrophoresis after PCR with intron primers. c.1001G>A , p.Arg334Gln (CFTR1) ? , The above mutation was found by DGGE and direct sequencing in Caucasian patients. c.1001G>T , p.Arg334Leu (CFTR1) D , Missense mutation E334L was detected in a German CBAVD patient who is compound heterozygous for the R334L and I336K mutations.
Predicted by SNAP2:	A: D (91%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (91%), I: D (95%), K: D (85%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (91%), S: D (91%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: N, C: D, D: N, E: N, F: D, G: N, H: N, I: D, K: N, L: N, M: N, N: N, P: N, Q: N, S: N, T: N, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] An unstable transmembrane segment in the cystic fi... EMBO J. 1999 Nov 15;18(22):6290-8. Tector M, Hartl FU
An unstable transmembrane segment in the cystic fibrosis transmembrane conductance regulator.
EMBO J. 1999 Nov 15;18(22):6290-8., 1999-11-15 [PMID:10562541]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR), a chloride channel with 12 membrane-spanning sequences, undergoes inefficient maturation in the endoplasmic reticulum (ER). Potentially charged residues in transmembrane segments may contribute to this defect in biogenesis. We demonstrate that transmembrane segment 6 of CFTR, which contains three basic amino acids, is extremely unstable in the lipid bilayer upon membrane insertion in vitro and in vivo. However, two distinct mechanisms counteract this anchoring deficiency: (i) the ribosome and the ER translocon co-operate to prevent transmembrane segment 6 from passing through the membrane co- translationally; and (ii) cytosolic domains of the ion channel post-translationally maintain this segment of CFTR in a membrane-spanning topology. Although these mechanisms are essential for successful completion of CFTR biogenesis, inefficiencies in their function retard the maturation of the protein. It seems possible that some of the disease-causing mutations in CFTR may reduce the efficiency of proper membrane anchoring of the protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 (C) Translation and translocation into microsomes of constructs containing wild-type or doubly mutated, R334L and K335I, Tm6 were analysed by immunoprecipitation with anti-myc antibody (lanes 1, 2, 5 and 6) or a non-relevant control antibody (NRA) (lanes 3 and 7) from TX-100 extracts of the isolated microsomes. Login to comment
95 Arginine 334 was changed to leucine and lysine 335 to isoleucine, generating construct Tm5-6(RK-LI)-Inv (Figure 3A). Login to comment
203 These mutations enabled the production of proteins containing leucine in place of arginine 334 and isoleucine in place of lysine 335 in Tm6 of CFTR. Login to comment

[hide] Molecular determinants and role of an anion bindin... J Physiol. 2003 Jun 1;549(Pt 2):387-97. Epub 2003 Apr 4. Gong X, Linsdell P
Molecular determinants and role of an anion binding site in the external mouth of the CFTR chloride channel pore.
J Physiol. 2003 Jun 1;549(Pt 2):387-97. Epub 2003 Apr 4., 2003-06-01 [PMID:12679372]

Abstract [show]
Chloride permeation through the cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel is blocked by highly lyotropic permeant anions which bind tightly within the pore. Here we show that several different substitutions of a positively charged amino acid residue, arginine R334, in the putative outer mouth of the CFTR pore, greatly reduce the block caused by lyotropic Au(CN)2- ions applied to the intracellular side of the channel. Fixed positive charge at this site appears to play a role in Au(CN)2- binding, as judged by multiple substitutions of differently charged amino acid side chains and also by the pH dependence of block conferred by the R334H mutant. However, non-charge-dependent effects also appear to contribute to Au(CN)2- binding. Mutation of R334 also disrupts the apparent electrostatic interaction between intracellular Au(CN)2- ions and extracellular permeant anions, an interaction which normally acts to relieve channel block. All six mutations studied at R334 significantly weakened this interaction, suggesting that arginine possesses a unique ability to coordinate ion-ion interactions at this site in the pore. Our results suggest that lyotropic anions bind tightly to a site in the outer mouth of the CFTR pore that involves interaction with a fixed positive charge. Binding to this site is also involved in coordination of multiple permeant anions within the pore, suggesting that anion binding in the outer mouth of the pore is an important aspect in the normal anion permeation mechanism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Block of wild-type, R334C-, R334E-, R334H-, R334K-, R334L- and R334Q-CFTR by 100 mM and 1 mM intracellular Au(CN)2 _ are compared in Fig. 4B. Login to comment
106 However, SCN_ permeability was significantly increased in one mutant, R334L (Fig. 9B). Login to comment
117 Mean of data from 3-5 patches. B, relative SCN_ permeability, estimated from the reversal potential with 150 mM NaSCN in the extracellular solution, was unaltered in most mutants but significantly increased (**P < 0.001) in R334L. Login to comment
148 The fact that tight Au(CN)2 _ binding and strong Au(CN)2 _ -anion interactions are separable by mutagenesis is also evident in R334H and R334L (Fig. 5). Login to comment

[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

[hide] Direct and indirect effects of mutations at the ou... J Membr Biol. 2007 Apr;216(2-3):129-42. Epub 2007 Aug 3. Zhou JJ, Fatehi M, Linsdell P
Direct and indirect effects of mutations at the outer mouth of the cystic fibrosis transmembrane conductance regulator chloride channel pore.
J Membr Biol. 2007 Apr;216(2-3):129-42. Epub 2007 Aug 3., [PMID:17673962]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel pore is thought to contain multiple binding sites for permeant and impermeant anions. Here, we investigate the effects of mutation of different positively charged residues in the pore on current inhibition by impermeant Pt(NO(2)) (4) (2-) and suramin anions. We show that mutations that remove positive charges (K95, R303) influence interactions with intracellular, but not extracellular, Pt(NO(2))(4)(2-) ions, consistent with these residues being situated within the pore inner vestibule. In contrast, mutation of R334, supposedly located in the outer vestibule of the pore, affects block by both extracellular and intracellular Pt(NO(2))(4)(2-). Inhibition by extracellular Pt(NO(2))(4)(2-) requires a positive charge at position 334, consistent with a direct electrostatic interaction resulting in either open channel block or surface charge screening. In contrast, inhibition by intracellular Pt(NO(2))(4)(2-) is weakened in all R334-mutant forms of the channel studied, inconsistent with a direct interaction. Furthermore, mutation of R334 had similar effects on block by intracellular suramin, a large organic molecule that is apparently unable to enter deeply into the channel pore. Mutation of R334 altered interactions between intracellular Pt(NO(2))(4)(2-) and extracellular Cl(-) but not those between intracellular Pt(NO(2))(4)(2-) and extracellular Pt(NO(2))(4)(2-). We propose that while the positive charge of R334 interacts directly with extracellular anions, mutation of this residue also alters interactions with intracellular anions by an indirect mechanism, due to mutation-induced conformational changes in the protein that are propagated some distance from the site of the mutation in the outer mouth of the pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Figure 3 shows the blocking effects of internally applied Pt(NO2)4 2À in six different channel mutants (R334C, R334E, R334H, R334K, R334L, R334Q) under conditions of both low (Fig. 3a) and high (Fig. 3b) extracellular ClÀ concentration. Login to comment
91 With elevated extracellular ClÀ , the Kd(0) was significantly increased only in R334C and R334E; not significantly altered in R334K, R334L and R334Q; and significantly decreased in R334H (Fig. 5b). Login to comment
106 Comparison of the mean Kd estimated for suramin (at 0 mV) shows that R334C, R334E, R334K, R334L and R334Q were all associated with weakened suramin block, with only R334H failing to significantly affect suramin block (Fig. 7). Login to comment
129 Mean of data from three to eight patches. Fitted lines are to equation 1 as described in Figure 1 for wild type and R334Q and with the following parameters for other channel variants: R334C 4 mM external ClÀ , Kd(0) = 1362 lM, zd = À0.295; R334C 154 mM external ClÀ , Kd(0) = 836 lM, zd = À0.219; R334E 4 mM external ClÀ , Kd(0) = 759 lM, zd = À0.376; R334E 154 mM external ClÀ , Kd(0) = 564 lM, zd = À0.173; R334H 4 mM external ClÀ , Kd(0) = 140 lM, zd = À0.166; R334H 154 mM external ClÀ , Kd(0) = 119 lM, zd = À0.149; R334K 4 mM external ClÀ , Kd(0) = 143 lM, zd = À0.314; R334K 154 mM external ClÀ , Kd(0) = 317 lM, zd = À0.374; R334L 4 mM external ClÀ , Kd(0) = 176 lM, zd = À0.258; R334L 154 mM external ClÀ , Kd(0) = 284 lM, zd = À0.366 extracellular Pt(NO2)4 2À by normalizing current amplitude at the hyperpolarized extreme of the voltage range studied, -80 mV (Fig. 10b). Login to comment
159 These plots represent mean data from four to seven patches. Fitted lines are to equation 1 with the following parameters: wild type, Kd(0) = 2.51 lM, zd = À0.042; R334C, Kd(0) = 18.5 lM, zd = À0.056; R334E, Kd(0) = 25.0 lM, zd = À0.107; R334H, Kd(0) = 3.10 lM, zd = À0.085; R334K, Kd(0) = 6.31 lM, zd = À0.232; R334L, Kd(0) = 4.08 lM, zd = À0.061; R334Q, Kd(0) = 6.64 lM, zd = À0.239 with our previous suggestion that intracellular Au(CN)2 À blocks the channel by interacting directly with R334, several reasons prompt us to suggest that Pt(NO2)4 2À does not interact directly with the arginine side chain at this position. Login to comment
228 ), R334E (5), R334H (j), R334K (), R334L (h), R334Q (u); c wild type (d), K95Q (m), R303Q (Å). Login to comment

[hide] Membrane-integration characteristics of two ABC tr... J Mol Biol. 2009 Apr 17;387(5):1153-64. Epub 2009 Feb 21. Enquist K, Fransson M, Boekel C, Bengtsson I, Geiger K, Lang L, Pettersson A, Johansson S, von Heijne G, Nilsson I
Membrane-integration characteristics of two ABC transporters, CFTR and P-glycoprotein.
J Mol Biol. 2009 Apr 17;387(5):1153-64. Epub 2009 Feb 21., [PMID:19236881]

Abstract [show]
To what extent do corresponding transmembrane helices in related integral membrane proteins have different membrane-insertion characteristics? Here, we compare, side-by-side, the membrane insertion characteristics of the 12 transmembrane helices in the adenosine triphosphate-binding cassette (ABC) transporters, P-glycoprotein (P-gp) and the cystic fibrosis transmembrane conductance regulator (CFTR). Our results show that 10 of the 12 CFTR transmembrane segments can insert independently into the ER membrane. In contrast, only three of the P-gp transmembrane segments are independently stable in the membrane, while the majority depend on the presence of neighboring loops and/or transmembrane segments for efficient insertion. Membrane-insertion characteristics can thus vary widely between related proteins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ΔM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
116 One mutation, TM6CFTR (R334L), increased the insertion efficiency from 55% to 85%, as expected for a charged-to-hydrophobic replacement. Login to comment
109 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ƊM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
112 One mutation, TM6CFTR (R334L), increased the insertion efficiency from 55% to 85%, as expected for a charged-to-hydrophobic replacement. Login to comment

[hide] Distinct spectrum of CFTR gene mutations in congen... Hum Genet. 1997 Sep;100(3-4):365-77. Dork T, Dworniczak B, Aulehla-Scholz C, Wieczorek D, Bohm I, Mayerova A, Seydewitz HH, Nieschlag E, Meschede D, Horst J, Pander HJ, Sperling H, Ratjen F, Passarge E, Schmidtke J, Stuhrmann M
Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens.
Hum Genet. 1997 Sep;100(3-4):365-77., [PMID:9272157]

Abstract [show]
Congenital absence of the vas deferens (CAVD) is a frequent cause for obstructive azoospermia and accounts for 1%-2% of male infertility. A high incidence of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has recently been reported in males with CAVD. We have investigated a cohort of 106 German patients with congenital bilateral or unilateral absence of the vas deferens for mutations in the coding region, flanking intron regions and promotor sequences of the CFTR gene. Of the CAVD patients, 75% carried CFTR mutations or disease-associated CFTR variants, such as the "5T" allele, on both chromosomes. The distribution of mutation genotypes clearly differed from that observed in cystic fibrosis. None of the CAVD patients was homozygous for delta F508 and none was compound heterozygous for delta F508 and a nonsense or frameshift mutation. Instead, homozygosity was found for a few mild missense or splicing mutations, and the majority of CAVD mutations were missense substitutions. Twenty-one German CAVD patients were compound heterozygous for delta F508 and R117H, which was the most frequent CAVD genotype in our study group. Haplotype analysis indicated a common origin for R117H in our population, whereas another frequent CAVD mutation, viz. the "5T allele" was a recurrent mutation on different intragenic haplotypes and multiple ethnic backgrounds. We identified a total of 46 different mutations and variants, of which 15 mutations have not previously been reported. Thirteen novel missense mutations and one unique amino-acid insertion may be confined to the CAVD phenotype. A few splice or missense variants, such as F508C or 1716 G-->A, are proposed here as possible candidate CAVD mutations with an apparently reduced penetrance. Clinical examination of patients with CFTR mutations on both chromosomes revealed elevated sweat chloride concentrations and discrete symptoms of respiratory disease in a subset of patients. Thus, our collaborative study shows that CAVD without renal malformation is a primary genital form of cystic fibrosis in the vast majority of German patients and links the particular expression of clinical symptoms in CAVD with a distinct subset of CFTR mutation genotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 The R334L mutation occurs at a position at which another mutation, R334W, has been described in mild to moderate CF and has been found to affect chloride channel conductivity significantly (Gasparini et al. 1991; Sheppard et al. 1993). Login to comment
83 The German CBAVD patient in our study was compound heterozygous for R334L and for the missense mutation I336K in the same exon. Login to comment
86 The V938G substitution was identified in two unrelated patients, one homozygote with unilateral ab- 368 Table 1A Frequency distribution and haplotypes of CFTR mutations in 106 CAVD patients Mutationa Nucleotide changesb Locationc Frequencyd Haplotypee Referencef 174delA deletion of A at 174 exon 1 1 D3 This study E56K G→A at 298 exon 3 1 B3 This study D58N G→A at 304 exon 3 1 C2 This study D110H G→A at 460 exon 4 2 C2 Dean et al. (1990) R117H G→A at 482 exon 4 24 B6 Dean et al. (1990) A120T G→A at 490 exon 4 1 n.p. Chillón et al. (1994) ̃L138 insertion of CTA after 546 exon 4 1 A2 This study L206W T→G at 749 exon 6a 1 B8 Claustres et al. (1993) M265R T→G at 926 exon 6b 1 A2 Schwarz et al. (pers. comm.) R297W C→T at 1021 exon 7 1 C2 This study 1078delT deletion of T at 1078 exon 7 1 C2 Claustres et al. (1992) R334W C→T at 1132 exon 7 1 B1 Gasparini et al. (1991) R334L G→T at 1133 exon 7 1 D3 This study I336K T→A at 1139 exon 7 1 A2 Cuppens et al. (1993) R347H G→A at 1172 exon 7 3 D1 Cremonesi et al. (1992) L375F A→C at 1257 exon 8 1 B3 Jézéquel et al. (1996) ∆F508 deletion of 3 bp between 1652-1655 exon 10 57 B1 Kerem et al. (1989) G542X G→T at 1756 exon 11 2 B1 Kerem et al. (1990) R553X C→T at 1789 exon 11 1 A4 Cutting et al. (1990) L568F G→T at 1836 exon 12 1 B3 This study 2184insA insertion of A at 2184 exon 13 1 D3 Dörk et al. (1994b) 2789+5 G→A G→A at 2789+5 intron 14b 4 D3 Highsmith et al. (1997) R933S A→T at 2931 exon 15 1 n.p. Login to comment
137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level. Login to comment
145 Maldigestion 13 25 5T/D58N 184 99 55 - 14 34 5T/̃L138 177 80 53 - 15 33 5T/1078delT 187 87 56 Recurrent bronchitis 16 31 5T/G542X 181 85 79 - 17 31 5T/2184insA n.d. n.d. 60 Borderline pancreatic sufficiency 18 31 5T/D979A n.d. n.d. 55 Recurrent infections, FEVI 76% 19 29 5T/D1152H n.d. n.d. 57 - 20 32 5T/W1282X 180 76 n.d. Recurrent infections, nasal polyposis 21 37 5T/unknown 180 74 n.d. Nasal polyposis 22 28 D110H/D110H 175 80 n.d Asthma bronchiale, obstipation 23 33 R334L/I336K 170 65 n.d. Recurrent infections, nasal polyposis, maldigestion, salt depletion episodes 24 35 N1303K/R347H 167 77 93 - 25 30 V938G/174delA n.d. n.d. 42 - 26 29 V938G/V938G 197 115 n.d. Asthma bronchiale Fig.2 Spectrum of CFTR mutation genotypes in CF patients (left) and in patients with congenital absence of the vas deferens (right). Login to comment

[hide] Maximization of the rate of chloride conduction in... Arch Biochem Biophys. 2004 Jun 1;426(1):78-82. Gong X, Linsdell P
Maximization of the rate of chloride conduction in the CFTR channel pore by ion-ion interactions.
Arch Biochem Biophys. 2004 Jun 1;426(1):78-82., [PMID:15130785]

Abstract [show]
Multi-ion pore behaviour has been identified in many Cl(-) channel types but its biophysical significance is uncertain. Here, we show that mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel that disrupt anion-anion interactions within the pore are associated with drastically reduced single channel conductance. These results are consistent with models suggesting that rapid Cl(-) permeation in CFTR results from repulsive ion-ion interactions between Cl(-) ions bound concurrently inside the pore. Naturally occurring mutations that disrupt these interactions can result in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Results and discussion Previously we characterized the properties of six different R334 mutants (R334C, R334E, R334H, R334K, R334L, and R334Q) [19]. Login to comment
65 (A) Unitary current-voltage relationships for each of the channel variants shown in Fig. 1: (d) wild type, (r) R334C, (j) R334E, (}) R334H, (s) R334K, () R334L, (.) Login to comment
98 Interestingly, three of these mutations-R334L, R334Q, and R334W-have been identified in cystic fibrosis patients [29]. Login to comment

[hide] A 96-well formatted method for exon and exon/intro... Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5. Lucarelli M, Narzi L, Piergentili R, Ferraguti G, Grandoni F, Quattrucci S, Strom R
A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene.
Anal Biochem. 2006 Jun 15;353(2):226-35. Epub 2006 Apr 5., [PMID:16635477]

Abstract [show]
Full genotypic characterization of subjects affected by cystic fibrosis (CF) is essential for the definition of the genotype-phenotype correlation as well as for the enhancement of the diagnostic and prognostic value of the genetic investigation. High-sensitivity diagnostic methods, capable of full scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, are needed to enhance the significance of these genetic assays. A method for extensive sequencing of the CFTR gene was optimized. This method was applied to subjects clinically positive for CF and to controls from the general population of central Italy as well as to a single subject heterozygous for a mild mutation and with an uncertain diagnosis. Some points that are crucial for the optimization of the method emerged: a 96-well format, primer project and purification, and amplicon purification. The optimized method displayed a high degree of diagnostic sensitivity; we identified a subset of 13 CFTR mutations that greatly enhanced the diagnostic sensitivity of common methods of mutational analysis. A novel G1244R disease causing mutation, leading to a CF phenotype with pancreatic sufficiency but early onset of pulmonary involvement, was detected in the subject with an uncertain diagnosis. Some discrepancies between our results and previously published CFTR sequence were found.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 In this work, we found a limited subset of 13 mutations (not included in the PCR/OLA/SCS assay) in 7 CFTR exons, significantly improving the sensitivity of standard assays: D110H, R117C, and H139R (exon 4); R334L, T338I, and A349V (exon 7); S549R(A->C) (exon 11); Y849X (exon 14a); L997F (exon 17a); L1065P, R1066C, and L1077P (exon 17b); and G1244E (exon 20). Login to comment

[hide] Understanding how cystic fibrosis mutations disrup... Int J Biochem Cell Biol. 2014 Jul;52:47-57. doi: 10.1016/j.biocel.2014.04.001. Epub 2014 Apr 13. Wang Y, Wrennall JA, Cai Z, Li H, Sheppard DN
Understanding how cystic fibrosis mutations disrupt CFTR function: from single molecules to animal models.
Int J Biochem Cell Biol. 2014 Jul;52:47-57. doi: 10.1016/j.biocel.2014.04.001. Epub 2014 Apr 13., [PMID:24727426]

Abstract [show]
Defective epithelial ion transport is the hallmark of the life-limiting genetic disease cystic fibrosis (CF). This abnormality is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), the ATP-binding cassette transporter that functions as a ligand-gated anion channel. Since the identification of the CFTR gene, almost 2000 disease-causing mutations associated with a spectrum of clinical phenotypes have been reported, but the majority remain poorly characterised. Studies of a small number of mutations including the most common, F508del-CFTR, have identified six general mechanisms of CFTR dysfunction. Here, we review selectively progress to understand how CF mutations disrupt CFTR processing, stability and function. We explore CFTR structure and function to explain the molecular mechanisms of CFTR dysfunction and highlight new knowledge of disease pathophysiology emerging from large animal models of CF. Understanding CFTR dysfunction is crucial to the development of transformational therapies for CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2002 Mutation of R334, including the CF mutations R334L and R334Q, transformed the current-voltage (I-V) relationship of CFTR from linear (or quasi-linear, see Cai et al., 2003) to strongly inwardly rectifying (Smith et al., 2001; Gong and Linsdell, 2003). Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
370 991del5 c.859_863delAACTT CF-PI nd p.Asn287LysfsX19 L320V c.958T>G uncertain: CF-PI and/or CF-PS and/or CFTR-RD nd p.Leu320Val R334W c.1000C>T CF-PI,CF-PS CF-causing p.Arg334Trp R334L c.1001G>T CF-PS nd p.Arg334Leu T338I c.1013C>T CF-PS,CFTR-RD,CBAVD CF-causing p.Thr338Ile R347P c.1040G>C CF-PI,CF-PS CF-causing p.Arg347Pro R347H c.1040G>A CF-PS CF-causing p.Arg347His [M348K;S912X] c. Login to comment