ABCMdb

ABCC7 p.Ala1006Glu

ClinVar:	c.3017C>A , p.Ala1006Glu ? , not provided
CF databases:	c.3017C>A , p.Ala1006Glu (CFTR1) ? , This mutation was identified on one Italian CF chromosome.
Predicted by SNAP2:	C: D (75%), D: D (91%), E: N (57%), F: D (80%), G: D (71%), H: D (91%), I: D (85%), K: D (95%), L: D (80%), M: D (91%), N: D (91%), P: D (95%), Q: D (91%), R: D (95%), S: D (71%), T: D (75%), V: D (80%), W: D (95%), Y: D (85%),
Predicted by PROVEAN:	C: N, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, R: N, S: N, T: N, V: N, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Heterogeneity for mutations in the CFTR gene and c... Hum Reprod. 2000 Jul;15(7):1476-83. Casals T, Bassas L, Egozcue S, Ramos MD, Gimenez J, Segura A, Garcia F, Carrera M, Larriba S, Sarquella J, Estivill X
Heterogeneity for mutations in the CFTR gene and clinical correlations in patients with congenital absence of the vas deferens.
Hum Reprod. 2000 Jul;15(7):1476-83., [PMID:10875853]

Abstract [show]
Congenital absence of the vas deferens (CAVD) is a heterogeneous disorder, largely due to mutations in the cystic fibrosis (CFTR) gene. Patients with unilateral absence of the vas deferens (CUAVD) and patients with CAVD in association with renal agenesis appear to have a different aetiology to those with isolated CAVD. We have studied 134 Spanish CAVD patients [110 congenital bilateral absence of the vas deferens (CBAVD) and 24 CUAVD], 16 of whom (six CBAVD, 10 CUAVD) had additional renal anomalies. Forty-two different CFTR mutations were identified, seven of them being novel. Some 45% of the CFTR mutations were specific to CAVD, and were not found in patients with cystic fibrosis or in the general Spanish population. CFTR mutations were detected in 85% of CBAVD patients and in 38% of those with CUAVD. Among those patients with renal anomalies, 31% carried one CFTR mutation. Anomalies in seminal vesicles and ejaculatory ducts were common in patients with CAVD. The prevalence of cryptorchidism and inguinal hernia appeared to be increased in CAVD patients, as well as nasal pathology and frequent respiratory infections. This study confirms the molecular heterogeneity of CFTR mutations in CAVD, and emphasizes the importance of an extensive CFTR analysis in these patients. In contrast with previous studies, this report suggests that CFTR might have a role in urogenital anomalies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 The abnormally migrating fragments were characterized by sequencing with the DyeDeoxy™ chain terminator method on an variant and another mutation (S50P, 2751ϩ3A→G, A1006E I. Description of the seven novel CFTR mutations and five polymorphisms in CAVD patients Mutation Location Nucleotide Amino acid Markers haplotype changes change (T)n-8CA-17bTA-M470V S50P exon 2 280 T→C Ser → Pro 5T/7T-16-31-ND D110Y exon 4 460 G→T Asp acid → Tyr 7T-17-7-V470 L383S exon 8 1280 T→C Leu → Ser 7T-16-7-M470 H484Y exon 10 1582 C→T His → Tyr no phase-M470 2751ϩ3A→G intron 14a 2751ϩ3 A→G - 5T-16-30-ND Q890R exon 15 2801 A→G Glu → Arg 7T-16-7/29-V470 P1021S exon 17a 3193 C→T Pro → Ser 7T-17-7-M470 Polymorphisms 104C/A 5ЈUTR - 296ϩ128G/C intron 3 - 741C/T exon 6a Ile203 no change 3195A/T exon 17a Pro1021 no change 3212T/C exon 17a Ile1027 no change CAVD ϭ congenital absence of the vas deferens; ND ϭ not determined; 5ЈUTR ϭ 5Ј untranslated region. Login to comment
74 The five new polymorphisms identified are Others (27) 27 (17) 1 (7) 28 (17) described in Table I. aS50P (n ϭ 1), 2751ϩ3A→G (n ϭ 1), F1074L (n ϭ 1), A1006E (n ϭ 2). Login to comment
97 Dilatation V232D/V232D 9T/9T 1 of ejaculatory ducts, often resembling utricular cysts, was S945L/R258G 7T/7T 1 demonstrable also in some men, all of whom were azoospermicG551D/F1074L 5T/7T 1 A1006E/L383S 5T/7T 1 (Figure 1). Login to comment
99 The prostate gland showed normal size and A1006E/- 5T/5T 1 morphology in all patients. Login to comment

[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 These mutations included S4X (143 C to A), exon 1; S42F (257 C to T), exon 2; R117L (482 G to T), exon 4; S549R (1779 T to G), exon 11; 3667ins4, exon 19; A1006E (3149 C to A), exon17a; L1065P (3326 T to C), R1066C (3328 C to T), L1077P (3362 T to C), exon 17b. Login to comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

[hide] Extensive sequencing of the CFTR gene: lessons lea... Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28. McGinniss MJ, Chen C, Redman JB, Buller A, Quan F, Peng M, Giusti R, Hantash FM, Huang D, Sun W, Strom CM
Extensive sequencing of the CFTR gene: lessons learned from the first 157 patient samples.
Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28., [PMID:16189704]

Abstract [show]
Cystic fibrosis (CF) is one of the most common monogenic diseases affecting Caucasians and has an incidence of approximately 1:3,300 births. Currently recommended screening panels for mutations in the responsible gene (CF transmembrane regulator gene, CFTR) do not detect all disease-associated mutations. Our laboratory offers extensive sequencing of the CFTR (ABCC7) gene (including the promoter, all exons and splice junction sites, and regions of selected introns) as a clinical test to detect mutations which are not found with conventional screening. The objective of this report is to summarize the findings of extensive CFTR sequencing from our first 157 consecutive patient samples. In most patients with classic CF symptoms (18/24, 75%), extensive CFTR sequencing confirmed the diagnosis by finding two disease-associated mutations. In contrast, only 5 of 75 (7%) patients with atypical CF had been identified with two CFTR mutations. A diagnosis of CF was confirmed in 10 of 17 (58%) newborns with either positive sweat chloride readings or positive immunoreactive trypsinogen (IRT) screen results. We ascertained ten novel sequence variants that are potentially disease-associated: two deletions (c.1641AG>T, c.2949_2853delTACTC), seven missense mutations (p.S158T, p.G451V, p.K481E, p.C491S, p.H949L, p.T1036N, p.F1099L), and one complex allele ([p.356_A357del; p.358I]). We ascertained three other apparently novel complex alleles. Finally, several patients were found to carry partial CFTR gene deletions. In summary, extensive CFTR gene sequencing can detect rare mutations which are not found with other screening and diagnostic tests, and can thus establish a definitive diagnosis in symptomatic patients with previously negative results. This enables carrier detection and prenatal diagnosis in additional family members.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Finally, one CF patient with mild symptoms carried a complex allele [p.V562I; p.A1006E] and a nonsense mutation (p.R1158X) on the other allele. Login to comment
103 The last two samples were from affected siblings and were found to be positive for three previously described CFTR mutations: p.V562I, p.A1006E, and p.R1158X. Login to comment

[hide] N-terminal CFTR missense variants severely affect ... Hum Mutat. 2008 May;29(5):738-49. Gene GG, Llobet A, Larriba S, de Semir D, Martinez I, Escalada A, Solsona C, Casals T, Aran JM
N-terminal CFTR missense variants severely affect the behavior of the CFTR chloride channel.
Hum Mutat. 2008 May;29(5):738-49., [PMID:18306312]

Abstract [show]
Over 1,500 cystic fibrosis transmembrane conductance regulator (CFTR) gene sequence variations have been identified in patients with cystic fibrosis (CF) and related disorders involving an impaired function of the CFTR chloride channel. However, detailed structure-function analyses have only been established for a few of them. This study aimed evaluating the impact of eight N-terminus CFTR natural missense changes on channel behavior. By site-directed mutagenesis, we generated four CFTR variants in the N-terminal cytoplasmic tail (p.P5L, p.S50P, p.E60K, and p.R75Q) and four in the first transmembrane segment of membrane-spanning domain 1 (p.G85E/V, p.Y89C, and p.E92K). Immunoblot analysis revealed that p.S50P, p.E60K, p.G85E/V, and p.E92K produced only core-glycosylated proteins. Immunofluorescence and whole cell patch-clamp confirmed intracellular retention, thus reflecting a defect of CFTR folding and/or trafficking. In contrast, both p.R75Q and p.Y89C had a glycosylation pattern and a subcellular distribution comparable to the wild-type CFTR, while the percentage of mature p.P5L was considerably reduced, suggesting a major biogenesis flaw on this channel. Nevertheless, whole-cell chloride currents were recorded for all three variants. Single-channel patch-clamp analyses revealed that the channel activity of p.R75Q appeared similar to that of the wild-type CFTR, while both p.P5L and p.Y89C channels displayed abnormal gating. Overall, our results predict a major impact of the CFTR missense variants analyzed, except p.R75Q, on the CF phenotype and highlight the importance of the CFTR N-terminus on channel physiology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
133 Genotype^Phenotype Correlation in the N-Terminal CFTR MissenseVariants Under StudyÃ Missense varianta Phenotype Second allele (number of patients)b p.P5L CF p.F508del (1), p.P205S (1) p.S50P CBAVD p.F508del (1), p.E115del (1) p.E60K CF p.G542X (1), p.I507del (1) p.R75Q HT p.F508del (3), p.E725K (1) B p.R347H (1), p.R75Q (1), n.i. (4) Br c.1584G4A (2), c.1210-7_1210-6delTT (1), n.i.(3) NT p.F508del (1) CP c.1584G4A (1), n.i. (3) MI n.i. (1) CUAVD n.i. (2) OZ n.i. (2) Normal p.R75Q (1), c.2052_2053insA (1), n.i. (1) p.G85E CF p.F508del (8), p.G542X (2), p.I507del (1), c.580-1G4T (1), p.G85E (1), c.1477_ 1478delCA (1) CBAVD p.G576A (1) HT p.L997F (1),WT (1) p.G85V CF p.F508del (2), p.G542X (2), p.Y1092X (1), c.265715G4A (1), p.A1006E, c.1210-7_1210- 6delTT (1), n.i. (1) p.Y89C CF n.i. (1)c p.E92K CF p.F508del (2), p.Q890X (1), p.L206W (1) CBAVD c.1210-7_1210-6delTT (1) ÃThe recommendations for mutation nomenclature (www.hgvs.org/mutnomen/) were used to name CFTR gene sequence variations at both the nucleotide level and the protein level. Login to comment

[hide] CFTR mutations in cystic fibrosis patients from Mu... Clin Genet. 2009 Dec;76(6):577-9. Epub 2009 Oct 21. Moya-Quiles MR, Mondejar-Lopez P, Pastor-Vivero MD, Gonzalez-Gallego I, Juan-Fita MJ, Egea-Mellado JM, Carbonell P, Casals T, Fernandez-Sanchez A, Sanchez-Solis M, Glover G
CFTR mutations in cystic fibrosis patients from Murcia region (southeastern Spain): implications for genetic testing.
Clin Genet. 2009 Dec;76(6):577-9. Epub 2009 Oct 21., [PMID:19845690]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
17 of chromosomes Frequency (%) F508dela E.10 67 36.8 G542Xa E.11 22 12.1 A1006E E.17a 10 5.5 K710X E.13 10 5.5 2789+5G>Aa I.14b 9 4.9 L206W E.6a 7 3.8 1811+1.6kbA>G I.11 6 3.3 R334Wa E.7 5 2.7 2869insG E.15 5 2.7 I507dela E.10 4 2.2 N1303Ka E.21 4 2.2 R347Pa E.7 3 1.6 711+1G>Ta I.5 3 1.6 3849+10kbC>Ta I.19 3 1.6 Q890X E.15 3 1.6 R117Ha E.4 2 1.1 R1162Xa E.19 2 1.1 2183AA>Ga E.13 2 1.1 A561E E.12 2 1.1 R560G E.11 2 1.1 1717-1G>Aa I.10 1 0.5 E1308X E.21 1 0.5 E585X E.12 1 0.5 L997F E.17a 1 0.5 1677delTA E.10 1 0.5 R1158X E.19 1 0.5 W202X E.6a 1 0.5 R74W+D1270N E.3 + E.20 1 0.5 G576A+R668C E.12 + E.13 1 0.5 Unknown 2 1.1 Total 182 100 aCFTR mutations identified with the PCR OLA CF Genotyping Assay . Login to comment
20 Letter to the Editor Although we observed a marked difference in the frequency distribution of all mutations, it was interesting to note that the third and fourth most prevalent were A1006E and K710X, mutations undetected by commercial panels and each presenting with a frequency of 5.5%. Login to comment
22 In Mediterranean France the K710X mutation showed a frequency of 0.93% and the A1006E mutation has never been reported (11). Login to comment
23 By contrast, the A1006E mutation has been previously reported in Italians (15). Login to comment
27 This may be due to the relatively low influx of people from other Spanish regions, hence not diluting the frequency of mutations that are common in this region, including A1006E or K710X. Login to comment

[hide] Clinical hallmarks and genetic polymorphisms in th... Clin Invest Med. 2010 Aug 1;33(4):E234-9. Tomaiuolo AC, Alghisi F, Petrocchi S, Surace C, Roberti MC, Bella S, Lucidi V, Angioni A
Clinical hallmarks and genetic polymorphisms in the CFTR gene contribute to the disclosure of the A1006E mutation.
Clin Invest Med. 2010 Aug 1;33(4):E234-9., [PMID:20691141]

Abstract [show]
Since the identification of the Cystic Fibrosis transmembrane conductance regulator (CFTR) gene in 1989, many genetic mutations have been found in cystic fibrosis (CF) patients. Dysfunctions of the CFTR gene are responsible for the highly variable clinical presentation ranging from severe CF, disseminated bronchiectasis, idiopathic chronic pancreatitis and congenital bilateral absence of vas deferens (CBAVD). Linkage disequilibrium studies have shown that some mutations are stringently coupled with polymorphisms in a genetic complex called haplotype. From a familial study of a patient with CBAVD, carrier of the A1006E mutation, we have observed its strict association with the polymorphism 5T-TG11. In order to speed up the genetic diagnosis and to correlate the clinical setting to this genetic feature, we have directly investigated the exon 17a, where the A1006E mutation is located, of five cystic fibrosis patients belonging to two unrelated families. All patients had the 5T-TG11 tract, F508del and one unknown mutation. One more family with two affected individuals carrying the Q220X/A1006E mutations was investigated for the poly-T polymorphism. All the members were found to have the A1006E mutation and the 5T-TG11 in the same DNA strand, demonstrating that this strategy is a reliable and inexpensive method for genotyping the CFTR gene. A detailed description of the clinical presentation and follow-up are provided in order to highlight common phenotypic features useful to improve the management of cystic fibrosis patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Clinical hallmarks and genetic polymorphisms in the CFTR gene contribute to the disclosure of the A1006E mutation Anna Cristina Tomaiuolo MSc1 Federico Alghisi MD2 Stefano Petrocchi MSc1 Cecilia Surace PhD1 Maria Cristina Roberti PhD1 Sergio Bella MD2 Vincenzina Lucidi MD2 Adriano Angioni MD1 1 Cytogenetics and Molecular Genetics Laboratory. Login to comment
6 From a familial study of a patient with CBAVD, carrier of the A1006E mutation, we have observed its strict association with the polymorphism 5T-TG11. Login to comment
7 In order to speed up the genetic diagnosis and to correlate the clinical setting to this genetic feature, we have directly investigated the exon 17a, where the A1006E mutation is located, of five cystic fibrosis patients belonging to two unrelated families. Login to comment
9 One more family with two affected individuals carrying the Q220X/A1006E mutations was investigated for the poly-T polymorphism. Login to comment
10 All the members were found to have the A1006E mutation and the 5T-TG11 in the same DNA strand, demonstrating that this strategy is a reliable and inexpensive method for genotyping the CFTR gene. Login to comment
15 Among these, due to familial segregation studies, we have found that the A1006E mutation is in cis with the 5T-TG11 polymorphism. Login to comment
16 Based on these observations we have decided to use the 5T-TG11 haplotype to trace the A1006E mutation in five CF patients with incomplete genotyping, belonging to two unrelated families. Login to comment
17 Two additional related patients, both compound heterozygotes carrying the A1006E, were investigated for the Tn-TGm locus to implement the finding of this association. Login to comment
28 They also carried the same CFTR gene mutations (Q220X/A1006E). Login to comment
56 Family 1 and Family 3 members underwent exon 17a sequencing that revealed the 3149 C>A mutation (A1006E) in all of them. Login to comment
58 A familial study involving all the informative relatives was then carried out showing the linkage of 5T-TG11 with the A1006E mutation. Login to comment
59 Discussion The A1006E is included in the group of the so called "borderline mutations".7 It is a missense defect due to the C to A nucleotide variation at 3149, within the exon 17a, resulting in the amino acid change alanine to glutamic acid. Login to comment
60 The involved proteic region is the second membrane spanning domain that contributes to complete the proper CFTR channel structure In our CF patient`s database the A1006E mutation has been detected, using the trace of the 5T-TG11 polymorphism, in 3 out of 436 CF chromosomes, accounting for an estimated incidence of about 0.7%. Login to comment
62 These results have been further confirmed through familial studies of informative relatives that showed the same linkage of the 5T-TG11 polymorphism with the A1006E mutation. Login to comment
66 Among the A1006E partners a possible role in modifying gene activity may be attributed to the poly-5T-TG tract, and indirectly, to M470V. Login to comment
69 The A1006E mutation has been detected in large series of patients with CBAVD or CF but scarce information is available from the clinical setting. Login to comment
72 Despite the late onset of clinical presentation (mean age at di- Tomaiuolo et al. A1006E mutation and TG(m)Tn polymorphism (c) 2010 CIM Clin Invest Med • Vol 33, no 4, August 2010 E237. Login to comment
73 TABLE 1. Allelic genotyping of the patients with CFTR geneTABLE 1. Allelic genotyping of the patients with CFTR geneTABLE 1. Allelic genotyping of the patients with CFTR geneTABLE 1. Allelic genotyping of the patients with CFTR geneTABLE 1. Allelic genotyping of the patients with CFTR geneTABLE 1. Allelic genotyping of the patients with CFTR gene Patients Haplotype Mutations Tn-TGm Sequence variations Sequence variations Pt1 Strand 1 F508del 9T-TG10 M470V Strand 2 A1006E 5T-TG11 M470V - Pts2-3 Strand 1 Q220X 7T-TG11 M470V Strand 2 A1006E 5T-TG11 M470V V562I Pts4-7 Strand 1 F508del 9T-TG10 M470V Strand 2 A1006E 5T-TG11 M470V V562I TABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR geneTABLE 2. Phenotypic features of patients with CFTR gene Pts Age at diagnosis Sweat test Current clinical statusCurrent clinical statusCurrent clinical statusCurrent clinical statusCurrent clinical status (years) (mmol/L) Age (years) X-Ray Lung Assessment FEV1% PS ARP 1 35 Cl: 84 36 Bronchiectasis 61 - - 2 21 Cl: 74 36 Bronchiectasis 76 - + 3 14 Cl: 76 29 Bronchiectasis 73 + - 4 IRT + Na: 76 18 Bronchial thickening 110 + - 5 16 Na: 121 34 Initial bronchiectasis 86 + - 6 14 Na: 119 32 Bronchiectasis; lobe excision 74 - + 7 13 Na: 97 31 Bronchial thickening 91 + - IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` IRT: Immunoreactive Trypsinogen Test FEV1: Forced Expiratory Volume in 1 second PS: Pancreatic Sufficiency ARP: Acute Recurrent Pancreatitis ` agnosis of 16.2 ± 10.5 years, median age of 14 years) the course of the disease leads to a complete phenotypic expression. Login to comment
81 An interesting observation is the unexpectedly elevated incidence of the A1006E mutation within our data base of CF patients. Login to comment
83 Moreover, the geographic origin of our families may suggest a possible relationship for the high rate of the A1006E, with the historical Spanish domination along the south-western regions of our country. Login to comment
84 In conclusion, the study reports a detailed description of the phenotypic spectrum of the A1006E mutation, providing useful information for a ready and inexpensive genotyping in selected cases. Login to comment
86 For the clinical setting, these results illustrate the importance of an early detection of the disease - before the patients become symptomatic;17 IRT and sweat test appear to be sensitive diagnostic tests for patients affected by the A1006E mutation. Login to comment

[hide] A new complex allele of the CFTR gene partially ex... Genet Med. 2010 Sep;12(9):548-55. Lucarelli M, Narzi L, Pierandrei S, Bruno SM, Stamato A, d'Avanzo M, Strom R, Quattrucci S
A new complex allele of the CFTR gene partially explains the variable phenotype of the L997F mutation.
Genet Med. 2010 Sep;12(9):548-55., [PMID:20706124]

Abstract [show]
PURPOSE: To evaluate the role of complex alleles, with two or more mutations in cis position, of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in the definition of the genotype-phenotype relationship in cystic fibrosis (CF), and to evaluate the functional significance of the highly controversial L997F CFTR mutation. METHODS: We evaluated the diagnosis of CF or CFTR-related disorders in 12 unrelated subjects with highly variable phenotypes. According to a first CFTR mutational analysis, subjects appeared to be compound heterozygotes for a classic mutation and the L997F mutation. A further CFTR mutational analysis was conducted by means of a protocol of extended sequencing, particularly suited to the detection of complex alleles. RESULTS: We detected a new [R117L; L997F] CFTR complex allele in the four subjects with the highest sweat test values and CF. The eight subjects without the complex allele showed the most varied biochemical and clinical outcome and were diagnosed as having mild CF, CFTR-related disorders, or even no disease. CONCLUSIONS: The new complex allele partially explains the variable phenotype in CF subjects with the L997F mutation. CFTR complex alleles are likely to have a role in the definition of the genotype-phenotype relationship in CF. Whenever apparently identical CFTR-mutated genotypes are found in subjects with divergent phenotypes, an extensive mutational search is mandatory.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 In vivo findings and, in some cases, in vitro functional characterizations have been reported for [F508C; S1251N],38 [R347H; D979A],39,40 [R74W; D1270N],41 [G628R; S1235R],42,43 [M470V; S1235R],42 [S912L; G1244V],44 [R117H; (TG)mTn],45-47 [R117C; (TG)mTn],46 [S1235R; (TG)mT5],48 [G576A; R668C],10,49 [V562I; A1006E],49 [R352W; P750L],49 [1198_1203del TGGGCT; 1204GϾA],49 [V754M; CFTRdele3_10,14b_16],50 and [F508del; I1027T].51 These complex alleles have been found in patients with either CF or CFTR-RD, although more often in the former. Login to comment

[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]

Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 (%) p.F508del # E.10 1009 (51.74) p.G542X # E.11 150 (7.69) p.N1303K # E.21 57 (2.92) c.1811 + 1.6kbA > G I.11 36 (1.84) p.R334W # E.7 35 (1.79) p.L206W E.6a 32 (1.64) c.711 + 1G > T # I.5 31 (1.58) p.Q890X E.15 28 (1.43) p.R1162X # E.19 25 (1.28) c.2789 + 5G > A # I.14b 24 (1.23) p.R1066C E.17b 23 (1.18) p.I507del # E.10 21 (1.07) c.1609delCA E.10 18 (0.92) c.712-1G > T I.5 18 (0.92) c.3272-26A > G I.17a 18 (0.92) c.2183AA > G # E.13 16 (0.82) p.G85E # E.3 15 (0.77) c.2869insG E.15 15 (0.77) p.W1282X # E.20 15 (0.77) p.V232D E.6a 14 (0.71) p.A1006E * E.17a 12 (0.61) c.2184insA E.13 11 (0.56) p.K710X E.13 11 (0.56) TOTAL (n = 23) 1,634 (83.72) * , the complex allele [p.A1006E; p.V562I; IVS8-6(5T)] #, CF mutations identified with the Celera Diagnosis Cystic Fibrosis v2 genotyping assay and the Inno-Lipa CFTR12, CFTR17 + Tn Samples with microsatellite haplotypes 16/45-46-47 (IVS8CA/IVS17bTA) were submitted to direct analysis of the c.1811 + 1.6kbA > G mutation, which was found mainly associated with the 16-46 haplotype. Login to comment
66 For example the IVS8-6(5T) allele was detected in cis with four different mutations (p.S50P, c.2751 + 3A > G, p.A1006E and p.F1074L). Login to comment
70 The major complexity detected is attributable to the polyvariant [p.A1006E; p.V562I; IVS8-6(5T)], which was observed in all patients with the p.A1006E mutation (Table 1). Login to comment
85 In addition, three other mild mutations, c.3272-26A > G, p.V232D and p.A1006E, showed frequencies ranging from 0.9% to 0.6% (Table 1). Login to comment

[hide] Membrane-integration characteristics of two ABC tr... J Mol Biol. 2009 Apr 17;387(5):1153-64. Epub 2009 Feb 21. Enquist K, Fransson M, Boekel C, Bengtsson I, Geiger K, Lang L, Pettersson A, Johansson S, von Heijne G, Nilsson I
Membrane-integration characteristics of two ABC transporters, CFTR and P-glycoprotein.
J Mol Biol. 2009 Apr 17;387(5):1153-64. Epub 2009 Feb 21., [PMID:19236881]

Abstract [show]
To what extent do corresponding transmembrane helices in related integral membrane proteins have different membrane-insertion characteristics? Here, we compare, side-by-side, the membrane insertion characteristics of the 12 transmembrane helices in the adenosine triphosphate-binding cassette (ABC) transporters, P-glycoprotein (P-gp) and the cystic fibrosis transmembrane conductance regulator (CFTR). Our results show that 10 of the 12 CFTR transmembrane segments can insert independently into the ER membrane. In contrast, only three of the P-gp transmembrane segments are independently stable in the membrane, while the majority depend on the presence of neighboring loops and/or transmembrane segments for efficient insertion. Membrane-insertion characteristics can thus vary widely between related proteins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ΔM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
109 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ƊM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment

[hide] The use of DHPLC (Denaturing High Performance Liqu... J Prenat Med. 2010 Jul;4(3):45-8. Mesoraca A, Di Natale M, Cima A, Di Giacomo G, Sarti M, Barone MA, Bizzoco D, Cignini P, Mobili L, D'emidio L, Giorlandino C
The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis.
J Prenat Med. 2010 Jul;4(3):45-8., [PMID:22439061]

Abstract [show]
OBJECTIVE: The aim of the study is to evaluate the role of Denaturing High Performance Liquid Chromatography (DHPLC) in the second level screening of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene. METHODS: A 9-month prospective study, between June 2008 and March 2009 at Artemisia Fetal Medical Centre, included 3829 samples of amniotic fluid collected from women undergoing mid-trimester amniocentesis.The genetic diagnosis of CF was based on research of the main mutations of the CFTR gene on fetal DNA extracted from the amniocytes, (first level screening) using different commercial diagnostic systems. A second level screening using DHPLC, on the amniotic fluid and on a blood sample from the couple, was offered in case of fetuses heterozygous at first level screening. RESULTS: Of 3829 fetuses, 134 were found to be positive, 129 heterozygous and 5 affected. Of the 129 couples, following appropriate genetic counselling, 53 requested a second level screening. Through the use of DHPLC, 44 couples were found to be negative, and in nine couples, nine rare mutations were identified. CONCLUSIONS: The first level screening can be useful to evidence up to 75% of the CF mutations. The second level screening can identify a further 10% of mutant alleles. DHPLC was found to be a reliable and specific method for the rapid identification of the rare CFTR mutations which were not revealed in initial first level screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Through the use of DHPLC, all the exonic regions of the CFTR gene were analysed and through the technique 44 of the 53 couples were found to be negative, while for 9 couples, 9 rare mutations were identified which were not revealed in I level screening: R1066C, L1065P, L1077P (exon 17b), A1006E (exon 19), R75Q (exon 3), D537E (exon 11), W1134X (exon 18), R1145X (exon 18), C524X (exon 11). Login to comment
100 48 Journal of Prenatal Medicine 2010; 4 (3): 45-50 Table III Mutations found with II level screening through DHPLC Mutations of mutated alleles DF508 29 W1282X 3 N1303K 8 1717-1G®A 2 3659delC 1 G85E 1 2789 +5G®A 2 R553X 2 R1162X 1 R117H 1 G542X 3 Total 53Table I Mutations found through I level screeningMutations analysed with I level screening through OLA CFTR Mutations Position on the CFTR gene DF508 Exon 10 3849+10KbC®T Intron 19 R334W Exon 7 W1282X Exon 10 V520F Exon 10 3905insT Exon 20 N1303K Exon 21 3876delA Exon 20 1717-1G®A Exon 11 3659delC Exon 19 DI507 Exon 10 A455E Exon 9 G85E Exon 3 2789 +5G®A Exon 14 / Intron 14 2183AA®G Exon 13 1898+1G®A Exon 12 / Intron 12 R347P Exon 7 R347H Exon 7 R560T Exon 11 1078delT Exon 7 R553X Exon 11 711+1G®T Exon 5 / Intron 5 G551D Exon 11 R1162X Exon 19 S549R Exon 11 R117H Exon 4 S549N Exon 11 621+1G®T Exon 4 G542X Exon 11 394delTT Exon 3 3120+1G®ðA Exon 16/ Intron 16 2184delA Exon 13 Table II Mutations found through I level screening Mutations Positions on CFTR gene R1066C Exon 17 b L1065P Exon 17 b A1006E Exon 19 R75Q Exon 3 D537E Exon 11 W1134X Exon 18 W1145X Exon 18 L1077P Exon 17b C524X Exon 11 Total 9 The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis Journal of Prenatal Medicine 2010; 4 (3): 45-50 49 tion was to provide the couple with adequate counselling in order to better understand the genotype-phenotype correlation in the various associations of mutations. Login to comment

[hide] High heterogeneity for cystic fibrosis in Spanish ... Hum Genet. 1997 Dec;101(3):365-70. Casals T, Ramos MD, Gimenez J, Larriba S, Nunes V, Estivill X
High heterogeneity for cystic fibrosis in Spanish families: 75 mutations account for 90% of chromosomes.
Hum Genet. 1997 Dec;101(3):365-70., [PMID:9439669]

Abstract [show]
We have analyzed 640 Spanish cystic fibrosis (CF) families for mutations in the CFTR gene by direct mutation analysis, microsatellite haplotypes, denaturing gradient gel electrophoresis, single-strand conformation analysis and direct sequencing. Seventy-five mutations account for 90.2% of CF chromosomes. Among these we have detected seven novel CFTR mutations, including four missense (G85V, T582R, R851L and F1074L), two nonsense (E692X and Q1281X) and one splice site mutation (711+3A-->T). Three variants, two in intronic regions (406-112A/T and 3850-129T/C) and one in the coding region (741C/T) were also identified. Mutations G85V, T582R, R851L, E692X and Q1281X are severe, with lung and pancreatic involvement; 711+3A-->T could be responsible for a pancreatic sufficiency/insufficiency variable phenotype; and F1074L was associated with a mild phenotype. These data demonstrate the highest molecular heterogeneity reported so far in CF, indicating that a wide mutation screening is necessary to characterize 90% of the Spanish CF alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Eight mutations have frequencies 366 Table 1 Seventy-five CFTR mutations identified in 640 Spanish families with cystic fibrosis (CF) Mutation Exon/intron CF alleles % ∆F508 E.10 681 53.20 G542X E.11 108 8.43 N1303K E.21 34 2.65 1811+1.6kbA→Ga I.11 24 1.87 711+1G→T I.5 22 1.71 R1162Xa E.19 21 1.64 R334Wa E.7 21 1.64 R1066C E.17b 14 1.09 1609delCAa E.10 13 1.01 Q890X E.15 13 1.01 G85E E.3 12 0.94 712-1G→Ta I.5 11 0.86 2789+5G→A I.14b 11 0.86 ∆I507 E.10 10 0.78 W1282X E.20 10 0.78 2869insGa E.15 9 0.70 L206W E.6a 7 0.54 R709X E.13 7 0.54 621+1G→T I.4 6 0.47 3272-26A→G I.17a 6 0.47 R347H E.7 5 0.39 2183AA→G E.13 5 0.39 K710X E.13 5 0.39 2176insC E.13 5 0.39 3849+10kbC→T I.19 5 0.39 P205Sa E.6a 4 0.31 1078delT E.7 4 0.31 R553X E.11 4 0.31 G551D E.11 4 0.31 1812-1G→Aa I.11 4 0.31 CFdel#1a E.4-7/11-18 4 0.31 V232D E.6a 3 0.23 936delTAa E.6b 3 0.23 1717-8G→A I.10 3 0.23 1949del84 E.13 3 0.23 W1089X E.17b 3 0.23 R347P E.7 3 0.23 del E.3a E.3 2 0.16 R117H E.4 2 0.16 L558S E.11 2 0.16 A561E E.12 2 0.16 2603delT E.13 2 0.16 Y1092X E.17b 2 0.16 Q1100Pa E.17b 2 0.16 M1101K E.17b 2 0.16 delE.19a E.19 2 0.16 G1244E E.20 2 0.16 P5La E.1 1 0.08 Q30Xa E.2 1 0.08 G85Va E.3 1 0.08 E92Ka E.4 1 0.08 A120Ta E.4 1 0.08 I148T E.4 1 0.08 711+3A→Ta I.5 1 0.08 H199Y E.6a 1 0.08 875+1G→A I.6a 1 0.08 Table 1 (continued) Mutation Exon/intron CF alleles % 1717-1G→A I.10 1 0.08 L571S E.12 1 0.08 T582Ra E.12 1 0.08 E585X E.12 1 0.08 1898+3A→G I.12 1 0.08 G673X E.13 1 0.08 E692Xa E.13 1 0.08 R851X E.14a 1 0.08 R851La E.14a 1 0.08 A1006E E.17a 1 0.08 L1065Ra E.17b 1 0.08 F1074La E.17b 1 0.08 R1158X E.19 1 0.08 3667del4a E.19 1 0.08 3860ins31a E.20 1 0.08 3905insT E.20 1 0.08 4005+1G→A I.20 1 0.08 Q1281Xa E.20 1 0.08 Q1313X E.21 1 0.08 Known mutations (75) 1155 90.23 Unknown mutations 125 9.77 a Mutations discovered by the CF group of the Medical and Molecular Genetics Centre - IRO, Barcelona, Spain that range between 0.5% and 0.9%, representing 6.0% of the CF chromosomes. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
215 The Q779X (p.Gln779*) mutation was found in a CF-PS brother and sister with a [(TG)11T5; V562I; A1006E]/Q779X (c. Login to comment
288 The V562I (p.Val562Ile) and the A1006E (p.Ala1006Glu) were only found within the complex allele. Login to comment
377 [1210-14TG[11];1210-12T[5];1684G>A;3017C>A] CF-PS,CFTR-RD T5 varying clinical consequence; V562I nd; A1006E nd K442X c.1324A>T CF-PI nd p.Lys442* T465N c.1394C>A CF-PI nd p.Thr465Asn [S466X(TGA);R1070Q] c. Login to comment