ABCMdb

ABCC7 p.Gln552*

ClinVar:	c.1654C>T , p.Gln552* D , Pathogenic
CF databases:	c.1654C>T , p.Gln552* D , CF-causing c.1654C>A , p.Gln552Lys (CFTR1) D , The mutation Q552K was detected by DGGE and direct sequencing in a patient from Brazil (Afro-American origin), he is homozygous for this mutation, with PI and mild lung involvement.

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Two buffer PAGE system-based SSCP/HD analysis: a g... Eur J Hum Genet. 1999 Jul;7(5):590-8. Liechti-Gallati S, Schneider V, Neeser D, Kraemer R
Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease.
Eur J Hum Genet. 1999 Jul;7(5):590-8., [PMID:10439967]

Abstract [show]
The large size of many disease genes and the multiplicity of mutations complicate the design of an adequate assay for the identification of disease-causing variants. One of the most successful methods for mutation detection is the single strand conformation polymorphism (SSCP) technique. By varying temperature, gel composition, ionic strength and additives, we optimised the sensitivity of SSCP for all 27 exons of the CFTR gene. Using simultaneously SSCP and heteroduplex (HD) analysis, a total of 80 known CF mutations (28 missense, 22 frameshift, 17 nonsense, 13 splicesite) and 20 polymorphisms was analysed resulting in a detection rate of 97.5% including the 24 most common mutations worldwide. The ability of this technique to detect mutations independent of their nature, frequency, and population specificity was confirmed by the identification of five novel mutations (420del9, 1199delG, R560S, A613T, T1299I) in Swiss CF patients, as well as by the detection of 41 different mutations in 198 patients experimentally analysed. We present a three-stage screening strategy allowing analysis of seven exons within 5 hours and analysis of the entire coding region within 1 week, including sequence analysis of the variants. Additionally, our protocol represents a general model for point mutation analysis in other genetic disorders and has already been successfully established for OTC deficiency, collagene deficiency, X-linked myotubular myopathy (XLMTM), Duchenne and Becker muscular dystrophy (DMD, BMD), Wilson disease (WD), Neurofibromatosis I and II, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, and defects in mitochondrial DNA. No other protocol published so far presents standard SSCP/HD conditions for mutation screening in different disease genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 The distribution of analysed known mutations is similar to that of the total number of mutations in the entire CFTR gene: missense mutations account for 35% (G27E, G85E, R117H, A120T, I148T, H199Y, R334W, T338I, R347P, R347H, A455E, M718K, S5449N, S5449I, G551D, R560T, R560S, S945L, S977P, I1005R, R1066C, R1070Q, M1101K, D1152H, S1235R, R1283M, N1303K, N1303H), followed by 28% of frameshift mutations (175delC, 394delTT, 457TAT- > G, 905delG, 1078delT, I507, F508, 1609delCA, 1677delTA, 2143delT, 2176insC, 218delA, 2184insA, 2869insG, 3659delC, 3732delA, 3821delT, 3905insT, 4016insT, 4172delGC, 4382delA), 21% of nonsense mutations (Q30X, Q39X, Q220X, W401X, Q525X, G542X, Q552X, R553X, V569X, E585X, K710X, R792X, Y1092X, R1162X, S1255X, W1282X, E1371X), and 16% of splice site mutations (621 + 1G- > T, 711 + 1G- > T, 711 + 5G- > A, 1717-1G- > A, 1898 + 1G- > A, 1898 + 5G- > T, 2789 + 5G- > A, 3271 + 1G- > A, 3272-26A- > G, 3601-17T- > C, 3849 + 4A- > G, 3849 + 10kbC- > T, 4374 + 1G- > T). Login to comment

[hide] Effect of genistein on native epithelial tissue fr... Br J Pharmacol. 2000 Aug;130(8):1884-92. Mall M, Wissner A, Seydewitz HH, Hubner M, Kuehr J, Brandis M, Greger R, Kunzelmann K
Effect of genistein on native epithelial tissue from normal individuals and CF patients and on ion channels expressed in Xenopus oocytes.
Br J Pharmacol. 2000 Aug;130(8):1884-92., [PMID:10952679]

Abstract [show]
The flavonoid genistein has been shown to activate a Cl(-) conductance in various cell types expressing CFTR. We examined if similar effects can be observed when genistein is applied to native ex vivo tissues from human respiratory tract and rectum. We further compared the effects when genistein was applied to oocytes of Xenopus laevis expressing CFTR. In oocytes, both wtCFTR and DeltaF508-CFTR were activated by genistein while both cyclic AMP (K(v)LQT1) and Ca(2+) (SK4) activated K(+) channels were inhibited at high concentrations of genistein. Biopsies from nasal polyps and rectal mucosa were obtained from normal individuals (non-CF) and CF patients and in the presence of amiloride (10 micromol l(-1); mucosal side) the effects of genistein were assessed using a perfused Ussing chamber. In non-CF airway epithelia, genistein (50 micromol l(-1); mucosal side) increased lumen negative I(sc) but had no additional effects on tissues pre-stimulated with IBMX and forskolin (100 micromol l(-1) and 1 micromol l(-1); both sides). In non-CF rectal biopsies, in the presence of amiloride (10 micromol l(-1); mucosal side) and indomethacin (10 micromol l(-1); basolateral side), genistein increased lumen negative I(sc) and enabled cholinergic (carbachol; CCH, 100 micromol l(-1); basolateral side) stimulation of Cl(-) secretion indicating activation of luminal CFTR Cl(-) channels. However, after stimulation with IBMX/forskolin, genistein induced opposite effects and significantly inhibited CCH activated I(sc). In CF airway and intestinal tissues genistein failed to induce Cl(-) secretion. Thus, genistein is able to activate luminal CFTR Cl(-) conductance in non-CF tissues and mutant CFTR in oocytes. However, additional inhibitory effects on basolateral K(+) conductance and missing effects in native CF tissues do not support the use for pharmacological intervention in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 In all CF patients from whom rectal biopsies were studied DNA analysis was carried out for the following CFTR mutations: DF508; R117H and S108F in exon 4; R347P, R347H, I336K and T338I in exon 7; S549N, G551D, R553X, G542X, Q552X, 1717-1 G?A in exon 11; W1282X and 3905insT in exon 20; N1303K in exon 21 and 3849+10kB C?T in intron 19. Login to comment

[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]

Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 These were G91R, 711 ϩ 5GϾA, T338I, 712-1GϾT, Q359K/T360K, 1161delC, 1609delCA, S549I, Q552X, 1949del84, 1989 ϩ 5GϾT, S1251N, and R1283M. Login to comment

[hide] Analysis of the entire coding region of the cystic... Hum Mutat. 2001 Aug;18(2):166. Castellani C, Gomez Lira M, Frulloni L, Delmarco A, Marzari M, Bonizzato A, Cavallini G, Pignatti P, Mastella G
Analysis of the entire coding region of the cystic fibrosis transmembrane regulator gene in idiopathic pancreatitis.
Hum Mutat. 2001 Aug;18(2):166., [PMID:11462247]

Abstract [show]
Many Cystic Fibrosis (CF) carriers have been detected testing some subjects with chronic pancreatitis for a limited number of mutations. The aim of this study was to find out if some subjects with pancreatitis and a CFTR mutation actually carry another, undetected mutation. We screened for 18 CFTR mutations plus the CFTR intron 8 poly(T) tract length a population of 67 patients suffering from idiopathic either acute, or recurrent acute, or chronic pancreatitis. Three of them were diagnosed as affected by CF. Among the others, a subset of 14 (8 CFTR mutation carriers, 4 5T carriers, and 2 sweat chloride borderliners) was selected and analyzed by denaturing gradient gel electrophoresis. Six possibly CF-related mutations were detected: L997F and 3878delG were found in two of the subjects already carrying another mutation, S1235R and L997F in one patient carrying the 5T, and L997F and D614G in the two patients with borderline sweat chloride. Among the 14 selected cases a total of 11 patients carried at least one mutation, and three of them were compound heterozygotes. Though it is debatable whether these three individuals can be considered affected by CF, their pancreatitis is possibly a clinical manifestation of some CFTR-related disease. Hum Mutat 18:166, 2001.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 Genetic analysis Phase 1 - Patients were tested for the following mutations: F508del, I507del, R117H, R1162X, 2183AA>G, N1303K, 3849+10KbC>T, G542X, 1717-1G>A, R347P, R352Q, R553X, Q552X, G85E, 711+5G>A, W1282X, 3132delTG and 2789+5G>A, plus the CFTR intron 8 poly(T) tract length. Login to comment

[hide] Cystic fibrosis mutation testing in Italy. Genet Test. 2001 Fall;5(3):229-33. Bombieri C, Pignatti PF
Cystic fibrosis mutation testing in Italy.
Genet Test. 2001 Fall;5(3):229-33., [PMID:11788089]

Abstract [show]
In Italy, Cystic fibrosis (CF) mutation frequency differences have been observed in different regions. In the northeastern Veneto and Trentino Alto Adige regions, a complete cystic fibrosis transmembrane conductance regulator (CFTR) gene screening in CF patients detected through a newborn screening program has identified about 90% of the mutations. In these two regions, the current detection rate using a CF screening panel containing the 16 most common mutations is 86.6%. CF mutations in some other Italian regions have not been so thoroughly analysed. Available data indicate that a more general national screening panel comprising 31 mutations may detect about 75% of all CF mutations in Italy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 CF MUTATIONS IDENTIFIED IN TWO ITALIAN REGIONS (VENETO AND TRENTINO ALTO ADIGE) Number of alleles Frequency Cumulative Mutation with mutation (%) frequency (%) DF508 107 47.6 47.56 R1162X 22 9.8 57.33 2183 AA ® G 21 9.3 66.67 N1303K 9 4.0 70.67 G542X 6 2.7 73.33 711 1 5 G ® A 6 2.7 76.00 1717-1 G ® A 5 2.2 78.22 G85E 3 1.3 79.56 R553X 3 1.3 80.89 2789 1 5 G ® A 3 1.3 82.22 Q552X 3 1.3 83.56 621 1 1 G ® T 2 0.9 84.44 W1282X 2 0.9 85.33 R347P 1 0.4 85.77 G551D 1 0.4 86.21 3849 1 10 Kb C ® T 1 0.4 86.67a 3132 del TG 2 0.9 87.54 2790-2 A ® G 2 0.9 88.43 457 TAT ® G 1 0.4 88.87 1717-8 G ® A 1 0.4 89.31 R709X 1 0.4 89.75 1898 1 3 A ® G 1 0.4 90.22 Total 203 90.22 Numbers refer to CFTR gene alleles carrying the specified mutation, over total tested alleles (n 5 225) from the affected subjects CF cohort, as indicated in the text (from Bonizzato et al., 1995). Login to comment
38 CF MUTATION PANEL (VENETO AND TRENTINO ALTO ADIGE ITALIAN REGIONS) DF508 R1162X 2183 AA ® G N1303K G542X 711 1 5 G ® A 1717-1 G ® A G85E R553X 2789 1 5 G ® A Q552X 621 1 1 G ® T W1282X R347P G551D 3849 1 10 Kb C ® T Note: Contrary to what is suggested for the U.S. population (Grody et al., 2001), R117H mutation (and its reflex IVS8-5T test) is not included in the panel because it is not commonly found in the Italian CF population (Bonizzato et al., 1995; Estivill et al., 1997; Rendine et al., 1997). Login to comment
44 CF GENE MUTATIONS IN ITALY Number of alleles Frequency Cumulative Mutation screened (%) frequency (%) DF508 3442 51.07 51.07 N1303K 3056 4.84 55.91 G542X 3082 4.83 60.75 2183 AA ® G 2596 2.66 63.41 R1162X 2580 2.42 65.83 1717-1 G ® A 2892 2.11 67.94 W1282X 2600 1.23 69.17 R553X 2882 1.15 70.31 T338I 2306 0.69 71.01 R347P 2642 0.61 71.61 711 1 5 G ® A 2454 0.57 72.18 G85E 1980 0.40 72.59 621 1 1 G ® T 2594 0.39 72.97 R334W 2366 0.30 73.27 R352Q 2112 0.24 73.50 S549N 2118 0.24 73.74 R347H 2184 0.18 73.92 L1077P 1840 0.16 74.09 R1158X 1878 0.16 74.25 541del C 1884 0.16 74.40 R1066H 1918 0.16 74.56 E585X 1922 0.16 74.72 Q552X 2172 0.14 74.86 D1152H 1824 0.11 74.97 2790-2 A ® G 1862 0.11 75.07 3132 del TG 1862 0.11 75.18 3667ins 4 1876 0.11 75.29 DI507 1914 0.10 75.39 1898 1 3 A ® G 1920 0.10 75.50 G1244E 1960 0.10 75.60 1784 del G 2052 0.10 75.69 From Rendine et al. (1997). Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
110 Germany ∆F508 (71.8%) 1789+5G→A (0.9%) 87.6 76.7 17 5662/1316 Dörk et al. [1992]; Dörk et al. R553X (2.0%) 3272-26A→G (0.9%) [1994]; Tümmler et al. [1996]; N1303K (1.8%) W1282X (0.7%) Estivill et al. [1997]; Dörk et G542X (1.2%) 2143delT (0.7%) al. [2000] R347P (1.2%) 1078delT (0.6%) CFTRdele2,3 (1.2%) 2183AA→G (0.6%) 3849+10KbC→T (1.0%) 2184insA (0.6%) G551D (0.9% 3659delC (0.6%) 1717-1G→A (0.9%) Greece ∆F508 (52.9%) 3272-26A→G (0.8%) 82.2 67.6 22 2097/718 Kanavakis et al. [1995]; Estivill 621+1G→T (5.0%) R1070Q (0.8%) et al. [1997]; Tzetis et al. G542X (4.1%) W496X (0.7%) [1997]; Macek et al. [2002] N1303K (3.3%) 621+3A→G (0.7%) 2183AA→G (1.8%) ∆I507 (0.7%) 2789+5G→A (1.7%) W1282X (0.7%) E822X (1.6%) 574delA (0.7%) R117H (1.2%) 1677delTA (0.7%) R334W (1.1%) A46D (0.6%) R1158X (1.0%) 3120+1G→A (0.6%) G85E (1.0%) G551D (0.5%) Hungary ∆F508 (54.9%) W1282X (1.8%) 68.3 46.6 9 1133/976 CFGAC [1994]; Estivill et al. 1717-1G→A (1.9%) G542X (1.7%) [1997]; Macek et al. [2002] R553X (2.1%) N1303K (1.3%) Y1092X (1.8%) G551D (1.0%) S1196X (1.8%) Ireland ∆F508 (70.4%) G542X (1.0%) 82.1 67.4 7 801/509 CFGAC [1994]; Estivill et al. G551D (5.7%) 621+1G→T (0.8%) [1994] R117H (2.4%) 1717-1G→A (0.6%) R560T (1.2%) Italy ∆F508 (50.9%) ∆I507 (0.65%) 60.3 36.4 9 3524 Estivill et al. [1997] (total) G542X (3.1%) W1282X (0.62%) 1717-1G→A (1.6%) Y122K (0.59%) N1303K (1.4%) G551D (0.53%) R553X (0.94%) Italy ∆F508 (47.6%) R553X (1.3%) 87.1 75.9 15 225 Bonizzato et al. [1995] (Northeast) R1162X (9.8%) 2789+G→A (1.3%) 2183AA→G (9.3%) Q552X (1.3%) N1303K (4.0%) 621+1G→T (0.9%) G542X (2.7%) W1282X (0.9%) 711+5G→A (2.7%) 3132delTG (0.9%) 1717-1G→A (2.2%) 2790-2A→G (0.9%) G85E (1.3%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS583 Italy ∆F508 (56.4%) 711+1G→T (1.3%) 85.7 73.4 13 660/396 Castaldo et al. [1996]; Castaldo (southern) N1303K (6.8%) G1244E (1.3%) et al. [1999] G542X (5.7%) R1185X (1.3%) W1282X (3.8%) L1065P (1.3%) 1717-1G→A (2.3%) R553X (1.1%) 2183AA→G (1.9%) I148T (0.7%) 4016insT (1.8%) Latvia 1) DF508 (58.3%) 4) CFTRdele2,3 (2.8%) - - 6 36 Dörk et al. [2000]; Macek et al. 2) 3849+10KbC®T (8.3%) 5) W1282X (2.8%) [2002] 3) N1303K (5.6%) 6) 394delTT (2.8%) Lithuania ∆F508 (31.0%) N1303K (2.0%) 39.0 15.2 4 94 Dörk et al. [2000]; Macek et al. R553X (4.0%) CFTRdele2,3 (2.0%) [2002] Macedonia ∆F508 (54.3%) 711+3A→G (1.0%) 69.2 47.9 12 559/226 Petreska et al. [1998]; Dörk et G542X (4.2%) 3849G→A (1.0%) al. [2000]; Macek et al. N1303K (2.0%) 2184insA (0.9%) [2002] CFTRdele2,3 (1.3%) 457TAT→G (0.7%) 621+1G→T (1.3%) V139E (0.7%) 611-1G→T (1.2%) 1811+1G→C (0.6%) Netherlands ∆F508 (74.2%) R1162X (0.9%) 86.8 75.3 9 3167/1442 Gan et al. [1995]; Estiville et al. A455E (4.7%) S1251N (0.9%) [1997]; Collee et al. [1998] G542X (1.8%) N1303K (0.9%) 1717-1G→A (1.5%) W1282X (0.7%) R553X (1.2%) Norway ∆F508 (60.2%) G551D (1.2%) 69.8 48.7 6 410/242 Schwartz et al. [1994]; Estivill 394delTT (4.2%) G542X (0.6%) et al. [1997] R117H (3.0%) N1303K (0.6%) Poland ∆F508 (57.1%) CFTRdele2,3 (1.8%) 73.5 54.0 11 4046/1726 CFGAC [1994]; Estivill et al. 3849+10Kb C→T (2.7%) R560T (1.5%) [1997]; Dörk et al [2000]; G542X (2.6%) W1282X (0.7%) Macek et al. [2002] 1717-1G→A (2.4%) ∆I507 (0.5%) R553X (1.9%) G551D (0.5%) N1303K (1.8%) Portugal ∆F508 (44.7%) R334W (0.7%) 49.7 24.7 5 739/454 CFGAC [1994]; Estivill et al. G542X (1.6%) N1303K (0.7%) [1997] R1066C (2.0%) Romania ∆F508 (36.6%) G542X (1.4%) 51.5 26.5 11 224/74 CFGAC [1994]; Estivill et al. 2043delG (2.0%) R553X (1.4%) [1997]; Popa et al. [1997]; W1282X (1.7%) G576X (1.4%) Macek et al. [2002] 1717-2A→G (1.4%) 1898+1G→A (1.4%) I148T (1.4%) 2183AA→G (1.4%) 621+1G→T (1.4%) Russia ∆F508 (54.4%) 552insA (0.9%) 70.7 50.0 12 5073/2562 CFGAC [1994]; Estivill et al. CFTRdele2,3 (5.0%) G542X (0.9%) [1997]; Dörk et al. [2000]; R553X (3.5%) R334W (0.9%) Macek et al. [2002] 2183AA→G (1.3%) 1677delTA (0.8%) W1282X (1.0%) Y122X (0.5%) 394delTT (1.0%) 1367del5 (0.5%) (Continued) BOBADILLAETAL. Login to comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

[hide] Correction of G551D-CFTR transport defect in epith... Br J Pharmacol. 2002 Oct;137(4):504-12. Zegarra-Moran O, Romio L, Folli C, Caci E, Becq F, Vierfond JM, Mettey Y, Cabrini G, Fanen P, Galietta LJ
Correction of G551D-CFTR transport defect in epithelial monolayers by genistein but not by CPX or MPB-07.
Br J Pharmacol. 2002 Oct;137(4):504-12., [PMID:12359632]

Abstract [show]
1. This study compares the effect of three chemically unrelated cystic fibrosis transmembrane conductance regulator (CFTR) activators on epithelial cell monolayers expressing the G551D-CFTR mutant. 2. We measured Cl(-) transport as the amplitude of short-circuit current in response to the membrane permeable cAMP analogue 8-(4-chlorophenylthio)adenosine-3'-5'-cyclic monophosphate (CPT-cAMP) alone or in combination with a CFTR opener. The correction of G551D-CFTR defect was quantified by comparison with maximal activity elicited in cells expressing wild type CFTR. To this end we used Fisher rat thyroid (FRT) cells transfected with wild type or G551D CFTR, and primary cultures of human nasal epithelial cells. 3. In both types of epithelia, cAMP caused activation of Cl(-) transport that was inhibited by glibenclamide and not by 4,4'-diisothiocyanato-stilbene-2,2'-disulfonic acid. After normalising for CFTR expression, the response of FRT-G551D epithelia was 1% that of wild type monolayers. 4. Addition of genistein (10-200 micro M), but not of 8-cyclopentyl-1,3-dipropylxanthine (CPX, 1-100 micro M) or of the benzo[c]quinolizinium MPB-07 (10-200 micro M) to FRT-G551D epithelia pre-treated with cAMP, stimulated a sustained current that at maximal genistein concentration corresponded to 30% of the response of wild type epithelia. 5. The genistein dose-response curve was bell-shaped due to inhibitory activity at the highest concentrations. The dose-dependence in G551D cells was shifted with respect to wild type CFTR so that higher genistein concentrations were required to observe activation and inhibition, respectively. 6. On human nasal epithelia the correction of G551D-CFTR defective conductance obtained with genistein was 20% that of wild type. The impressive effect of genistein suggests that it might correct the Cl(-) transport defect on G551D patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 The second mutation is presently unknown, but is not one of the 15 most frequent mutations found in the CF patients of Northeast Italy, namely F508del, I507del, R1162X, 2183AA4G, N1303K, 3849+10KbC4T, G542X, 1717-1G4A, R553X, Q552X, G85E, 711+5G4A, 3132delTG, 2789+5G4A, W1282X. Login to comment

[hide] Clinical characteristics and genotype analysis of ... Clin Otolaryngol Allied Sci. 2003 Apr;28(2):125-32. Cimmino M, Cavaliere M, Nardone M, Plantulli A, Orefice A, Esposito V, Raia V
Clinical characteristics and genotype analysis of patients with cystic fibrosis and nasal polyposis.
Clin Otolaryngol Allied Sci. 2003 Apr;28(2):125-32., [PMID:12680831]

Abstract [show]
The prevalence of nasal polyps in a group of paediatric patients with cystic fibrosis was prospectively studied in comparison with a control group with cystic fibrosis but without polyps. Clinical variables, including pulmonary function tests, skin testing and mucociliary transport, were carried out in both groups, as well as genotype analysis. Endoscopic intranasal evaluation identified polyps in 29 of 89 patients (33%). Statistical analysis revealed that patients with nasal polyposis had better pulmonary function, a higher rate of Pseudomonas aeruginosa colonization, more hospitalizations, and more prevalence of allergy to Aspergillus fumigatus than did the comparison group. We found no statistically different genotype distribution between the polyposis and the control group. However, it can be emphasized that the prevalence of the compound heterozygous genotype is higher in the nasal polyposis group than in controls. Our observations suggest that other genetic and environmental factors could play an important role in the development of nasal polyposis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 Analysis of mutations in the CFTR gene as tested by the multiplex polymerase chain reaction (PCR), followed by the reverse dot-blot technique, which searches for 29 of the most frequent mutations (DF508, N1303K, G542X, W1282X, 1717±1 G-A, R553X, 2183 AA-G, DI507, G551D, R560T, 3849 10kbC > T, R1162X, 3659delC, 3905insT, G85E, 621 1GT, R117H, R347P, R334W, A455E, 2789 5GA, Q552X, S1251N, 3905insT, 394delTT, E60X, 2143delT, 2184delA, 711 5G > A), and by ASO dot-blot for the following mutations: I148T, R1158X, 4016 1T, G1244E G >A.26 Statistical analysis was performed using multivariate analysis, by forward stepwise comparison; it was done to ®nd out which of the examined characteristics could be associated (P < 0.01) to nasal polyposis. Login to comment

[hide] Mutation analysis of the cystic fibrosis transmemb... Eur J Hum Genet. 2003 Sep;11(9):687-92. Perri F, Piepoli A, Stanziale P, Merla A, Zelante L, Andriulli A
Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis.
Eur J Hum Genet. 2003 Sep;11(9):687-92., [PMID:12939655]

Abstract [show]
Susceptibility to alcoholic chronic pancreatitis (ACP) could be genetically determined. Mutations in cationic trypsinogen (PRSS1), cystic fibrosis transmembrane conductance regulator (CFTR), and serine protease inhibitor, Kazal type 1 (SPINK1) genes have been variably associated with both the hereditary and the idiopathic form of chronic pancreatitis (CP). Our aim was to analyze the three genes in ACP patients. Mutational screening was performed in 45 unrelated ACP patients and 34 patients with alcoholic liver disease (ALD). No mutation of PRSS1 was found in ACP and ALD patients. Three mutations of CFTR were detected in four ACP patients with a prevalence (8.9%) not significantly different from that observed (3.0%) in ALD patients and from that expected (3.2%) in our geographical area. Neither compound heterozygotes for CFTR nor trans-heterozygotes for CFTR/SPINK1 were found. One ACP patient (2.2%) was found to carry the most common mutation (N34S) of SPINK1 compared to none of the ALD patients (P=NS). In five other patients (two with ACP and three with ALD) other rare variants, including P55S, were found. In contrast with the hereditary and the idiopathic forms of CP, in which mutations of PRSS1, CFTR, and SPINK1 genes may occur, ACP is still a "gene(s)-orphan" disease. The supposed genetic susceptibility to ACP relies on other yet unknown gene(s) which could affect the alcohol metabolism or modulate the pancreatic inflammatory response to alcohol abuse.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Other seven mutations, frequently observed in Italian CF patients (Q552X; 711+5G4A; 2790-2A4G; S589N; T338I; 1898+3A4G, and 1717-8G4A), were examined by sequencing. Login to comment

[hide] Mutations of the CFTR gene in pancreatic disease. Pancreas. 2003 Nov;27(4):332-6. Pezzilli R, Morselli-Labate AM, Mantovani V, Romboli E, Selva P, Migliori M, Corinaldesi R, Gullo L
Mutations of the CFTR gene in pancreatic disease.
Pancreas. 2003 Nov;27(4):332-6., [PMID:14576497]

Abstract [show]
INTRODUCTION: An association has been found between CFTR gene mutations and chronic pancreatitis; however, there is a lack of information about the frequency of CFTR gene mutations in acute pancreatitis and in pancreatic cancer. AIM: To prospectively evaluate the prevalence of CFTR gene mutations in acute pancreatitis, chronic pancreatitis, and pancreatic cancer. METHODOLOGY: Ninety-eight consecutive patients were studied and divided into 3 groups: 34 patients with acute pancreatitis, 46 patients with chronic pancreatitis, and 18 patients with pancreatic cancer. The mutation analysis of the CFTR gene was carried out using diagnostic commercial kits for the simultaneous detection of 29 mutations and Tn polymorphism. RESULTS: Among the 98 patients studied, 12 (12.2%) had CFTR gene mutations: 2 of the 34 patients (5.9%) with acute pancreatitis, 9 of the 46 (19.6%) with chronic pancreatitis, and 1 of the 18 (5.6%) with pancreatic cancer. All the mutations were found in heterozygosis (2 DeltaF508, 1 W1282X, and 9 T5 allele). CONCLUSION: Our prospective study adds further information about the frequency of CFTR mutations in patients with a single episode of acute pancreatitis. Furthermore, our results suggest an association of CFTR gene mutations with chronic alcoholic pancreatitis and emphasize the need for a multicenter study, possibly multinational, to conclusively establish the role of CFTR mutations as a genetic susceptibility factor for this disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 The 29 Mutations and the Tn Polymorphism Which Can Be Detected by INNO-LiPA Assays Mutation Exon/Intron (i) E60X, G85E, 394delTT 3 621 + 1G > T, R117H (i) 4, 4 711 + 5G > A (i) 5 1078delT, R347P, R334W 7 A455E, Tn (i) 8, 9 ⌬F508, ⌬I507 10 G542X, 1717-1 G > A, G551D, R553X, R560T, Q552X (i) 10, 11 2183AA > G, 2184del A, 2143delT 13 2789 + 5G > A (i) 14b R1162X, 3659delC 19 3849 + 10kbC > T (i) 19 3905insT, W1282X, S1251N 20 N1303K 21 Group 3: pancreatic cancer CFTR gene mutations were identified only in 1 of the 18 patients (5.6%) with this cancer. Login to comment

[hide] Molecular analysis using DHPLC of cystic fibrosis:... BMC Med Genet. 2004 Apr 14;5:8. D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PMID:15084222]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a multisystem disorder characterised by mutations of the CFTR gene, which encodes for an important component in the coordination of electrolyte movement across of epithelial cell membranes. Symptoms are pulmonary disease, pancreatic exocrine insufficiency, male infertility and elevated sweat concentrations. The CFTR gene has numerous mutations (>1000) and functionally important polymorphisms (>200). Early identification is important to provide appropriate therapeutic interventions, prognostic and genetic counselling and to ensure access to specialised medical services. However, molecular diagnosis by direct mutation screening has proved difficult in certain ethnic groups due to allelic heterogeneity and variable frequency of causative mutations. METHODS: We applied a gene scanning approach using DHPLC system for analysing specifically all CFTR exons and characterise sequence variations in a subgroup of CF Italian patients from the Lazio region (Central Italy) characterised by an extensive allelic heterogeneity. RESULTS: We have identified a total of 36 different mutations representing 88% of the CF chromosomes. Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). CONCLUSION: Using this approach, we were able to increase our standard power rate of mutation detection of about 11% (77% vs. 88%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment

[hide] Frequency of large CFTR gene rearrangements in Ita... Eur J Hum Genet. 2005 May;13(5):687-9. Bombieri C, Bonizzato A, Castellani C, Assael BM, Pignatti PF
Frequency of large CFTR gene rearrangements in Italian CF patients.
Eur J Hum Genet. 2005 May;13(5):687-9., [PMID:15741992]

Abstract [show]
In most populations, an appreciable fraction of cystic fibrosis transmembrane regulator (CFTR) gene mutations in patients affected by cystic fibrosis (CF) cannot be identified, and large gene rearrangements might be missed by standard analyses. We have searched large gene rearrangements in a sample of 25 North East Italian CF patients who, after an extensive gene analysis of 188 patients, still bear one or two unidentified CF mutations. A systematic gene screening by quantitative multiplex PCR of short fluorescent fragments was performed. Overall, 5/26 (19.2%) rearranged alleles were detected, bearing mutation 3120+1Kbdel8.6Kb (three patients), and c.4_IVS1+69del119bpins299bp (two patients). These mutations were observed in compound heterozygotes with F508del or termination mutations, and a pancreatic insufficient form of CF. These findings confirm the frequency of CFTR gene rearrangements recently observed in French CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 In all patients, the rearrangements are present in compound heterozygosity with a common CF mutation (F508del, G542X, or Q552X). Login to comment

[hide] Cystic fibrosis carriers have higher neonatal immu... Am J Med Genet A. 2005 Jun 1;135(2):142-4. Castellani C, Picci L, Scarpa M, Dechecchi MC, Zanolla L, Assael BM, Zacchello F
Cystic fibrosis carriers have higher neonatal immunoreactive trypsinogen values than non-carriers.
Am J Med Genet A. 2005 Jun 1;135(2):142-4., 2005-06-01 [PMID:15832355]

Abstract [show]
Following cystic fibrosis (CF) neonatal screening implementation, a high frequency of heterozygotes has been reported among neonates with elevated immunoreactive trypsinogen (IRT) and normal sweat chloride levels. We studied the relationship between normal IRT values and CF heterozygosity: 10,000 neonates were screened for CF by IRT measurement and tested for 40 CF mutations; the 294 carriers detected were coupled with newborns negative to the same genetic testing, and the two groups' IRT levels compared. Heterozygotes had higher IRT levels than their controls (mean 35.32 vs. 27.58 microg/L, P<0.001). Even within normal trypsinogen range, the probability of being a CF carrier increases with neonatal IRT concentration.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 Distribution and Classification of the Tested Mutations in the Normal IRT Heterozygote Population Under Study Mutations Type of mutation Class of mutation Number of cases F508del Severe II 161 N1303K Severe II 19 G542X Severe I 19 711 þ 5G > A - V 15 R117H Mild IV 13 R1162X Severe I 13 R553X Severe I 11 G85E - IV 8 2183AA > G Severe I 8 1717-1G > A Severe I 8 R334Q Mild - 4 Q552X Severe I 4 W1282X Severe I 3 2789 þ 5G > A Mild V 2 1898 þ 3A > G Mild V 2 T338I Mild IV 1 R709X Severe I 1 R347H Mild IV 1 3849 þ 10KbC > T Mild V 1 Total 294 Other tested mutations: 1078delTn1609delCAn1717-8g/an394delTTn457TAT> Gn541delCn621 þ 1g/tn711 þ 1g/tnA559TnDI507nG551DnR1158XnR334Wn R347PnR352QnS549InS549NnS549Ra/cn2790-2G > An1811 þ 1.2KbA > G; 711þ5G > A and G85E not categorized in type of mutation; R334Q not categorized in class of mutation. Login to comment

[hide] Screening of mutations in the CFTR gene in 1195 co... Eur J Hum Genet. 2005 Aug;13(8):959-64. Stuppia L, Antonucci I, Binni F, Brandi A, Grifone N, Colosimo A, De Santo M, Gatta V, Gelli G, Guida V, Majore S, Calabrese G, Palka C, Ravani A, Rinaldi R, Tiboni GM, Ballone E, Venturoli A, Ferlini A, Torrente I, Grammatico P, Calzolari E, Dallapiccola B
Screening of mutations in the CFTR gene in 1195 couples entering assisted reproduction technique programs.
Eur J Hum Genet. 2005 Aug;13(8):959-64., [PMID:15870824]

Abstract [show]
Genetic testing of the cystic fibrosis transmembrane conductance (CFTR) gene is currently performed in couples undergoing assisted reproduction techniques (ART), because of the high prevalence of healthy carriers in the population and the pathogenic relationship with congenital bilateral absence of vas deferens (CBAVD). However, discordant data have been reported concerning the usefulness of this genetic test in couples with no family history of cystic fibrosis (CF). In this study, we report the results of CFTR molecular screening in 1195 couples entering ART. Genetic testing was initially carried out in a single partner of each couple. CFTR mutations were detected in 55 subjects (4.6%), a percentage that overlaps with the one reported in the general population. However, significantly higher frequencies of were found in CBAVD individuals (37.5%) and in males with nonobstructive azoospermia (6.6%). The 5T allele was found in 78 patients (6.5%). This figure was again significantly different in males with nonobstructive-azoospermia (9.9%) and in those with CBAVD (100%). All together, 139 subjects (11.6%) had either a CFTR mutation or the 5T allele. Subsequent molecular analysis of their partners disclosed a CFTR mutation or 5T allele in nine cases (6.5%). However, none of these couples had CFTR alterations in both members, a CFTR mutation being invariably present in one partner and the 5T allele in the other. In order to improve genetic counselling of these couples, the TG-M470V-5T association was analyzed, and a statistically significant relationship between 12TG-V470 and CBAVD was detected.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 of detected carriers Prevalence among detected CFTR mutations DF508 40 (3.34%) 65.58% DI507 0 0 G542X 6 (0.50%) 9.84% 1717-1G-A 1 (0.08%) 1.64% G551D 0 0 R553X 0 0 R560T 0 0 Q552X 0 0 W1282X 7 (0.58 %) 11.48% S1251N 0 0 N1303K 3 (0.20%) 4.91% 394delTT 0 0 G85E 3 (0.25%) 4.91% E60X 0 0 621+1G-T 0 0 R117H 0 0 1078delT 0 0 R347P 0 0 R334W 0 0 2143delT 0 0 2183AA-G 0 0 2184delA 0 0 711+5G-A 0 0 2789+5G-A 1 (0.08%) 1.64% R1162X 0 0 3659del5 0 0 3849+10kbC-T 0 0 A455E 0 0 5T 78 (6.52%) Table 2 Distribution of CFTR mutations and 5T allele according to phenotype for the 1195 individuals Phenotype CF/WT 5T/WT CF/5T WT/WT Infertile males (non-CBAVD), N ¼ 304 20 (6.58%) 30 (9.87%) 0 254 (83.55%) Infertile males (CBAVD), N ¼ 16 0 10 (62.50%) 6 (37.50 %) 0 Infertile females, N ¼ 93 5 (5.37%) 7 (7.53%) 0 81 (87.10%) Unexplained infertility, N ¼ 782 30 (3.84%) 31 (3.96%) 0 721 (92.20%) Total ¼ 1195 55 (4.60%) 78 (5.50%) 6 (0.50%) 1056 (88.40%) CFTR alteration was detected, including a mutation in three cases and the 5T polymorphism in the remaining six. Login to comment

[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2003 Dec;24(6):629-38. Gallati S
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2003 Dec;24(6):629-38., [PMID:16088579]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene, which encodes a protein expressed in the apical membrane of exocrine epithelial cells. CFTR functions principally as a cyclic adenosine monophosphate (cAMP)-induced chloride channel and appears capable of regulating other ion channels. Mutations affect CFTR through a variety of molecular mechanisms, which can produce little or no functional gene product at the apical membrane. More than 1000 different disease-causing mutations within the CFTR gene have been described. The potential of a mutation to contribute to the phenotype depends on its type, localization in the gene, and the molecular mechanism as well as on interactions with secondary modifying factors. Genetic testing can confirm a clinical diagnosis of CF and can be used for infants with meconium ileus, for carrier detection in individuals with positive family history and partners of proven CF carriers, and for prenatal diagnostic testing if both parents are carriers. Studies of clinical phenotype in correlation with CFTR genotype have revealed a very complex relationship demonstrating that some phenotypic features are closely determined by the underlying mutations, whereas others are modulated by modifier genes, epigenetic mechanisms, and environment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 In effect, virtually no func- Table 2 Unusually Common Cystic Fibrosis Mutations in Specific Populationsa Total Exon/ Number Number Frequency Mutation Intron Ethnic Origin Observed Screened (%) 296+12T→C intron 02 Pakistani 02 24 8.33 E60X exon 03 Belgian 06 394 1.52 G91R exon 03 French 04 266 1.50 394delTT exon 03 Scandinavian 78 1588 4.91 457TAT→G exon 04 Austrian 04 334 1.20 Y122X exon 04 Réunion Island 14 29 48.27 I148T exon 04 French Canadian 06 66 9.09 711+5G→A intron 05 Italian (North East) 06 225 2.67 1078delT exon 07 Celtic 27 475 5.68 1161delC exon 07 Pakistani 02 24 8.33 T338I exon 07 Italian, Sardinian 04 86 4.65 Q359K/T360K exon 07 Georgian Jews 07 8 87.50 R347H exon 07 Turkish 04 134 2.98 1609delCA exon 10 Spanish 03 96 3.12 1677delTA exon 10 Bulgarian 05 222 2.25 S549I exon 11 Arabs 02 40 5.00 Q552X exon 11 Italian (North East) 03 225 1.33 A559T exon 11 African-American 02 79 2.53 1811+1.2kbA→G intron 11 Spanish 22 1068 2.06 1898+5G→T intron 12 Chinese 03 10 30.00 1949del84 exon 13 Spanish 02 136 1.47 2143delT exon 13 Russian 04 118 3.39 2183AA→G exon 13 Italian (North East) 21 225 9.33 2184insA exon 13 Russian 03 118 2.54 3120+1G→A intron 16 African-American 14 112 12.50 3272-26A→G intron 17a Portugese, French 06 386 1.55 R1066C exon 17b Portugese 05 105 4.76 R1070Q exon 17b Bulgarian 04 166 2.41 Y1092X exon 17b French Canadian, 11 725 1.52 French M1101K exon 17b Hutterite 22 32 68.75 3821delT exon 19 Russian 03 118 2.54 S1235R exon 19 French (South) 04 340 1.18 S1251N exon 20 Dutch, Belgian 11 792 1.39 S1255X exon 20 African-American 02 79 2.53 3905insT exon 20 Swiss 45 982 4.58 Amish, Arcadian 13 86 15.12 W1282X Exon 20 Jewish-Ashkenazi 50 95 52.63 R1283M exon 20 Welsh 03 183 1.64 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/. Login to comment
67 SSCP analysis is one of the most popular methods for the detection of sequence variants in polymerase chain reaction (PCR) amplified DNA fragments.29 The princi- Table 3 Cystic Fibrosis Mutations Detected by Commercial Kits INNO-LiPA Mutations CF2 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K CFTR12 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K, S1251N, R560T, 3905insT, Q552X CFTR17+Tn 394delTT, G85E, 621+1G→T, R117H, 1078delT, R347P, R334W, E60X, 2183AA→G, 2184delA, 711+5G→A, 2789+5G→A, R1162X, 3659delC, 3849+10kbC→T, 2143delT, A455E, (5T/7T/9T) Elucigene CF4 ⌬F508, G542X, G551D, 621+1G→T CF12 ⌬F508, G542X, G551D, N1303K, W1282X, 1717-1G→A, R553X, 621+1G→T, R117H, R1162X, 3849+10kbC→T, R334W CF20 1717-1G→A, G542X, W1282X, N1303K, ⌬F508, 3849+10kbC→T, 621+1G→T, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA→G, 3659delC, 1078delT, ⌬I507, R345P, S1251N, E60X CF Poly-T 5T/7T/9T OLA CF OLA assay ⌬F508, F508C, ⌬I507, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183AA→G, 2789+5G→A b Figure 2 Mutation screening of exon 19 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene using polymerase chain reaction (PCR) followed by single-strand conformation polymorphism/heteroduplex (SSCP/HD) analysis on a silver-stained polyacrylamide gel. Login to comment

[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]

Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T. Login to comment
79 Concerning instead the mutations found in the male group, besides ∆F508 the following have been found: 2789+5 g/a, 711+5 g/a, D1152H, G85E, N1303K, Q552X, R1158X, R117H, R334Q, R334W and R553X. Login to comment

[hide] Mutations of the CFTR gene in idiopathic pancreati... Pancreas. 2005 Nov;31(4):350-2. Gullo L, Mantovani V, Manca M, Migliori M, Bastagli L, Pezzilli R
Mutations of the CFTR gene in idiopathic pancreatic hyperenzymemia.
Pancreas. 2005 Nov;31(4):350-2., [PMID:16258369]

Abstract [show]
OBJECTIVES: Idiopathic pancreatic hyperenzymemia is a new syndrome that is characterized by a chronic increase of serum pancreatic enzymes in the absence of pancreatic disease. The aim of this study was to assess whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene may have a role in the etiology of this hyperenzymemia. METHODS: Seventy subjects with idiopathic pancreatic hyperenzymemia, 44 men and 26 women (mean age, 48 years; range, 8-74 years), were studied. Thirteen of these 70 subjects had the familial form of the syndrome. The mutation analysis of the CFTR gene was carried out using diagnostic commercial kits for the simultaneous detection of 29 mutations and Tn polymorphism. RESULTS: Among the 70 subjects studied, 7 (10.0%) had CFTR gene mutations. None of these 7 subjects had the familial form of pancreatic hyperenzymemia. These mutations were DeltaF 508 in 1 subject, 2789 + 5 G > A in another subject, and T5 allele in the remaining 5. All these mutations were heterozygous, with the exception of 1 T5 allele that was homozygous in 1 subject. CONCLUSIONS: The frequencies of the mutations of the CFTR gene found in these subjects are similar to the carrier frequencies in the general Italian population. This finding does not support a role for CFTR gene mutations in the etiology of idiopathic pancreatic hyperenzymemia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 A, G551D, R553X, R560T, Q552X (i) 10, 11 2183AA . Login to comment

[hide] Analysis of CFTR, SPINK1, PRSS1 and AAT mutations ... J Pediatr Gastroenterol Nutr. 2006 Sep;43(3):299-306. Sobczynska-Tomaszewska A, Bak D, Oralewska B, Oracz G, Norek A, Czerska K, Mazurczak T, Teisseyre M, Socha J, Zagulski M, Bal J
Analysis of CFTR, SPINK1, PRSS1 and AAT mutations in children with acute or chronic pancreatitis.
J Pediatr Gastroenterol Nutr. 2006 Sep;43(3):299-306., [PMID:16954950]

Abstract [show]
OBJECTIVES: Defects of PRSS1, SPINK1, CFTR and AAT are considered causative or predisposing to pancreatitis. The aim of this study was to evaluate the impact of these defects into molecular pathology of chronic pancreatitis (CP) and acute recurrent pancreatitis (ARP). METHODS: Ninety-two children with CP or ARP, 55 family members and 50 controls were investigated. The subjects were screened for PRSS1 mutations: R122H, R122C, A16V, N29I; SPINK1 N34S variant; panel of 14 CFTR defects: INNOLiPA CFTR12, CFTRdele2,3 and IVS8-T variant or panel of 3 CFTR defects-F508del, CFTRdele2,3 and IVS8-T; AAT mutations: E264V, E342K. RESULTS: We identified 1 mutated allele in at least 1 of 4 genes in 31 of 92 patients and 12 of 50 controls (P = 0.157). Mutations in SPINK1 and PRSS1 were most frequent. PRSS1 mutations were identified mainly in CP patients (9.6% of CP vs 2.5% of ARP alleles, P = 0.094), whereas N34S SPINK1 mutation was present with comparable frequency in CP and ARP patients (7.7% vs 10.0%, P = 0.768). The frequency of mutations in CFTR alleles was similar to controls (4.9% vs 5%, P = 0.587). Overall frequency of AAT mutations was lower than in the controls. Family studies showed that defects in the examined genes did not always segregate with disease. CONCLUSIONS: PRSS1 defects seem to be causative for pancreatitis, whereas defects in SPINK1 are suggested to be associated with the disease. No association between CFTR mutations and pancreatitis was observed. The importance of AAT variants remains speculative.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 For the first 50 patients enrolled in this study, the CFTR mutations F508del, G542X, G551D, R553X, N1303K, W1282X, 1717-1G/A, I507del, S1251N, R560T, 3905insT, Q552X (INNO-LiPA CFTR12, Innogenetics, Gent, Belgium), CFTRdele2,3 (16) and polyT variant in intron 8 (IVS8-T) (17) were analyzed. Login to comment

[hide] Analysis of cystic fibrosis gene mutations and ass... Genet Test. 2007 Summer;11(2):133-8. Knezevic J, Tanackovic G, Matijevic T, Barisic I, Pavelic J
Analysis of cystic fibrosis gene mutations and associated haplotypes in the Croatian population.
Genet Test. 2007 Summer;11(2):133-8., [PMID:17627383]

Abstract [show]
The aim of this study was to reveal the CFTR gene mutation status in the Croatian population as well as to establish the haplotypes associated with cystic fibrosis (CF) and those associated with specific gene mutations. A total of 48 unrelated CF patients from Croatia were examined. Among 96 tested alleles, we found nine different mutations: DeltaF508, 58.33%; G542X, 3.12%; N1303K, 2.08%; R1162X; 621 + 1G --> T; G85E; Y569C; E585X; and S466X, 1.04%. Analysis of three polymorphic loci revealed 15 different haplotypes. Two of them (21-23-13 and 21-17-13) occurred with a higher frequency (40% and 24%). Both of these haplotypes also carried a CFTR gene mutation (DeltaF508 or G542X) on 27 out of 32 chromosomes. Among 12 (of all together 29) CF alleles on which no mutations were found, we detected 10 different haplotypes. Because there are still no published data on the distribution of polymorphic loci in Croatia, nor haplotypes associated with mutations in the CFTR gene, our results greatly contribute to knowledge regarding the genetic background of CF in this region.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 INNOGENETICS INNO-LIPA CFTR 12 and INNO-LIPA CFTR 7 ϩ Tn diagnostic kits were used to assess the presence of the 29 mutations in CF patients; ⌬F508, ⌬I507, G542X, N1303K, 1717-1G Ǟ A, W1282X, G551D, R553X, S1251N, R560T, 3905insT, Q552X, 394delTT, G85E, E60X, 621 ϩ 1G Ǟ T, R117H, 1078delT, R347P, R334W, 2143delT, 2183AA Ǟ G, 2184delA, 711 ϩ 5G Ǟ A, 2789 ϩ 5G Ǟ A, R1162X, 3659delC, 3849 ϩ 10kbC Ǟ T, and A455E. Login to comment

[hide] One multiplex control for 29 cystic fibrosis mutat... Genet Test. 2007 Fall;11(3):256-68. Lebo RV, Bixler M, Galehouse D
One multiplex control for 29 cystic fibrosis mutations.
Genet Test. 2007 Fall;11(3):256-68., [PMID:17949287]

Abstract [show]
A simple approach is described to synthesize and clone an inexhaustible supply of any homozygous and/or heterozygous controls diluted with yeast genomic DNA to mimic human genome equivalents for use throughout the entire multiplex mutation assay. As a proof of principle, the 25 cystic fibrosis mutation panel selected by the American College of Medical Genetics and four additional mutant sequences were prepared as a single control mixture. The 29 CFTR mutations were incorporated into 17 gene fragments by PCR amplification of targeted sequences using mutagenic primers on normal human genomic DNA template. Flanking primers selected to bind beyond all published PCR primer sites amplified controls for most assay platforms. The 17 synthesized 433-933-bp CFTR fragments each with one to four homozygous mutant sequences were cloned into nine plasmid vectors at the multiple cloning site and bidirectionally sequenced. Miniplasmid preps from these nine clones were mixed and diluted with genomic yeast DNA to mimic the final nucleotide molar ratio of two CFTR genes in 6 x 10(9) bp total human genomic DNA. This mixture was added to control PCR reactions prior to amplification as the only positive control sample. In this fashion >200 multiplex clinical PCR analyses of >4,000 clinical patient samples have been controlled simultaneously for PCR amplification and substrate specificity for 29 tested mutations without cross contamination. This clinically validated multiplex cystic fibrosis control can be modified readily for different test formats and provides a robust means to control for all mutations instead of rotating human genomic controls each with a fraction of the mutations. This approach allows scores of additional mutation controls from any gene loci to be added to the same mixture annually.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
181 The four additional mutant locations that do not label, CFTR⌬2,3(21kb), 3272-26A Ǟ G, 3199⌬6, and Q552X, are located in regions of the CF gene not spanned by any of the clones and no bands were seen at either of these wild-type or mutant allelic sites. Login to comment

[hide] Evaluation and use of a synthetic quality control ... Hum Mutat. 2008 Aug;29(8):1063-70. Berwouts S, Gordon JT, Rundell CA, Barton DE, Dequeker E
Evaluation and use of a synthetic quality control material, included in the European external quality assessment scheme for cystic fibrosis.
Hum Mutat. 2008 Aug;29(8):1063-70., [PMID:18470946]

Abstract [show]
Assuring high quality within the field of genetic testing is fundamental, as the results can have considerable impact on the patient and his or her family. The use of appropriate quality control (QC) samples is therefore essential. Diagnostic laboratories mainly use patient samples as QC material, which of course include a maximum of two mutations per sample. Bearing in mind that some assays (such as for cystic fibrosis [CF] testing) can test for more than 100 mutations, multiplex QC materials including more than two mutations could save valuable time and reagents. Based on this need, synthetic multiplex controls have been developed by Maine Molecular Quality Controls, Inc. (MMQCI) for CF. A synthetic control, containing six homozygous mutations and one polymorphism for CF transmembrane conductance regulator (CFTR), was evaluated by distributing it through the CF external quality assessment (EQA) scheme, along with the EQA samples in 2005. A total of 197 participants returned results of the yearly EQA scheme and 133 laboratories participated in the evaluation of the synthetic sample. Respectively, 76% and 73% of the participants were assigned as successful. This evaluation study revealed that the multiplex QC material performed well in the majority of assays and could be useful in method validation, as a tool to challenge interpretation skills, and as potential proficiency testing (PT) material.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
143 Two of the laboratories that saw this weak signal for wild-type R553X (c.1657C4T, p.Arg553X) also reported weak mutant signals for Q552X (c.1654C4T, p.Gln552X) or G542X (c.1624G4T, p.Gly542X), possibly indicating DNA overload. Login to comment
144 The Q552X (c.1654C4T, p.Gln552X) wild-type and mutant signal should disappear when R553X (c.1657C4T, p.Arg553X) homozygous is present, using INNO-LiPA. Login to comment
157 ErrorTypes for the QCS in More Detail, for the LaboratoriesThat Used Only One Detection AssayÃ Genotype error Genotype Detection assay Number of labs Expected Reported Comment OLA-CFASR v2.0 1 R117 H hom ^ Correct on raw data INNO-LiPA CFTR36 1 R117 H hom R117 H het No signal for wt R117 H visible on copy of the raw data, could be very weak on original raw data INNO-LiPA CFTR36 1 R553X hom R553X het No signal for wt R553X visible on copy of the raw data, could be very weak on original raw dataI507del hom I507del/F508del Sequencing 2 R347 H hom ^ No complete raw data received Sequencing 1 I507del hom ^ No raw data received Additional mutation(s) reported Detection assay Number of labs Additional mutation(s) Comment OLA-CFASR v3.0 US 1 2184delAa hom Software called it INNO-LiPA CFTR36 3 A455E het (3labs), F508del (1lab) No signal for mut A455E visible on copy of the raw data, could be very weak on original raw data ARMS-ElucigeneTM CF29 3 2184delAa (3labs), R347P (3labs), 1717-1G4A (3labs), 3849110kbC4T (2labs) Cross reaction with 2183AA4Gb and R347 H and no full compatibility of MMQCI-CF-P1and ARMS method: no control bands visible ARMS-ElucigeneTM CF29 1CF-HT 1 2184delAa , R347P Cross reaction with 2183AA4Gb and R347H Sequencing 1 W1282X het, N1303 K het No raw data received ASPE-CFTR 4014 Tag-It 1 71111G4T het No raw data received Genotype error 1 additional mutation(s) reported Genotype Detection assay Number of labs Expected Reported Comment Additional mutation(s) Comment OLA-CFASR v3.0 EU 1 R117 H hom ^ No raw data received; probably 2183AA4Gb missed, but 2184delAa reported due to cross reaction 2184delAa hom No raw data received, probably due to cross-reaction with 2183AA4Gb 394delTTc hom 394delTTc het 2183AA4Gb hom ^ INNO-LiPA CFTR36 1 R553X hom I507del hom R553X het I507del/ F508del No signal for wt R553X visible on copy of the raw data, could be very weak on original raw data G542X het A455E het No signal for mut G542X and mut A455E visible on copy of the raw data, could be very weak on original raw data INNO-LiPA CFTR36 1 Italian regional 1 R553X hom R553X het No signal for wt R553X visible on copy of the raw data, could be very weak on original raw data Q552X het Misinterpretation: wt and mut signal for Q552X not visible, but this is a normal reaction pattern when R553X is hom present; the lab reported R553X het ARMS-ElucigeneTM CF29 1 I507del hom ^ No full compatibility of MMQCI- CF-P1 and ARMS method: no control bands R347P Cross-reaction with R347H2183AA4Gb hom ^ ÃIf the zygosity is not mentioned in the table, the laboratory did not report it. Login to comment

[hide] Clinical and radiological outcome of patients suff... Pancreas. 2008 Nov;37(4):371-6. Frulloni L, Scattolini C, Graziani R, Cavestro GM, Pravadelli C, Amodio A, Manfredi R, Scarpa A, Vantini I
Clinical and radiological outcome of patients suffering from chronic pancreatitis associated with gene mutations.
Pancreas. 2008 Nov;37(4):371-6., [PMID:18953248]

Abstract [show]
OBJECTIVES: Cystic fibrosis transmembrane conductance regulator (CFTR), cationic trypsinogen gene (PRSS1), and serine protease inhibitor kazal type 1 (SPINK1) gene mutations have been associated with chronic pancreatitis (CP). The aim of this study was to compare clinical and radiological findings in sporadic CP with (CPgm) and without (CPwt) gene mutations. METHODS: Data from patients observed between 2001 and 2006 were collected. All patients were tested for 25 CFTR gene mutations, for R122H and N29I on the PRSS1 gene, and for N34S mutation on the SPINK1 gene. RESULTS: We found 34 (17.2%) of 198 patients with CPgm, 23 (11.6%) of them on the CFTR gene, 11 (5.6%) on the SPINK1, and none on the PRSS1 gene. The age at clinical onset was younger in CPgm (36.2 +/- 17.2 years) than in CPwt (44 +/- 12.6 years; P = 0.005). There were more heavy drinkers among CPwt (33%) than among CPgm (9%; P = 0.003), and the same applied to smokers (69% vs 33%, respectively; P < 0.0001). In CPgm group, the onset of pancreatic calcifications was observed more frequently in drinkers and/or smokers. Exocrine and endocrine insufficiency occurred less frequently and later in CPgm than in CPwt patients. CONCLUSIONS: Clinical and radiological outcome differ in CPgm compared with CPwt. Alcohol, even in small quantities, and cigarette smoking influence the onset of pancreatic calcifications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 All patients were tested for 25 CFTR gene mutations ($F508, $I507, R117H, R1162X, 2183AAYG, N1303K, 3849 + 10KbCYT, G542X, G551D, 1717-1GYA, R347P, R352Q, R553X, Q552X, G85E, 711 + 5GYA, W1282X, 3272-26AYG, 3132delTG, R334W, I148T, 3659del_C, 3120 + 1GYA, 1898 + 1GYA, and 2789 + 5GYA), which cover approximately 72% of the cystic fibrosis mutations in the Italian population. Login to comment

[hide] Preliminary evidence for cell membrane amelioratio... PLoS One. 2009;4(3):e4782. Epub 2009 Mar 11. Scambi C, De Franceschi L, Guarini P, Poli F, Siciliano A, Pattini P, Biondani A, La Verde V, Bortolami O, Turrini F, Carta F, D'Orazio C, Assael BM, Faccini G, Bambara LM
Preliminary evidence for cell membrane amelioration in children with cystic fibrosis by 5-MTHF and vitamin B12 supplementation: a single arm trial.
PLoS One. 2009;4(3):e4782. Epub 2009 Mar 11., [PMID:19277125]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is one of the most common fatal autosomal recessive disorders in the Caucasian population caused by mutations of gene for the cystic fibrosis transmembrane conductance regulator (CFTR). New experimental therapeutic strategies for CF propose a diet supplementation to affect the plasma membrane fluidity and to modulate amplified inflammatory response. The objective of this study was to evaluate the efficacy of 5-methyltetrahydrofolate (5-MTHF) and vitamin B12 supplementation for ameliorating cell plasma membrane features in pediatric patients with cystic fibrosis. METHODOLOGY AND PRINCIPAL FINDINGS: A single arm trial was conducted from April 2004 to March 2006 in an Italian CF care centre. 31 children with CF aged from 3 to 8 years old were enrolled. Exclusion criteria were diabetes, chronic infections of the airways and regular antibiotics intake. Children with CF were supplemented for 24 weeks with 5-methyltetrahydrofolate (5-MTHF, 7.5 mg /day) and vitamin B12 (0.5 mg/day). Red blood cells (RBCs) were used to investigate plasma membrane, since RBCs share lipid, protein composition and organization with other cell types. We evaluated RBCs membrane lipid composition, membrane protein oxidative damage, cation content, cation transport pathways, plasma and RBCs folate levels and plasma homocysteine levels at baseline and after 24 weeks of 5-MTHF and vitamin B12 supplementation. In CF children, 5-MTHF and vitamin B12 supplementation (i) increased plasma and RBC folate levels; (ii) decreased plasma homocysteine levels; (iii) modified RBC membrane phospholipid fatty acid composition; (iv) increased RBC K(+) content; (v) reduced RBC membrane oxidative damage and HSP70 membrane association. CONCLUSION AND SIGNIFICANCE: 5-MTHF and vitamin B12 supplementation might ameliorate RBC membrane features of children with CF. TRIAL REGISTRATION: ClinicalTrials.gov NCT00730509.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 Patient Gender Age (yr) CFTR mutations BMI (kg/m2) FEV1 (%) Pancreatic sufficiency M.o. in sputum Antibiotic treatment 1 M 8 DF508/DF508 17,29 81 no no no 2 F 7 DF508/DF508 21,7 101 no P. aeruginosa C azithromycin p.o. tobramycin neb. 3 F 6 DI507/711+5G A 22,5 91 no no no 4 F 5 DF508/not identified 15,2 NA no no no 5 M 8 DF508/DF508 15,4 92 no no no 6 M 7 N1303K/2789+5G A 19,2 73 no no no 7 F 7 DF508/621+1G T 15,1 82 no S. aureus no 8 F 8 DF508/1717-1G T 18,3 91 no S. aureus no 9 F 8 DF508/not identified 21,2 95 yes no no 10 F 7 DF508/2789+5G A 14,4 93 no no no 11 M 8 DF508/2789+5G A 15,9 106 yes no no 12 F 7 R1162X/R1162X 17,15 78 no S. aureus no 13 M 8 DF508/not identified 15,2 63 no no no 14 M 6 DF508/DF508 17,1 115 no P. aeruginosa I ciprofloxacin p.o. tobramycin neb. 15 F 8 DF508/R1162X 14 49 no P. aeruginosa C azithromycin p.o. tobramycin neb. 16 M 5 G542/1717-1G A 16,5 NA no no No 17 F 5 DF508/not identified 13,3 NA no P. aeruginosa I ciprofloxacin p.o. tobramycin neb. 18 M 4 DF508/G542X 15,7 NA no no no 19 F 7 DI507/R1162X 16,5 94 no no no 20 F 4 DF508/Q552X 13,5 NA no no no 21 M 8 DF508/R1162X 13,8 78 no no no 22 F 6 2183AA G/N1303K 16,8 102 no no no P.: Pseudomonas; S.: Staphylococcus; H.: Haemophilus; C: chronic colonization; I: intermittent colonization; NA: not applicable; p.o.: per os; neb.: nebulized. Login to comment

[hide] A novel approach to CFTR mutation testing by pyros... Clin Chem. 2009 Jun;55(6):1083-91. Epub 2009 Apr 16. Bickmann JK, Kamin W, Wiebel M, Hauser F, Wenzel JJ, Neukirch C, Stuhrmann M, Lackner KJ, Rossmann H
A novel approach to CFTR mutation testing by pyrosequencing-based assay panels adapted to ethnicities.
Clin Chem. 2009 Jun;55(6):1083-91. Epub 2009 Apr 16., [PMID:19372188]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a common autosomal recessive genetic disorder caused by a variety of sequence alterations in the CFTR gene [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)]. Because the relative prevalence of mutations strongly depends on the ethnic background, first-level testing of CF as defined by recent consensus recommendations ought to be adaptable to the ethnicity of patients. METHODS: We therefore developed and implemented a diagnostic approach to first-level testing for CF based on published mutation frequencies and Pyrosequencing (PSQ) technology that we complemented with standard procedures of mutation detection at the second level. RESULTS: The current test system of PSQ assays for 46 target CF mutations [including CFTRdele2,3 (21 kb) and 1342-6 (T)(n) (5T/7T/9T)] permits recombinations of single assays to optimize sensitivities for certain ethnicities. By easy expansion of the original mutation panel, the first-level test sensitivities with other ethnic groups would be increased, provided that the mutation frequencies are known. The test was validated with our local, ethnically mixed, but mainly German population (155 patients). The mutation-detection rate for the 92 patients whose CF was confirmed by the sweat test was 89.0% for the patients of German descent (73 of the 92 patients) and 73.7% for the patients of any other origin (19 of the 92 patients). Ethnicity-adapted testing panels for our foreign CF patients would increase the sensitivities for the respective groups by approximately 5%. CONCLUSIONS: PSQ-based genotyping is a reliable, convenient, highly flexible, and inexpensive alternative to conventional methods for first-level testing of CFTR, facilitating flexible adaptation of the analyzed mutation panel to any local ethnic group.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
100 Diagnostic evaluation of the PSQ-based first-level testing of a predominantly German CF population.a Panethnic population Clinical diagnosis All patients Sweat test-confirmed CF Suspected atypical CF Carrier screening Chromosomes, n 310 184 96 30 PSQ screen 168 (54.2%) 158 (85.9%) 5 (5.2%) 5 (33.3%) Conventional sequencing 25 (8.1%) 25 (13.6%) 0 (0%) 0 (0%) Total detected alleles 193 (62.3%) 183 (99.5%) 5 (5.2%) 5 (33.3%) German ethnicity Other ethnicities Clinical diagnosis Sweat test-confirmed CF Sweat test-confirmed CF Chromosomes, n 146 38 PSQ screen F508del 106 (72.6%) 14 (36.8%) I507del 1 (0.7%) 1 (2.6%) 1677delTA 0 (0%) 2 (5.3%) G551D 6 (4.1%) 0 (0%) R553X 2 (1.4%) 0 (0%) Q552X 1 (0.7%) 0 (0%) G542X 2 (1.4%) 1 (2.6%) S549N 0 (0%) 2 (5.3%) W1282X 1 (0.7%) 3 (7.9%) R117H 1 (0.7%) 0 (0%) 1342-12 (TG)11-5T 0 (0%) 0 (0%) R347P 2 (1.4%) 1 (2.6%) 3849ϩ10kb CϾT 2 (1.4%) 0 (0%) N1303K 3 (2.1%) 3 (7.9%) 1717-1 GϾA 1 (0.7%) 0 (0%) CFTRdele2,3 (21 kb) 2 (1.4%) 1 (2.6%) Sum 130 (89.0%) 28 (73.7%) Conventional sequencing 16 (11.0%) 9 (23.7%) Total detected alleles 146 (100%) 37 (97.4%) a Data are presented as the number of chromosomes (percent). Login to comment
153 The fact that simultaneously detecting some mutations (e.g.: F508del, 1677delTA, and I507del; G542X and S549N; or G551D, R553X, and Q552X) within a single assay improves the sensitivity of each PSQ run underlines even further the advantages that arise from detecting neighboring mutations as well as the target mutation within one assay (Table 2). Login to comment

[hide] Non-classic cystic fibrosis associated with D1152H... Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15. Burgel PR, Fajac I, Hubert D, Grenet D, Stremler N, Roussey M, Siret D, Languepin J, Mely L, Fanton A, Labbe A, Domblides P, Vic P, Dagorne M, Reynaud-Gaubert M, Counil F, Varaigne F, Bienvenu T, Bellis G, Dusser D
Non-classic cystic fibrosis associated with D1152H CFTR mutation.
Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15., [PMID:19843100]

Abstract [show]
BACKGROUND: Limited knowledge exists on phenotypes associated with the D1152H cystic fibrosis transmembrane conductance regulator (CFTR) mutation. METHODS: Subjects with a D1152H allele in trans with another CFTR mutation were identified using the French Cystic Fibrosis Registry. Phenotypic characteristics were compared with those of pancreatic insufficient (PI) and pancreatic sufficient (PS) cystic fibrosis (CF) subjects in the Registry (CF cohort). RESULTS: Forty-two subjects with D1152H alleles were identified. Features leading to diagnosis included chronic sinopulmonary disease (n = 25), congenital absence of the vas deferens (n = 11), systematic neonatal screening (n = 4), and genetic counseling (n = 2). Median age at diagnosis was 33 [interquartile range (IQR, 24-41)] years in D1152H subjects. Median sweat chloride concentrations were 43.5 (39-63) mmol/l in D1152H subjects and were markedly lower than in PI and PS CF subjects (p < 0.05). Bronchiectasis was present in 67% of D1152H subjects, but Pseudomonas aeruginosa colonization and pancreatic insufficiency were present in <30% of subjects. Estimated rates of decline in forced expiratory volume in 1 s (FEV(1)) were lower in D1152H subjects vs PI CF subjects (p < 0.05). None of the D1152H subjects identified since 1999 had died or required lung transplantation. CONCLUSIONS: When present in trans with a CF-causing mutation, D1152H causes significant pulmonary disease, but all subjects had prolonged survival.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 Diagnostic features in 42 D1152H subjects according to the other CFTR mutation class Subject Sex (M/F) Other CFTR mutation Sweat Cl- mean (mmol/l) Age at diagnosis (years) Presentation at diagnosis Class I mutations 1 F W1282X 58 4 Pneumonia recurrent bronchitis 2 F W1282X 25 74 Bronchiectasis 3 M W1282X 43 33 CBAVD 4 M G542X 48 39 CBAVD 5 M G542X 72 27 CBAVD 6 F S1206X 18 13 Recurrent bronchitis+ diarrhea 7 F 394delTT 19 41 Bronchiectasis 8 F 394delTT 25 18 Bronchiectasis 9 F Q552X 56 43 Bronchiectasis Class II mutations 10 F F508del 13 42 Bronchiectasis 11 F F508del 40 32 Bronchiectasis 12 F F508del 52 23 Bronchiectasis 13 M F508del 51 15 Bronchiectasis 14 F F508del 100 24 Bronchiectasis 15 M F508del 79 26 Bronchiectasis 16 F F508del - 43 Bronchiectasis 17 M F508del - 23 Bronchiectasis 18 F F508del 19 55 Bronchiectasis 19 F F508del 25 33 Bronchiectasis 20 F F508del 78 15 Bronchiectasis 21 M F508del 90 40 Bronchiectasis 22 F F508del 44 42 Bronchiectasis 23 M F508del 88 11 Bronchiectasis 24 F F508del 63 47 Bronchiectasis 25 F F508del 43 33 Bronchiectasis 26 M F508 del 62 49 Bronchiectasis 27 M F508del 20 - CBAVD 28 M F508del - 27 CBAVD 29 M F508del 42 36 CBAVD 30 M F508del 36 34 CBAVD 31 M F508del 40 36 CBAVD 32 M F508del 41 30 CBAVD 33 M F508del 82 9 Asymptomatic genetic counseling 34 M F508del - 0 Neonatal screening 35 F F508del 53 0 Neonatal screening 36 F F508del 35 0 Neonatal screening 37 M F508del 35 0 Neonatal screening Class III mutation 38 F S549N 75 31 Bronchiectasis Class IV mutations 39 M E116K 80 41 ABPA+ diarrhea 40 M D1152H 34 34 CBAVD 41 M R1070Q 56 38 CBAVD Class V mutation 42 M 3849+10kbC>T 31 40 Asymptomatic genetic counseling ABPA, allergic bronchopulmonary aspergillosis; CBAVD, congenital bilateral absence of the vas deferens. Login to comment

[hide] Is CFTR 621+3 A>G a cystic fibrosis causing mutati... J Hum Genet. 2010 Jan;55(1):23-6. Epub 2009 Nov 6. Forzan M, Salviati L, Pertegato V, Casarin A, Bruson A, Trevisson E, Di Gianantonio E, Clementi M
Is CFTR 621+3 A>G a cystic fibrosis causing mutation?
J Hum Genet. 2010 Jan;55(1):23-6. Epub 2009 Nov 6., [PMID:19893581]

Abstract [show]
The 621+3 A>G variant of the CFTR gene was initially detected in four Greek patients with a severe form of cystic fibrosis, and it is reported to impair CFTR mRNA splicing. We present three lines of evidence that argue against the pathogenicity of this variant. First, its allelic frequency in the Italian population was 0.4%. Even considering the lowest value in the confidence interval we would expect 10% of Italian CF patients to be heterozygotes for this variant, whereas it has been reported only in one patient (0.04% of Italian CF patients). Second, expression of the 621+3 A>G variant in HeLa cells using a hybrid minigene showed that 39.5+/-1.1% of transcripts were correctly spliced, indicating that its effects on mRNA splicing are similar to those of the CFTR intron 8 5T variant, associated with congenital bilateral absence of vas deferens (CBAVD), but not with CF. Third, we have identified an asymptomatic individual who harbored the 621+3 A>G variant in trans with the Q552X mutation. Because 621+3 A>G is often included in population-screening programs, this information is critical to provide adequate counseling to patients. Further work should be aimed at investigating whether this variant may have a role in CBAVD or atypical CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Third, we have identified an asymptomatic individual who harbored the 621+3 A4G variant in trans with the Q552X mutation. Login to comment
48 Patient data In the course of the study we identified by chance an individual who harbored the 621 +3A4G variant in trans with the pathogenic Q552X-truncating mutation. Login to comment
53 She was identified to be the carrier of both alterations because her parents underwent CF screening during a second pregnancy: the mother was found to harbor 621+3 A4G, whereas the father had tested positive for Q552X. Login to comment
93 In conclusion, our data suggest that 621+3 A4G should not be considered a severe CF mutation because of its frequency in the population, because it still allows the synthesis of significant amounts of functional CFTR protein, and the absence of clinical disease in a compound (621+3 A4G/ Q552X) heterozygote individual. Login to comment

[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT. Login to comment
97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction. Login to comment

[hide] Identification of the second CFTR mutation in pati... Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26. Giuliani R, Antonucci I, Torrente I, Grammatico P, Palka G, Stuppia L
Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols.
Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26., [PMID:20657600]

Abstract [show]
Congenital bilateral absence of vas deferens (CBAVD) is a manifestation of the mildest form of cystic fibrosis (CF) and is characterized by obstructive azoospermia in otherwise healthy patients. Owing to the availability of assisted reproductive technology, CBAVD patients can father children. These fathers are at risk of transmitting a mutated allele of the CF transmembrane conductance regulator (CFTR) gene, responsible for CF, to their offspring. The identification of mutations in both CFTR alleles in CBAVD patients is a crucial requirement for calculating the risk of producing a child with full-blown CF if the female partner is a healthy CF carrier. However, in the majority of CBAVD patients, conventional mutation screening is not able to detect mutations in both CFTR alleles, and this difficulty hampers the execution of correct genetic counselling. To obtain information about the most represented CFTR mutations in CBAVD patients, we analysed 23 CBAVD patients, 15 of whom had a single CFTR mutation after screening for 36 mutations and the 5T allele. The search for the second CFTR mutation in these cases was performed by using a triplex approach: (i) first, a reverse dot-blot analysis was performed to detect mutations with regional impact; (ii) next, multiple ligation-dependent probe amplification assays were conducted to search for large rearrangements; and (iii) finally, denaturing high-performance liquid chromatography was used to search for point mutations in the entire coding region. Using these approaches, the second CFTR mutation was detected in six patients, which increased the final detection rate to 60.8%.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] Initial evaluation of a biochemical cystic fibrosi... J Inherit Metab Dis. 2010 Oct;33(Suppl 2):S263-71. Epub 2010 Aug 17. Sommerburg O, Lindner M, Muckenthaler M, Kohlmueller D, Leible S, Feneberg R, Kulozik AE, Mall MA, Hoffmann GF
Initial evaluation of a biochemical cystic fibrosis newborn screening by sequential analysis of immunoreactive trypsinogen and pancreatitis-associated protein (IRT/PAP) as a strategy that does not involve DNA testing in a Northern European population.
J Inherit Metab Dis. 2010 Oct;33(Suppl 2):S263-71. Epub 2010 Aug 17., [PMID:20714932]

Abstract [show]
BACKGROUND: Ethical concerns and disadvantages of newborn screening (NBS) for cystic fibrosis (CF) related to genetic testing have raised controversies and impeded implementation of CF NBS in some countries. In the present study, we used a prospective and sequential immunoreactive trypsinogene (IRT)/pancreatitis-associated protein (PAP) strategy, with IRT as first and PAP as second tier, and validated this biochemical approach against the widely used IRT/DNA protocol in a population-based NBS study in southwest Germany. METHODS: Prospective quantitation of PAP and genetic analysis for the presence of four mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene most prevalent in southwest Germany (F508del, R553X, G551D, G542X) were performed in all newborns with IRT > 99.0th percentile. NBS was rated positive when either PAP was >/=1.0 ng/mL and/or at least one CFTR mutation was detected. In addition, IRT > 99.9th percentile was also considered a positive rating. Positive rating led to referral to a CF centre for testing of sweat Cl(-) concentration. FINDINGS: Out of 73,759 newborns tested, 98 (0.13%) were positive with IRT/PAP and 56 (0.08%) with IRT/DNA. After sweat testing of 135 CF NBS-positive infants, 13 were diagnosed with CF. Detection rates were similar for both IRT/PAP and IRT/DNA. One of the 13 diagnosed CF newborns had a PAP concentration <1.0 ng/mL. CONCLUSIONS: Sequential measurement of IRT/PAP provides good sensitivity and specificity and allows reliable and cost-effective CF NBS which circumvents the necessity of genetic testing with its inherent ethical problems.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
110 In the second column, the results for both screening strategies are given CF patient True result for PAP/DNA Meconium ileus IRT (ng/ml) PAP (ng/ml) initial DNA result Age at referral (weeks) Mean of sweat Cl- measures (mmol/l) Age at diagnosis (weeks) Subsequent investigation Further DNA analysis 1 FN/FN No 36.0 n.d. n.d. 10 84 12 No special F508del/S1251N 2 TP/TP No 95.5 2.56 F508del/G542X 5 84 6 No special n.d. 3 TP/TP No 132.5 5.81 F508del/ - 4 95 5 No special n.d.a 4 TP/FN No 152.5 2.70 - / - 8b 44 10 ICMc CFTRdele2,3/ - c 5 TP/TP No 204.0 1.00 F508del/G551D 6 95 6 No special n.d. 6 TP/TP Yes 245.0 1.00 F508del/F508del - n.d.d 1 No special n.d. 7 TP/TP No 220.5 1.70 F508del/F508del 8b 82 10 No special n.d. 8 FN/FN No 139.0 0.95 - / - 15b 93 16 No special N1303K/R709X 9 TP/TP Yes 197.5 1.20 F508del/F508del - n.d.d 1 No special n.d. 10 TP/TP Yes 143.5 1.10 F508del/F508del - 92 1 No special n.d. 11 TP/TP No 114.0 1.45 F508del/ - 7b 116 7 No special F508del/p.Q552X 12 TP/TP No 174.5 2.60 F508del/F508del 4 88 5 No special n.d. 13 TP/TP Yes 81 1.30 F508del/F508del 1 n.d.d 1 No special n.d. 14 TP/FN No 198.5 9.45 - / - 8b 103 8 No special CFTRdele2,3/ E664X PAP IRT/PAP strategy, DNA IRT/DNA strategy, TP true positive, FN false negative a Further DNA analysis was not performed in the local CF centre after the health insurance of the patient refused to pay for further DNA analysis. Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Preconceptional identification of cystic fibrosis ... J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22. Coiana A, Faa' V, Carta D, Puddu R, Cao A, Rosatelli MC
Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program.
J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22., [PMID:21429822]

Abstract [show]
BACKGROUND: In Sardinia the mutational spectrum of CFTR gene is well defined. A mutation detection rate of 94% can be achieved by screening for 15 CFTR mutations with a frequency higher than 0.5%. The efficiency of this molecular test suggests that Sardinians may represent a suitable population for a preconceptional screening. METHODS: Five hundred couples of Sardinia descent were screened for 38 mutations using a semi-automated reverse-dot blot and PCR-gel electrophoresis assays. This mutation panel included the 15 most frequent CF alleles in Sardinia. RESULTS: We identified 38 CF carriers, revealing an overall frequency of 1/25 (4%). The most common CF allele was the p.Thr338Ile (T338I) (65%), followed by the p.Phe508del (F508del) (22.5%). We also identified one couple at risk and an asymptomatic female homozygote for the p.Thr338Ile allele. CONCLUSIONS: In spite of the low number of the couples tested, the results herein reported demonstrate the efficacy and efficiency of the preconceptional screening program and the high participation rate of the Sardinian population (99%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 Mutation nomenclaturea Alleles (%) T338I (p.Thr338Ile) 26 (65.0) F508del (p.Phe508del) 9 (22.5) N1303K (p.Asn1303Lys) 1 (2.5) 2183AANG (c.2051_2052delAAinsG) 1 (2.5) 621+1GNT (c.489+1GNT) 1 (2.5) exon 2 del (c.54-5811_164+2187del8108ins182) 1 (2.5) R347P (p.Arg347Pro) 1 (2.5) The 3849+10kbCNT (c.3717+12191CNT), G85E (p.Gly85Glu), 2789+5GNA (c.2657+5GNA), W1282X (p.Trp1282X), G1244E (p.Gly1244Glu), 711+5GNA (c.579+5GNA), 711+1GNT (c.579+1GNA), 4016insT (p.Ser1297PhefsX5), G542X (p.Gly542X), 1717-1GNA (c.1585-1GNA), R553X (p.Arg553X), Q552X (p.Gln552X), G551D (p.Gly551Asp), S549R (ANC) (p.Ser549Arg), I507del (p.Ile507del), F508C (p.Phe508Cys), I502T (p.Ile502Thr), 1706del17 (p.Gln525LeufsX37), 1677delTA (p.Tyr515X), R117H (p.Arg117His), D1152H (p.Asp1152His), L1065P (p.Leu1065Pro), R1066H (p.Arg1066His), L1077P (p.Leu1077Pro), 4382delA (p.Glu1418ArgfsX14), R1162X (p.Arg1162X), R1158X (p.Arg1158X), 1259 insA (p.Gln378AlafsX4), 852del22 (p.Gly241GlufsX13), S912X (p.Ser912X), and 991del5bp (p.Asn287LysfsX19) mutations included in the CF panel were not detected in the population tested. Login to comment

[hide] Defective CFTR expression and function are detecta... PLoS One. 2011;6(7):e22212. Epub 2011 Jul 21. Sorio C, Buffelli M, Angiari C, Ettorre M, Johansson J, Vezzalini M, Viviani L, Ricciardi M, Verze G, Assael BM, Melotti P
Defective CFTR expression and function are detectable in blood monocytes: development of a new blood test for cystic fibrosis.
PLoS One. 2011;6(7):e22212. Epub 2011 Jul 21., [PMID:21811577]

Abstract [show]
BACKGROUND: Evaluation of cystic fibrosis transmembrane conductance regulator (CFTR) functional activity to assess new therapies and define diagnosis of cystic fibrosis (CF) is cumbersome. It is known that leukocytes express detectable levels of CFTR but the molecule has not been characterized in these cells. In this study we aim at setting up and validating a blood test to evaluate CFTR expression and function in leukocytes. DESCRIPTION: Western blot, PCR, immunofluorescence and cell membrane depolarization analysis by single-cell fluorescence imaging, using the potential-sensitive DiSBAC(2)(3) probe were utilized. Expression of PKA phosphorylated, cell membrane-localized CFTR was detected in non-CF monocytes, being undetectable or present in truncated form in monocytes derived from CF patients presenting with nonsense mutations. CFTR agonist administration induced membrane depolarization in monocytes isolated from non-CF donors (31 subjects) and, to a lesser extent, obligate CFTR heterozygous carriers (HTZ: 15 subjects), but it failed in monocytes from CF patients (44 subjects). We propose an index, which values in CF patients are significantly (p<0.001) lower than in the other two groups. Nasal Potential Difference, measured in selected subjects had concordant results with monocytes assay (Kappa statistic 0.93, 95%CI: 0.80-1.00). RESULTS AND SIGNIFICANCE: CFTR is detectable and is functional in human monocytes. We also showed that CFTR-associated activity can be evaluated in 5 ml of peripheral blood and devise an index potentially applicable for diagnostic purposes and both basic and translational research: from drug development to evaluation of functional outcomes in clinical trials.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
202 Case Gender Age at diagnosis (years) CFTR genotype* Age (years) Sweat Cl- mEq/L** FEV1 % mean values 2009 Pa PI NPD results*** CF-index 1 F 0 3132delTG 1497delGG 34 129 75 yes yes nd 222,10 2 F 0 R1162X R1162X 43 144 52 yes yes nd 229,65 3 M 0 R1162X R1162X 10 102 59 no yes 1,02 210,18 4 M 0 R1162X R1162X 25 115 81 no yes 1,07 267,11 5 M 7 G542X 711+5 G.A 24 105 59 yes yes nd 25,84 6 M 1 CFTRdele1 G542X 36 107 22 yes yes nd 2113,92 7 M 0 G542X G542X 16 110 71 yes yes 0,97 280,20 8 F 1 Q552X CFTRdele17a-18 35 99 72 yes yes 2,08 2219,81 9 M 16 R1162X 3849+10 Kb C.T 42 74 43 yes no 1,02 271,47 10 M 0 R1162X R1162X 32 105 45 yes yes 1,43 2114,67 11 M 1 F508del F508del 16 86 71 no yes nd 260,04 12 F 0 F508del F508del 16 88 118 no yes nd 248,20 13 M 0 F508del F508del 33 118 51 yes yes nd 265,49 14 M 7 F508del F508del 37 89 37 yes yes nd 2359,82 15 F 0 F508del F508del 27 118 71 yes yes nd 267,26 16 F 8 1717-1 G.A F508del 38 140 74 yes yes nd 2136,80 17 F 0 R1158X F508del 32 95 60 yes yes 1,77 228,31 18 M 7 G542X F508del 39 110 46 yes yes nd 247,52 19 M 0 Q39X F508del 17 101 79 no yes 1,11 264,20 20 F 1 R1162X F508del 41 188 60 no yes 0,94 296,73 21 M 13 3849+10 Kb C.T F508del 24 76 78 yes no 4,67 26,33 22 M 0 W1282X 621+1G.T 33 119 77 yes yes 1,27 242,74 23 F 4 R553X 2789+5 G.A 31 92 44 yes no 7,4 260,94 24 F 11 F508del R553X 39 116 55 yes yes nd 2113,67 25 M 12 F508del 3849+10 Kb C.T 27 51 71 yes no 1,12 298,84 26 F 0 F508del G542X 19 109 109 yes yes nd 2173,24 27 F 0 F508del R1162X 32 94 86 yes yes 1,34 270,16 28 F 0 F508del W57X (TAG) 27 99 78 yes yes 1,21 269,33 29 M 0 F508del Q552X 24 94 41 yes yes 1,50 272,75 30 M 20 F508del 3849+10 Kb C.T 43 58 60 no no 1,13 2112,56 31 M 0 F508del R1162X 12 99 65 no yes 2,14 280,92 32 M 4 F508del 3849+10 Kb C.T 17 60 100 no no nd 2121,31 33 F 1 F508del 1717-1 G.A 26 105 73 yes yes 2,05 255,66 34 F 11 F508del 3849+10 Kb C.T 40 85 59 yes no nd 2152,23 35 F 4 F508del 1717-1 G.A 44 130 97 yes yes nd 2116,56 36 M 13 F508del 3849+10 Kb C.T 43 70 65 yes no CF 265,10 37 F 19 F508del unknown 29 95 100 no no nd 240,53 38 M 6 F508del unknown 15 92 87 yes no nd 270,17 39 F 0 G542X N1303K 34 108 97 yes yes nd 296,14 40 M 50 G1249R IVS8 T5TG12 50 61 74 no no nd 2199,15 41 F 10 2183 AA.G IVS8 T5TG15/T7TG10 45 79 29 yes no 1,9 286,27 42 F 1 G85E unknown 43 120 107 yes no nd 249,21 43 F 0 3272-26 A.G I507del 21 113 88 no no nd 236,79 44 M 8 F508del D1152H 10 77 107 no no nd 210,85 *Cystic Fibrosis mutation database reference: http://www3.genet.sickkids.on.ca/cftr/app. Login to comment

[hide] Nasal potential difference in congenital bilateral... Am J Respir Crit Care Med. 1998 Sep;158(3):896-901. Pradal U, Castellani C, Delmarco A, Mastella G
Nasal potential difference in congenital bilateral absence of the vas deferens.
Am J Respir Crit Care Med. 1998 Sep;158(3):896-901., [PMID:9731023]

Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) is supposed to be due to defective activity of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) in the genital tract. With the aim of studying CFTR activity in vivo we measured nasal potential difference (NPD) in a group of CBAVD subjects, who were then compared with normal control subjects and CF patients. Sodium transport, measured under basal conditions and after amiloride superinfusion, was normal in almost all CBAVD patients, who had NPD values similar to those of normal control subjects. Chloride transport was studied by measuring NPD during perfusion with a chloride-free solution and isoproterenol. Under these circumstances CBAVD patients as a whole showed normal chloride secretion. However, three subjects with CBAVD had abnormal NPD values. They had either elevated sweat chloride concentrations together with symptoms of mild CF, or compound heterozygosity (DeltaF508/R117H). In conclusion the group of CBAVD patients as a whole presented normal bioelectric properties of nasal epithelium, suggesting normal CFTR activity. In a small subgroup NPD was abnormal, suggesting a diagnosis of CF, later confirmed by elevated sweat chloride concentrations or positive DNA testing. We suggest that CBAVD patients with altered NPD should undergo further clinical follow-up in order to detect possible late complications of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 ⌬F508, R117H, R1162X, 2183AA→G, N1303K, 3849 ϩ 10KbC→T, G542X, 1717-1G→A, R553X, Q552X, G85E, 711 ϩ 5G→A, 3132delTG and 2789 ϩ 5G→A were tested using for R117H two specifically designed primers which create a CFoI restriction site when the mutation is absent, and for all the other mutations a reverse dot blot assay (19). Login to comment

[hide] Cystic fibrosis in Chilean patients: Analysis of 3... J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30. Lay-Son G, Puga A, Astudillo P, Repetto GM
Cystic fibrosis in Chilean patients: Analysis of 36 common CFTR gene mutations.
J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30., [PMID:21036675]

Abstract [show]
BACKGROUND: CFTR gene mutations have worldwide differences in prevalence and data on Chilean patients is scarce. METHODS: We studied 36 of the most common CFTR mutations in Chilean patients from the CF National Program [Programa Nacional de Fibrosis Quistica (PNFQ)] of the Ministry of Health of Chile. RESULTS: Two hundred and eighty-nine patients were studied. Fourteen different mutations were identified with an overall allele detection rate of 42.0%. Mutations with frequencies greater than 1% were p.F508del (30.3% of alleles), p.R334W (3.3%), p.G542X (2.4%), c.3849+10Kb C>T (1.7%), and p.R553X (1.2%). A north to south geographical gradient was observed in the overall rate of detection. CONCLUSIONS: Southern European CFTR mutations predominate in the Chilean population, but a high percentage of alleles remain unknown. Geographical heterogeneity could be explained in part by admixture. Complementary analyses are necessary to allow for effective genetic counselling and improve cost-effectiveness of screening and diagnostic tests.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Mutation This study Rios et al. [4] Molina et al. [5] Repetto et al. [6] Perez et al. [13] CFGAC [2] (n=578) (%) (n=72) (%) (n=36) (%) (n=100) (%) (n=4102) (%) (n=43,849) (%) Chile Chile Chile Chile Latin-Americaa Worldwide Unknown 58.0 66.6 61.1 34.0 36.7 22.7 p.F508del 30.6 29.2 30.6 45.0 47.1 66.0 p.R334W 3.1 - - 2.0 0.8 0.1 p.G542X 2.4 0 8.3 7.0 5.0 2.4 c.3849+10Kb CNT 1.7 - - 3.0 0.3 0.2 p.R553X 1.2 4.2 0 1.0 0.4 0.7 p.R1162X 0.9 - - 2.0 1.0 0.3 p.1078delT 0.5 - - 0 b0.1 0.1 p.G85E 0.5 - - - 0.8 0.2 p.W1282X 0.2 - - 5.0 1.0 1.2 c.3120+1 GNA 0.2 - - - 0.3 - c.711+1 GNT 0.2 - - - 0.1 0.1 p.R117H 0.2 - - 0 b0.1 0.3 p.A455E 0.2 - - 0 0 0.1 p.I148T 0.2 - - - - - p.G551D 0 0 0 1.0 0.1 1.6 p.N1303K 0 0 0 0 1.8 1.3 c.621+1 GNT 0 - - 0 0.2 0.7 c.1717-1 GNA 0 - - 0 0.3 0.6 p.I507del 0 - - 0 0.2 0.2 p.R347P 0 - - 0 0 0.2 c.2789+5 GNA 0 - - - 0.2 0.1 c.1898+1 GNA 0 - - - 0.1 0.1 c.2184delA 0 - - - b0.1 0.1 p.S549N 0 - 0 - 0.1 0.1 c.3659delC 0 - - 0 0.1 0.1 p.R560T 0 - - - 0 0.1 c.1811+1.6Kb ANG 0 - - - 0.4 - c.2183AANG 0 - - 0 0.1 - p.S549R 0 - - - 0.1 - c.3272-26 ANG 0 - - - 0.1 - c.3199del6 0 - - - b0.1 - p.E60X 0 - - 0 0 - c.3905insT 0 - - - 0 - p.S1251N 0 - - 0 - - CFTRdele2,3 0 - - - - - p.R347H 0 - - - - - p.V520F 0 - - - - - p.Q552X 0 - - - - - c.394delTT 0 - - - - - c.711+1 GNA 0 - - - - - c.2143delT 0 - - - - - c.3876delA 0 - - - - - a Data from Chilean patients published in Rios et al., Molina et al., and Repetto et al. [4-6] included in this publication were excluded in this table to avoid repetition. Login to comment

[hide] Newborn screening for cystic fibrosis: Polish 4 ye... Eur J Hum Genet. 2012 Aug 15. doi: 10.1038/ejhg.2012.180. Sobczynska-Tomaszewska A, Oltarzewski M, Czerska K, Wertheim-Tysarowska K, Sands D, Walkowiak J, Bal J, Mazurczak T
Newborn screening for cystic fibrosis: Polish 4 years' experience with CFTR sequencing strategy.
Eur J Hum Genet. 2012 Aug 15. doi: 10.1038/ejhg.2012.180., [PMID:22892530]

Abstract [show]
Newborn screening for cystic fibrosis (NBS CF) in Poland was started in September 2006. Summary from 4 years' experience is presented in this study. The immunoreactive trypsin/DNA sequencing strategy was implemented. The group of 1 212 487 newborns were screened for cystic fibrosis during the programme. We identified a total of 221 CF cases during this period, including, 4 CF cases were reported to be omitted by NBS CF. Disease incidence in Poland based on the programme results was estimated as 1/4394 and carrier frequency as 1/33. The frequency of the F508del was similar (62%) to population data previously reported. This strategy allowed us to identify 29 affected infants with rare genotypes. The frequency of some mutations (eg, 2184insA, K710X) was assessed in Poland for the first time. Thus, sequencing assay seems to be accurate method for screening programme using blood spots in the Polish population.European Journal of Human Genetics advance online publication, 15 August 2012; doi:10.1038/ejhg.2012.180.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Mutations D537N and P731L have not been Period of NBS CF Method The most frequent mutations in Polish population under analysis September 2006 - December 2007 Estonia Asper Biotech assay E60X, G85E, 394delTT, R117H, R117P, R117L, I148T, 621G>A, 711+1G>T, 711+5G>A, 1078delT, R334W, R347H, R347P, R347L, IVS8-T, A455E, I507del, F508del, 1717-1G>A, G542X, p.G551D, Q552X, R553X, R553G, R560T, R560K, 1898+1G>A, 1898+1G>T, 1898+1G>C, 2143delT, 2184delA, 2183AA>G, 2789+5G>A, 3120+1G>A, 3199del6, 3272-26A>G, R1162X, 3659delC, 3849+10kbC>T, 3905insT, S1235R, S1251N, W1282X, W1282C, N1303K, CFTRdele2,3 January 2007 - June 2009 Sanger sequencing of exons: 4, 7, 10, 11, 13, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R117H+IVS8-T*, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K July 2009 - currently Sanger sequencing of exons: 7, 10, 11, 13, 17b, 20, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K, 3272-26A>G**, W1282X** * removed from DNA analysis since July 2009 , **added into DNA analysis since July 2009 Figure 1 NBS CF in Poland. Login to comment

[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]

Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 [Gln552X] + [Leu1376SerfsX8] (Q552X/4259del5) was missed by the utilized commercial assay. Login to comment

[hide] Improving test properties for neonatal cystic fibr... J Inherit Metab Dis. 2012 Jul;35(4):635-40. Cornel MC, Gille JJ, Loeber JG, Vernooij-van Langen AM, Dankert-Roelse J, Bolhuis PA
Improving test properties for neonatal cystic fibrosis screening in the Netherlands before the nationwide start by May 1st 2011.
J Inherit Metab Dis. 2012 Jul;35(4):635-40., [PMID:22302635]

Abstract [show]
When new technical possibilities arise in health care, often attunement is needed between different actors from the perspectives of research, health care providers, patients, ethics and policy. For cystic fibrosis (CF) such a process of attunement in the Netherlands started in a committee of the Health Council on neonatal screening in 2005. In the balancing of pros and cons according to Wilson and Jungner criteria, the advantages for the CF patient were considered clear, even though CF remains a severe health problem with treatment. Nevertheless, screening was not started then, mainly since the specificity of the tests available at that time was considered too low. Many healthy infants would have been referred for sweat testing and much uncertainty would arise in their parents. Also the limited sensitivity for immigrants and the detection of less severe phenotypes and carriers were considered problematic. The Health Council recommended a pilot screening project which was subsequently performed in some provinces, leading to a 4-step protocol: IRT, PAP, screening for a CFTR mutation panel, and sequencing of the CFTR gene. This would lead to the identification of 23 cases of classical CF, two infants with less severe forms and 12 carriers per year in the Netherlands. Thus many CF patients can be diagnosed early, while limiting the number of referrals, the number of infants with less severe forms diagnosed and the number of carriers identified. Technical solutions were found to limit the ethical problems. A nationwide program using this four step protocol started by 1 May 2011.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 This protocol was expected to identify 25 CF patients on an annual basis, additional to four infants already diagnosed because of meconium ileus (Health Council of 1 Using the LiPA test (INNO-LiPA CFTR 19 en INNO-LiPA CFTR 17+Tn; Innogenetics, Gent, Belgium) the following CFTR mutations can be detected: exon 2-3del (21 kb), 394delTT, E60X, G85E, R117H, 621+1G>T, 711+1G>T, 711+5G>A, 1078delT, R334W, R347P, A455E, I507del, F508del, 1717-1G>A, G542X, G551D, Q552X, R553X, R560T, 1898+1G>A, 2143delT, 2183AA>G, 2184delA, 2789+5G>A, 3120+1G>A, 3199del6, 3272-26A>G, 3659delC, R1162X, 3849+10kbC>T, 3905insT, S1251N, W1282X en N1303K. Login to comment
70 This test also identifies the CFTR polymorphism Tn in intron 8 which is important in cases where the mutation R117H is detected. Login to comment

[hide] The K+ channel opener 1-EBIO potentiates residual ... PLoS One. 2011;6(8):e24445. Epub 2011 Aug 31. Roth EK, Hirtz S, Duerr J, Wenning D, Eichler I, Seydewitz HH, Amaral MD, Mall MA
The K+ channel opener 1-EBIO potentiates residual function of mutant CFTR in rectal biopsies from cystic fibrosis patients.
PLoS One. 2011;6(8):e24445. Epub 2011 Aug 31., [PMID:21909392]

Abstract [show]
BACKGROUND: The identification of strategies to improve mutant CFTR function remains a key priority in the development of new treatments for cystic fibrosis (CF). Previous studies demonstrated that the K(+) channel opener 1-ethyl-2-benzimidazolone (1-EBIO) potentiates CFTR-mediated Cl(-) secretion in cultured cells and mouse colon. However, the effects of 1-EBIO on wild-type and mutant CFTR function in native human colonic tissues remain unknown. METHODS: We studied the effects of 1-EBIO on CFTR-mediated Cl(-) secretion in rectal biopsies from 47 CF patients carrying a wide spectrum of CFTR mutations and 57 age-matched controls. Rectal tissues were mounted in perfused micro-Ussing chambers and the effects of 1-EBIO were compared in control tissues, CF tissues expressing residual CFTR function and CF tissues with no detectable Cl(-) secretion. RESULTS: Studies in control tissues demonstrate that 1-EBIO activated CFTR-mediated Cl(-) secretion in the absence of cAMP-mediated stimulation and potentiated cAMP-induced Cl(-) secretion by 39.2+/-6.7% (P<0.001) via activation of basolateral Ca(2)(+)-activated and clotrimazole-sensitive KCNN4 K(+) channels. In CF specimens, 1-EBIO potentiated cAMP-induced Cl(-) secretion in tissues with residual CFTR function by 44.4+/-11.5% (P<0.001), but had no effect on tissues lacking CFTR-mediated Cl(-) conductance. CONCLUSIONS: We conclude that 1-EBIO potentiates Cl(-)secretion in native CF tissues expressing CFTR mutants with residual Cl(-) channel function by activation of basolateral KCNN4 K(+) channels that increase the driving force for luminal Cl(-) exit. This mechanism may augment effects of CFTR correctors and potentiators that increase the number and/or activity of mutant CFTR channels at the cell surface and suggests KCNN4 as a therapeutic target for CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 CFabsent CFresidual CFTR genotype Number of individuals CFTR genotype Number of individuals F508del/F508del 10 F508del/Y161C 1 F508del/W57X 1 F508del/V232D 1 F508del/G85E 3 F508del/R334W 2 F508del/120del23 1 F508del/T338I 1 F508del/182delT 1 F508del/I1234V 1 F508del/G542X 1 F508del/3272-26 A.G 1 F508del/A561E 1 F508del/3849+10 kb C.T 1 F508del/Y1092X 1 F508del/4005 +5727 A.G 1 F508del/N1303K 1 F508del/G576A 1 F508del/1525-1 G.A 2 N1303K/R334W 1 F508del/Q39X 1 F1052V/M1137R 1 F508del/Q552X 1 1898+3 A.G/ 1898+3 A.G 1 G85E/G85E 1 R334W/3199del6 1 Q552X/R1162X 1 R334W/X 1 A561E/A561E 2 dele2,3/X 1 R764X/1717-1 G.A 1 R1158X/2183AA.G 1 R1158X/R560T 1 doi:10.1371/journal.pone.0024445.t001 luminal and basolateral surfaces of the epithelium were perfused continuously with a solution of the following composition (mmol/ L): NaCl 145, KH2PO4 0.4, K2HPO4 1.6, D-glucose 5, MgCl2 1, Ca-gluconate 1.3, pH 7.4, at 37uC. Login to comment

[hide] Borderline sweat test: Utility and limits of genet... Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24. Seia M, Costantino L, Paracchini V, Porcaro L, Capasso P, Coviello D, Corbetta C, Torresani E, Magazzu D, Consalvo V, Monti A, Costantini D, Colombo C
Borderline sweat test: Utility and limits of genetic analysis for the diagnosis of cystic fibrosis.
Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24., [PMID:19318035]

Abstract [show]
OBJECTIVE: The sweat test remains the gold standard for the diagnosis of Cystic Fibrosis (CF) even despite the availability of molecular analysis of Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR). We investigated the relationship between CFTR mutation analysis and sweat chloride concentration in a cohort of subjects with borderline sweat test values, in order to identify misdiagnosis of CF. DESIGN AND METHODS: In the period between March 2006 and February 2008 we performed 773 sweat tests in individuals referred for suspect CF. Ninety-one subjects had chloride values in the border-line range. Clinicians required CFTR gene complete scanning on 66 of them. RESULTS: The mean value of sweat chloride in the DNA negative subjects was lower than in those with at least one CFTR mutation. Our data indicate that 39 mEq/l is the best sensitivity trade off for the sweat test with respect to genotype. CONCLUSIONS: To optimise diagnostic accuracy of reference intervals, it may be useful to modify from 30 to 39 mEq/l the threshold for sweat chloride electrolytes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported. Login to comment
57 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Hepatol. 2009 Jan;50(1):150-7. Epub 2008 Oct 7. Henckaerts L, Jaspers M, Van Steenbergen W, Vliegen L, Fevery J, Nuytten H, Roskams T, Rutgeerts P, Cassiman JJ, Vermeire S, Cuppens H
Cystic fibrosis transmembrane conductance regulator gene polymorphisms in patients with primary sclerosing cholangitis.
J Hepatol. 2009 Jan;50(1):150-7. Epub 2008 Oct 7., [PMID:18992954]

Abstract [show]
BACKGROUND/AIMS: Primary sclerosing cholangitis (PSC) is a progressive cholestatic disease commonly associated with inflammatory bowel disease (IBD) and characterized by fibrosing inflammatory destruction of bile ducts. The histological features in the liver of PSC patients are similar to those observed in cystic fibrosis (CF). Our aim was to study whether variants in the CFTR gene are associated with the occurrence and/or evolution of PSC. METHODS: PSC patients (n=140) were genotyped for F508del, the TGmTn variants, and four additional polymorphic loci (1001+11 C>T, M470V, T854T and Q1463Q), and compared to 136 matched healthy controls. RESULTS: The 1540G-allele, encoding V470, was less frequent in PSC (52%) than in controls (64%, p=0.003), and was associated with protection against PSC in individuals without IBD (OR 0.25, 95% CI 0.12-0.52, p=0.0002). Also TG11-T7 was less frequent in PSC (53%) than in controls (61%, p=0.04), this haplotype was associated with reduced risk for PSC (OR 0.34, 95% CI 0.17-0.70, p=0.003) in individuals without IBD. CONCLUSIONS: In this cohort of PSC patients, several CFTR-variants affecting the functional properties of the CFTR protein seem to offer protection against the development of PSC, confirming our hypothesis that CFTR might be implicated in the pathogenesis of PSC.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
91 There was Table 4 Summary of the 37 CFTR variants studied in the exploratory phase INNO-LiPA CFTR 19 INNO-LiPA CFTR17+Tn Update F508del 621+1GfiT G542X 3849+10kbCfiT N1303K 2183AAfiG W1282X 394delTT G551D 2789+5GfiA 1717-1GfiA R1162X R553X 3659delC CFTRdele2,3(21kb) R117H I507del R334W 711+1GfiT R347P 3272-26AfiG G85E 3905insT 1078delT R560T A455E 1898+1GfiA 2143delT S1251N E60X I148T 2184delA 3199del6 711+5GfiA 3120+1GfiA Tn Q552X Fig. 1. Login to comment

[hide] Consensus on the use and interpretation of cystic ... J Cyst Fibros. 2008 May;7(3):179-96. Castellani C, Cuppens H, Macek M Jr, Cassiman JJ, Kerem E, Durie P, Tullis E, Assael BM, Bombieri C, Brown A, Casals T, Claustres M, Cutting GR, Dequeker E, Dodge J, Doull I, Farrell P, Ferec C, Girodon E, Johannesson M, Kerem B, Knowles M, Munck A, Pignatti PF, Radojkovic D, Rizzotti P, Schwarz M, Stuhrmann M, Tzetis M, Zielenski J, Elborn JS
Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice.
J Cyst Fibros. 2008 May;7(3):179-96., [PMID:18456578]

Abstract [show]
It is often challenging for the clinician interested in cystic fibrosis (CF) to interpret molecular genetic results, and to integrate them in the diagnostic process. The limitations of genotyping technology, the choice of mutations to be tested, and the clinical context in which the test is administered can all influence how genetic information is interpreted. This paper describes the conclusions of a consensus conference to address the use and interpretation of CF mutation analysis in clinical settings. Although the diagnosis of CF is usually straightforward, care needs to be exercised in the use and interpretation of genetic tests: genotype information is not the final arbiter of a clinical diagnosis of CF or CF transmembrane conductance regulator (CFTR) protein related disorders. The diagnosis of these conditions is primarily based on the clinical presentation, and is supported by evaluation of CFTR function (sweat testing, nasal potential difference) and genetic analysis. None of these features are sufficient on their own to make a diagnosis of CF or CFTR-related disorders. Broad genotype/phenotype associations are useful in epidemiological studies, but CFTR genotype does not accurately predict individual outcome. The use of CFTR genotype for prediction of prognosis in people with CF at the time of their diagnosis is not recommended. The importance of communication between clinicians and medical genetic laboratories is emphasized. The results of testing and their implications should be reported in a manner understandable to the clinicians caring for CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1236 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment
1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment

[hide] High incidence of the CFTR mutations 3272-26A-->G ... J Cyst Fibros. 2007 Nov 30;6(6):371-5. Epub 2007 May 3. Storm K, Moens E, Vits L, De Vlieger H, Delaere G, D'Hollander M, Wuyts W, Biervliet M, Van Schil L, Desager K, Nothen MM
High incidence of the CFTR mutations 3272-26A-->G and L927P in Belgian cystic fibrosis patients, and identification of three new CFTR mutations (186-2A-->G, E588V, and 1671insTATCA).
J Cyst Fibros. 2007 Nov 30;6(6):371-5. Epub 2007 May 3., [PMID:17481968]

Abstract [show]
We have analyzed 143 unrelated Belgian patients with a positive diagnosis of cystic fibrosis (CF) for mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. An initial screening for 29 CFTR mutations led to mutation identification in 89.9% of the tested chromosomes. Subsequently an extensive analysis of the CFTR gene was performed by denaturating gradient gel electrophoresis (DGGE) in those patients with at least one unknown mutation after preliminary screening. In addition to 10 previously reported mutations we identified 2 new mutations 186-2A-->G and E588V. A third new mutation 1671insTATCA was identified during routine screening for DeltaF508. Two mutations were detected with a higher frequency than expected: 3272-26A-->G, which is the second most common mutation after DeltaF508 in our CF population with a frequency of 3.8%, and L927P (2.4%). The clinical data is presented for the mutations 186-2A-->G, E588V, 3272-26A-->G and L927P. The mutation data are useful for the Belgian population to supplement the initial screening set of mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 The Inno Lipa™ CFTR12 assay contains normal and mutant probes for 12 different CFTR mutations (ΔF508, G542X, N1303K, 1717-1G→A, W1282X, G551D, R553X, S1251N, R560T, 3905insT, Q552X, ΔI507). Login to comment

[hide] Spectrum of mutations in CFTR in Finland: 18 years... J Cyst Fibros. 2005 Dec;4(4):233-7. Epub 2005 Jul 26. Kinnunen S, Bonache S, Casals T, Monto S, Savilahti E, Kere J, Jarvela I
Spectrum of mutations in CFTR in Finland: 18 years follow-up study and identification of two novel mutations.
J Cyst Fibros. 2005 Dec;4(4):233-7. Epub 2005 Jul 26., [PMID:16051530]

Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) is low in the isolated Finnish population and the Finnish CF mutation spectrum has differed from many European countries. METHODS: We have analyzed the mutation spectrum and the geographical distribution of CF mutations in Finland covering the last 18 years (1987-2004). RESULTS: A total of 14 mutations were identified; two of them new, 774insT and S589T (G>C at 1,898). The overall coverage of mutations was 97% (99/102 chromosomes). The most frequent mutations were F508del and 394delTT, found in 36% (37/102) and 35% (36/102) of the CF chromosomes respectively. Of the rare mutations, a mutation of presumable Slavic origin, CFTRdele2.3 (21 kb), was enriched in a rural isolate with a frequency of 5,9% (6/102), and a mutation that possibly indicates Swedish influence, 3659delC, was scattered throughout the country with a similar frequency of 5,9% (6/102). G542X, R1162X, R117H, 3732delA, 1,898 + 3A >C, S1196X, S945L, W57R, 774insT and S589T were each identified in a number of chromosomes from one to three. CONCLUSIONS: Our observations of the Finnish CF mutation spectrum fit well with the characteristics of Finland as a population of multiple local founder effects.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 The InnoLipa assay recognizes 36 mutations: E60X (c.178G>T, p.Glu60X), G85E (c.254G>A, p.Gly85- Glu), 394delTT, R117H (c.350G>A, p.Arg117His), I148T (c.443T>C, p.Ile148Thr), 621+1G>T (c.489+1G>T), 711+1G>T (c.579+1G>T), 711+5G>A (c.579+5G>A), 1078delT (c.948delT, p.Phe316fs), R334W (c.1000C>T, p.Arg334Trp), R347P (c.1040G>C, p.Arg347Pro), A455E (c.1364C>A, p.Ala455Glu), I507del (c.1519_1521delATC, p.Ile507del), F508del, 1717À1G>A (c.1585À1G>A), G542X, G551D (c.1652G >A, p.Gly551Asp), Q552X (c.1654C > T, p.Gln552X), R553X (c.1657C > T, p.Arg553X), R560T (1679G>vC, p.Arg560Thr), 1898+ 1G > A (c.1766 + 1G > A), 2143delT (c.2012delT, p.Leu671fs), 2183AA > G (c.2051_2052delAAinsG, p.Lys684fs), 2184delA (c.2052delA, p.Lys684fs), 2789+ 5G>A (c.2657+5G>A), 3120+1G>A (c.2988+1G>A), 3199del6 (c.3067_3072del, p.Ile1023_Val1024del), 3272À 26A > G (c.3140 À26A > G), R1162X (c.3484C > T, p.Arg1162X), 3849+10kbCYT, 3659delC (c.3528delC, p.Lys1177fs), S1251N (c.3752G > A, p.Ser1251Asn), 3905insT (c.3773dupT, p.Leu1258fs), W1282X (c.3846G> A, p.Trp1282X), N1303K (c.3909C>G, p.Asn1303Lys), CFTRdele2,3(21kb) and Tn-polymorphism on intron 8. Login to comment
37 The InnoLipa assay recognizes 36 mutations: E60X (c.178G>T, p.Glu60X), G85E (c.254G>A, p.Gly85Glu), 394delTT, R117H (c.350G>A, p.Arg117His), I148T (c.443T>C, p.Ile148Thr), 621+1G>T (c.489+1G>T), 711+1G>T (c.579+1G>T), 711+5G>A (c.579+5G>A), 1078delT (c.948delT, p.Phe316fs), R334W (c.1000C>T, p.Arg334Trp), R347P (c.1040G>C, p.Arg347Pro), A455E (c.1364C>A, p.Ala455Glu), I507del (c.1519_1521delATC, p.Ile507del), F508del, 1717 1G>A (c.1585 1G>A), G542X, G551D (c.1652G >A, p.Gly551Asp), Q552X (c.1654C > T, p.Gln552X), R553X (c.1657C > T, p.Arg553X), R560T (1679G>vC, p.Arg560Thr), 1898+ 1G > A (c.1766 + 1G > A), 2143delT (c.2012delT, p.Leu671fs), 2183AA > G (c.2051_2052delAAinsG, p.Lys684fs), 2184delA (c.2052delA, p.Lys684fs), 2789+ 5G>A (c.2657+5G>A), 3120+1G>A (c.2988+1G>A), 3199del6 (c.3067_3072del, p.Ile1023_Val1024del), 3272 26A > G (c.3140 26A > G), R1162X (c.3484C > T, p.Arg1162X), 3849+10kbCYT, 3659delC (c.3528delC, p.Lys1177fs), S1251N (c.3752G > A, p.Ser1251Asn), 3905insT (c.3773dupT, p.Leu1258fs), W1282X (c.3846G> A, p.Trp1282X), N1303K (c.3909C>G, p.Asn1303Lys), CFTRdele2,3(21kb) and Tn-polymorphism on intron 8. Login to comment

[hide] Hyperechogenic fetal bowel: counseling difficultie... Eur J Med Genet. 2005 Oct-Dec;48(4):421-5. Marcus-Soekarman D, Offermans J, Van den Ouweland AM, Mulder AL, Muntjewerff N, Vossen M, Kleijer W, Schrander-Stumpel C, Dooijes D
Hyperechogenic fetal bowel: counseling difficulties.
Eur J Med Genet. 2005 Oct-Dec;48(4):421-5., [PMID:16378926]

Abstract [show]
The detection of echodense fetal bowel on ultrasound examination in the second trimester of pregnancy justifies invasive procedures such as amniocentesis to detect an underlying cause. We present a case in which initial tests identified only one mutation in the cystic fibrosis transmembrane regulator (CFTR)-gene of the fetus, the family history being negative for CF. Strongly reduced intestinal enzyme activities suggested intestinal obstruction and further increased the estimated risk for CF. After the 24th gestational week, a second mutation was found, confirming cystic fibrosis in this child. Problems in counseling in this particular case are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Routine CFTR-mutation analysis, using Table 1 CFTR-mutations screened for in the first step E60X 2143delT G542X G85E 2183AA-G G551D 394delTT 2184delA Q552X 621 + 1G-T 2789 + 5G-A R553X R117H 3849 + 10kbC-T R560T 711 + 5G-A R1162X S1251N 1078delT 3659delC 390insT R334W delta I507 W1282X R347P delta F508 N1303K A455E 1717-1G-A a panel of 29 CFTR-mutations, detects only 41.6% of CFTR-mutations in the Turkish population [1]. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

[hide] CFTR Cl- channel function in native human colon co... Gastroenterology. 2004 Oct;127(4):1085-95. Hirtz S, Gonska T, Seydewitz HH, Thomas J, Greiner P, Kuehr J, Brandis M, Eichler I, Rocha H, Lopes AI, Barreto C, Ramalho A, Amaral MD, Kunzelmann K, Mall M
CFTR Cl- channel function in native human colon correlates with the genotype and phenotype in cystic fibrosis.
Gastroenterology. 2004 Oct;127(4):1085-95., [PMID:15480987]

Abstract [show]
BACKGROUND & AIMS: Cystic fibrosis (CF) is caused by over 1000 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and presents with a widely variable phenotype. Genotype-phenotype studies identified CFTR mutations that were associated with pancreatic sufficiency (PS). Residual Cl- channel function was shown for selected PS mutations in heterologous cells. However, the functional consequences of most CFTR mutations in native epithelia are not well established. METHODS: To elucidate the relationships between epithelial CFTR function, CFTR genotype, and patient phenotype, we measured cyclic adenosine monophosphate (cAMP)-mediated Cl- secretion in rectal biopsy specimens from 45 CF patients who had at least 1 non-DeltaF508 mutation carrying a wide spectrum of CFTR mutations. We compared CFTR genotypes and clinical manifestations of CF patients who expressed residual CFTR-mediated Cl- secretion with patients in whom Cl- secretion was absent. RESULTS: Residual anion secretion was detected in 40% of CF patients, and was associated with later disease onset (P < 0.0001), higher frequency of PS (P < 0.0001), and less severe lung disease (P < 0.05). Clinical outcomes correlated with the magnitude of residual CFTR activity, which was in the range of approximately 12%-54% of controls. CONCLUSIONS: Specific CFTR mutations confer residual CFTR function to rectal epithelia, which is related closely to a mild disease phenotype. Quantification of rectal CFTR-mediated Cl- secretion may be a sensitive test to predict the prognosis of CF disease and identify CF patients who would benefit from therapeutic strategies that would increase residual CFTR activity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Original recordings of the effects of cAMP-dependent (100 ␮mol/L IBMX and 1 ␮mol/L forskolin, basolateral) and cholinergic (100 ␮mol/L carbachol and CCH, basolateral) activation on Vte and Rte in rectal tissues from (A) a control subject, (B) a CF patient with no detectable Cl- secretion (R1162X/Q552X), and (C) a CF patient expressing residual Cl- secretion (S1159F/S1159F), as evidenced by lumen-negative Vte responses. Login to comment
78 Relationship Between the CFTR Genotype and Cl- Channel Function in Native Rectal Epithelia CFTR genotype Number of individuals Sweat Cl-concentration (mmol/L)a cAMP-mediated response Carbachol-induced plateau response or maximal lumen-negative response Isc-cAMP (␮A/cm2) Cl- secretion (% of control) Isc-carbachol (␮A/cm2) Cl- secretion (% of control) Cl- secretion absent R1162X/Q552X 1 71 17.1 0 0.7 0 W1282X/3121-2AϾG 1 112 1.9 0 0.6 0 1898 ϩ 1G Ͼ T/1609delCA 2b 114, 118 25.4, 13.4 0, 0 0, 0.7 0, 0 ⌬F508/Q39X 2b 127, 129 2.6, 4.4 0, 0 1.7, 3.7 0, 0 ⌬F508/G542X 1 102 29.0 0 6.6 0 ⌬F508/R553X 3 112, 102, 109 13.1, 4.5, 23.8 0, 0, 0 1.5, 4.4, 1.0 0, 0, 0 ⌬F508/E585X 1 115 1.4 0 1.1 0 ⌬F508/Q637X 1 100 2.9 0 1.2 0 ⌬F508/Y1092X 1 119 0.0 0 -0.3 0 ⌬F508/120del23c 1 72 20.1 0 3.3 0 ⌬F508/182delT 1 116 10.8 0 5.2 0 ⌬F508/3905insT 2 88, 96 8.4, 5.6 0, 0 2.3, -1.1 0, 1 ⌬F508/V520F 1 68 1.2 0 1.7 0 ⌬F508/A561E 3 113, 146, 100 17.0, 17.0, 16.0 0, 0, 0 2.1, 1.5, 3.7 0, 0, 0 ⌬F508/R1066C 1 138 0.0 0 0.0 0 ⌬F508/N1303K 3 100, 117, 94 1.7, 4.1, 1.5 0, 0, 0 -0.6, 2.2, 0.8 0, 0, 0 A561E/A561E 2 101, 116 6.6, 2.0 0, 0 7.3, 3.3 0, 0 Residual Cl- secretiond G542X/I148N 1 75 -50.1 54 -22.2 12 1898 ϩ 3A Ͼ G/1898 ϩ 3A Ͼ G 1 82 -36.8 39 -12.9 7 ⌬F508/3272-26A Ͼ G 1 116 -17.8 19 -27.2 14 ⌬F508/S108F 1 118 -15.8 17 -12.3 7 ⌬F508/R117H 1 90 -35.9 38 -207.7 109 ⌬F508/Y161Cc 1 44 -35.1 37 -45.9 25 ⌬F508/P205S 1 80 -23.3 25 -10.4 5 ⌬F508/V232D 1 120 -16.9 18 -26.9 14 ⌬F508/R334W 1 92 -22.1 23 -21.1 11 ⌬F508/R334W 1 101 -24.5 26 -37.4 20 ⌬F508/T338I 1 73 -44.4 47 -79.4 42 ⌬F508/G576A 1 40 -16.9 18 -115.5 61 ⌬F508/I1234V 1 113 -13.6 15 -8.6 5 G576A/G85E 1 95 -26.1 28 -61.6 32 F1052V/M1137R 1 47 -36.7 39 -146.6 77 M1101K/M1101K 1 94 -11.1 12 -4.8 3 S1159F/S1159F 1 67 -47.9 51 -38.7 21 N1303K/R334W 1 91 -30.3 32 -47.7 25 NOTE. CFTR Cl- channel function was determined in rectal epithelia from Cl- secretory responses induced by IBMX/forskolin (Isc-cAMP) and after co-activation with carbachol (Isc-carbachol). Login to comment
101 Functional Classification and Protein Location of CFTR Mutations Mutation type Severe mutations (protein location) Mild mutations (protein location) Missense V520F, A561E (NBD1) G85E (MSD1, TM1) R1066C (MSD2, CL4) S108F, R117H (MSD1, EL1) N1303K (NBD2) I148N, Y161Ca (MSD1, CL1) P205S (MSD1, TM3) V232D (MSD1, TM4) R334W, T338I (MSD1, TM6) G576A (NBD1) I1234V (NBD2) F1052V, M1101K (MSD2, CL4) M1137R (MSD2, TM12) S1159F (pre-NBD2) Splice 1898 ϩ 1G Ͼ T (R domain) 1898 ϩ 3A Ͼ G (R domain) 3121-2A Ͼ G (MSD2, TM9) 3272-26A Ͼ G (MSD2, TM10) Single amino acid deletion ⌬F508 (NBD1) Nonsense Q39X (N-terminus) G542X, Q552X, R553X, E585X (NBD1) Q637X (R domain) Y1092X (MSD2, CL4) R1162X (pre-NBD2) W1282X (NBD2) Frameshift 120del23a 182delT (N-terminus) 1609delCA (NBD1) 3905insT (NBD2) NOTE. Severe mutation, Cl- secretion absent; mild mutation, residual cAMP-mediated Cl- secretion. Login to comment

[hide] CFTR mutations and IVS8-5T variant in newborns wit... J Med Genet. 1997 Apr;34(4):297-301. Castellani C, Bonizzato A, Mastella G
CFTR mutations and IVS8-5T variant in newborns with hypertrypsinaemia and normal sweat test.
J Med Genet. 1997 Apr;34(4):297-301., [PMID:9138152]

Abstract [show]
Neonates positive for immunoreactive trypsinogen assay (IRT) and negative for sweat test have formerly been found to carry the major cystic fibrosis (CF) mutation, delta F508, much more frequently than the general population. Among the 716 IRT positive newborns detected by a three tier (IRT, mutation analysis plus meconium lactase assay, sweat test) CF screening programme in north eastern Italy during the period January 1993 to March 1996, we found 45 carriers, a number significantly higher than the expected 17 (p < 0.001). We speculated that some of these heterozygotes could actually be affected by a very mild form of CF, and carry on the other chromosome an undetected CFTR mutation or a DNA variant, such as the 5-thymidine allele in intron 8 of the CFTR gene (IVS8-5T). This hypothesis was tested in four samples; group A (the 45 carriers mentioned above), group B (51 non-carrier, IRT positive neonates), group C (50 IRT negative neonates), and group D (90 CF adult female carriers). Chromosomes with IVS8-5T were seven (7.78%) in group A, seven (6.86%) in group B, five (5%) in group C, and four in group D (2.22%). The 5T prevalence in group A was significantly higher (p < 0.05) compared to group D; similarly, a higher (p < 0.05) 5T frequency in group A compared to group C was detected by considering the chromosomes free from CFTR mutations. This study is consistent with previous papers in finding among neonates with high trypsin levels a CF carrier frequency significantly higher than that expected. It is also suggested that in at least some babies raised trypsin levels at birth could be a phenotypic expression of compound heterozygosity for a major CF mutation plus IVS8-5T.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Initially we tested for AF508, Rl 162X, and N1303K, estimated by a cohort study7 to cover 61 % of CF chromosomes in our area; from March 1995 10 other mutations were included (2183AAG, 3849+1OKbCT, G542X, 1717-1GA, R553X, Q552X, G85E, 711+5GA, 3132delTG, Cystic Fibrosis Centre, Ospedale Civile Maggiore, Piazzale Stefani, 37126 Verona, Italy C Castellani A Bonizzato G Mastella Correspondence to: Dr Castellani. Login to comment

[hide] Haplotype analysis of 94 cystic fibrosis mutations... Hum Mutat. 1996;8(2):149-59. Morral N, Dork T, Llevadot R, Dziadek V, Mercier B, Ferec C, Costes B, Girodon E, Zielenski J, Tsui LC, Tummler B, Estivill X
Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers.
Hum Mutat. 1996;8(2):149-59., [PMID:8844213]

Abstract [show]
We have analyzed 416 normal and 467 chromosomes carrying 94 different cystic fibrosis (CF) mutations with polymorphic genetic markers J44, IVS6aGATT, IVS8CA, T854, IVS17BTA, IVS17BCA, and TUB20. The number of mutations found with each haplotype is proportional to its frequency among normal chromosomes, suggesting that there is no preferential haplotype in which mutations arise and thus excluding possible selection for specific haplotypes. While many common mutations in the worldwide CF population showed absence of haplotype variation, indicating their recent origins, some mutations were associated with more than one haplotype. The most common CF mutations, delta F508, G542X, and N1303K, showed the highest number of slippage events at microsatellites, suggesting that they are the most ancient CF mutations. Recurrence was probably the case for 9 CF mutations (R117H, H199Y, R347YH, R347P, L558S, 2184insA, 3272-26A-->G, R1162X, and 3849 + 10kbC-->T). This analysis of 94 CF mutations should facilitate mutation screening and provides useful data for studies on population genetics of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Other haplotypes that were less commonon normal chromosomes(16-44-13, 16-35-13, 16-33-13, and 16-29-13)were each associatedwith only one CF mutation. Several mutations were associated with more than one haplotype apparentlyas the result of slippage at one of the microsatellites IVS8CA, IVS17BTA, and IVS17BCA: AF508, G542X, N1303K, R553X, Q552X, 2869insG, L1077P, 7H, and R1162X (Table 3). Login to comment
106 (1992) Dork et al. (1994a) Malone et al. (personal communication) Claustreset al. (1992) Ferec et al. (1992) Fanen et al. (1992) lvaschenko et al. (1991) T. Dork (personal communication) Dean et al. (1990) Dork et al. (1994a) Ferec et al. (1992) Bozon et al. (1994) Costes et al. (personal communication) Fanen et al. (1992) Audrezet et al. (personal communication) Zielenski et al. (1991a) Zielenski et al. (1991a) Granell et al. (1992) Highsmith et al. (1990) Mercier et al. (1993b) Vidaud et al. (1990) Fanen et al. (1992) Fanen et al. (1992) Dork et al. (1994b) (continued) HAPLOTYPESFOR 94 CF MUTATIONS TABLE2. CFTR HaplotvpesforDiallelic and Multiallelic DNA Markers for 94 CF Mutations"(Continued) ~~ ~ J44-GAIT- 8CA-17BTA- No. of TSU-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 1-6-1-2 (9.1%) 1-6-2-2 (8.9%) 1-7-1-2 (3.4%) 1-7-2-2 (2.6%) 2-7-1-1 (1.2%) 2-7-2-2 (0.7%) 17-7-16 16-7-18 16-7-17 15-7-17 24-31-13 23-52-13 23-34-13 23-33-14 23-33-13 23-32-13 23-31-13 23-30-13 23-21-19 23-18-13 22-35-13 22-31-13 22-30-13 21-31-13 19-33-13 18-45-13 18-37-13 18-35-13 17-57-11 17-55-13 17-55-11 17-54-11 17-53-11 17-52-11 17-51-11 17-33-13 16-46-13 16-45-13 16-44-13 16-42-13 16-35-13 16-30-13 16-30-13 16-7-17 16-21-19 L107% L1077P 24ldelAT L719X A1507 3849+10kbC-T 2184insA 2991de132 G551D 1154insTC V520F R560T 4114ATA+lT 3667de14 435insA Q414X C225R Q39X N1303K R1162X H199Y G542X G542X w1204x R347H G542X AF50gb N1303K 2143delT 3849f 10kbC-T N1303K 681delC R347H A455E N1303K A120T 621+1 h T 574delA 1221delCT F311L R560K R553X R533X R553X Q552X R553X Q552X R116W R553X 1898+5 h T 3272-26A-G 1717-1hA 1342-2A-C A1507 2869insG 2869insG E92X 4374+1 h T 2183AA-G R117H 1609delCA I336K W1063X 1 1 1 1 6 1 3 1 1 22 17 1 1 1 1 1 1 1 1 1 1 1 1 1 17 1 1 4 157 7 1 2 2 1 1 2 2 1 9 1 1 1 1 1 1 6 1 1 1 2 1 3 2 1 3 1 1 1 4 2 4 1 1 - - 10.33 1.45 - - 0.48 1.45 - 0.24 1.45 0.24 - - - - 0.24 0.48 - - - - - - 0.49 0.48 - 0.24 0.24 0.24 - - - - - 0.72 0.24 0.72 - t h fP h b.fb,fP h b,fp.t t h b.fb.fp,h,t b.fb.fp,h,t t t t h b h h fP h fP fb b fP b.fb,fP,h.t fP fb b,fP,t b.fb,fp,h,t b.fb,h h h h,t t fb t b b b.fb.t fP fb fb tb h fP h h t t b h t h b b h h b,fb,h fP.h b h fP fP Bozon et al. (1994) Fanen et al. (1992) Dork et al. (1994a) Kerem et al. (1990) Dork et al. (1994~) Cutting et al. (1990) Kerem et al. (1990) lannuui et d. Login to comment
136 Other mutations with relative frequency of less than 0.7% are associated with more than one haplotype that should be the result of slippage at one or several microsatellite repeats (R553X, R334W, 1811+1.6kbA-+G, 711 + lG+T, Q552X, 2869insG, L1077P, R347H, and R1162X). Login to comment

[hide] Cystic fibrosis mutation detection by hybridizatio... Hum Mutat. 1996;7(3):244-55. Cronin MT, Fucini RV, Kim SM, Masino RS, Wespi RM, Miyada CG
Cystic fibrosis mutation detection by hybridization to light-generated DNA probe arrays.
Hum Mutat. 1996;7(3):244-55., [PMID:8829658]

Abstract [show]
We have combined photochemistry and photolithography with solid-phase DNA synthesis chemistry to form a new technology that makes high density oligonucleotide probe array synthesis possible. Hybridization to these two-dimensional arrays containing hundreds or thousands of oligonucleotide probes provides a powerful DNA sequence analysis tool. Two types of light-generated DNA probe arrays have been used to test for a variety of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. One array, made up of 428 probes, was designed to scan through the length of CFTR exon 11 and identify differences from the wild type reference sequence. The second type of array contained 1480 probes chosen to detect known deletions, insertions, or base substitution mutations. The validity of the probe arrays was established by hybridizing them with fluorescently labeled control oligonucleotide targets. Characterized mutant CFTR genomic DNA samples were then used to further test probe array hybridization specificity. Finally, ten unknown patient samples were genotyped using the CFTR probe array assay. The genotype assignments were identical to those obtained by PCR product restriction fragment analysis. Our results show that light-generated DNA probe arrays are highly effective in analyzing complex mutation and polymorphism patterns in a relatively large gene such as CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
238 Cystic Fibrosis Mutation-Specific DNA Probe Array" Mutation Exon and column Tested Subarrayhow G85E R117H I148T 621 -+ l(G+T) 711 + 1(G+T) R334W R347H R347P 1078 delT A455E G480C Q493X A1507 F508C AF508 V520F G542X S549R(T-+ G) G551D Q552X R553X A559T R560T 1898 + l(G-,A) 2184 del A 2789 + 5(G+ A) R1066C L1077P Y1092X R1162X 3659 del C 1717-1(& A) 3272 - 26(A+ G) 3 4 4 in 4 in 5 7 7 7 7 9 10 10 10 10 10 10 in 10 11 11 11 11 11 11 11 in 12 13 in 14b in 17a 17b 17b 17b 19 19 * * * * * * * * * * * * * * * * * * * * * * * * * * * * 3849 + lOkb C-, T in 19 9,3 W1282X 20 994 3905insT 20 10.1 * N1303K 21 10,2 * * * "Row and column locations for each of the mutation specific,40 probe sets included in the specialized probe array design. Login to comment

[hide] Correlation of sweat chloride concentration with c... J Pediatr. 1995 Nov;127(5):705-10. Wilschanski M, Zielenski J, Markiewicz D, Tsui LC, Corey M, Levison H, Durie PR
Correlation of sweat chloride concentration with classes of the cystic fibrosis transmembrane conductance regulator gene mutations.
J Pediatr. 1995 Nov;127(5):705-10., [PMID:7472820]

Abstract [show]
OBJECTIVE: To compare differences in epithelial chloride conductance according to class of mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. METHODS: We evaluated the relationship between the functional classes of CFTR mutations and chloride conductance using the first diagnostic sweat chloride concentration in a large cystic fibrosis (CF) population. RESULTS: There was no difference in sweat chloride value value between classes of CFTR mutations that produce no protein (class I), fail to reach the apical membrane because of defective processing (class II), or produce protein that fails to respond to cyclic adenosine monophosphate (class III). Those mutations that produce a cyclic adenosine monophosphate-responsive channel with reduced conductance (class IV) were associated with a significantly lower, intermediate sweat chloride value. However, patients with the mutations that cause reduced synthesis or partially defective processing of normal CFTR (class V) had sweat chloride concentrations similar to those in classes I to III. CONCLUSION: Studies of differences in chloride conductance between functional classes of CFTR mutations provide insight into phenotypic expression of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 Defined mutations (each mutation cited in references 8, 23, and 24; numerals in parentheses indicate number of patients): Nonsense mutations-----class I: Frameshift mutations---class I: Splice site mutations-class I: Missense mutations---class HI: Missense mutations---class IV: Partially defective processing---class V: Alternative spficing-----classV: R1162X (3), Y1092X (3), G542X (21), Q552X (2), Q493X (2), w1282x (2), E1104X (1), R553X (6), E585X (l), (all PI) 3659delC (5), 2184delA (4), 4010de14 (1), 556delA (1), 3002delG (1) 3905insT (1), 4016insT (3), 1154insTC (l), 441delA (1), 2184insA (2), 1078delT (1), 4326delTC (3) (all PI) I717-1G--~A (4), 621+lG--*T (10), 711+IG--~T (3), 875+1G-+C (2), 3120+IG-~A (1) (18 PI, 2 PS) G551D (25), N1303K (7), R560T (8), I148T (1), G85E (3), A559T (1), L1077P (2), T1234V (1), (47 PI, 1 PS) R117H (10), R347H (3), R347P (1), D614G (1), S1251N (2), (all PS) P574H (2), A455E (2), (all PS) 3272-26A-+G (4), 3849+10KbC---~T (2), 3120G-+A (1), (all PS) analysis, we further grouped the patients according to the molecular consequences conferred by the CFTR alleles. Login to comment

[hide] Analysis of the complete coding region of the CFTR... Hum Genet. 1995 Apr;95(4):397-402. Bonizzato A, Bisceglia L, Marigo C, Nicolis E, Bombieri C, Castellani C, Borgo G, Zelante L, Mastella G, Cabrini G, et al.
Analysis of the complete coding region of the CFTR gene in a cohort of CF patients from north-eastern Italy: identification of 90% of the mutations.
Hum Genet. 1995 Apr;95(4):397-402., [PMID:7535742]

Abstract [show]
A complete coding-region analysis on 225 cystic fibrosis (CF) chromosomes from a cohort that includes all the affected subjects born in two North-Eastern Italian regions over eight years was performed. In a previous study, we identified mutations on 166/225 (73.8%) CF chromosomes after screening for 62 mutations. To characterise the remaining 59 CF chromosomes, we carried out automated direct DNA sequencing (exons 9 and 13), RNA single-strand conformation polymorphism (exons 1-8 and 10-12) and denaturing gradient gel electrophoresis (exons 14a-24) of the 27 exons and flanking regions of the CF transmembrane conductance regulator gene. We identified 22 mutations, four of which are novel, viz. 711 + 5G-->A, R709X, 3132delTG and 2790-2A-->G, and we characterised 90.2% (203/225) of the CF chromosomes. Taking advantage of the homogeneity of the sample, an evaluation of the most important clinical parameters, assessed at the age of 12 years, is presented. We confirm some previously reported genotype-phenotype correlations and we report a new nonsense mutation (R709X) associated with a pancreatic sufficient phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Table 1 CF mutations identified in this cohort study (225 chromosomes from Veneto and Trentino Alto-Adige) n Number of CF chromosomes, Cum fi cumulative fraction, wnovel mutation identified during this study " Cystic Fibrosis Genetic Analysis Consortium, personal comunication Table 2 DNA sequence variations identified in this cohort study (w Novel sequence variation identified during this study a Cystic Fibrosis Genetic Analysis Consortium, personal comunication Mutation Exon n % Cure fr References AF508 l0 107 47.56 47.56 Kerem et al. 1989 R1162X 19 22 9.78 57.33 Gasparini et al. 1991 2183AA----~G 13 21 9.33 66.67 Bozon et al. 1994 N1303K 21 9 4.00 70.67 Osborne et al. t991 G542X 11 6 2.67 73.33 Kerem et al. 1990 711+5G--~A intron 5 6 2.67 76.00 w 1717 1G--~A intron 10 5 2.22 78.22 Kerem et al. 1990 G85E 3 3 1.33 79.56 Zielenski et al. 1991~' R553X 11 3 1.33 80.89 Cutting et al. 1990 2789+5G--~A intron 14b 3 1.33 82.22 Highsmith* Q552X 11 3 1.33 83.56 Devoto et al. 1991 621+lG---~T intron 4 2 0.89 84.44 Zielenski et al. 1991b W1282X 20 2 0.89 85.33 Vidaud et al. 1990 3132delTG 17a 2 0.89 86.22 w 2790-2A---~G intron 14b 2 0.89 87.11 w 457TAT--)G 4 1 0.44 87.56 Ravnik-Glavac et al. 1993 R347P 7 1 0.44 88.00 Dean et al. 1990 G551D 11 .1 0.44 88.44 Cutting et al. 1990 1717-8G-+A intron 10 1 0.44 88.89 Savov et al. 1994 3849+ 10KbC--)T intron 19 1 0.44 89.33 Highsmith* R709X 13 1 0.44 89.78 w 1898+3A---~G intron 12 1 0.44 90.22 Cremonesi et al. 1992 Identified 203 90.22 Unidentified 22 9.78 Variatioh Exon References 1540 A orG Met or Val at 470 10 Kerem et al. 1990 1898+152 T or A intron 12 Chillon et al. 1991 2134 C or T Arg or Cys at 668 13 Fanen et al. 1992 2694 T or G No change Thr at 854 14a Zielenski et al. 199 lb 2752-22 A or G intron 14a w 3601-65 C or A intron 18 Dork et al. 199l 4029 A or G No change Thr at 1299 21 Fanen et al. 1992 4404 C or T No change Tyr at 1424 24 ShoshanP 711 +5G--+A This mutation was found in the splice donor site flanking the 3' end of exon 5. Login to comment

[hide] Increased incidence of cystic fibrosis gene mutati... Hum Mol Genet. 1995 Apr;4(4):635-9. Pignatti PF, Bombieri C, Marigo C, Benetazzo M, Luisetti M
Increased incidence of cystic fibrosis gene mutations in adults with disseminated bronchiectasis.
Hum Mol Genet. 1995 Apr;4(4):635-9., [PMID:7543317]

Abstract [show]
In order to identify a possible hereditary predisposition to the development of obstructive pulmonary disease of unknown origin, we have looked for the presence of Cystic Fibrosis Transmembrane Regulator (CFTR) gene mutations in unrelated patients with no signs of Cystic Fibrosis (CF). We screened for 70 common mutations, and also for rare mutations by denaturing gradient gel electrophoresis analysis. In this search, different CFTR gene mutations (R75Q, delta F508, R1066C, M1137V and 3667ins4) were found in five out of 16 adult Italian patients with disseminated bronchiectasis, a significant increase over the expected frequency of carriers. Moreover, three rare CFTR gene DNA polymorphisms (G576A, R668C, and 2736 A-->G), not deemed to be the cause of CF, were found in two patients, one of which was a compound heterozygote with R1066C. These results indicate that CFTR gene mutations, and perhaps also DNA polymorphisms, may be involved in the etiopathogenesis of at least some cases of bronchiectasis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 RESULTS Common CF mutations All the study subjects were initially typed with respect to some CFTR mutations known to be present in CF patients in the North East Italian population: AF508, R1162X, 2183AA->G, NI303K, G542X, 711 + 5G->A, 1717-1 G^>A, 1717-8G->A, G85E, R553X, 2789 + 5 G->A, Q552X, 621 + 1 G->T, W1282X, 3132delTG, 2790-2A->G, 457 TAT->G, R347P, G551D, 1898 + 3A->G and 3849 + 10 kbC^T. Login to comment
31 List of CFTR gene mutations and DNA polymorphisms screened Mutations R75Q/X/L, G85E, 394deITT 457TAT->G, R117H 621 + 1G->T 711 + 5G->A L206W 875 + 40 A->G 936 del TA 1001 + 11C->T R334W, R347 P/H/L, 1154insTC A455E, V456F DF5O8 1717-IG->A, 1717-8G->A G542X, G551D, Q552X, R553X P574H 1898 + 3A->G 2183 AA->G, 2184delA, R709X D836Y, 2694 T/G 2752-22 A/G 2789 + 5 G->A, 2790-2 A-»G Q890X 3041-71 G/C 3132delTG 3271 + 18 C-»T, 3272-26 A->G H1054D, G1061R, R1066C/H, A1067T, H1085R, Y1092X, 3320 ins5 D1152H R1162X, 3667ins4, 3737delA, 11234V 3849 + 10 kb C-»T, 3850-1 G-»A SI25IN, S1255P, 3905insT, 3898insC, D127ON, W1282X, R1283M, 4002 A/G 4005 + 1 G-»A N1303 K/H, 4029 A/G D1377H Q1411 X 4404 C/T, 4521 G/A Location e 3 e 4 i 4 i 5 e 6a i 6a e 6b i 6b e 7 e 9 e 10 i 10 e 11 e 12 i 12 e 13 e 14a i 14a i 14b e 15 i 15 e 17a i 17a e 17b e 18 e 19 i 19 e 20 i 20 e2l e 22 e 23 e24 Listing is in order of location along the CFTR gene, e = exon; i = intron. Login to comment
120 Several mutations were searched by restriction analysis: 457 TAT-»G, R334W, R347P/H/L, A455E, Q552X, 3849 + 10 kbC->T, D1270N. Login to comment

[hide] Detection of more than 50 different CFTR mutations... Hum Genet. 1994 Nov;94(5):533-42. Dork T, Mekus F, Schmidt K, Bosshammer J, Fislage R, Heuer T, Dziadek V, Neumann T, Kalin N, Wulbrand U, et al.
Detection of more than 50 different CFTR mutations in a large group of German cystic fibrosis patients.
Hum Genet. 1994 Nov;94(5):533-42., [PMID:7525450]

Abstract [show]
We have conducted a comprehensive study of the molecular basis of cystic fibrosis (CF) in 350 German CF patients. A screening approach based on single-strand conformation analysis and direct sequencing of genomic polymerase chain reaction products has allowed us to detect the molecular defects on 95.4% of the CF chromosomes within the coding region and splice sites of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The spectrum of sequence changes comprises 54 different mutations, including 17 missense mutations, 14 nonsense mutations, 11 frameshift mutations, 10 splice site variants and two amino acid deletions. Eleven of these mutations have not previously been described. Our results reflect the marked mutational heterogeneity of CF in a large sample of patients from a non-isolated population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 Table 1 Frequency distribution and haplotypes of CFTR mutations in 700 German CF chromosomes Mutation~ Nucleotide changesb Locationc Frequencyd Haplotype~ Referencef Q39x C--~T at 247 Exon 2 1 (0.1%) D3 Cutting et al. (1992) E60X G-+T at 310 Exon 3 1 (0.1%) A2 Malone et al. (*) R75X C--+T at 355 Exon 3 1 (0.1%) C2 This study 405+1 G---~A G-+A at 405+1 Intron 3 1 (0.1%) C2 D6rk et al. (1993c) E92X G--~T at 406 Exon 4 2 (0.3%) B2 Will et al. (1994) R117C C---~Tat 481 Exon 4 1 (0.1%) C2 This study R117H G--+A at 482 Exon 4 2 (0.3%) B6 Dean et al. (1990) 621+1 G--+T G--+T at 621+1 Intron 4 1 (0.1%) B1 Zielenski et al. (1991b) H199Y C--+T at 727 Exon 6a 1 (0.1%) A2 This study (*) 1078delT Deletion of T at 1078 Exon 7 4 (0.6%) C2 Claustres et al. (1992) R334W C-~T at 1132 Exon 7 2 (0.3%) BI Gasparini et al. (1991) 1336K T-->A at 1139 Exon 7 3 (0.4%) A2 Cuppens et al. (1993) R347P G--+C at 1172 Exon 7 11 (1.6%) A2, C2 Dean et al. (1990) 1342-2 A--+C A--+C at 1342-2 Intron 8 3 (0.4%) A4 D/3rk et al. (1993b) Q414X C--+T at 1372 Exon 9 1 (0.1%) D3 D6rk et al. (1994a) A455E C-+A at 1496 Exon 9 1 (0.1%) BI Kerem et al. (1990) V456F G--~T at 1498 Exon 9 1 (0.1%) B3 D6rk et al. (1994a) A1507 Deletion of 3 bp between 1648-1653 Exon 10 1 (0.1%) D5 Kerem et al. (1990) AF508 Deletion of 3 bp between 1652-1655 Exon 10 504 (72.0%) B1, DI, B7 Kerem et al. (1989) 1717-1 G--+A G--+A at 1717-1 lntron 10 6 (0.9%) B3 Kerem et al. (1990) G542X G--+T at 1756 Exon 11 10 (1.4%) B1 Kerem et al. (1990) G551D G--+A at 1784 Exon 11 7 (l.0%) B3 Cutting et al. (1990) Q552X C-+T at 1786 Exon 11 1 (0.1%) A4 Devoto et al. (1991) R553X C--+T at 1789 Exon 11 16 (2.3%) A4, B4, D3 Cutting et al. (1990) L558S T--+C at 1805 Exon 11 1 (0.1%) C2 Maggio et al. (*) 1811+I.6kBA-+G A--+Gat 1811+l.6kB lntron 11 1 (0.1%) A2 Chillonetal. Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment

[hide] Identification of three novel mutations (457 TAT--... Hum Genet. 1994 Jun;93(6):659-62. Audrezet MP, Canki-Klain N, Mercier B, Bracar D, Verlingue C, Ferec C
Identification of three novel mutations (457 TAT-->G, D192G, Q685X) in the Slovenian CF patients.
Hum Genet. 1994 Jun;93(6):659-62., [PMID:7516305]

Abstract [show]
Chromosomes from a cohort of 60 Slovenian families, corresponding to the 121 cystic fibrosis (CF) chromosomes available, were fully scanned for mutations in the coding sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene (The 60 families yielded 121 CF alleles because the mother of one patient was also affected). This corresponds to the 27 exons and intron/exon boundaries that have been studied in chromosomes carrying unidentified alleles. As a result of this survey 84% of the alleles are now clearly identified and we describe in this paper three novel mutations (457 TAT-->G, D192G, and Q685X).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Mutations identified in the population of Slovenia Number of chromosomes Mutations 661 83 AF508 4 G542X 5 R1162X 2 3905 ins T 2 I148T 1 Q552X 1 Q685X 1 S4X 1 457 TAT---~G 1 D192G 1 R1066H 19 Unidentified 121 Exons Frequencies References 10 68.60% Kerem et al. (1989) 11 3.30% Kerem et al. (1990) 19 4.10% Gasparini et al. (1991) 20 1.65% Personal Communication 4 1.65% Personal Communication 11 0.85% Devoto et al. (1991) 13 0.85% This study 1 0.85% Glavac et al. (1993) 4 0.85% This study and Glavac et al. (1993) 5 0.85% This study 17b 0.85% Ftrec et al. (1992) 15.70% by 11 mutations, occurring in 9 exons of the gene (1, 4, 5, 10, 11, 13, 17b, 19, and 20). Login to comment

[hide] Analysis of the CFTR gene confirms the high geneti... Hum Genet. 1994 Apr;93(4):447-51. Chillon M, Casals T, Gimenez J, Ramos MD, Palacio A, Morral N, Estivill X, Nunes V
Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes.
Hum Genet. 1994 Apr;93(4):447-51., [PMID:7513293]

Abstract [show]
We have analysed 972 unrelated Spanish cystic fibrosis patients for 70 known mutations. Analysis was performed on exons 1, 2, 3, 4, 5, 6a, 6b, 7, 10, 11, 12, 13, 14a, 14b, 15, 16, 17b, 18, 19, 20 and 21 of the cystic fibrosis transmembrane regulator gene using single strand conformation polymorphism analysis and denaturing gradient gel electrophoresis. The major mutation delta F508 accounts for 50.6% of CF chromosomes, whereas another 42 mutations account for 27.6% of CF chromosomes, with 21.8% of Spanish CF chromosomes remaining uncharacterized. At present, we have identified 36 mutations that have frequency of less than 1% and that are spread over 15 different exons. This indicates that, in the Spanish population, with the exception of delta F508 (50.6%) and G542X (8%), the mutations are not concentrated in a few exons of the gene nor are there any predominating mutations. This high degree of genetic heterogeneity is mainly a result of the different ethnic groups that have populated Spain and of the maintenance of separated population sets (Basques, Arab-Andalusian, Mediterranean, Canarian and Gallician). The high proportion of CF chromosomes still unidentified (21.8%) together with association analysis with intragenic markers suggest that at least 100 different mutations causing CF are present in our population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 At present, we have not detected any Spanish CF chromosomes bearing any of the following mutations: 394delTA, Y122X, 556delA, 852de122, R347P, $492F, 1677delTA, V520F, Q552X, R553X, L559S, R560K, R560T, Y563N, P564H, 2043delG, 3320ins5, R1066H, A1067T, H1085R, 3732delA, 3737delA, I1234V, S1255P, 3898insC, Q1291H or 4005+ 1G---~A. Login to comment

[hide] Screening for non-delta F508 mutations in five exo... Am J Hum Genet. 1991 Jun;48(6):1127-32. Devoto M, Ronchetto P, Fanen P, Orriols JJ, Romeo G, Goossens M, Ferrari M, Magnani C, Seia M, Cremonesi L
Screening for non-delta F508 mutations in five exons of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in Italy.
Am J Hum Genet. 1991 Jun;48(6):1127-32., [PMID:1709778]

Abstract [show]
Analysis of exons 10, 11, 14a, 15, and 20 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by denaturing-gradient-gel electrophoresis (DGGE) allowed the identification of mutations causing cystic fibrosis (CF) in 25 of 109 non-delta F508 chromosomes, as well as identification of a number of polymorphisms and sequence variations. Direct sequencing of the PCR fragments which showed an altered electrophoretic behavior not attributable to known mutations has led to the characterization of four new mutations, two in exon 11, and one each in exons 15 and 20. Screening for the different mutations thus far identified in our patients by the DGGE analysis and other independent methods should allow detection of about 70% of the molecular defects causing CF in Italy. Mutations located in exons 11 and 20 account for at least 30% of the non-delta F508 mutations present in Italian CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 The second mutation (Q552X) located in exon 11 is a C-to-T transition at position 1786 which causes the substitution of a glutamine residue in position 552 by a stop codon. Login to comment
82 However, there is little doubt that Q552X, 1784delG, and 2909delT are disease-causing mutations, since all of them cause a premature termination of CFTR synthesis. Login to comment

[hide] The genetic background of osteoporosis in cystic f... J Cyst Fibros. 2006 Dec;5(4):229-35. Epub 2006 May 18. Castellani C, Malerba G, Sangalli A, Delmarco A, Petrelli E, Rossini M, Assael BM, Mottes M
The genetic background of osteoporosis in cystic fibrosis: association analysis with polymorphic markers in four candidate genes.
J Cyst Fibros. 2006 Dec;5(4):229-35. Epub 2006 May 18., [PMID:16713399]

Abstract [show]
BACKGROUND: Reduced Bone Mass Density (BMD) is frequent in Cystic Fibrosis (CF). Potentially, other genes than the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene may contribute to the bone phenotype variability in CF patients. METHODS: Four candidate genes likely associated with BMD variability were studied: the vitamin D receptor (VDR) gene, the estrogen receptor alpha (ESR1), the calcitonin receptor (CALCR) and the type I alpha 1 collagen (COL1A1) gene. A complete bone and CF evaluation was obtained for 82 subjects (39 m, 43 f): 15 had normal BMD (group 1), 46 were osteopenic (group 2), and 21 were osteoporotic (group 3). RESULTS: No statistical difference was found among the three groups for age, sex, pancreatic status, and vertebral fractures, nor for any of the biochemical markers. Weight, Body Mass Index (BMI), and FEV1, scored significantly worse in the two groups with the lowest T score. The CFTR mutations R1162X and F508del were more frequent in patients with lower BMD (p=0.044 and p=0.071). There was no significant difference in the distribution of the five marker genotypes among the 3 groups defined according to the unadjusted or adjusted (BMI and FEV1) BMD T score. No significant correlation was found between the VDR, CALCR, or COL1A1 gene polymorphisms and reduced BMD values. The individual ESR1 PvuII-XbaI haplotype C-A is associated to elevated u-calcium levels whereas the haplotype T-A is associated to lower values (p=0.00251). CONCLUSIONS: There was no evidence that the genes under study, with the possible exception of ESR1 gene variants, may modulate bone phenotype in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 CFTR analysis Patients selected for the study had been characterized previously for CFTR mutations with a reverse dot blot (RDB) Table 1 Anthropometric and CF-associated variables in normal, osteopenic and osteoporotic patients Group 1 normal bone density Group 2 osteopenia Group 3 osteoporosis Statistical evaluation Numerosity 15/82 46/82 21/82 - Mean age (years) 27.73T4.19 26.71T5.93 28.1T9.51 NS Males/females 9/6 19/27 11/10 NS CFTR genotype F508del/UK: 3 UK/ UK: 3 F508del/ F508del: 2 F508del/ G542X: 2 F508del/ R553X: 2 1717-1G> AvW1282X: 1 F508del/ N1303K: 1 G542X/UK: 1 F508del/F508del: 6 UK/UK: 5 F508del/ UK: 3 2183AA>G/UK: 3 2789+5G> A /UK: 3 F508del/N1303K: 3 F508del / R1162X: 3 F508del/2183AA>G: 2 N1303K/ N1303K: 2 R1162X/R1162X: 2 R1162X/ 2183AA>G: 2 2183AA>G/G542X: 1 F508del/ 1898+3A>G: 1 F508del/2789+5G> A: 1 F508del/711+5G>A: 1 F508del/ Q353X: 1 I507del/R1162X: 1 Q552X/ UK: 1 N1303K/G542X: 1 R1162X/3849+ 10KbC>T: 1 R1162X/711+5G>A: 1 T338I/ UK: 1 R553X/UK: 1 F508del/F508del: 4 F508del/ UK: 3 F508del/N1303K: 2 UK/ UK: 2 2789+5G>A/2789+5G> A: 1 F508del/1898+3A>G: 1 F508del/ 2183AA>G: 1 F508del/3849+10KbC> T: 1 F508del/G542X: 1 F508del/ R1066H: 1 F508del/R1162X: 1 Q552X/: 1 R352Q/: 1 R553X/UK: 1 Weight (kg) 61.7T5.89 56.5T8.25 48.9T9.40 p <0.0001 BMI 22.6T1.3 20.3T2.7 18T2.9 p <0.0001 PS/PI 3/12 10/36 7/14 NS FEV1% predicted 52.33T16.73 49.82T21.44 37.1T21.07 p =0.0205 NS = not significant. Login to comment
80 assay which allows the simultaneous analysis of the commonest CFTR mutations in North-eastern Italy (F508del, I507del, R117H, R1162X, 2183AA>G, N1303K, 3849+10KbC>T, G542X, 1717-1G>A, R553X, Q552X, G85E, 711+5G>A, W1282X, 3132delTG and 2789+5G>A) [25]. Login to comment

[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]

Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

[hide] CFTR mutations spectrum and the efficiency of mole... PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014. Zietkiewicz E, Rutkiewicz E, Pogorzelski A, Klimek B, Voelkel K, Witt M
CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.
PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014., [PMID:24586523]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans Pathogenic mutations 1 1 L15Ffs10X c.43delC 175delC 1 CFMDB 1717-1G.A 2 2 G27V 21.92 c.80G.T 212G.T 1 Novel F508del 2 2 S18RfsX16 c.54-5940_273 +10250del21kb exon2,3del21kb 66 IL19 various CF mutations i2 i2 IVS2_Donor c.164+1G.A 296+1G.A 3 CFMDB various CF mutations 3 3 G85E 22.61 c.254G.A 386G.A 1 IL17 unknown 3 3 E60X c.178G.T 310G.T 0 IL17 x 3 3 L88IfsX22 c.262_263delTT 394delTT 0 IL17 x 4 4 E92K 21.92 c.274G.A 406G.A 2 CFMDB c.164+1G.A; c.2051- 2AA.G 4 4 L101X c.302T.G 434T.G 1 CFMDB c.3717+12191C.T 4 4 K114IfsX5 c.341_353del13bp 473del13bp 1 Novel F508del 4 4 R117H 20.35 c.350G.A 482G.A 5 IL17 F508del; 2x unknown 4 4 R117C 22.07 c.349C.T 481C.T 2 CFMDB S1206X;1x unknown 4 4 L137_L138insT c.412_413insACT L138ins 1 CFMDB F508del 4 4 R153I 22.61 c.458G.T 590G.T 2 Novel F508del; c.3527delC i4 i4 IVS4_Donor c.489+1G.T 621+1G.T 5 IL17 F508del; c.489+1G.T 5 5 L165X c.494T.A 626T.A 1 Novel F508del i5 i5 IVS5_Donor c.579+1G.T 711+1G.T 0 IL19 x i5 i5 IVS5_Donor c.579+3A.G 711+3A.G 2 CFMDB 2,3del21kb; c.2052-3insA i5 i5 IVS5_Donor c.579+5G.A 711+5G.A 0 IL17 x 7 8 F311L 20.90 c.933C.G 965C.G 2 CFMDB 2x F508 7 8 G314R 20.58 c.940G.A 1072G.A 4 CFMDB various CF mutations 7 8 F316LfsX12 c.948delT 1078delT 1 IL17 unkown 7 8 R334W 22.41 c.1000C.T 1132C.T 6 IL17 various CF mutations 7 8 I336K 22.07 c.1007T.A 1139T.A 2 CFMDB 2,3de21kb; F508del 7 8 R347P 22.27 c.1040G.C 1172G.C 11 IL17 various CF mutations i7 i8 IVS8_Donor c.1116+2T.A 1248+2T.A 1 Novel Q1412X 9 10 A455E 22.61 c.1364C.A 1496C.A 0 IL17 x i9 i10 IVS10_Donor c.1392+1G.A 1524+1G.A 1 CFMDB c.3816-7delGT 10 11 S466X c.1397C.G 1529C.G 1 CFMDB G542X 10 11 I507del c.1519_1521delATC 1651delATC 2 IL19 F508del 10 11 F508del c.1521_1523delCTT 1654delCTT 805 IL19 various CF mutations i10 i11 IVS11_Acceptor c.1585-1G.A 1717-1G.A 27 IL19 various CF mutations 11 12 G542X c.1624G.T 1756G.T 25 IL19 various CF mutations 11 12 G551D 21.24 c.1624G.T 1756G.T 5 IL19 various CF mutations 11 12 Q552X c.1654C.T 1786C.T 0 IL19 x 11 12 R553X c.1657C.T 1789C.T 14 IL19 various CF mutations 11 12 R560T 21.92 c.1679G.C 1811G.C 0 IL19 x i12 i13 IVS13_Donor c.1766+1G.A 1898+1G.A 6 IL19 various CF mutations i12 i13 IVS13_Donor c.1766+1G.C 1898+1G.C 1 CFMDB F508del 13 14 H620P 21.73 c.1859A.C 1991A.C 1 CFMDB F508del 13 14 R668C//G576A 21.61//1.73 c.2002C.T//c.1727G.C 2134C.T// 1859G.C 5 b CFMDB// rs1800098 c.1585-1G.A; 4 unknown 13 14 L671X c.2012delT 2143delT 27 IL17 various CF mutations 13 14 K684SfsX38 c.2051_2052delAAinsG 2183AA.G 10 IL17 various CF mutations 13 14 K684NfsX38 c.2052delA 2184delA 0 IL17 x 13 14 Q685TfsX4 c.2052_2053insA 2184insA 15 CFMDB various CF mutationsc , 1 unknown Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 13 14 L732X c.2195T.G 2327T.G 1 CFMDB F508del 14A 15 R851X c.2551C.T 2683C.T 3 CFMDB various CF mutations 14A 15 I864SfsX28 c.2589_2599del11bp 2721del11bp 2 CFMDB F508del; 2,3del21kb i14B i16 IVS16_Donor c.2657+2_2657+3insA 2789+2insA 1 CFMDB F508del i14B i16 IVS16_Donor c.2657+5G.A 2789+5G.A 0 IL17 unkown 15 17 Y919C 21.02 c.2756A.G 2888A.G 1 CFMDB unknown 15 17 H939HfsX27 c.2817_2820delTACTC 2949delTACTC 1 Novel unkown i15 i17 IVS17_Donor c.2908+3A.C 3040+3A.C 1 Novel F508del i16 i18 IVS18_Donor c.2988+1G.A 3120+1G.A 0 IL19 x 17A 19 I1023_V1024del c.3067_3072delATAGTG 3199del6 0 IL19 x i17A i19 IVS19 c.3140-26A.G 3272-26A.G 9 IL19 various CF mutations 17B 20 L1065R 21.90 c.3194T.G 3326T.G 1 CFMDB F508del 17B 20 Y1092X c.3276C.A 3408C.A 1 CFMDB R334W i18 i21 IVS21_Donor c.3468+2_3468+3insT 3600+2insT 11 CFMDB various CF mutationsd , 1 unknown 18 21 E1126EfsX7 c.3376_3379delGAAG 3508delGAAG 1 Novel F508del 19 22 R1158X c.3472C.T 3604C.T 2 CFMDB F508del; R553X 19 22 R1162X c.3484C.T 3616C.T 1 IL17 F508del 19 22 L1177SfsX15 c.3528delC 3659delC 4 IL17 various CF mutations 19 22 S1206X c.3617C.A 3749C.A 1 CFMDB R117C i19 i22 IVS22 c.3717+12191C.T 3849+10kbC.T 58 IL17 various CF mutations 20 23 G1244R 22.62 c.3730G.C 3862G.C 1 CFMDB F508del 20 23 S1251N 22.28 c.3752G.A 3884G.A 0 IL19 x 20 23 L1258FfsX7 c.3773_3774insT 3905insT 0 IL19 x 20 23 V1272VfsX28 c.3816_3817delGT 3944delGT 1 CFMDB c.1392+1G.A 20 23 W1282X c.3846G.A 3978G.A 9 IL19 various CF mutations 21 24 N1303K 22.62 c.3909C.G 4041C.G 18 IL19 various CF mutations 22 25 V1327X c.3979delG 4111delG 1 Novel F508del 22 25 S1347PfsX13 c.4035_4038dupCCTA c.4167dupCCTA 1 CFMDB 2,3del21kb 23 26 Q1382X c.4144C.T 4276C.T 1 CFMDB F508del 23 26 Q1412X c.4234C.T 4366C.T 2 CFMDB F508del; c.1116+2T.A i23 i26 IVS26_Donor c.4242+1G.T 4374+1G.T 1 CFMDB F508del Sequence changes of uncertain pathogenic effect, tentatively counted as mutations 6A 6 E217G 0.30 c.650A.G 782A.G 1 CFMDB; rs1219109046 unknown 7 8 R352Q 20.01 c.1055G.A 1187G.A 1 CFMDB; rs121908753 F508del 7 8 Q359R 0.33 c.1076A.G 1208A.G 1 CFMDB F508del i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)12 1332-12Tn_- 34TGm 6 CFMDB F508del; 3x unknown i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)13 1332-12Tn_- 34TGm 2 CFMDB 2143delT; 1x unknown i8 i9 IVS9 c.1210-12T8 1332-12Tn 1 Novel unknown 10 11 I506V 20.21 c.1516A.G 1648A.G 1 CFMDB; rs1800091 unknown 12 13 V562L 0.79 c.1684G.C 1816G.C 1 CFMDB; rs1800097 unknown 13 14 G723V 0.44 c.2168G.T 2300G.T 1 CFMDB; rs200531709 unknown 15 17 D924N 0.03 c.2770G.A 2902G.A 1 CFMDB; rs201759207 unknown patient with F508del on another allele) was not supported by the SVM value (+0.35); the patient was PS and had ambiguous chloride values (45, 64 and 83 mmol/L). Login to comment
102 a Mutations detected by two INNOLiPA_CFTR tests (legacy names): IL19 (INNOLiPA_CFTR19): F508del; G542X; N1303K; W1282X; G551D; 1717-1G.A; R553X; CFTRdele2,3(21kb); I507del; 711+1G.T; 3272-26A.G; 3905insT; R560T; 1898+1G.A; S1251N; I148T; 3199del6; 3120+1G.A; Q552X. Login to comment

[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]

Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] Mutation analysis of PRSS1, SPINK1 and CFTR gene i... Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287. Sisman G, Tugcu M, Ayla K, Sebati O, Senturk H
Mutation analysis of PRSS1, SPINK1 and CFTR gene in patients with alcoholic and idiopathic chronic pancreatitis: A single center study.
Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287., [PMID:25835118]

Abstract [show]
BACKGROUND/AIMS: A relation between some genetic mutations and chronic pancreatitis (CP) has been reported. However, the relation of genetic mutation to alcoholic CP (ACP) and idiopathic CP (ICP) still remains controversial. In this study, we investigated the prevalence of protease serine 1 (PRSS1), serine protease inhibitor, Kazal type 1 (SPINK1) SPINK1 and cystic fibrosis transmembrane conductance regulator (CFTR) mutations in ACP and ICP patients in Turkey. MATERIALS AND METHODS: Forty-one patients with ACP and 38 patients with ICP were enrolled, and 35 healthy individuals served as controls. The PRSS1 and SPINK1 mutations were investigated by the polymerase chain reaction (PCR)-restriction fragment-length polymorphism (RFLP) technique. The CFTR mutation was examined with PCR direct sequencing. RESULTS: The mean ages of the ACP, ICP and healthy control groups were 53.2, 40.4 and 46.3 years, respectively. A CFTR F508 mutation was detected as a heterozygote in one (2.4%) patient with ACP. In the ICP and control populations, PRSS1, SPINK1 and CFTR mutations were not detected. CONCLUSION: This study shows that PRSS1, SPINK1 and CFTR mutations do not play a role in ACP and ICP patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 DNA samples were multiplied by multiplex PCR with a CF 22Mut and CF 14Mut+Tn strip assay kit which has 36 common mutations of the CFTR gene (DF508, DI507, F508C, I502T, 1706del17, 1677del TA, G542X, 1717-1G>A, R553X, Q552X, G551D, S549R(A>C), N1303K, 4016insT, R1162X, R1158X, W1282X, G1244E, 2789+5G>A, 2183AA>G, 711+5G>A, 711+1G>T, G85E, 3849+10kbC>T, 621+1G>T, R117H, D1152H, L1065P, R1066H, L1077P, 4382delA, 1259insA, 852del22, R347P, T338I, S912X and Allele5T-7T-9T). Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
381 [Glu479*;Val754Met] F508del c.1521_1523delCTT CF-PI CF-causing p.Phe508del 1717-8G>A c.1585-8G>A CF-PI CF-causing 1717-1G>A c.1585-1G>A CF-PI CF-causing D529N c.1585G>A CF-PI nd p.Asp529Asn G542X c.1624G>T CF-PI CF-causing p.Gly542* S549R(A>C) c.1645A>C CF-PI CF-causing p.Ser549Arg S549N c.1646G>A CF-PI CF-causing p.Ser549Asn S549R(T>G) c.1647T>G CF-PI CF-causing p.Ser549Arg G551D c.1652G>A CF-PI CF-causing p.Gly551Asp Q552X c.1654C>T CF-PI CF-causing p.Gln552* R553X c.1657C>T CF-PI CF-causing p.Arg553* L558S c.1673T>C CF-PI unknown significance p.Leu558Ser Y569D c.1705T>G CFTR-RD,CBAVD unknown significance p.Tyr569Asp Continued on next page 2 0 | L U C A R E L L I E T A L . Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment