ABCMdb

ABCC7 p.Asp1152His

Admin's notes:	Class III (gating defect) Veit et al.
ClinVar:	c.3454G>C , p.Asp1152His D , Pathogenic
CF databases:	c.3454G>C , p.Asp1152His ? , Varying clinical consequence ; CFTR1: The family in whom this mutation was identified is of Ashkenazi/Jewish/North European Protestant and is remarkable for advanced age, mild pulmonary disease, pancreatic sufficiency and normal sweat chloride values. The index patient was diagnosed with variant CF at the age of 57 on the basis of clinical phenotype and abnormal nasal epithelial bioelectric parameters.
Predicted by SNAP2:	A: D (80%), C: D (85%), E: D (66%), F: D (85%), G: D (91%), H: D (66%), I: D (91%), K: D (91%), L: D (91%), M: D (85%), N: D (80%), P: D (95%), Q: D (80%), R: D (91%), S: D (80%), T: D (75%), V: D (91%), W: D (95%), Y: D (91%),
Predicted by PROVEAN:	A: D, C: D, E: N, F: D, G: D, H: D, I: D, K: N, L: D, M: D, N: N, P: D, Q: N, R: D, S: N, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

III (gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]

Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
378 M1137R interfered with the proper maturation of the protein and the whole cell cAMP activated chloride currents were reduced for M1137V, I1139V, D1152H and D1154G, indicating that these mutations interfere with the proper gating of chloride channels [180]. Login to comment

[hide] Two buffer PAGE system-based SSCP/HD analysis: a g... Eur J Hum Genet. 1999 Jul;7(5):590-8. Liechti-Gallati S, Schneider V, Neeser D, Kraemer R
Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease.
Eur J Hum Genet. 1999 Jul;7(5):590-8., [PMID:10439967]

Abstract [show]
The large size of many disease genes and the multiplicity of mutations complicate the design of an adequate assay for the identification of disease-causing variants. One of the most successful methods for mutation detection is the single strand conformation polymorphism (SSCP) technique. By varying temperature, gel composition, ionic strength and additives, we optimised the sensitivity of SSCP for all 27 exons of the CFTR gene. Using simultaneously SSCP and heteroduplex (HD) analysis, a total of 80 known CF mutations (28 missense, 22 frameshift, 17 nonsense, 13 splicesite) and 20 polymorphisms was analysed resulting in a detection rate of 97.5% including the 24 most common mutations worldwide. The ability of this technique to detect mutations independent of their nature, frequency, and population specificity was confirmed by the identification of five novel mutations (420del9, 1199delG, R560S, A613T, T1299I) in Swiss CF patients, as well as by the detection of 41 different mutations in 198 patients experimentally analysed. We present a three-stage screening strategy allowing analysis of seven exons within 5 hours and analysis of the entire coding region within 1 week, including sequence analysis of the variants. Additionally, our protocol represents a general model for point mutation analysis in other genetic disorders and has already been successfully established for OTC deficiency, collagene deficiency, X-linked myotubular myopathy (XLMTM), Duchenne and Becker muscular dystrophy (DMD, BMD), Wilson disease (WD), Neurofibromatosis I and II, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, and defects in mitochondrial DNA. No other protocol published so far presents standard SSCP/HD conditions for mutation screening in different disease genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 The distribution of analysed known mutations is similar to that of the total number of mutations in the entire CFTR gene: missense mutations account for 35% (G27E, G85E, R117H, A120T, I148T, H199Y, R334W, T338I, R347P, R347H, A455E, M718K, S5449N, S5449I, G551D, R560T, R560S, S945L, S977P, I1005R, R1066C, R1070Q, M1101K, D1152H, S1235R, R1283M, N1303K, N1303H), followed by 28% of frameshift mutations (175delC, 394delTT, 457TAT- > G, 905delG, 1078delT, I507, F508, 1609delCA, 1677delTA, 2143delT, 2176insC, 218delA, 2184insA, 2869insG, 3659delC, 3732delA, 3821delT, 3905insT, 4016insT, 4172delGC, 4382delA), 21% of nonsense mutations (Q30X, Q39X, Q220X, W401X, Q525X, G542X, Q552X, R553X, V569X, E585X, K710X, R792X, Y1092X, R1162X, S1255X, W1282X, E1371X), and 16% of splice site mutations (621 + 1G- > T, 711 + 1G- > T, 711 + 5G- > A, 1717-1G- > A, 1898 + 1G- > A, 1898 + 5G- > T, 2789 + 5G- > A, 3271 + 1G- > A, 3272-26A- > G, 3601-17T- > C, 3849 + 4A- > G, 3849 + 10kbC- > T, 4374 + 1G- > T). Login to comment
34 Intron 19, all 27 exons and their exon-intron boundaries, including the 24 most common mutations worldwide (G85E, R117H, 621 + 1G- > T, 711 + 1G- > T, 1078delT, R334W, R347P, A455E, I507, F508, 1717-1G- > A, G542X, S549N, G551D, R553X, R560T, 1898 + 1G- > A, 2184delA, 2789 + 5G- > A, R1162X, 3659delC, 3849 + 10kbC- > T, W1282X, N1303K) (Cystic Fibrosis Genetic Analysis Consortium 1994), and the 15 most common mutations in our population (I148T, 1078delT, R334W, R347P, F508, 1717-1G- > A, G542X, R553X, 2347delG, D1152H, R1162X, 3849 + 10kbC- > T, 3905insT, W1282X, N1303K), were considered in this study. Login to comment
92 The technique developed demonstrates excellent single-strand separation and non-radioactive visualisation on polyacrylamide gels, and is time-saving and directly Table 2 Known mutations identified in 198 CF patients analysed investigatively Exon (E) Number of CFTR mutations intron (I) chromosomes Patient`s nationality Highest prevalence ∆F508 E10 212 miscellaneous 3905insT E20 025 Swiss Swiss, Amish, Arcadian R553X E11 020 Swiss, German German 1717-1G->A I10 017 Swiss, Italian Italian N1303K E21 011 Swiss, French, Italian Italian W1282X E20 014 Swiss, Italian, Israelit Jewish-Askhenazi G542X E11 009 Swiss, Spanish, Italian Spanish 2347delG E13 008 Swiss R1162X E19 006 Swiss, Italian, Russian Italian 3849+10kbC->T I19 005 German, French R347P E07 004 Swiss T5 I08 004 Swiss R334W E07 003 Swiss Q525X E10 003 Swiss 3732delA E19 003 Swiss S1235R E19 003 Italian, Turkish G85E E03 002 Italian, Greek I148T E04 002 Austrian, Turkish French-Canadian 621+1G->T I04 002 French French-Canadian 1078delT E07 002 Swiss E585X E12 002 Italian 2176insC E13 002 Swiss, Italian 2789+5G->A I14b 002 Italian Spanish D1152H E18 002 Swiss, French 4016insT E21 002 Turkish Q39X E02 001 Swiss 394delTT E03 001 Swiss Nordic, Finnish R117H E04 001 Swiss A120T E04 001 Swiss G126D E04 001 Swiss 711+5G->A I05 001 Russian M348K E07 001 Italian L568F E12 001 Italian 2183AA->G E13 001 Italian Italian K710X E13 001 Swiss S945L E15 001 French 3272-26A.->G I17a 001 Swiss M1101K E17b 001 Swiss Huttite 3601-17C->T I18 001 Swiss R1158X E19 001 Swiss 4005+1G-A I20 001 Italian applicable to early diagnostic testing, carrier detection and prenatal diagnosis. Login to comment

[hide] Complete mutational screening of the cystic fibros... Hum Reprod. 1999 Dec;14(12):3035-40. Pallares-Ruiz N, Carles S, Des Georges M, Guittard C, Arnal F, Humeau C, Claustres M
Complete mutational screening of the cystic fibrosis transmembrane conductance regulator gene: cystic fibrosis mutations are not involved in healthy men with reduced sperm quality.
Hum Reprod. 1999 Dec;14(12):3035-40., [PMID:10601093]

Abstract [show]
Based on the analysis of the most frequent mutations responsible for cystic fibrosis (CF), a higher than expected frequency of CF mutations was recently reported in men with infertility due to reduced sperm quality. To further document whether this condition is associated with severe or mild abnormalities of cystic fibrosis transmembrane conductance regulator (CFTR) functions, we carried out a complete scanning of CFTR sequences using a strategy that detects almost all 850 mutations and 150 polymorphisms reported to date in the CFTR gene. We have investigated a cohort of 56 patients with severe oligoasthenoteratozoospermia (OAT) and 50 controls from southern France for CFTR gene mutations and variations. The frequencies of CF-causing mutations and CFTR variations identified in this OAT sample did not differ significantly from the frequencies found in the normal population. However, we observed a 1.7-fold increase in the proportion of homozygotes for a specific CFTR haplotype (TG11-T7-G1540) in the OAT group (P = 0.025). Our results do not confirm a link between CF mutations and reduced sperm quality. Further studies are needed to substantiate the hypothesis that a combination of variants affecting expression and function of the CFTR protein is associated with male infertility.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 As it has been shown recently (Cuppens et al.,CF` mutation on a gene and a 'mild` mutation retaining some residual CFTR activity on the other gene, such as the '5T 1998a) that some of the more common polymorphisms in the (c) European Society of Human Reproduction and Embryology CFTR gene affect expression and function of the CFTR protein, although only mutation D1152H is commonly accepted as a we also analysed the distribution of three intragenic markers disease-causing mutation and has been demonstrated to reduce [TGn and Tn in intron 8, and 1540A/G (M470V) in exon 10] chloride currents in vitro (Vankeerberghen et al., 1998). Login to comment
56 Four OAT men had a missense mutation on one chromosome, 1540 (M470V) in exon 10 was significantly different between Table I. Characterization of CFTR genotypes in 56 patients with oligoasthenoteratozoospermia (OAT) and in 50 controls Mutations IVS8(T)n 1540A/G Other variations IVS8(TG)n OAT 1 I1230T 7/7 A/G 1655T/G 12/12 1 D1152H 7/7 G/G - 11/11 1 F1052V 7/7 A/A 875ϩ40A/G 10/10 1 M952I 7/7 G/G 4404C/T 11/11 1 - 7/7 G/G 4404C/T 11/11 2 - 7/7 A/G 875ϩ40A/G 10/11 2 - 7/7 A/G 125G/C 11/12 1 - 7/7 A/A 125G/C 12/12 1 - 7/9 A/A 1716G/A, 3041-71G/C ϩ 4002A/Ga 11/10 1 - 7/7 G/G 356G/A, 405ϩ46G/T, 4374ϩ13A/G 11/11 1 - 7/7 A/A 875ϩ40A/G, 3499ϩ37G/A 10/10 1 - 7/9 A/A 1859G/C ϩ 2134C/Ta 10/10 1 - 7/7 A/G 4002A/G 12/12 1 - 7/9 A/G 4002A/G 11/10 1 - 7/7 G/G 2377C/T 11/11 1 - 7/7 A/A 875ϩ40A/G, 1716G/A 10/10 1 - 7/7 G/G 3417A/T 11/11 1 - 7/7 A/G 3417A/T 11/12 24 - 7/7 G/G - 11/11 2 - 7/9 A/G - 10/12 3 - 7/9 A/G - 11/10 2 - 7/9 A/A - 10/10 1 - 9/9 A/A - 10/10 2 - 7/7 A/G - 10/11 1 - 7/7 A/A - 10/10 1 - 7/7 G/G - 8/11 Controls 1 ∆F508 7/9 A/G - 10/12 1 ∆F508 7/9 A/A 875ϩ40A/G 10/11 1 V562L 7/7 A/A 223C/T 10/10 1 G622D 7/9 A/G 3041-71G/C ϩ 4002A/Ga 10/11 1 - 7/7 A/A 3419T/G 10/11 1 - 7/7 G/G 4002A/G 11/11 3 - 7/7 A/G 125G/C 11/11 1 - 7/7 G/G 125G/C 11/11 1 - 7/7 A/A 125G/C 10/11 1 - 7/7 A/A 125G/C 11/12 2 - 7/5 A/G 875ϩ40A/G 11/11 1 - 7/7 A/G 875ϩ40A/G 10/10 1 - 7/7 A/A 875ϩ40A/G, 125G/C 10/11 1 - 7/7 G/G 356G/A 11/11 1 - 7/7 A/G 356G/A 10/10 1 - 9/9 A/A 3041-71G/C ϩ 4002A/Ga 10/10 1 - 7/7 G/G 406-6T/C 11/11 1 - 7/7 A/G 3417A/T 10/11 1 - 7/7 G/G 4404C/T 11/11 1 - 7/7 A/G 1859G/Cϩ2134C/Ta 10/11 11 - 7/7 G/G - 11/11 6 - 7/7 A/G - 10/10 2 - 7/7 A/G - 11/11 1 - 7/7 A/G - 10/11 5 - 7/9 A/G - 10/12 2 - 7/5 G/G - 10/11 aDouble mutant alleles, In bold: mutations or variations previously undescribed. Login to comment

[hide] CFTR gene mutations and male infertility. Andrologia. 2000 Mar;32(2):71-83. Stuhrmann M, Dork T
CFTR gene mutations and male infertility.
Andrologia. 2000 Mar;32(2):71-83., [PMID:10755189]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are a relatively frequent cause of male infertility. Depending on their molecular consequences, CFTR mutations may either result in typical cystic fibrosis (CF), one of the most common autosomal recessive disorders, which is characterized by chronic lung disease, pancreatic exocrine insufficiency, an increase in the concentration of sweat electrolytes and male infertility, due to obstructive azoospermia, or in atypical (often monosymptomatic) forms of CF such as congenital absence of the vas deferens (bi- or unilateral), bilateral ejaculatory duct obstruction or bilateral obstructions within the epididymides. All males with idiopathic obstructive azoospermia bear an increased risk for CF offspring. Couples requesting microsurgical epididymal sperm aspiration and in vitro fertilization, e.g. intracytoplasmic sperm injection, should be offered genetic counselling and molecular genetic analysis of the CFTR gene, if male infertility due to obstructive azoospermia is the underlying cause.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 CFTR mutations and male fertility Disorder Number of Proportion of Most frequent mutations (%) patients mutated alleles (%) Ethnic origin Reference CBAVD 17 20.6* DF508 (20.6) French Dumur et al. (1990b) CBAVD 25 38.0 DF508 (26.0) Northern European Anguiano et al. (1992) CBAVD 12 41.7 DF508 (20.8) French Culard et al. (1994) CBAVD 49 45.9 DF508 (32.6), R117H (6.1) Caucasians Oates & Amos (1994) CBAVD 47 21.3 DF508 (8.5), D1152H (3.2) Mostly Askenazim Augarten et al. (1994) CBAVD 30 41.7 DF508 (15.0), G542X (6.7), R117H (3.3) Spanish Casals et al. (1994) CBAVD 67 44.8 DF508 (20.9), R117H (4.5), W1282X (3.7) French Mercier et al. (1995) CBAVD 102 65.7+a DF508 (21.6), 5T (21.1), R347H (2.4) Caucasians Chillon et al. (1995) CBAVD 45 75.6+b DF508 (25.6), 5T (25.6), R117H (3.3), W1282X (3.3) French Costes et al. (1995) CBAVD 25 52.0+c 5T (26.0), DF508 (12.0), R117H (6.0) Caucasian Jarvi et al. (1995) CBAVD 70 68.6+d 5T (25.7), DF508 (19.3), W1282X (7.9) Mostly Caucasian Zielenski et al. (1995) CBAVD 101 79.2+e DF508 (26.2), R117H (11.4), 5T (12.9) Mostly German Do¨rk et al. (1997) CUAVD 10 5.0 DF508 (5.0) Spanish Casals et al. (1995) CUAVD 21 19.0 DF508 (9.5), R117H (4.8) Caucasian Mickle et al. (1995) BEDO 7 78.6 DF508 (28.5), 5T (21.4), R117H (14.3) Mostly German Meschede et al. (1997) IASV 16 3.1 I1139V (3.1) Mostly German Meschede et al. (1997) Azoospermia† 17 23.5+c 5T (14.7), R117H (5.9) DF508 (2.9) Caucasian Jarvi et al. (1995) Azoospermia 21 9.5 DF508 (2.4), G551D (2.4), R117H (2.4), G542X (2.4) Caucasian van der Ven et al. (1996) Spermatogenic failure 18 5.5+c G542X (2.8), 5T (2.8) Caucasian Jarvi et al. (1995) Spermatogenic failure 80 8.7 G542X (4.4), DF508 (3.1) Caucasian van der Ven et al. (1996) Spermatogenic failure 75 2.7+f DF508 (1.3), R117H (0.6), 5T (0.6) Dutch Tuerlings et al. (1998) *Testing only for DF508; +testing included the 5T allele; a-f, frequency of the 5T allele in the general population: a5.2%, n=498; b5.3%, n=131; c,dnot determined; e4.8%, n=186; f3.7%, n=212; †azoospermia with normal vas deferens and bilateral epididymal obstruction. Login to comment

[hide] Mutations of the cystic fibrosis gene, but not cat... Am J Gastroenterol. 2000 Aug;95(8):2061-7. Ockenga J, Stuhrmann M, Ballmann M, Teich N, Keim V, Dork T, Manns MP
Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.
Am J Gastroenterol. 2000 Aug;95(8):2061-7., [PMID:10950058]

Abstract [show]
OBJECTIVE: We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. METHODS: Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). RESULTS: No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CONCLUSIONS: CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Finally, we tested all samples for the presence of mutations or variants R75Q, I336K, R347H, IVS8-5T (5T allele), 1716G3A, 2143delT, 2789ϩ5G3A, Y1092X, 3272-26A3G, D1152H, and CFTRdel2,3 (21kb) by PCR and restriction enzyme digestion with the respective enzymes (for mutation references, see http://www.genet. Login to comment

[hide] Cystic fibrosis in infertility: screening before a... Hum Reprod. 2000 Nov;15(11):2415-7. Lewis-Jones DI, Gazvani MR, Mountford R
Cystic fibrosis in infertility: screening before assisted reproduction: opinion.
Hum Reprod. 2000 Nov;15(11):2415-7., [PMID:11056144]

Abstract [show]
Cystic fibrosis (CF) is the most common autosomal recessive disease in Caucasians. In 97-98% of men with CF, bilateral congenital absence of the vas deferens (CBAVD) blocks the transport of spermatozoa resulting in azoospermia. Abnormalities in sperm parameters have also been identified in males with CF. To date, over 800 disease-causing mutations of the CF transmembrane conductance regulator (CFTR) gene have been identified (also called ABCC7). Current legislation suggests that prior to intracytoplasmic sperm injection (ICSI) treatment, men with CBAVD or unexplained oligozoospermia should be considered for screening. If the male is negative with routine screening then the female partner is not screened. This is fundamentally wrong because if the female is screened and is found to be CF positive on routine testing, her partner would then need the fullest possible investigation of the CFTR gene. It is ideal to screen both partners in cases of oligozoospermia. However, if the resources are stretched, then only the female needs to be routinely screened because if she is negative, then the couple's residual risk of having a CF or CBAVD child will be reduced to 1:960. Only when the female is found to be a carrier does the male partner need routine screening followed by full testing for known mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Q493X D1152H Gregg, R.G., Wilfond, B.S., Farell, P.M. et al. (1993) Application of DNA 1717-1G→A 4326∆TC analysis in a population-screening program for neonatal diagnosis of cystic R56OT 4279insA fibrosis (CF): comparison of screening protocols. Login to comment

[hide] Prevalence of cystic fibrosis mutations in Israeli... Genet Test. 2001 Spring;5(1):47-52. Orgad S, Neumann S, Loewenthal R, Netanelov-Shapira I, Gazit E
Prevalence of cystic fibrosis mutations in Israeli Jews.
Genet Test. 2001 Spring;5(1):47-52., [PMID:11336401]

Abstract [show]
The aim of this study was to evaluate the screening policies of cystic fibrosis (CF) in the Jewish population. The prevalence of mutations that account for CF in Israel have been defined in the past by determining the frequency of CF mutations in affected individuals. This study is a population-based study and is, therefore, different from previous patient-based studies. We found that the CF mutations D1152H, W1089X, and 405 + IG-->A were present in some ethnic groups in which no CF patients carrying these mutations were reported. These facts necessitate a reevaluation of the screening policy regarding the ethnic groups in Israel. We studied 9,430 healthy Jewish Israeli individuals of 36 countries of origin. The prevalence of CF mutations was 1:19, 1:19, 1:28, and 1:42 for the Ashkenazi, Sephardi, North African, and Eastern Jews, respectively. CF mutations were identified in 374 (4.0%) individuals. These included 173 (46.3%) carriers of the W1282X mutation; 110 (29.4%) found to carry delF508; 23 (6.1%) who carried G542X; 22 (5.9%) who carried 3849 + 10Kb (C-->T; 20 (5.3%) who carried D1152H; 10 (2.7%) who carried N1303K; 11 (2.9%) who carried 405 + IG-->A; 4 (1.1%) who carried W1089X; and one (0.3%) who carried S549R. No carriers were detected for the 1717-1G-->A, G85E, and T360K mutations, which were tested for in 7,383, 1,558, and 41 individuals, respectively.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 These were: delF508 (Kerem et al., 1989), W1282X (Vidaud et al., 1990), G542X, 1717-1G R A, S549R (Kerem et al., 1990), N1303K (Osborn et al., 1991), 3849 1 10Kb C R T (Highsmith et al., 1994), T359K/Q360K (Shoshani et al., 1992), G85E (Zielenski et al., 1991), 405 1 1G R A (Dork et al., 1993), W1089X (Shosani et al., 1994), and D1152H (Highsmith et al., 1993). Login to comment
40 THE CONSENSUS POLICY OF SCREENING OF CF MUTATIONS IN ETHNIC GROUPS OF ISRAELI JEWSa Buchara and Iran Georgia Libya Morocco Tunis Turkey Egypt Sephardi W1089X 1 1 1 G85E 1 1 405-1 G® A 1 1 1 S549R 1 1 D1152H 1 1 1 1 T360K 1 Individuals of all ethnic groups were screened for the mutations W1282X, delF508, G5429X, N1303K, 3849110Kb C® T and 1717-1G® A. Login to comment
45 There were 173 (46.3%) carriers of the W1282X mutation; 110 (29.4%) carriers of delF508; 23 (6.1%) carriers of G542X; 10 (2.7%) carriers of N1303K; and 22 (5.9%) carriers of 3849 1 10KbC R T. Twenty (5.3%) were found to carry D1152H; 11 (2.9%) carried 405 1 1G R A; 4 (1.1%) carried W1089X; and 1 (0.3%) carried S549R. No carriers were detected for the mutations 1717-1G R A, G85E, and T360K, which were tested for in 7,383, 1,436, and 41 individuals, respectively. Login to comment
46 D1152H, W1089X, and 405 1 1G R A were tested for in 2,764, 1,658, and 1,551 individuals, respectively. Login to comment
47 The mutations D1152H and W1089X were detected in individuals whose origins had not been included in the consensus panel policy, namely Ashkenazi and Eastern Jews (Table 4B; Figs. 1 and 2). Login to comment
52 Mutations tested for all individuals in the cohort North Total Ashkenazi Sephardi Africa Eastern number of Mutation no. 6850 no. 933 no. 1146 no. 468 carriers W1282X 142 17 8 6 173 delF508 86 12.25 11.5 0.25 110 G542X 20.25 0.5 1.75 0.5 23 N1303K 7.5 1.5 0.25 0.75 10 3849110Kb 17 2 2 1 22 C® T B. Mutations tested for individuals of non-Ashkenazi origin, mixed origin, and of spouses of carriers Type of Total number mutation Number tested Ashkenazi Sephardi North Africa Eastern of carriers D1152H Number tested 1,305 458.25 722.75 280 Carriers 11.5 4.5 3.5 0.5 20 405 Number tested 425.75 372 633.5 119 11G® A Carriers 0.5 1 9.5 0 11 W1089X Number tested 539.25 345 638.5 135 Carriers 2 0.5 1 0.5 4 S549R Number tested 534.5 385.5 686 110 Carriers 0 1 0 0 1 a Ethnic origin was classified according to the country of origin of the four grandparents of each individual. Each grandparent was calculated as contributing a quarter of his/her gene pool and these were summed up for each ethnic origin. Login to comment
54 Ethnic origin of carriers of the D1152H mutation. Login to comment
55 The D1152H mutation was tested in 2,701 individuals; 20 were carriers (0.74%). Login to comment
74 Therefore, Ashkenazi Jews would have been tested for the five main mutationsonly: delF508,W1282X, G542X, N1303K, and 3849 1 10KbC R T. The mutations D1152H and W1089X would not have been included in the test panel in Ashkenazi Jews. Login to comment
77 Surprisingly, our results show that the D1152H and W1089X mutations are present in Ashkenazi Jews, as 8 of the 20 carriers of D1152H were of Ashkenazi origin only, and an additional 6 were half-Ashkenazi (Table 4B; Figs. 1 and 2). Login to comment
79 Of special interest is the D1152H mutation. Login to comment
85 It seems, therefore, that the D1152H mutation exists in all Jewish ethnic groups. Login to comment

[hide] Improved detection of cystic fibrosis mutations in... Genet Med. 2001 May-Jun;3(3):168-76. Heim RA, Sugarman EA, Allitto BA
Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel.
Genet Med. 2001 May-Jun;3(3):168-76., [PMID:11388756]

Abstract [show]
PURPOSE: To determine the comparative frequency of 93 CFTR mutations in U.S. individuals with a clinical diagnosis of cystic fibrosis (CF). METHODS: A total of 5,840 CF chromosomes from Caucasians, Ashkenazi Jews, Hispanics, African Americans, Native Americans, Asians, and individuals of mixed race were analyzed using a pooled ASO hybridization strategy. RESULTS: Sixty-four mutations provided a sensitivity of 70% to 95% in all ethnic groups except Asians, and at least 81% when the U.S. population was considered as a whole. CONCLUSIONS: For population-based carrier screening for CF in the heterogeneous U.S. population, which is characterized by increasing admixture, a pan-ethnic mutation panel of 50 to 70 CFTR mutations may provide a practical test that maximizes sensitivity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
110 This difference is unlikely to be due to ascertainment, since the observed frequency of ⌬F508 (29%) is equivalent to the frequency of 30% reported by Abeliovich et al.16 In this study, the detection of an additional three mutations was required to bring the overall detection rate to 95.4% (A455E, R553X, and D1152H). Login to comment

[hide] Nasal potential difference measurements in patient... Eur Respir J. 2001 Jun;17(6):1208-15. Wilschanski M, Famini H, Strauss-Liviatan N, Rivlin J, Blau H, Bibi H, Bentur L, Yahav Y, Springer H, Kramer MR, Klar A, Ilani A, Kerem B, Kerem E
Nasal potential difference measurements in patients with atypical cystic fibrosis.
Eur Respir J. 2001 Jun;17(6):1208-15., [PMID:11491166]

Abstract [show]
The diagnosis of cystic fibrosis (CF) is based on characteristic clinical and laboratory findings. However, a subgroup of patients present with an atypical phenotype that comprises partial CF phenotype, borderline sweat tests and one or even no common cystic fibrosis transmembrane conductance regulator (CFTR) mutations. The aim of this study was to evaluate the role of nasal potential difference (PD) measurements in the diagnosis of CF patients with an atypical presentation and in a population of patients suspected to have CF. Nasal PD was measured in 162 patients from four different groups: patients with classical CF (n = 31), atypical phenotype (n = 11), controls (n = 50), and patients with questionable CF (n = 70). The parameter, or combination of nasal PD parameters was calculated in order to best discriminate all CF patients (including atypical CF) from the non-CF group. The patients with atypical CF disease had intermediate values of PD measurements between the CF and non-CF groups. The best discriminate model that assigned all atypical CF patients as CF used: e(response to chloride-free and isoproterenol/response to amiloride) with a cut-off >0.70 to predict a CF diagnosis. When this model was applied to the group of 70 patients with questionable CF, 24 patients had abnormal PD similar to the atypical CF group. These patients had higher levels of sweat chloride concentration and increased rate of CFTR mutations. Nasal potential difference is useful in diagnosis of patients with atypical cystic fibrosis. Taking into account both the sodium and chloride transport elements of the potential difference allows for better differentiation between atypical cystic fibrosis and noncystic fibrosis patients. This calculation may assist in the diagnostic work-up of patients whose diagnosis is questionable.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 110 PI 100 16 M 3849z10kbCRT/DF508 67 PS 69 39 M D1152H/D1152H 15 PS 100 52 M ?/? Login to comment
164 - Clinical parameters of patients referred with questionable cystic Fibrosis (CF) QCF-CF QCF-non-CF p-value Subjects n 24 46 Age yrs 12.17¡10.49 19.13¡11.9 0.013 Sweat chloride mmol?L-1 56¡17 39¡18 v0.001 FEV1 % pred 83.6¡19.7 83.7¡32.9 NS Positive sputum clutures# 4 9 NS CFTR mutations W1282X/5T(2) 5T/5T(1) v0.001} W1282X/3849z10kbC-wT(1) DF508(3) 0.04z DF508/5T(1) 5T(3) D1152H/5T(1) DF508(1) Male infertility 1 3 NS Pancreatic insufficiency 1 1 NS Data are preserted as mean¡SD. Login to comment

[hide] [Cystic fibrosis and normal sweat chloride values:... Rev Mal Respir. 2001 Sep;18(4 Pt 1):443-5. Lebecque P, Leal T, Godding V
[Cystic fibrosis and normal sweat chloride values: a case-report].
Rev Mal Respir. 2001 Sep;18(4 Pt 1):443-5., [PMID:11547256]

Abstract [show]
In a suggestive context, normal sweat chloride values (<60 mmol/L) do not always suffice to exclude the diagnosis of CF.CASE-REPORT: A 19-year-old female presented with a diagnosis of bronchiectasis. Her past medical history was noteworthy for the onset of respiratory symptoms in the infancy, colonization of the respiratory tract by Pseudomonas aeruginosa for three years and previous treatment for allergic bronchopulmonary aspergillosis. She was heterozygote for the DeltaF 508 mutation of the CFTR gene. Sweat chloride values were repeatedly normal, ranging from 25 to 46 mmol/L. The diagnosis of CF was confirmed by the identification of a second CFTR mutation (D1152H) and the demonstration of typical nasal potential.CONCLUSION: It is now estimated that approximately 2% of CF patients will present an "atypical" phenotype with sweat chloride values<60 mmol/L. For these patients, the diagnosis can be confirmed by the identification of a CF-causing mutation in each CFTR allele or in vivo demonstration of CFTR dysfunction by nasal potential difference study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 The diagnosis of CF was confirmed by the identification of a second CFTR mutation (D1152H) and the demonstration of typical nasal potential. Login to comment
10 D1152H. Diagnostic. Login to comment
17 Un diagnostic de mucoviscidose est rapidement confirmé par l`identification d`une seconde mutation, plus rare (D1152H), et par la démonstration d`anomalies du potentiel nasal typiques de la maladie. Login to comment
20 D1152H. Diagnostic. Login to comment
61 Un diagnostic de mucoviscidose est confirmé par l`étude répétée de la différence de potentiel transépithéliale au niveau nasal (fig. 1) puis par la mise en évidence d`une seconde mutation du gène CFTR (D1152H) sur l`autre allèle. Login to comment
73 Dans des situations d`hétérozygotie composite, la présence de certaines d`entre elles a pu être associée de manière occasionnelle ou parfois plus consistante avec un taux de chlorure dans la sueur inférieur à 60 voire même (dans de très rares cas) 30 mmol/L. Dans ce singulier petit groupe, figurent notamment les mutations 3 849 + 10kb C→T, A455E, R117H, , R347H, G551S, D1152H. Login to comment
77 La mutation D1152H siège au niveau de l`exon 18. Login to comment
126 FELDMANN D, ROCHEMAURE J, PLOUVIER E, MAGNIER C, CHAUVE C, AYMARD P : Mild course of cystic fibrosis in an adult with the D1152H mutation. Login to comment
129 FRIEDMAN KJ, HIGHSMITH JR, ZHOU Z et coll. : D1152H : a common CFTR mutation associated with highly variable disease expression. Login to comment
132 ANDRIEUX J, VERLINGUE C,AUDRÉZET M-P, SCOTET V, FÉREC C : Genotype-phenotype correlation in 18 patients with the D1152H mutation. Login to comment

[hide] Cystic fibrosis mutation testing in Italy. Genet Test. 2001 Fall;5(3):229-33. Bombieri C, Pignatti PF
Cystic fibrosis mutation testing in Italy.
Genet Test. 2001 Fall;5(3):229-33., [PMID:11788089]

Abstract [show]
In Italy, Cystic fibrosis (CF) mutation frequency differences have been observed in different regions. In the northeastern Veneto and Trentino Alto Adige regions, a complete cystic fibrosis transmembrane conductance regulator (CFTR) gene screening in CF patients detected through a newborn screening program has identified about 90% of the mutations. In these two regions, the current detection rate using a CF screening panel containing the 16 most common mutations is 86.6%. CF mutations in some other Italian regions have not been so thoroughly analysed. Available data indicate that a more general national screening panel comprising 31 mutations may detect about 75% of all CF mutations in Italy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 CF GENE MUTATIONS IN ITALY Number of alleles Frequency Cumulative Mutation screened (%) frequency (%) DF508 3442 51.07 51.07 N1303K 3056 4.84 55.91 G542X 3082 4.83 60.75 2183 AA ® G 2596 2.66 63.41 R1162X 2580 2.42 65.83 1717-1 G ® A 2892 2.11 67.94 W1282X 2600 1.23 69.17 R553X 2882 1.15 70.31 T338I 2306 0.69 71.01 R347P 2642 0.61 71.61 711 1 5 G ® A 2454 0.57 72.18 G85E 1980 0.40 72.59 621 1 1 G ® T 2594 0.39 72.97 R334W 2366 0.30 73.27 R352Q 2112 0.24 73.50 S549N 2118 0.24 73.74 R347H 2184 0.18 73.92 L1077P 1840 0.16 74.09 R1158X 1878 0.16 74.25 541del C 1884 0.16 74.40 R1066H 1918 0.16 74.56 E585X 1922 0.16 74.72 Q552X 2172 0.14 74.86 D1152H 1824 0.11 74.97 2790-2 A ® G 1862 0.11 75.07 3132 del TG 1862 0.11 75.18 3667ins 4 1876 0.11 75.29 DI507 1914 0.10 75.39 1898 1 3 A ® G 1920 0.10 75.50 G1244E 1960 0.10 75.60 1784 del G 2052 0.10 75.69 From Rendine et al. (1997). Login to comment

[hide] Genetic and clinical features of false-negative in... Acta Paediatr. 2002;91(1):82-7. Padoan R, Genoni S, Moretti E, Seia M, Giunta A, Corbetta C
Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis.
Acta Paediatr. 2002;91(1):82-7., [PMID:11883825]

Abstract [show]
A study was performed on the delayed diagnosis of cystic fibrosis (CF) in infants who had false-negative results in a neonatal screening programme. The genetic and clinical features of false-negative infants in this screening programme were assessed together with the efficiency of the screening procedure in the Lombardia region. In total, 774,687 newborns were screened using a two-step immunoreactive trypsinogen (IRT) (in the years 1990-1992), IRT/IRT + delF508 (1993-1998) or IRT/IRT + polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) protocol (1998-1999). Out of 196 CF children born in the 10 y period 15 were false negative on screening (7.6%) and molecular analysis showed a high variability in the genotypes. The cystic fibrosis transmembrane regulator (CFTR) gene mutations identified were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 + 10kbC --> T, 2789 + 5G --> A, 5T-12TG and the novel mutation D110E. In three patients no mutation was identified after denaturing gradient gel electrophoresis of the majority of CFTR gene exons. Conclusion: The clinical phenotypes of CF children diagnosed by their symptoms at different ages were very mild. None of them presented with a severe lung disease. The majority of them did not seem to have been damaged by the delayed diagnosis. The combination of IRT assay plus genotype analysis (1998-1999) appears to be a more reliable method of detecting CF than IRT measurement alone or combined with only the delF508 mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 The cystic brosis transmembrane regulator (CFTR) gene mutations identi ed were delF508, D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 ‡ 10kbC ® T, 2789 ‡ 5G ® A, 5T-12TG and the novel mutation D110E. Login to comment
40 Mutation Frequency (%) DelF508 54 N1303K 8 G542X 6.25 1717-1G ® A 2.50 R334W 1.75 2183AA ® G 1.50 R117H, L1077P, W1282X 1.25 D110E, R347P, E585X, 2789 ‡ 5G ® A 0.75 R352Q, R553X, R1066H, D1152H, R1158X, 1782delA, 1898 ‡ 1G ® A, 3659delC 0.50 G85E, R117L, G178R, D579G, H609R, Y1032C, V1153E, R1162X, 621 ‡ 1G ® T, 711 ‡ 1G ® T, 1845delAG o 1846delGA, 2143delT 0.25 Table2.Differencesinthethreestrategiesofneonatalscreening(audit1990-1999). Login to comment
70 Year of birth Patient Sex Age at diagnosis Genotype Sweat test (chloride mEq l¡1 ) 1990 1 BA F 8 mo DF508/2789 ‡ 5G ® A 74, 79 2 LG M 4 y ¡/¡ 84, 83 1991 3 BV F 6 y ¡/¡ a 61, 85, 70 4 CA F 8 y R1066C/D1152H 58, 59 5 CA F 8 y DF508/5T-TG12 65, 67 6 PS M 5 y N1303K/-a 41, 43, 55, 63, 85, 89 1992 7 AE F 1 y R334W/-a 57, 42, 78, 82 8 DA M 4 mo ¡/¡ 85, 101, 143, 9 FA M 1 y ¡/¡ a 70, 75, 98, 114 1993 10 CA F 7 y DF508/5T-TG12 45, 50 1995 11 BM M 3 y DF508/DF508 117, 123 1997 12 DG M 6 mo G542X/D110E 59, 88, 80, 70 13 DE F 2 y D1152H/3849 ‡ 10kbC ® T 31, 35 14 TL M 2 y ¡/¡ a 115, 136 1998 15 CM M 5 mo F1052V/A120T 20, 25 F: female; M: male. Login to comment
80 The CFTR alterations identi ed were D1152H, R1066C, R334W, G542X, N1303K, F1052V, A120T, 3849 ‡ 10kbC ® T, 2789 ‡ 5G ® A, 5T-12TG and the new mutation D110E (19). Login to comment

[hide] Mutations of the cystic fibrosis gene and intermed... Am J Respir Crit Care Med. 2002 Mar 15;165(6):757-61. Lebecque P, Leal T, De Boeck C, Jaspers M, Cuppens H, Cassiman JJ
Mutations of the cystic fibrosis gene and intermediate sweat chloride levels in children.
Am J Respir Crit Care Med. 2002 Mar 15;165(6):757-61., 2002-03-15 [PMID:11897640]

Abstract [show]
The incidence of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in children with intermediate sweat chloride levels is unknown. The results of 2,349 sweat tests performed at two Belgian university hospitals were reviewed. Intermediate chloride concentrations were observed in 98 subjects (4.2%), 68 being younger than 18 years of age. Forty-three children could be traced and their parents agreed to take part in the study. Exhaustive analysis of the CFTR gene disclosed a total of 24 putative mutations (27.9%). Three subjects were found to carry only one CFTR mutation, whereas 10 harbored one mutation on both CFTR genes. These 10 children were investigated in detail. At the time of writing, the mean age (+/-SD) of this group is 8.9 years (+/-4.2 years). Nine children are pancreatic sufficient. Three have been asymptomatic for more than two years, whereas the others display, to different degrees, clinical features suggestive of CF. The sweat chloride concentration is slightly higher in this group (39.4 +/- 5.4 mM) than in subjects without CFTR mutation (35.2 +/- 4.4 mM, p < 0.05). The nasal potential difference was abnormal in five of the nine subjects tested. In this study, 23% of children displaying intermediate sweat chloride levels were found to carry a putative mutation on both CFTR genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 Age at First Sweat Test (yr) Clin Sweat (mM) Nasal Potential (mV) Bacteriology (Throat Swab or Sputum Culture) GenotypePDmax ⌬Iso ϩ Cl-free 1 2.5 34 -15 -7* Staphylococcus aureus ⌬F508/D1152H 2 2.8 36 -21 -10 - ⌬F508/R117H, 7T 3 0.3 33 ND ND - ⌬F508/R117H, 7T 4 0.7 43 -51* -7* S. aureus S977F, 5T/2789 ϩ 5G→A 5 0.1 39 -16 -4* Haemophilus influenzae, S. aureus ⌬F508/R117C 6 0.1 37 -48* -9* H. influenzae, S. aureus ⌬F508/R117C 7 0.7 48 -15 -12 Pseudomonas aeruginosa, S. aureus R553X/R117H, 7T 8 6 34 -30 -10 H. influenzae 5T/5T 9 7 45 -24 -15 S. aureus ⌬F508/S1235R 10 9.5 45 -47* -11 P. aeruginosa ⌬F508/D1152H Definition of abbreviations: PDmax ϭ maximum basal nasal potential difference; ⌬Iso ϩ Cl-free ϭ cumulative change in PD after perfusion with chloride-free solution plus isoproterenol in the presence of amiloride. Login to comment
77 C→T (6-9), R347H (12), G551S (13), D1152H (14), R117H (15, 16), and R117C (17) mutations. Login to comment
87 D1152H is a common mutation in men with congenital bilateral aplasia of the vas deferens (CBAVD) (28-31). Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment
112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL. Login to comment

[hide] Negative sweat test in hypertrypsinaemic infants w... Eur J Pediatr. 2002 Apr;161(4):212-5. Padoan R, Bassotti A, Seia M, Corbetta C
Negative sweat test in hypertrypsinaemic infants with cystic fibrosis carrying rare CFTR mutations.
Eur J Pediatr. 2002 Apr;161(4):212-5., [PMID:12014388]

Abstract [show]
Persistent hypertrypsinaemia in newborn screening for cystic fibrosis (CF) recognises subjects at high risk to be affected. Diagnosis is confirmed by a positive sweat test and/or by the presence of two mutations in the cystic fibrosis transmembrane regulator gene. The aim of the present study was to evaluate the occurrence of a negative sweat test (chloride < 60 mmol/l) during the first months of life, in hypertrypsinaemic infants, which would lead to a delayed diagnosis. We reviewed clinical charts of CF patients born between January 1993 and September 1998, when the neonatal screening programme consisted of an immunoreactive trypsinogen (IRT)/DNA (F508del) + IRT strategy. Laboratory and clinical data were collected for patients diagnosed after 12 months of life. Out of 446,492 newborns, 104 CF patients were diagnosed giving an overall incidence of 1:4293. Of these, six had a blood IRT level above the cut off value (99th percentile) and a negative sweat test in the first trimester of life. At a mean age of 3.5years, the patients were again referred to our CF Centre for re-evaluation in order to confirm or exclude the disorder. Molecular analysis identified the following genotypes: F508del/A309D, F508del/3849 + 10kbC-->T, F508del/R117H (in two patients), R117H/ L997F, and F508del/R117L. CONCLUSION: Infants with cystic fibrosis bearing a spectrum of mild cystic fibrosis transmembrane regulator gene mutations may present as hypertrypsinaemic newborns with a sweat chloride within the normal range. Reference values for normal sweat test during the first months of life should be revised. A wide molecular genetic analysis is recommended for newborns presenting persistent hypertrypsinaemia and a sweat test result > 30 mmol/l in order to diagnose atypical forms of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
14 Diagnostic delay has been reported for patients bearing specific CFTR gene mutations such as R117H, D1152H, 3849+10kbCfiT, A455E and 2789+5GfiA, which were associated with a non-pathological sweat chloride level [3, 6, 9,13]. Login to comment

[hide] Hyperechogenic bowel loops and meconium ileus in a... Prenat Diagn. 2002 Jul;22(7):636-7. Orgad S, Berkenstadt M, Achiron R, Yahav Y, Gazit E, Barkai G, Loewenthal R
Hyperechogenic bowel loops and meconium ileus in a fetus carrying the D1152H and G542X cystic fibrosis CFTR mutations.
Prenat Diagn. 2002 Jul;22(7):636-7., [PMID:12124706]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Hyperechogenic bowel loops and meconium ileus in a fetus carrying the D1152H and G542X cystic fibrosis CFTR mutations In the Jewish cystic fibrosis (CF) patient population, 12 mutations account for more than 91% of the CF chromosomes. Login to comment
22 Until the year 2000 the mutation D1152H was tested only for individuals from Morocco, Iran and Buchara. Login to comment
23 However, we have recently found that the mutation D1152H is the third most prevalent mutation in Ashkenazi and other Jewish ethnic groups (Orgad et al., 2001). Login to comment
33 Since the D1152H mutation was not tested for previously, we tested the father and found that indeed he was a carrier of D1152H. Login to comment
39 The D1152H mutation is caused by a guanine to cytosine substitution at nucleic acid position 3586 of the CFTR gene, resulting in replacement of aspartic acid by histidine at amino acid 1152 of the protein (Highsmith et al., 1994). Login to comment
42 Therefore, the D1152H mutation may cause variable manifestations of cystic fibrosis, some may indeed be severe. Login to comment
43 This case emphasizes the importance of expanding the prenatal diagnosis of the CFTR gene and the need for inclusion of the D1152H mutation in screening. Login to comment
44 The prevalence of the D1152H mutation in the Jewish population comprises 5.2% of all the CFTR mutations (Orgad et al., 2001). Login to comment

[hide] Genotype-phenotype correlation in cystic fibrosis:... Am J Med Genet. 2002 Jul 22;111(1):88-95. Salvatore F, Scudiero O, Castaldo G
Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes.
Am J Med Genet. 2002 Jul 22;111(1):88-95., 2002-07-22 [PMID:12124743]

Abstract [show]
More than 1,000 mutations have been identified in the cystic fibrosis (CF) transmembrane regulator (CFTR) disease gene. The impact of these mutations on the protein and the wide spectrum of CF phenotypes prompted a series of Genotype-Phenotype correlation studies. The CFTR genotype is invariably correlated with pancreatic status-in about 85% of cases with pancreatic insufficiency and in about 15% of cases with pancreatic sufficiency. The correlations between the CFTR genotype and pulmonary, liver, and gastrointestinal expression are debatable. The heterogeneous phenotype in CF patients bearing the same genotype or homozygotes for nonsense mutations implicated environmental and/or genetic factors in the disease. However, the discordant phenotype observed in CF siblings argued against a major role of environmental factors and suggested that genes other than CFTR modulate the CF phenotype. A locus that modulates gastrointestinal expression was identified in mice and subsequently in humans. By analyzing nine CF patients discordant for meconium ileus we were able to show that this locus had a dominant effect. Moreover, in a collaborative study we found a higher rate of polymorphisms in beta-defensin genes 1 and 2 in CF patients and in controls. In another multicenter study mutations in alpha-1 antitrypsin (A1AT) and mannose binding lectin genes were found to be independent risk factors for liver disease in CF patients. The body of evidence available suggests that the variegated CF phenotype results from complex interactions between numerous gene products.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 A series of mutations usually associated with pancreatic sufficiency have been identified and defined as ''mild`` with reference to pancreatic status [Kerem et al., 1989c]: G85E, G91R, R117H, E193K, P205S, R334W, T338I, R347H, R347L, R347P, R352Q, A455E, S492F, S549N, P574H, D579G, 711 þ 5 G > A, C866Y, F1052V, H1054D, R1066H, R1068H, H1085R, D1152H, S1159P, S1251N, F1286S, G1349D, 2789 þ 5 G > A, and 3849 þ 10kb C > T [Dean et al., 1990; Cutting et al., 1990a; Cremonesi et al., 1992; Highsmith et al., 1994]. Login to comment

[hide] Screening for cystic fibrosis in newborn infants: ... J Med Screen. 2002;9(2):60-3. Corbetta C, Seia M, Bassotti A, Ambrosioni A, Giunta A, Padoan R
Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population.
J Med Screen. 2002;9(2):60-3., [PMID:12133923]

Abstract [show]
OBJECTIVE: To assess the performance of a two tier neonatal screening programme (IRT/DNA/IRT) for cystic fibrosis, based on immunoreactive trypsinogen (IRT) followed by direct cystic fibrosis transmembrane conductance regulator (CFTR) gene analysis (based on a panel of up to 31 mutations) in hypertrypsinaemic newborn infants and to compare it with a previous screening protocol. SETTING: The study comprised all the newborn infants in the period 1 October 1998 to 31 December 1999 in the Lombardia region, north western Italy. METHODS: The screening strategy consisted of an immunoreactive trypsinogen assay from dried blood spots, a polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (PCR-OLA), and a sequence code separation. RESULTS: 104 609 newborn infants were screened. 1457 hypertrypsinaemic infants (1.39%) were analysed with the PCR-OLA assay. 18 newborn homozygotes or compound heterozygotes for CFTR mutations were identified and referred to the cystic fibrosis (CF) centre at a mean age of 3 weeks. 125 infants presenting only one mutation were recalled for a sweat test: a diagnosis of CF was made in 13 infants, and parents of 112 neonates identified as carriers (1:13) received genetic counselling. The remaining 1314 hypertrypsinaemic newborn infants were recalled for IRT retesting and 177 were referred for a sweat test because the second IRT measurement was above the cut off value. Among this group a further two infants were diagnosed with CF (1.1%) leading to a CF prevalence of 1:3170. CONCLUSIONS: This strategy resulted in an early and accurate diagnosis of CF. The IRT/DNA/IRT protocol with an OLA assay was shown to be useful in an Italian population with a genetic heterogeneity, leading to the identification of 94% of infants with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
302 The last led to a CF diagnosis in infants with sweat chloride values between 30 and 60 mmol/l, who underwent gene scanning (three infants with genotypes delF508/D1152H, delF508/D110N, delF508/D579G). Login to comment

[hide] Variant cystic fibrosis phenotypes in the absence ... N Engl J Med. 2002 Aug 8;347(6):401-7. Groman JD, Meyer ME, Wilmott RW, Zeitlin PL, Cutting GR
Variant cystic fibrosis phenotypes in the absence of CFTR mutations.
N Engl J Med. 2002 Aug 8;347(6):401-7., 2002-08-08 [PMID:12167682]

Abstract [show]
BACKGROUND: Cystic fibrosis is a life-limiting autosomal recessive disorder with a highly variable clinical presentation. The classic form involves characteristic findings in the respiratory tract, gastrointestinal tract, male reproductive tract, and sweat glands and is caused by loss-of-function mutations in the cystic fibrosis transmembrane conductance regulator (CFTR ) gene. Nonclassic forms of cystic fibrosis have been associated with mutations that reduce but do not eliminate the function of the CFTR protein. We assessed whether alteration in CFTR function is responsible for the entire spectrum of variant cystic fibrosis phenotypes. METHODS: Extensive genetic analysis of the CFTR gene was performed in 74 patients with nonclassic cystic fibrosis who had been referred by 34 medical centers. We evaluated two families that each included a proband without identified mutations and a sibling with nonclassic cystic fibrosis to determine whether there was linkage to the CFTR locus and to measure the extent of CFTR function in the sweat gland and nasal epithelium. RESULTS: Of the 74 patients studied, 29 had two mutations in the CFTR gene, 15 had one mutation, and 30 had no mutations. A final genotype of two mutations was more common among patients who had been referred after screening for common cystic fibrosis-causing mutations identified one mutation than among those who had been referred after screening had identified no such mutations (26 of 34 patients vs. 3 of 40 patients, P<0.001). Comparison of clinical features and sweat chloride concentrations revealed no significant differences among patients with two, one, or no CFTR mutations. Haplotype analysis in the two families revealed no linkage to CFTR. Although each of the affected siblings had elevated sweat chloride concentrations, measurements of cyclic AMP-mediated ion and fluid transport in the sweat gland and nasal epithelium demonstrated the presence of functional CFTR. CONCLUSIONS: Factors other than mutations in the CFTR gene can produce phenotypes clinically indistinguishable from nonclassic cystic fibrosis caused by CFTR dysfunction.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 MUTATION IDENTIFIED BY SCREENING FOR COMMON MUTATIONS MUTATION IDENTIFIED BY DNA SEQUENCING NO. OF PATIENTS ∆F508 5T* 3 ∆F508 D1152H 2 ∆F508 2789+2insA 2 ∆F508 R117C 2 ∆F508 D110H 1 ∆F508 2789+5G→A 1 ∆F508 P205S 1 ∆F508 L967S 1 ∆F508 I1027T 1 ∆F508 L206W 1 ∆F508 T1053I and 5T 1 ∆F508 V920M and 5T 1 ∆F508 R1070W 1 ∆F508 D579G 1 ∆F508 P67L 1 ∆F508 2811G→T†‡ 1 G85E F191V† 1 R117H G103X and 5T 1 I148T I556V 1 G542X R1162L 1 W1282X D1152H 1 None L138ins and 3272-26 A→G 1 None G463D† and 5T 1 None F693L and 5T 1 ∆F508 None 6 G551D None 1 W1282X None 1 None 5T 4 None 2307insA 1 None L997F 1 None V520I 1 None None 30 in Subject II-2 in Family 1. Login to comment

[hide] Standards and guidelines for CFTR mutation testing... Genet Med. 2002 Sep-Oct;4(5):379-91. Richards CS, Bradley LA, Amos J, Allitto B, Grody WW, Maddalena A, McGinnis MJ, Prior TW, Popovich BW, Watson MS, Palomaki GE
Standards and guidelines for CFTR mutation testing.
Genet Med. 2002 Sep-Oct;4(5):379-91., [PMID:12394352]

Abstract [show]
One mission of the ACMG Laboratory Quality Assurance (QA) Committee is to develop standards and guidelines for clinical genetics laboratories, including cytogenetics, biochemical, and molecular genetics specialties. This document was developed under the auspices of the Molecular Subcommittee of the Laboratory QA Committee by the Cystic Fibrosis (CF) Working Group. It was placed on the "fast track" to address the preanalytical, analytical, and postanalytical quality assurance practices of laboratories currently providing testing for CF. Due to the anticipated impact of the ACMG recommendation statement endorsing carrier testing of reproductive couples, it was viewed that CF testing would increase in volume and that the number of laboratories offering CF testing would also likely increase. Therefore, this document was drafted with the premise of providing useful information gained by experienced laboratory directors who have provided such testing for many years. In many instances, "tips" are given. However, these guidelines are not to be interpreted as restrictive or the only approach but to provide a helpful guide. Certainly, appropriately trained and credentialed laboratory directors have flexibility to utilize various testing platforms and design testing strategies with considerable latitude. We felt that it was essential to include technique-specific guidelines of several current technologies commonly used in laboratories providing CF testing, since three of the four technologies discussed are available commercially and are widely utilized. We take the view that these technologies will change, and thus this document will change with future review.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 A recent report by Orgad et al.11 indicated that additional mutations were found in Jewish Israeli populations, including D1152H, 405 ϩ 1GϾA, W1089X, and S549R. Login to comment

[hide] Splice mutation 1811+1.6kbA>G causes severe cystic... J Med Genet. 2002 Nov;39(11):e73. Reboul MP, Bieth E, Fayon M, Biteau N, Barbier R, Dromer C, Desgeorges M, Claustres M, Bremont F, Lacombe D, Iron A
Splice mutation 1811+1.6kbA>G causes severe cystic fibrosis with pancreatic insufficiency: report of 11 compound heterozygous and two homozygous patients.
J Med Genet. 2002 Nov;39(11):e73., [PMID:12414835]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
160 Some of them are always responsible for a unique phenotype that can be either CF-PI (for instance, the case of N1303K in class II, G551D in class III, and R1066C in class IV), or CF-PS (for instance, the case of G551S in class III) or CBVAD for D1152H (class IV). Login to comment

[hide] Chronic pancreatitis and cystic fibrosis. Gut. 2003 May;52 Suppl 2:ii31-41. Witt H
Chronic pancreatitis and cystic fibrosis.
Gut. 2003 May;52 Suppl 2:ii31-41., [PMID:12651880]

Abstract [show]
Recent discoveries of trypsinogen and trypsin inhibitor mutations in patients with chronic pancreatitis (CP) support the hypothesis that an inappropriate activation of pancreatic zymogens to active enzymes within the pancreatic parenchyma starts the inflammatory process. Current data suggest that CP may be inherited dominant, recessive, or complex as a result of mutations in the above mentioned or yet unidentified genes. Evaluation of patients with CP should include genetic testing. Cystic fibrosis (CF) is an autosomal recessive inherited disorder caused by mutations in the CF transmembrane conductance regulator (CFTR) gene and is characterised by pancreatic insufficiency and chronic bronchopulmonary infection. The progression and severity of pulmonary disease differs considerably between people with identical CFTR mutations and does not seem to correlate with the type or class of the CFTR mutation. The identification of further disease modifying genetic factors will increase the pathophysiological understanding and may help to identify new therapeutic targets.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
430 Nucleus Class I defective protein synthesis (R553X, W1282X, 3950delT) Class II abnormal processing/trafficking (del508, N1303K) Class VI defective regulation of other ion channels (del508, G551D) Class V reduced synthesis (3849+10kbC>T) Class IV decreased conductance (R117H, R347P, D1152H) Class III defective activation (G551D) I II VI V III IV RD ATP Endoplasmic reticulum NBD NBD Golgi mutations result in a decreased amount of functional protein by abnormal splicing or reduced trafficking. Login to comment

[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]

Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment

[hide] The phenotypic consequences of CFTR mutations. Ann Hum Genet. 2003 Sep;67(Pt 5):471-85. Rowntree RK, Harris A
The phenotypic consequences of CFTR mutations.
Ann Hum Genet. 2003 Sep;67(Pt 5):471-85., [PMID:12940920]

Abstract [show]
Cystic fibrosis is a common autosomal recessive disorder that primarily affects the epithelial cells in the intestine, respiratory system, pancreas, gall bladder and sweat glands. Over one thousand mutations have currently been identified in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene that are associated with CF disease. There have been many studies on the correlation of the CFTR genotype and CF disease phenotype; however, this relationship is still not well understood. A connection between CFTR genotype and disease manifested in the pancreas has been well described, but pulmonary disease appears to be highly variable even between individuals with the same genotype. This review describes the current classification of CFTR mutation classes and resulting CF disease phenotypes. Complex disease alleles and modifier genes are discussed along with alternative disorders, such as disseminated bronchiectasis and pancreatitis, which are also thought to result from CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Several mutations within exon 18, which encodes transmembrane helix 12 and the subsequent intracytoplasmic loop, were also shown to fall into Class IV with M1137V, I1139V, M1140, D1152H and D1154G mutants exhibiting significantly reduced cAMP-activated chloride currents (Vankeerberghen et al. 1998b). Login to comment

[hide] CFTR genotypes in patients with normal or borderli... Hum Mutat. 2003 Oct;22(4):340. Feldmann D, Couderc R, Audrezet MP, Ferec C, Bienvenu T, Desgeorges M, Claustres M, Mittre H, Blayau M, Bozon D, Malinge MC, Monnier N, Bonnefont JP, Iron A, Bieth E, Dumur V, Clavel C, Cazeneuve C, Girodon E
CFTR genotypes in patients with normal or borderline sweat chloride levels.
Hum Mutat. 2003 Oct;22(4):340., [PMID:12955726]

Abstract [show]
In recent years, some patients bearing "atypical" forms of cystic fibrosis (CF) with normal sweat chloride concentrations have been described. To identify the spectrum of mutant combinations causing such atypical CF, we collected the results of CFTR (ABCC7) mutation analysis from 15 laboratories. Thirty patients with one or more typical symptoms of the disease associated with normal or borderline sweat chloride levels and bearing two CFTR mutations were selected. Phenotypes and genotypes of these 30 patients are described. A total of 18 different CFTR mutations were observed in the 60 chromosomes analysed. F508del was present in 31.6 % of the mutated chromosomes and 3849+10kbC>T in 13.3 %. R117H, D1152H, L206W, 3272-26A>G, S1235R, G149R, R1070W, S945L, and the poly-T tract variation commonly called IVS8-5T were also observed. The relative frequency of CFTR mutations clearly differed from that observed in typical CF patients or in CBAVD patients with the same ethnic origin. A mild genotype with one or two mild or variable mutations was observed in all the patients. These findings improve our understanding of the distribution of CFTR alleles in CF with normal or borderline sweat chloride concentrations and will facilitate the development of more sensitive CFTR mutation screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 R117H, D1152H, L206W, 3272-26A>G, S1235R, G149R, R1070W, S945L, and the poly-T tract variation commonly called IVS8-5T were also observed. Login to comment
18 Other mutations that might be associated with intermediate (40-60 mmol/L) or normal sweat chloride values have been reported: R117H [Kerem et al., 1997; Massie et al., 2000], G551S [Strong et al., 1991], A455E [Gan et al., 1995], L206W [Desgeoges et al., 1995], D1152H [Feldmann et al., 1995; Lebecque et al., 2001]. Login to comment
44 Table 1 : Genotypes and Phenotypes of Patients with Normal or BordIerline Sweat Tests Patient Age at diagnosis (years) CFTR GENOTYPE* Allele 1 Allele 2 SWEAT CL- MEAN (MMOL/L) PHENOTYPE 1 0.2 F508del G149R 38 P+PI, neonatal hypertrypsinemia, 2 0.3 G551D R117H-7T 31 neonatal hypertrypsinemia 3 0.4 F508del R1070W 30.5 neonatal hypertrypsinemia 4 0.4 F508del R117H-7T 52 P 5 0.6 F508del 3849+10kbC>T 48 P 6 0.11 F508del S945L 58 P+PI 7 1 F508del 5T 40 P+CBAVD 8 2 F508del L206W 53 P 9 2 W1282X 5T 42.5 P 10 5 F508del 3849+10kbC>T 55.5 P 11 5 F508del L206W 55 P 12 5 G91R 5T 47.5 P 13 6 G551D S1235R+5T 49.5 P, neonatal hypertrypsinemia 14 7 F508del 3849+10kb 50 P, nasal popyposis 15 13 F508del R117H-7T 58 P, nasal polyposis 16 18 F508del 5T 60.5 P 17 20 G542X 3849+10kbC>T 52 P+PI 18 21 I507del 3849+10kbC>T 54 P, bronchiectasis 19 30 R347P 3849+10kbC>T 43 P, Pseudomonas colonisation 20 30 I507del L206W 57.5 CBAVD, chronic cough 21 31 F508del R117H-7T 60 CBAVD 22 32 G542X 3849+10kbC>T 30 P, Pseudomonas colonisation 23 34 F508del 3272-26A>G 64 P, CBAVD 24 37 R1070Q D1152H 56 CBAVD, bronchectasis 25 46 F508del D1152H 43 P 26 55 F508del D1152H 48 P, Pseudomonas colonisation 27 56 I507del S1235R 53 P 28 >18 F508del D1152H 60 P+PI 29 >20 F508del 3849+10kbC>T 18 P, bronchiectasis 30 >20 F508del 3272-26A>G 61 P *All mutations are named in accordance with the numbering used in the CFTR Mutation Database: http://www.genet.sickkids.on.ca/cftr/. Login to comment
52 Other common mutations observed in our study such as 3849+10kbC>T, R117H, D1152H, L206W were found at a low prevalence in typical CF patients (0.4 % to 0.2 %). Login to comment
82 Other common mutations observed in our study were R117H, IVS8(5T), D1152H, and L206W. Login to comment
97 The D1152H mutation has been observed in men with CBAVD [Claustres et al., 2000] but also in adults with mild pulmonary disease [Feldmann et al., 1995]. Login to comment
98 This mutation, combined with a second CFTR mutation, has also been observed by Lebecque et al. [2002] and Groman et al. [2002] associated with intermediate sweat tests and documented pulmonary symptoms in respectively two patients. We observed four adults with D1152H, the age of two of the patients (55 and 46 years) suggests an unusual course of the disease. Login to comment

[hide] Genetic disorders of the pancreas. Gastroenterol Clin North Am. 2003 Sep;32(3):763-87. Morinville V, Perrault J
Genetic disorders of the pancreas.
Gastroenterol Clin North Am. 2003 Sep;32(3):763-87., [PMID:14562574]

Abstract [show]
The venues opened to all by the remarkable studies of the genome are just starting to become manifest; they can now distinguish different variants of a disease; they are given the tools to better understand the pathophysiology of illness; they hope to be able to provide better treatment alternatives to our patients. The examples described in this review demonstrate the applicability of these concepts to pancreatic disorders. Researchers may be just scratching the surface at this time, but the potential is enormous. Many philosophic and ethical questions need to be answered as physicians move along: Should all family members of an index case be screened? Who should pay for testing? Who should get results? But, without the participation of so many patients, their family members, and numerous volunteers, researchers would not have witnessed the bridging of so many gaps as they have so far. All of us may now look forward to the application of this incredible knowledge to the therapeutic solutions so eagerly awaited.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 Mutations of CFTR include: deltaF508, R117H, D1152H, P574H, 3120 G > A, 621 + 1 G > T, G1069R, N1303K. Login to comment

[hide] Isolated idiopathic chronic pancreatitis associate... Gastroenterol Clin Biol. 2003 Aug-Sep;27(8-9):821-4. Reboul MP, Laharie D, Amouretti M, Lacombe D, Iron A
Isolated idiopathic chronic pancreatitis associated with a compound heterozygosity for two mutations of the CFTR gene.
Gastroenterol Clin Biol. 2003 Aug-Sep;27(8-9):821-4., [PMID:14586256]

Abstract [show]
We report the case of a patient suffering from idiopathic chronic pancreatitis (ICP) and compound heterozygous for mutations G542X and S1235R of the cystic fibrosis transmembrane regulator (CFTR) gene. The patient had normal sweat test and no other clinical sign usually linked with a typical or moderate pathology (bronchiectasis, nasal polyposis, congenital absence of the vas deferens) of the CFTR gene. G542X is a severe mutation, which is usually found in classical cystic fibrosis when associated with other severe mutations. S1235R is a quite rare abnormality recently reported as being potentially pathogenic when combined in trans with a second CF mutation. Our case is quite similar to the only other six patients in the literature in whom only the pancreas is affected and who bear a rare mutation with moderate effect. The history and the clinical features of our patient indicate an unambiguous isolated ICP in which the presence of the S1235R mutation--in trans with regard to G542X--is likely responsible for the ICP phenotype. This case could throw light on some of the as yet poorly known abnormalities of the CFTR gene in the ICP phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 In five patients (no 5, 9, 10, 11, 15) who bear a frequent mutation well known for its severity (F508del or G542X), the involvement of the ICP phenotype could lie in their "second" missense mutation, i.e. L997F in exon 17b (Patient no 5), I1027T in exon 17a (Patient no 9), D1152H in exon 18 (Patients no 10 and 11) and S1235R in exon 19 (Patient no 15); and the presence of 2 of these 4 missense mutations in patient no 7 could actually strengthen this hypothesis but to date little is known about the possible impact of his 5T allele on the phenotype (possible sterility). Login to comment
80 Patient CFTR no PolyT genotype Sex genotype Age (years) Sweat chloride (mmol/L) Anamnestic features known to be associated with atypical CF Reference 1 F508del/R117H 9T/7T M 45 29 CBAVD [4] 2 N1303K/R117H 9T/7T F n.a. 37 bronchiectasis, sinusitis, positive NPD [5] 3 R1162X/2789+5G>A 7T/7T F n.a. 108 chronic cough [5] 4 I336K/R75Q 7T/7T F 26 26 nasal polyposis [7] 5 F508del/L997F 9T/7T M 17 24 none [11] 6 3849+10kbC>T/3878delG 7T/7T M 14 n.a. none [11] 7 S1235R/L997F 5T/7T M 27 25 none [11] 8 F508del/R117H n.a. M 45 29 CBAVD, smooth P. aeruginosa [12] 9 F508del/I1027T n.a. F 32 59 none [12] 10 F508del/D1152H n.a. M 8 62 none [12] 11 F508del/D1152H n.a. F 15 32 none [12] 12 F508del/P574H n.a. F 26 81 sinus surgery, S. aureus, S. maltophilia [12] 13 F508del/3120G>A n.a. F 40 n.a. n.a. [12] 14 F508del/G1069R n.a. M 16 n.a. n.a. [12] 15 G542X/S1235R 7T/7T M 35 15 none [this study] n.a.: not available. Login to comment

[hide] Improvement in sensitivity of allele-specific PCR ... Clin Chem. 2004 Apr;50(4):694-701. Epub 2004 Feb 5. Nasis O, Thompson S, Hong T, Sherwood M, Radcliffe S, Jackson L, Otevrel T
Improvement in sensitivity of allele-specific PCR facilitates reliable noninvasive prenatal detection of cystic fibrosis.
Clin Chem. 2004 Apr;50(4):694-701. Epub 2004 Feb 5., [PMID:14764639]

Abstract [show]
BACKGROUND: Cell-free fetal DNA circulating in maternal blood has potential as a safer alternative to invasive methods of prenatal testing for paternally inherited genetic alterations, such as cystic fibrosis (CF) mutations. METHODS: We used allele-specific PCR to detect mutated CF D1152H DNA in the presence of an excess of the corresponding wild-type sequence. Pfx buffer (Invitrogen) containing replication accessory proteins and Taq polymerase with no proofreading activity was combined with TaqMaster PCR Enhancer (Eppendorf) to suppress nonspecific amplification of the wild-type allele. The procedure was tested on DNA isolated from plasma drawn from 11 pregnant women (gestational age, 11-19.2 weeks), with mutation confirmation by chorionic villus sampling. RESULTS: The method detected 5 copies of the CF D1152H mutant allele in the presence of up to approximately 100,000 copies of wild-type allele without interference from the wild-type sequence. The D1152H mutation was correctly identified in one positive sample; the only false-positive result was seen in a mishandled sample. CONCLUSIONS: This procedure allows for reliable detection of the paternally inherited D1152H mutation and has potential application for detection of other mutations, which may help reduce the need for invasive testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 CF mutation D1152H consists of a single nucleotide substitution (G to C) at nucleotide 3586, changing Asp to His at amino acid position 1152 (27). Login to comment
40 Patient 6 was carrying a fetus known to be heterozygous for the CF D1152H mutation (determined by a commercial laboratory by use of invasive prenatal diagnosis). Login to comment
41 This patient was a carrier for the CF ⌬F508 mutation, and the father of the fetus was a carrier for D1152H. Login to comment
42 To obtain DNA containing the D1152H mutation for use in the model experiment, we collected ϳ10 mL of blood from the father. Login to comment
52 Patient Maternal age, years Gestational age, weeks Time between collection and processing of blood, days Fetal D1152H mutation status DNA in PCR tubes,a ng 1 32 19.2 3 -/- 53.3 2 33 15.5 6 -/- 307.7 3 35 11.2 1 -/- 2.0 4 37 15.1 3 -/- 4.3 5 29 18 5 -/- 318.5 6 30 11 0 ϩ/- 0.3 B. Login to comment
61 dna used in the model pcr experiment Genomic DNA containing CF mutation D1152H was isolated from 800 ␮L of whole blood from a heterozygous male carrier (father of the fetus carried by patient 6) by use of the DNA Blood Mini Kit according to the manufacturer`s protocol. Login to comment
62 DNA samples with various ratios of mutant to wild-type alleles were prepared in the PCR reaction tubes by combining 30 pg of D1152H heterozygous carrier DNA with 3, 30, and 300 ng of wild-type female DNA obtained from Sigma. Login to comment
63 oligonucleotides The sequences of oligonucleotide primers 1152F (5Ј- GATAAGACTTACCAAGCTATCCACATG-3Ј) and 1152R (5Ј-GAGTTGGTATTATCCTGACTTTAGCCA-3Ј), used for amplification of DNA carrying the D1152H mutation, were designed with Primer Express 1.5 software (Applied Biosystems) and synthesized by Proligo. Login to comment
64 Forward primer 1152F is specific for the D1152H mutation and exhibits a perfect match to the mutated sequence. Login to comment
67 This oligonucleotide was used in the initial experiments and represents a destabilized D1152H mutation-specific primer. Login to comment
71 conventional pcr All ASPCR amplifications for detection of the D1152H mutation on the CFTR gene were performed on a GeneAmp PCR System 9700 thermal cycler (Applied Biosystems). Login to comment
95 However, because of frequent inconsistencies in PCR amplification when working with quantities of target lower than five copies-probably caused by an uneven distribution of intact DNA target molecules among the samples-we decided to include five copies of the mutated allele in all aliquots of D1152H-positive artificial specimens used in PCRs. Login to comment
96 These artificial specimens were used to develop the D1152H mutation detection assay. Login to comment
97 Considering that the diploid DNA content of one cell is 6.6 pg (28), five copies of the mutated allele should be present in ϳ30 pg of DNA isolated from a heterozygous D1152H carrier. Login to comment
99 Thus, to make model D1152H-positive samples that resemble conditions in maternal plasma- and to allow for biological variation and additionally to test the limits of our procedure-we prepared several PCR samples by mixing 30 pg of D1152H heterozygous carrier DNA (isolated from the father of the fetus carried by patient 6) with 3, 30, and 300 ng of wild-type female DNA (Sigma). Login to comment
101 However, our initial experiments, using mutation-specific primer 1152F, reverse primer 1152R, Accuprime Taq polymerase without 3Ј-exonuclease activity (Invitrogen), dNTPs and reaction buffer providing a final magnesium chloride concentration of 1.5 mM (Roche), failed to differentiate between the D1152H mutated and wild-type CF alleles (Fig. 1A). Login to comment
110 Attempts to differentiate between D1152H mutant and wild-type CF alleles with regular ASPCR conditions. Login to comment
112 The CF D1152H-specific bands (lanes 2-4) were produced in PCRs containing 30 pg of CF DNA with 0, 6, and 3 ng of female control DNA, respectively. Lanes 5 and 6 correspond to PCR tubes containing 6 and 3 ng of female DNA, respectively, without the presence of any mutated D1152H DNA and show amplification of the CF D1152H-specific bands. Login to comment
116 The CF D1152H-specific bands (lanes 2-4) were produced in PCRs containing 30 pg of CF DNA with 0, 6, and 3 ng of female control DNA, respectively. Login to comment
117 Lane 5 corresponds to the PCR tube with 6 ng of female DNA and shows amplification of the CF D1152H-specific bands. Login to comment
124 By contrast, the combination of a primer pair containing perfectly matched D1152 mutation-specific forward primer 1152F and reverse primer 1152R, Pfx PCR buffer from the Accuprime Pfx DNA Polymerase Kit (Invitrogen), Accuprime Taq polymerase (without proofreading activity; from the Accuprime Taq DNA Polymerase System), and TaqMaster PCR Enhancer (Eppendorf) allowed consistent detection of 5 copies of the CF D1152H mutant allele in the presence of up to ϳ100 000 copies of the wild-type allele without interference from the wild-type sequence. Login to comment
127 Approximately 5 copies of the D1152H mutated allele contained in 30 pg of D1152H heterozygous genomic DNA was amplified in the presence of 0-300 ng of wild-type female DNA (i.e., up to ϳ100 000 copies of the wild-type allele). Login to comment
128 No amplification was observed with 0-300 ng of female DNA in the absence of the D1152H mutated allele. Login to comment
129 analysis of dna samples isolated from maternal plasma Testing for the presence of the D1152H mutation. Login to comment
130 We studied DNA from the plasma of a woman known to be carrying a fetus with the CF D1152H mutant gene inherited from the father (Table 1A, patient 6) and five controls. Login to comment
131 The sample from patient 6 (Fig. 3A, lanes 2-4) showed amplification of the mutant D1152H allele in all three reactions. Login to comment
133 Samples from four of five control patients (Fig. 3, B and C) showed no amplification of the mutant D1152H allele, but patient 2 (Fig. 3C, lanes 5-7) showed a band in two of three amplifications. Login to comment
134 By contrast, the results from the CVS of patient 2 and a blood test performed on the father of the pregnancy were both negative for the D1152H mutation. Login to comment
145 PCR results obtained with experimental models containing CF D1152H heterozygous carrier DNA and wild-type female DNA. Login to comment
146 The CF D1152H-specific bands (lanes 2-5) were produced in PCRs containing 30 pg of CF DNA with 0, 300, 30, and 3 ng of female DNA, respectively. Lanes 6-9, which correspond to PCR tubes with 300, 30, 3, and 0 ng of female DNA, respectively, show no amplification product. Login to comment
149 Testing for D1152H mutation in DNA samples isolated from blood plasma of pregnant women. Login to comment
150 (A), CF D1152H mutation-specific band is present in all lanes containing samples from patient 6 (lanes 2-4). Login to comment
168 testing of an aspcr-based d1152h mutation assay on appropriately handled maternal blood samples obtained from d1152h-negative control pregnancies To demonstrate the reliability of the assay in terms of suppression of nonspecific amplification interference from the wild-type CFTR allele, we isolated new negative DNA control samples from appropriately processed maternal blood specimens corresponding to pregnancies with no D1152H mutation (Table 1B, patients 7-11). Login to comment
185 Testing for D1152H mutation in negative-control DNA samples isolated from appropriately processed blood plasma of pregnant women. Login to comment
186 (A), no CF D1152H mutation-specific bands are present in lanes containing samples from patients 7 (lanes 2-4), 8 (lanes 5-7), and 9 (lanes 8-10). Login to comment
188 The band in lane 9 represents the positive control: 30 pg of genomic DNA heterozygous for the D1152H mutation. Login to comment

[hide] Mutations of the CFTR gene in Turkish patients wit... Hum Reprod. 2004 May;19(5):1094-100. Epub 2004 Apr 7. Dayangac D, Erdem H, Yilmaz E, Sahin A, Sohn C, Ozguc M, Dork T
Mutations of the CFTR gene in Turkish patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2004 May;19(5):1094-100. Epub 2004 Apr 7., [PMID:15070876]

Abstract [show]
BACKGROUND: Mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) can cause congenital bilateral absence of the vas deferens (CBAVD) as a primarily genital form of cystic fibrosis. The spectrum and frequency of CFTR mutations in Turkish males with CBAVD is largely unknown. METHODS: We investigated 51 Turkish males who had been diagnosed with CBAVD at the Hacettepe University, Ankara, for the presence of CFTR gene mutations by direct sequencing of the coding region and exon/intron boundaries. RESULTS: We identified 27 different mutations on 72.5% of the investigated alleles. Two-thirds of the patients harboured CFTR gene mutations on both chromosomes. Two predominant mutations, IVS8-5T and D1152H, accounted for more than one-third of the alleles. Five mutations are described for the first time. With one exception, all identified patients harboured at least one mutation of the missense or splicing type. Presently available mutation panels would have uncovered only 7-12% of CFTR alleles in this population cohort. CONCLUSIONS: Although cystic fibrosis is relatively rare in Turkey, CFTR mutations are responsible for the majority of CBAVD in Turkish males. Because of a specific mutation profile, a population-specific panel should be recommended for targeted populations such as CBAVD in Turkey or elsewhere.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Two predominant mutations, IVS8-5T and D1152H, accounted for more than one-third of the alleles. Login to comment
35 We next screened for six further CFTR gene mutations of the coding region and ¯anking intron sequences by previously described restriction-enzyme based methods: G85E, D110H, R347H, 2789+5G®A, D1152H, N1303K (DoÈrk et al., 1994a, 1997). Login to comment
40 Finally, the 5'-UTR and minimum promoter region were Table I. CFTR gene mutations identi®ed in 51 CBAVD patients Mutation Location Nucleotide alteration Predicted effect Allele frequency (%) Reference IVS8-5T Intron 8 Deletion of 2T between 1342±12 and 1342±6 Aberrant splicing 20 (19.6)a Chu et al. 1993 D1152H Exon 18 G®C at 3586 Amino acid substitution 15 (14.7)a Highsmith et al. 1992* D110H Exon 4 G®C at 460 Amino acid substitution 3 (2.9) Dean et al. 1990 DF508 Exon 10 Deletion of 3 nt at 1652±1655 Amino acid deletion 3 (2.9) Kerem et al. 1989 2789+5G®A Intron 14b G®A at 2789+5 Aberrant splicing 3 (2.9) Highsmith et al. 1997 L997F Exon 17a G®C at 3123 Amino acid substitution 3 (2.9) Fanen et al. 1992b CFTRdele2 (ins186) Introns 1±2 Deletion of 8.1 kb and insertion of 186 bp In-frame-deletion 2 (2.0) DoÈrk et al. 2000b R347H Exon 7 G®A at 1172 Amino acid substitution 2 (2.0) Cremonesi et al. 1992 E831X Exon 14a G®T at 2623 Truncation 2 (2.0) Ferec et al. 1992* 1767del6 Exon 11 Deletion of 6 nt at 1767±1773 In-frame-deletion 2 (2.0) (a) This study 3041-15T®G Intron 15 T®G at 3041±15 Aberrant splicing? Login to comment
47 *The following mutations were previously reported as personal communications to the CF Genetic Analysis Consortium (http://www.genet.sickkids.on.ca): 359insT by Claustres M, Desgeorges M, Romey M-C; R334Q by FeÂrec C, Quere I, Verlingue C, Raguenes O, AudreÂzet M-P, Mercier B; T388M by Zielenski J, Markiewicz D, Tsui L-C, Rawashdeh M, Khateeb M; E831X by FeÂrec C, Quere I, Audrezet MP, Verlingue C, Guillermit H, Mercier B; M952I by Girodon E, Costes B, Cazeneuve C, Ghanem N, Goossens M; R1070W by Macek M Jr, Sedriks S, Kiesewetter S, Cutting GR; D1152H by Highsmith WE Jr, Burch L, Friedman KJ, Wood BM, Spock A, Silverman LM, Knowles MR. Login to comment
51 Secondly, the D1152H mutation in exon 18 was uncovered on 15 chromosomes, thereby revealing an unexpected high frequency of this missense substitution in Turkish CBAVD patients. Login to comment
52 Screening for the IVS8-5T and D1152H mutations together led to the identi®cation of more than one-third of alleles. Login to comment
53 The D1152H mutation was found in the homozygous state in ®ve patients and the IVS8-5T allele was found homozygous in four patients (Table II). Login to comment
72 CFTR genotypes in 51 patients with congenital bilateral absence of the vas deferens Mutation genotypes IVS8-(TG)mTn M470V n (%) Two mutations detected: D1152H/D1152H (TG)11 7T/ (TG)11 7T V/V 5 (9.8) IVS8-5T/IVS8-5T (TG)13 5T/ (TG)13 5T M/M 2 (3.9) (TG)12 5T/ (TG)13 5T M/V 1 (1.9) (TG)12 5T/ (TG)12 5T V/V 1 (1.9) IVS8-5T/D1152H (TG)12 5T/ (TG)11 7T V/V 2 (3.9) IVS8-5T/DF508 (TG)12 5T/ (TG)10 9T M/V 2 (3.9) IVS8-5T/2789+5G®A (TG)12 5T/ (TG)10 7T M/V 2 (3.9) IVS8-5T/365insT (TG)13 5T/ (TG)11 7T M/V 1 (1.9) IVS8-5T/D110H (TG)12 5T/ (TG)11 7T M/V 1 (1.9) IVS8-5T/E585X (TG)12 5T/ (TG)10 7T M/V 1 (1.9) IVS8-5T/2752-15C®G (TG)12 5T/ (TG)11 7T V/V 1 (1.9) IVS8-5T/M952I (TG)12 5T/ (TG)10 7T M/V 1 (1.9) IVS8-5T/3120+1G®A (TG)12 5T/ (TG)11 7T V/V 1 (1.9) D1152H/A349V (TG)10 7T/ (TG)11 7T M/V 1 (1.9) D1152H/2789+5G®A (TG)10 7T/ (TG)11 7T M/V 1 (1.9) D1152H/G1130A (TG)10 7T/ (TG)11 7T M/V 1 (1.9) CFTRdele2(ins186)/ IVS8-6T (TG)13 6T/ (TG)11 7T M/V 1 (1.9) CFTRdele2(ins186)/D110H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) E831X/D110H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) E831X/1677delTA (TG)11 7T/ (TG)11 7T V/V 1 (1.9) R334Q/R347H (TG)11 7T/ (TG)11 7T V/V 1 (1.9) 1767del6/1767del6 (TG)11 7T/ (TG)11 7T V/V 1 (1.9) 3041-15T®G/3041-15T®G (TG)12 7T/ (TG)12 7T M/M 1 (1.9) 3041-13del7/3041-13del7 (TG)10 7T/ (TG)10 7T M/M 1 (1.9) R1070W/3272-26A®G (TG)10 7T/ (TG)11 7T M/V 1 (1.9) I853F/L997F (TG)11 7T/ (TG)10 9T V/V 1 (1.9) One mutation detected: L997F/? Login to comment
93 The results of this study re¯ect the high allelic heterogeneity of CFTR gene mutations, although two mutations, IVS8-5T and D1152H, were found to be very common in Turkish CBAVD patients. Login to comment
97 Secondly, the D1152H missense substi- Figure 1. Login to comment
112 In vitro studies have shown that the D1152H substitution does not interfere with the maturation of the CFTR protein but strongly reduces its cAMP-activated chloride conductance (Vankeerberghen et al., 1998) which may provide the basis for a mild expression of disease. Login to comment
113 Our results implicate D1152H as a common missense mutation in Turkey which appears to be speci®cally associated with CBAVD, perhaps comparable to the role of the R117H missense substitution in Central Europe (Gervais et al., 1993; DoÈrk et al., 1997). Login to comment
114 All D1152H alleles appeared to be linked with the same haplotype comprising the IVS8-7T(TG)11 and Val470 alleles (Table II). Login to comment
115 Screening for the IVS8-5T and D1152H mutations together led to the identi®- cation of more than one-third of alleles in Turkish CBAVD males. Login to comment
141 In this regard, a population-speci®c mutation panel including the D1152H mutation and the IVS8-5T allele should be highly recommended for Turkish CBAVD patients. Login to comment

[hide] Population-based newborn screening for genetic dis... Pediatrics. 2004 Jun;113(6):1573-81. Comeau AM, Parad RB, Dorkin HL, Dovey M, Gerstle R, Haver K, Lapey A, O'Sullivan BP, Waltz DA, Zwerdling RG, Eaton RB
Population-based newborn screening for genetic disorders when multiple mutation DNA testing is incorporated: a cystic fibrosis newborn screening model demonstrating increased sensitivity but more carrier detections.
Pediatrics. 2004 Jun;113(6):1573-81., [PMID:15173476]

Abstract [show]
OBJECTIVES: Newborn screening for cystic fibrosis (CF) provides a model to investigate the implications of applying multiple-mutation DNA testing in screening for any disorder in a pediatric population-based setting, where detection of affected infants is desired and identification of unaffected carriers is not. Widely applied 2-tiered CF newborn screening strategies first test for elevated immunoreactive trypsinogen (IRT) with subsequent analysis for a single CFTR mutation (DeltaF508), systematically missing CF-affected infants with any of the >1000 less common or population-specific mutations. Comparison of CF newborn screening algorithms that incorporate single- and multiple-mutation testing may offer insights into strategies that maximize the public health value of screening for CF and other genetic disorders. The objective of this study was to evaluate technical feasibility and practical implications of 2-tiered CF newborn screening that uses testing for multiple mutations (multiple-CFTR-mutation testing). METHODS: We implemented statewide CF newborn screening using a 2-tiered algorithm: all specimens were assayed for IRT; those with elevated IRT then had multiple-CFTR-mutation testing. Infants who screened positive by detection of 1 or 2 mutations or extremely elevated IRT (>99.8%; failsafe protocol) were then referred for definitive diagnosis by sweat testing. We compared the number of sweat-test referrals using single- with multiple-CFTR-mutation testing. Initial physician assessments and diagnostic outcomes of these screened-positive infants and any affected infants missed by the screen were analyzed. We evaluated compliance with our screening and follow-up protocols. All Massachusetts delivery units, the Newborn Screening Program, pediatric health care providers who evaluate and refer screened-positive infants, and the 5 Massachusetts CF Centers and their affiliated genetic services participated. A 4-year cohort of 323 506 infants who were born in Massachusetts between February 1, 1999, and February 1, 2003, and screened for CF at approximately 2 days of age was studied. RESULTS: A total of 110 of 112 CF-affected infants screened (negative predictive value: 99.99%) were detected with IRT/multiple-CFTR-mutation screening; 2 false-negative screens did not show elevated IRT. A total of 107 (97%) of the 110 had 1 or 2 mutations detected by the multiple- CFTR-mutation screen, and 3 had positive screens on the basis of the failsafe protocol. In contrast, had we used single-mutation testing, only 96 (87%) of the 110 would have had 1 or 2 mutations detectable by single-mutation screen, 8 would have had positive screens on the basis of the failsafe protocol, and an additional 6 infants would have had false-negative screens. Among 110 CF-affected screened-positive infants, a likely "genetic diagnosis" was made by the multiple-CFTR-mutation screen in 82 (75%) versus 55 (50%) with DeltaF508 alone. Increased sensitivity from multiple-CFTR-mutation testing yielded 274 (26%) more referrals for sweat testing and carrier identifications than testing with DeltaF508 alone. CONCLUSIONS: Use of multiple-CFTR-mutation testing improved sensitivity and postscreening prediction of CF at the cost of increased referrals and carrier identification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
154 ‡ ⌬F508/D1152H, ⌬F508/R117H (2), G85E/R117H, and G551D/R117H. Login to comment
170 § Presumed second CFTR mutation: R1066C, 1898GϾA (2), D1152H, L206W, Y1092X, and "not present in additional mutation analysis and yet to be identified" (13). Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. Login to comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment
63 The most prevalent mutations were as follows: ⌬F508, D1152H, R117H, G542X, L206W, I148T (3199del6 status unknown), ⌬I507, R1066C, R553X, 3849ϩ10kbCϾT, and R334W representing 83.72% of the total identified. Login to comment
71 In the carrier screening group, 4 mutations, D1152H, R117H, ⌬I507, and L206W, had frequencies of 3.8% 1 CFTR mutation distribution among Hispanic CF patients and carrier screening referrals CFTR Mutation Identified CF Patients Carrier Screening Referrals # of CF Chromosomes % Detection # of Carrier Screen Referrals % of Positive Carriers ⌬F508a 118 37.11c 136 47.39 G542Xa 11 3.46 12 4.18 R334Wa 11 3.46 6 2.09 3120 ϩ 1G Ͼ Aa 7 2.20 5 1.74 3876delAb 7 2.20 4 1.39 W1089Xb 7 2.20 R1066Cb 6 1.89 9 3.14 3849 ϩ 10kbC Ͼ Ta 3 0.94 6 2.09 R1162Xa 2 0.63 5 1.74 G85Ea 2 0.63 3 1.05 S549Nb 2 0.63 2 0.70 711 ϩ 1G Ͼ Ta 2 0.63 1 0.35 2789 ϩ 5G Ͼ Aa 2 0.63 1 0.35 1949del84b 2 0.63 1 0.35 R117Ha 1 0.31 14 4.88 ⌬I507a 1 0.31 11 3.83 R553Xa 1 0.31 7 2.44 ⌬F311b 1 0.31 1 0.35 1078delTa 1 0.31 1 0.35 621 ϩ 1G Ͼ Ta 1 0.31 1 0.35 3659delCa 1 0.31 1 0.35 Q890Xb 1 0.31 1 0.35 G551Da 1 0.31 1812 - 1G Ͼ Ab 1 0.31 I148T ϩ 3199del6a 1 0.31 A559Tb 1 0.31 1717 - 1G Ͼ Aa 1 0.31 3905insTb 1 0.31 3821delTb 1 0.31 G178Rb 1 0.31 D1152Hb 18 6.27 L206Wb 11 3.83 I148T (3199del6 status unknown)a 10 3.48 N1303Ka 4 1.39 W1282Xa 4 1.39 R117Cb 4 1.39 R352Qb 2 0.70 712 - 1G Ͼ Tb 2 0.70 Y1092Xb 1 0.35 444delAb 1 0.35 S549Rb 1 0.35 1609delCAb 1 0.35 Negative for mutations analyzed 120 37.74 15046 Total 318 62.20d 15333 100.00 a Mutation included in the ACMG/ACOG Recommended Core Mutation Panel for general population CF carrier screening.4,5 b Mutation not included in the ACMG/ACOG Recommended Core Mutation Panel for general population CF carrier screening. Login to comment
91 These include mutations known to be associated with variable phenotypic expression such as R117H,21,22 D1152H,23-25 and 3849ϩ10kbCϾT.27,28 Assuming Ϸ74% detection for the mutations analyzed and an observed carrier frequency of 1/95, an adjustment to 100% detection would result in a carrier frequency of 1/76, which is not significantly different than the expected 1/613 based on the disease incidence (P ϭ 0.1779). Login to comment
112 In both the Hispanic and African American populations, mutations associated with a variable clinical phenotype such as R117H, D1152H, and L206W were more common in the carrier screening population than the affected population. Login to comment

[hide] Premarital and prenatal screening for cystic fibro... Genet Med. 2004 Sep-Oct;6(5):415-20. Kornreich R, Ekstein J, Edelmann L, Desnick RJ
Premarital and prenatal screening for cystic fibrosis: experience in the Ashkenazi Jewish population.
Genet Med. 2004 Sep-Oct;6(5):415-20., [PMID:15371906]

Abstract [show]
PURPOSE: Since the early 1990s, Dor Yeshorim (DY) and the Mount Sinai School of Medicine (MSSM) have conducted premarital and prenatal carrier screening for cystic fibrosis (CF) in the Ashkenazi Jewish (AJ) population as part of their genetic testing programs, respectively. Together, over 170,000 screenees have been tested. In this study, we report the CF mutation frequencies in over 110,000 screenees who reportedly were of 100% AJ descent from the DY program and MSSM. In addition, the CF mutation frequencies in a group of > 7,000 screenees for AJ diseases who were of < 100% AJ descent are reported. METHODS: Testing for CF mutations was performed by either PCR and restriction digestion or ASO hybridization analyses at MSSM or sent to various academic and commercial laboratories by DY. RESULTS: The overall (and individual) carrier frequency for the five common AJ mutations, W1282X (0.020), DeltaF508 (0.012), G542X (0.0024), 3849+10kb C>T (0.0020), and N1303K (0.0016), among screenees who were 100% AJ was 1 in 26; when D1152H and the rare 1717-1G>A were included, the overall carrier frequency increased to approximately 1 in 23. In four families with D1152H, five compound heterozygotes for D1152H and W1282X (n = 2), DeltaF508 (1) or 3849+10kb C>T (1) were identified. In contrast, the carrier frequency for screenees reporting < 100% AJ descent was approximately 1 in 30 for the seven mutations. CONCLUSIONS: The carrier frequency for five common CF mutations in a large 100% AJ sample increased from 1 in 26 to 1 in 23 when D1152H was included in the panel. Addition of D1152H to mutation panels when screening the AJ population should be considered because compound heterozygosity is associated with a variable disease phenotype. Further studies to delineate the phenotype of CF patients with this mutation are needed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
19 DOI: 10.1097/01.GIM.0000139510.00644.F7 September/October 2004 ⅐ Vol. 6 ⅐ No. 5 a r t i c l e Genetics IN Medicine Jewish community, began premarital screening in 1983 for Tay-Sachs.14 CF was added to their premarital testing panel in 1993.15 The Genetic Testing Laboratory at MSSM has been conducting prenatal CF carrier screening since 1992 and has performed over 60,000 CF tests.16 Both programs initially screened for five, reported common AJ mutations (W1282X, ⌬F508, G542X, 3849ϩ10kb CϾT, N1303K).11 In 2000, DY observed the presence of the D1152H CF mutation in the AJ population and, therefore, added this mutation along with 1717-1 GϾA to its routine AJ screening panel. Login to comment
22 In 2001, MSSM began screening the AJ population for the remaining 25 ACMG recommended panethnic mutations along with D1152H. Login to comment
29 The second subset was tested for the 25 ACMG recommended CFTR panethnic mutation panel and D1152H. Login to comment
33 Subsequently, the DY panel was increased to seven with the addition of D1152H and 1717-1GϾA. Login to comment
37 From January 2001, the panel was expanded to 26 mutations (the ACMG recommended panethnic panel plus D1152H). Login to comment
43 Of note, the third most common mutation, D1152H, was detected in about 1 in 190 of the 44,530 screenees tested (0.0053). Login to comment
48 For D1152H and 1717-1GϾA, 235 and 9 carriers were detected among 44,530 and 60,191 screenees, respectively. Login to comment
56 Five individuals from four families in the DY program were found to be compound heterozygotes for D1152H and W1282X (2 families), ⌬F508 (1), or 3849ϩ10kb CϾT (1). Login to comment
57 Two individuals with the D1152H/W1282X genotype had digestive problems and growth retardation without significant pulmonary problems. Login to comment
61 If D1152H was not included, the carrier rate was 1 in 29.8. Login to comment
68 Of the remaining 31 prenatal diagnoses, 24 fetuses were heterozygotes and Table 1 Carrier frequencies of seven routinely tested AJ CF mutations CF mutation No. individuals tested Frequency Combined frequency Previous studies DY MSSM DY MSSM Ref 3 n ϭ 6076 Ref 15 n ϭ 6850 W1282X 110889 6247 1 in 49.7 (0.0201) 1 in 48.8 (0.0205) 1 in 49.6 (0.0202) 1 in 48.2 (0.0207) 1 in 48.2 (0.0207) ⌬F508 110898 6247 1 in 81.7 (0.0122) 1 in 86.8 (0.0115) 1 in 82.0 (0.0122) 1 in 79.7 (0.0126) 1 in 77.9 (0.0128) D1152H 42208 2322 1 in 189.2 (0.00528) 1 in 193.5 (0.00517) 1 in 189.5 (0.00528) 1 in 113.5a (0.00881) NDb G542X 110893 6247 1 in 410.7 (0.00243) 1 in 446.2 (0.00224) 1 in 412.5 (0.00242) 1 in 338.3 (0.00296) 1 in 506.3 (0.00197) 3849ϩ10kb CϾT 110888 6247 1 in 490.7 (0.00204) 1 in 480.5 (0.00208) 1 in 490.1 (0.00204) 1 in 402.9 (0.00248) 1 in 607.6 (0.00165) N1303K 110894 6247 1 in 637.2 (0.00157) 1 in 567.9 (0.00176) 1 in 633.2 (0.00158) 1 in 913.3 (0.00109) 1 in 552.4 (0.00181) 1717-1 GϾA 57869 2322 1 in 7233.6 (0.000138) 1 in 2322 (0.000431) 1 in 6687.9 (0.000150) NDb NDb Five mutations (Without D1152H and 1717-1 GϾA) 1 in 26.1 (0.0384) 1 in 26.2 (0.0381) 1 in 26.1 (0.0384) 1 in 25.1 (0.0398) 1 in 25.7 (0.0389) Seven mutations 1 in 22.8 (0.0438) 1 in 22.9 (0.0437) 1 in 22.8 (0.0438) a n ϭ 1305. b Not determined. Login to comment
69 Table 2 Distribution of CF mutations in DY and MSSM carriers for five and seven common AJ mutations CF mutation % of AJ carriers (5 mutations) % of AJ carriers (7 mutations) DY MSSM Combined DY MSSM Combined W1282X 52.3 53.8 53.1 45.9 46.9 46.4 ⌬F508 31.9 30.2 31.0 27.9 26.3 27.1 G542X 6.3 5.9 6.1 5.5 5.1 5.3 3849ϩ10kb CϾT 5.3 5.5 5.4 4.7 4.8 4.8 N1303K 4.1 4.6 4.4 3.6 4.0 3.8 D1152H - - - 12.1 11.8 12.0 1717-1GϾA - - - 0.3 1.0 0.6 seven did not carry either parental mutation. Login to comment
86 For example, W1282X was the most prevalent mutation among Ashkenazi Jews, present in 46.4% of AJ carriers, whereas it was present in only 1.5% of non-Hispanic Caucasian CF patients.8 ⌬F508, the most common mutation in non-Hispanic Caucasian CF pa- Table 3 Frequency of CFTR mutations among screenees reporting 100% AJ or Ͻ 100% AJ descent who requested carrier testing for CF and at least one other AJ recessive disease CF mutation % of mutations in carriers reporting 100% AJ descent (n ϭ 45,530-117,145) % of mutations among carriers reporting Ͻ100% AJ descent (n ϭ 7,393) % of Non-Hispanic Caucasian CF patient chromosomes8 (n ϭ 37,263) W1282X 46.4 (n ϭ 117,136) 32.3 1.5 ⌬F508 27.1 (n ϭ 117,145) 35.7 71.5 D1152H 12.0 (n ϭ 44,530) 8.7 0.03 G542X 5.3 (n ϭ 117,140) 6.1 2.3 3849ϩ10kb CϾT 4.8 (n ϭ 117,135) 4.9 0.7 N1303K 3.8 (n ϭ 117,141) 3.0 1.3 1717-1GϾA 0.6 (n ϭ 60,191) 1.9 0.7 R117H a 2.7 0.8 I148T a 2.3 0.05 R334W - 0.76 0.16 A455E - 0.76 0.19 G551D a 0.38 2.5 R553X - 0.38 1.0 a These mutations were detected when screening Ϸ2,300 100% AJ individuals with the ACMG recommended panel. Login to comment
89 The D1152H and 1717-1GϾA mutations were added to the DY screening panel in 2000 and MSSM added the remaining mutations in the ACMG panel of 25 panethnic mutations along with D1152H in 2001. Login to comment
90 D1152H has a carrier frequency of 1 in 190 (or 0.0053) in the AJ population, where it represents 12% of the CF carrier alleles. Login to comment
91 Functional studies indicated that D1152H, located in the intracytoplasmic loop connecting transmembrane domain 12 and nucleotide binding domain 2, did not alter the maturation of the CFTR protein, but interfered with proper gating of the chloride channel.21 Mutation 1717-1GϾA was included in the ACMG recommended CF panethnic mutation panel (0.7% of CF chromosomes)8 so it was routinely tested as part of the MSSM program as well as most of the academic and commercial laboratories who now test the DY screenees. Login to comment
93 Of note, this mutation was not detected when over 7000 Israeli Jews were screened.3 When D1152H and 1717-1 GϾA were included, the overall AJ carrier frequency increased to 1 in 23. Login to comment
97 However, the two individuals identified at MSSM were found to be negative for the 3199del6 mutation that presumably is the disease-causing mutation in cis with the I148T variant.18-20 Of the five individuals identified by DY who were compound heterozygotes for D1152H and W1282X, ⌬F508 or 3849ϩ10kb CϾT, anecdotal information from the two individuals from one family with the D1152H/W1282X genotype indicated a mild form of CF. Login to comment
99 However, previous reports indicate that the D1152H mutation together with a classic CF mutation results in variant CF phenotypes, including an adult (D1152H/ ⌬F508) with mild pulmonary disease.22 The D1152H/⌬F508 genotype also has been reported in four adults with mild pulmonary symptoms, two with Pseudomonas colonization, and another with pancreatic insufficiency.23,24 This mutation has also been observed in males with CBAVD.25,26 However, this mutation was present along with G542X in a fetus with hyperechogenic bowel loops and meconium ileus, suggesting a more severe course would occur in this case.27 In contrast to the limited number of CFTR mutations that were detected in screenees who reported themselves to be 100% AJ, the distribution of CFTR mutations in the over 7,000 MSSM screenees who were of Ͻ 100% AJ descent differed significantly. Login to comment
104 Based on the results of these studies, it is recommended that premarital/prenatal carrier screening for CF be performed by testing the five common AJ CFTR mutations (W1282X, DF508, G542X, 3849ϩ10kb CϾT, N1303K), along with D1152H, for individuals who report that they are 100% AJ. Login to comment
105 Genetic counseling for at risk couples carrying D1152H and a classic CF mutation should include the latest clinical information about CF patients with the D1152H lesion for informed decision-making. Login to comment
109 Therefore, in the later situations, it is recommended that the revised ACMG screening panel of 23 mutations and D1152H (with proper counseling) be used for CF carrier screening. Login to comment

[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]

Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment

[hide] Cystic fibrosis carrier screening: validation of a... Genet Med. 2004 Sep-Oct;6(5):431-8. Edelmann L, Hashmi G, Song Y, Han Y, Kornreich R, Desnick RJ
Cystic fibrosis carrier screening: validation of a novel method using BeadChip technology.
Genet Med. 2004 Sep-Oct;6(5):431-8., [PMID:15371909]

Abstract [show]
PURPOSE: To validate a novel BeadChip assay system for cystic fibrosis (CF) mutation testing using the panel of 25 ACMG recommended mutations and D1152H. METHODS: DNA from 519 individuals originally tested for CF mutation status by allele specific oligonucleotide hybridization (ASOH) were blindly analyzed by the BeadChip assay and the results were compared. The elongation mediated multiplexed analysis of polymorphisms (eMAP) protocol, which combines multiplex amplification of genomic DNA and multiplex detection of mutations on color-coded bead arrays, was used to analyze 26 CF mutations in two separate groups. RESULTS: The system accurately distinguished the 26 CF genotypes and had 100% concordance with the ASOH technique with an assay failure rate of 1.7%. Benign variants of exon 10 codons 506, 507, and 508 did not interfere with mutation identification and reflex testing for the 5/7/9T IVS8 polymorphism was performed on a separate array. CONCLUSIONS: The BeadChip assay system provided accurate and rapid identification of the ACMG recommended CF mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Mutation controls included DNA from previously identified positive patient samples (I148T, D1152H, W1282X, R117H, G85E, A455E, delF508, N1303K) and DNA from NIGMS Human Genetic Cell Repositories (Coriell Cell Repositories) (delF508, delI507, G542X, R560T, 3849ϩ10kbCϾT, N1303K, G85E; G551D, R553X, 621ϩ1GϾT, 1717-1GϾA, A455E, R334W, R347P, R1162X, 3659delC; 711ϩ1GϾT, 2789ϩ5GϾA, 3120ϩ1GϾA). Login to comment
40 Allele-specific oligonucleotide hybridization Multiplex PCR analysis was performed in two reactions with seven amplimers in Group I and nine amplimers in Group II for the analysis of the ACMG panel of 25 mutations plus D1152H. Login to comment
46 Mutant ASOs were end-labeled with ␥-32 P-ATP and pooled into three subgroups (IA-IC) for Group I and four subgroups (IIA-IID) for Group II mutations with the following breakdown of mutations: IA: delF508, delI507, W1282X, R117H; IB: G542X, R560T, 3849ϩ10kbCϾT, N1303K, G85E; IC: G551D, R553X, 621ϩ1GϾT, 1717-1GϾA, I148T; IIA: A455E, R334W, D1152H; IIB: R347P, 1078delT, R1162X, 3659delC; IIC: 711ϩ1GϾT, 1898ϩ1GϾA, 2789ϩ5GϾA, 3120ϩ1GϾA; IID: 2184delA. Login to comment
87 RESULTS Validation strategy The BeadChip assay system and eMAP protocol were validated using a panel of 26 CF mutations currently screened for in our laboratory including the ACMG 25 recommended mu- tations plus D1152H, a mutation that is prevalent in the AJ population.15,16 To assess the overall performance and feasibility of this technology for use in the genetic testing laboratory, we blindly assayed 507 patient samples, 12 proficiency samples, and 145 control samples with the CF-26 BeadChip assay system and eMAP protocol, after reporting the testing results obtained by ASOH. Login to comment
160 I II III IV V VI VII VIII Totals Samples tested 87 57 69 72 66 35 72 61 519 Controls testedk 0h 17h 20 29 22 16 20 21 145 PCR Failuresi 4 4 2 1 1 2 1 3 18 (3.5%) Assay Failuresi 2 0 1 0 2 2 1 1 9 (1.7%) Positives 4a 3b 0 3c 4d 2e 2f 1g 19 (3.7%) a W1282X, delF508, D1152H, W1282X b delF508, delF508, D1152H c delF508, R117H, R117H d G542X, delF508, D1152H, N1303K (does not include proficiency samplesj ) e W1282X, delF508 f I148T, 3849ϩ10kbCϾT g I148T h Runs I and II were amplified with the same master mix and used the same control samples. Login to comment
167 Flexibility and limitations The CF-26 panel was developed at Bioarray Solutions, Ltd. specifically for custom use in our laboratory to mimic our current CF panel, which contains the 25 ABMG recommended CF mutations and the D1152H AJ mutation. Login to comment

[hide] Nasal airway ion transport is linked to the cystic... Thorax. 2004 Nov;59(11):971-6. Fajac I, Hubert D, Guillemot D, Honore I, Bienvenu T, Volter F, Dall'Ava-Santucci J, Dusser DJ
Nasal airway ion transport is linked to the cystic fibrosis phenotype in adult patients.
Thorax. 2004 Nov;59(11):971-6., [PMID:15516474]

Abstract [show]
BACKGROUND: This study was conducted to determine whether the major nasal airway ion transport abnormalities in cystic fibrosis (that is, defective cAMP regulated chloride secretion and basal sodium hyperabsorption) are related to the clinical expression of cystic fibrosis and/or to the genotype. METHODS: Nasal potential difference was measured in 79 adult patients with cystic fibrosis for whom clinical status, respiratory function, and CFTR genotype were determined. RESULTS: In univariate and multivariate analysis, patients with pancreatic insufficiency were more likely to have low responses to low chloride (odds ratio (OR) 8.6 (95% CI 1.3 to 58.5), p = 0.03) and isoproterenol (OR 11.2 (95% CI 1.3 to 93.9), p = 0.03) solutions. Similarly, in univariate and multivariate analysis, patients with poor respiratory function (forced expiratory volume in 1 second <50% of predicted value) were more likely to have an enhanced response to amiloride solution (OR 3.7 (95% CI 1.3 to 11.0), p = 0.02). However, there was no significant relationship between nasal potential difference and the severity of the genotype. CONCLUSIONS: Nasal epithelial ion transport in cystic fibrosis is linked to the clinical expression of the disease. The pancreatic status appears to be mostly related to the defect in epithelial chloride secretion whereas the respiratory status is mostly related to abnormal sodium transport and the regulatory function of the CFTR protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
219 RESULTS Patients Four of the 79 CF patients included in the study had a normal sweat test; three were compound heterozygous for the F508D mutation and the R117H, D1152H and R347H mutations, respectively, and one patient was compound heterozygous for the G542X and 3849+10 kb (C)R (T) mutations. Login to comment

[hide] The role of cystic fibrosis gene mutations in dete... Gastroenterol Clin North Am. 2004 Dec;33(4):817-37, vii. Cohn JA, Mitchell RM, Jowell PS
The role of cystic fibrosis gene mutations in determining susceptibility to chronic pancreatitis.
Gastroenterol Clin North Am. 2004 Dec;33(4):817-37, vii., [PMID:15528020]

Abstract [show]
This article reviews current concepts regarding the pathobiology of cystic fibrosis pancreatic disease. It summarizes recent studies on the relationship between CFTR mutations and pancreatitis, and it reviews several unresolved issues in the field.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 When these six nominal CF carriers were tested further by DNA sequencing, rare mutations were identified in five cases (D1152H, P574H, G1069R, 3120G > A; each detected rare mutation is mild-variable [18,30,48,49]. Login to comment
78 The European data Table 1 Abnormal CFTR and PSTI genotypes detected in two studies of idiopathic chronic pancreatitis* CFTR genotype category N Genotypes detected in individual subjects US study (Noone et al [47]) CFsev / CFm-v compound heterozygotes 8 DF508 / R117H-7T**; DF508 / 5T; DF508 / 5T; DF508 / D1152H; DF508 / D1152H; DF508 / P574H; DF508 / 3120G>A; 621þ1G>T/G1069R CFm-v / CFm-v compound heterozygotes 1 5T / 5T** CFsev / - (CF carriers) 1 N1303K / - CFm-v / - 7 R117H-7T / -; 5T / -**; 5T / -; 5T / -; 5T / -; 5T / -; 5T / - Normal (- / -) CFTR genotype 22 1 was homozygous for the N34S PSTI mutation; 5 were N34S carriers European study (Audrezet et al [50]) CFsev / CFm-v compound heterozygotes 4 DF508/R352Q; DF508/P5L; DF508/Q1476X; W1282X/5T*** CFm-v / CFm-v compound heterozygotes 2 V562I/5T; E217G/A1136T CFsev / - (CF carriers)**** 3 DF508 / -; DF508 / -; G542X / - CFm-v / - 9 L967S/-**; IVS18-20T>C/-**; c.4575þ2G>A/-; IVS3-6T>C; 5T/-; 5T/-; 5T/-; 5T/-; 5T/- Normal (- / -) CFTR genotype 17 1 was homozygous for the N34S PSTI mutation; 1 was a N34S carrier * CFTR mutations were classified as causing either severe (CFsev ) or mild-variable loss-of-function (CFm-v ) [18,47]; all detected CFsev mutations are CF-causing mutations according to current consensus criteria [79]. Login to comment

[hide] A large-scale study of the random variability of a... Eur J Hum Genet. 2005 Feb;13(2):184-92. Modiano G, Bombieri C, Ciminelli BM, Belpinati F, Giorgi S, Georges M, Scotet V, Pompei F, Ciccacci C, Guittard C, Audrezet MP, Begnini A, Toepfer M, Macek M, Ferec C, Claustres M, Pignatti PF
A large-scale study of the random variability of a coding sequence: a study on the CFTR gene.
Eur J Hum Genet. 2005 Feb;13(2):184-92., [PMID:15536480]

Abstract [show]
Coding single nucleotide substitutions (cSNSs) have been studied on hundreds of genes using small samples (n(g) approximately 100-150 genes). In the present investigation, a large random European population sample (average n(g) approximately 1500) was studied for a single gene, the CFTR (Cystic Fibrosis Transmembrane conductance Regulator). The nonsynonymous (NS) substitutions exhibited, in accordance with previous reports, a mean probability of being polymorphic (q > 0.005), much lower than that of the synonymous (S) substitutions, but they showed a similar rate of subpolymorphic (q < 0.005) variability. This indicates that, in autosomal genes that may have harmful recessive alleles (nonduplicated genes with important functions), genetic drift overwhelms selection in the subpolymorphic range of variability, making disadvantageous alleles behave as neutral. These results imply that the majority of the subpolymorphic nonsynonymous alleles of these genes are selectively negative or even pathogenic.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 In the Tajima`s test,19 the null hypothesis of neutrality is rejected if a statistically significant difference between p Common and rare nonsynonymous and synonymous cSNSs G Modiano et al European Journal of Human Genetics Table 1 List of the 61 cSNSsa encountered in the present survey The random samples of genes (and the technique utilized) cSNS variants found NE Italy (DGGE) Central Italy (DGGE) Southern France (DGGE) Northern France (DHPLC) Spain (SSCA) Czechia (DGGE) Hb Â 104 Exon Exon Length (bp) Ref. no. SNS SASc 1st 100d 2nd 500 1st 100d 2nde 1st 100d 2nd 500 1st 100 2nde 82d 72 Abs. Freq. Total sample size q Â 104 se Â 104 NSf Sf 1g 53 0 0 0 0 0/452 0 924 2 111 1 223C4T R31C 1 1 1/500 1 1 0 0/450 0 5 (11) 1 932 (2 432) 45.23 13.61 90 2 224G4T R31L 0 0 0/500 0 0 0 1/450 0 1 1 932 5.17 5.17 10 3 257C4T S42F 0 0 1/500 0 0 0 0/450 0 1 1 932 5.17 5.17 10 3 109 4 334A4G K68E 1 0 0 0/498 0 0 0 0/452 0 0 1 2 504 3.99 3.99 8 5 352C4T R74W 0 0 0 0/498 0 0 0 1/452 0 0 1 2 504 3.99 3.99 8 6 356G4A R75Q 1 7 1 7/498 2 9 2 9/452 0 2 40 (40) 2 504 (2 544) 157.23 24.66 310 7 386G4A G85E 0 0 1 1/498 0 0 0 0/452 0 0 2 2 504 7.99 5.65 16 4 216 8 482G4A R117H 0 0 0 0/292 0 2 0 1/456 0 0 3 2 302 13.03 7.52 26 9 528T4G I132M 0 0 0 0/292 0 0 0 1/456 0 0 1 2 302 4.34 4.34 8 10 575T4C I148T 1 2 0 1/292 0 0 0 1/456 0 1 6 2 302 26.06 10.63 52 5 90 11 640C4T R170C 0 0 0 0/6 0 0 1/448 0 1 1 436 6.96 6.96 14 12 641G4A R170H 1 1 0 0/6 0 0 2/448 0 4 (4) 1 436 (1 930) 20.73 10.35 41 6a 164 0 0 0/6 0 0 0/432 0 0 992 6b 126 0 0 0/6 0 0 0/454 0 942 7 247 0 0 0/6 0 0 0/796 0 1 284 8 93 13 1281G4A L383 0 0 0 0/6 0 0 1/456 0 0 1 1 516 6.60 6.60 13 9 183 14 1402G4A G424S 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 15 1459G4T D443Y 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 10 192 16 1540A4G M470Vh 42 197 30 37/96 39 199 (i) (i) 27 571(736) 1 484 (1 912) 3849.37 111.28 4 735 17 1598C4A S489X 0 0 0 0/96 0 0 0 1/796 0 1 2 374 4.21 4.21 8 18 1648A4G I506V 1 0 0 0/96 0 0 0 0/796 0 1 2 374 4.21 4.21 8 19 1655T4G F508C 0 1 0 0/96 0 0 0 1/796 0 2 2 038 8.42 5.96 17 20 1716G4A Q528 2 16 1 0/96 0 19 i I 5 43 (58) 1 478 (2 024) 286.56 37.08 557 11 95 21 1756G4T G542X 0 2 0 0/134 0 0 0/796 0 0 2 1 984 10.08 7.12 20 22 1764T4G G544 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 23 1784G4A G551D 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 12 87 24 1816G4A V562I 0 0 0 0 1 0 0/450 0 0 1 (1) 2 004 (2 504) 3.99 3.99 8 25 1816G4C V562L 0 0 0 1 0 0 1/450 0 0 2 (3) 2 004 (2 504) 11.98 6.91 24 26 1859G4C G576A 1 2 0 1 11 0 8/450 0 0 23 (27) 2 004 (2 538) 106.38 20.36 213 13 724j 449 27 1997G4A G622D 0 0 0/80 0/96 1 0 0 0/444 0 1 2 002 5.00 5.00 10 28 2082C4T F650 1 0 0/80 0/20 0 0 0 0/444 0 1 (1) 1 926 (2 412) 4.15 4.15 8 29 2134C4T R668C 1 2 0/80 0/96 1 11 0 12/444 0 27(32) 2 002 (2 558) 125.10 21.98 247 275 30 2377C4T L748 0 0 0/6 0 1 1 388 25.77 25.77 52 14a 129 31 2670G4A W846X 0 0 0/6 0 1 0/452 0/80 0 1 1 010 9.90 9.90 20 32 2694T4G T854 33 23 0/6 33 38 149/452 14/80 11 301 1 010 2980.20 143.92 4 184 33 2695G4A V855I 0 0 0/6 0 0 1/452 0/80 0 1 1 010 9.90 9.90 20 14b 38 0 0 0 0/520 0 0 0 0/446 0 2 448 15 251 34 2816G4C S895T 0 0 0/6 0 0 2/436 0 0 2 996 20.08 14.18 40 35 2831A4C N900T 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 36 2988G4C M952I 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 37 3030G4A T966 (2)k (1)k 0 6/436 0 6 (25)k 618 (1814)k 137.82 27.37 272 38 3032T4C L967S 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 16 80 0 0 0/498 0 0 0/450 0 0 1 502 17a 151 39 3123G4C L997F 0 2 2 1/494 0 7 1 4/454 0 0 17 2 502 67.95 16.42 135 40 3157G4A A1009T 0 2 0 0/494 0 0 0 0/454 0 0 2 2 502 7.99 5.65 16 41 3212T4C I1027T 1 0 0 0/494 0 0 0 0/454 0 0 1 2 502 4.00 4.00 8 17b 228 42 3286T4G F1052V 1 1 0 1/194 0 0 0 0/452 0 0 3 (3) 2 200 (2 240) 13.39 7.73 27 43 3337G4A G1069R 0 1 0 0/194 0 0 0 0/452 0 0 1 2 200 4.55 4.55 9 CommonandrarenonsynonymousandsynonymouscSNSs GModianoetal 186 EuropeanJournalofHumanGenetics 44 3345G4T Q1071H 0 0 0 0/194 0 1 0 0/452 0 0 1 2 200 4.55 4.55 9 45 3417A4T T1995 1 3 0 0/194 1 1 0 0/452 0 0 6 (8) 2 200 (2 506) 31.92 11.27 64 46 3419T4G L1096R 0 0 0 0/194 1 0 0 0/452 0 0 1 2 200 4.55 4.55 9 47 3477C4A T1115 0 0 0 0/194 0 0 0 1/452 0 0 1 2 200 4.55 4.55 9 18 101 48 3523A4G I1131V 0 0 1 0/10 0 0 0/448 0 0 1 (2) 1 512 (1 908) 10.48 7.07 21 49 3586G4C D1152H 0 0 0 0/10 0 0 1/448 0 0 1 1 512 6.61 6.61 13 19 249 50 3617G4T R1162L 0 0 1 1/494 0 0/260 0 0/454 0 0 2 2 262 8.84 6.25 18 51 3690A4G Q1186 0 0 0 0/494 0 0/260 0 0/454 1 0 1 2 262 4.42 4.42 9 52 3813A4G L1227 0 1 0 0/494 0 0/260 0 0/454 0 0 1 2 262 4.42 4.42 9 53 3837T4G S1235R 1 1 0 1/494 0 4/260 0 7/454 0 1 15 (15) 2 262 (2 310) 69.94 16.71 140 20 156 54 4002A4G P1290 2 3 0/6 3 5 18/454 3/80 2 36 1 012 357.73 58.22 690 21 90 55 4009G4A V1293I 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 56 4029A4G T1299 1 0 0/6 0 1/300 0 1/456 0 0 3 (8) 1 316 (2 330) 34.33 12.12 69 57 4041C4G N1303K 1 0 0/6 0 0/300 0 0/456 0 0 1 1 316 7.60 7.60 15 58 4085T4C V1318A 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 22 173 0 0 0/18 0 0 0/450 0 0 1 022 23 106 0 0 0 0/6 0 0 0/448 0 1 436 24l 198+3 59 4404C4T Y1424 1 0 0/6 1 2 5/420 0 2 11 (32) 980 (2 516) 127.19 22.34 251 60m 4521G4A Q1463 (21) (16) (3/32) (14/80) (30) (94/420) 15/76 (17) 15 (227) 76 (1052) 2142.86 131.07 3 367 61 4563T4C D1477 0 0 0/6 0 1 0/420 0 0 1 980 10.20 10.20 20 Totals 6 525 9 584 16 109 The bracketed figures include also the RFLP analysis data (see Materials and methods); the NE Italy, Central Italy, Southern and Northern France are each subdivided into two samples where the 1st is made up of 100 genes. Login to comment

[hide] Late diagnosis defines a unique population of long... Am J Respir Crit Care Med. 2005 Mar 15;171(6):621-6. Epub 2004 Dec 10. Rodman DM, Polis JM, Heltshe SL, Sontag MK, Chacon C, Rodman RV, Brayshaw SJ, Huitt GA, Iseman MD, Saavedra MT, Taussig LM, Wagener JS, Accurso FJ, Nick JA
Late diagnosis defines a unique population of long-term survivors of cystic fibrosis.
Am J Respir Crit Care Med. 2005 Mar 15;171(6):621-6. Epub 2004 Dec 10., 2005-03-15 [PMID:15591474]

Abstract [show]
Although the median survival for patients with cystic fibrosis (CF) is 32.9 years, a small group of patients live much longer. We analyzed the genotype and phenotype of CF patients 40 years and older seen between 1992 and 2004 at the National Jewish Medical and Research Center (n = 55). These patients were divided into two groups according to age at diagnosis: an early diagnosis (ED) group, median age at diagnosis 2.0 years (range 0.1-15 years, n = 28), and a late diagnosis (LD) group, median age of diagnosis 48.8 years (range 24-72.8 years, n = 27). Consistent with the hypothesis that the CFTR genotype affects the age at diagnosis, CFTR DeltaF508 homozygous individuals were more common in the ED group. Although patients in the ED group were predominantly male, the majority of LD patients were female. Patients with CF diagnosed late had a significantly lower prevalence of pancreatic insufficiency and CF-related diabetes, and better lung function. Fewer patients in the LD groups were infected with Pseudomonas aeruginosa, whereas a greater percentage had cultures positive for nontuberculous mycobacteria. This is the largest cohort of older patients with CF described to date, and our findings indicate that patients diagnosed as adults differ distinctly from survivors of long-term CF diagnosed as children.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 GENOTYPE DISTRIBUTION Early Diagnosis Late Diagnosis ⌬F508/⌬F508 10 1 ⌬F508/⌬I507 1 ⌬F508/G551D 1 ⌬F508/M1101K 1 ⌬F508/P67L/11027T 1 ⌬F508/3120G-A 1 ⌬F508/2789ϩ5G-A 1 2 ⌬F508/W1282X 1 ⌬F508/621ϩ1G-T 1 ⌬F508/R347P 1 ⌬F508/3849ϩ10kbC-T 1 1 ⌬F508/A455E 2 ⌬F508/R347H 2 ⌬F508/D1152H 1 ⌬508/I148T 1 ⌬F508/R117H 1 ⌬F508/Y109N 1 ⌬F508/IVS8-5T 1 ⌬F508/unknown 3 5 S1251N/D1152H 1 G542X/R117C 1 R117H/G551D 1 W1282X/D1152H 1 Unknown 4 4 Values represent number of individuals in each diagnostic group with each genotype. Login to comment

[hide] Comprehensive cystic fibrosis mutation epidemiolog... Ann Hum Genet. 2005 Jan;69(Pt 1):15-24. Castaldo G, Polizzi A, Tomaiuolo R, Cazeneuve C, Girodon E, Santostasi T, Salvatore D, Raia V, Rigillo N, Goossens M, Salvatore F
Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population.
Ann Hum Genet. 2005 Jan;69(Pt 1):15-24., [PMID:15638824]

Abstract [show]
We screened the whole coding region of the cystic fibrosis transmembrane regulator (CFTR) gene in 371 unrelated cystic fibrosis (CF) patients from three regions of southern Italy. Forty-three mutations detected 91.5% of CF mutated chromosomes by denaturing gradient gel electrophoresis analysis, and three intragenic CFTR polymorphisms predicted a myriad of rare mutations in uncharacterized CF chromosomes. Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711 + 1G > T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Several mutations frequently found in northern Italy (e.g., R1162X, 711 + 5G > T) and northern Europe (e.g., G551D, I507del and 621 + 1G > T) are absent from the studied population. The I148T-3195del6 complex allele was present in two CF chromosomes, whereas I148T was present in both alleles (as a single mutation) in another CF patient and in five CF carriers; this could result from crossover events. The haplotype analysis of three intragenic polymorphisms (IVS8CA, IVS17bTA and IVS17bCA) compared with data from other studies revealed that several mutations (3849 + 10kbC > T, 1717-1G > A, E585X, 3272-26G > A, L558S, 2184insA and R347P) originated from multiple events, whereas others (R1158X and S549R) could be associated with one or more intragenic recombinant events. Given the large population migration from southern Italy, knowledge of the CF molecular epidemiology in this area is an important contribution to diagnosis, counselling and interlaboratory quality control for molecular laboratories worldwide.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
62 A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n. Login to comment
85 Present study case (n) Mutation references* Haplotype (n. of repeats) Other studies case (n) W1282X 16 17-7-17 26 1, 2, 3 1259insA 11 16-33-13 852del22 11 16-33-13 4016insT 11 16-30-13 I502T 8 16-30-13 L1065P 4 16-30-13 2522insC 4 23-30-13 2789+5G>A 2 17-7-17 9 1, 2, 3 D1152H 2 16-7-13 2711delT 1 16-45-13 2 3 D110H 1 16-32-13 Y849X 1 16-30-13 * References: 1: Morral et al., 1996 2: Claustres et al., 1996 3: Hughes et al., 1996b peculiar to Sardinia, is absent in our population (Rendine et al. 1997). Login to comment

[hide] Phenylglycine and sulfonamide correctors of defect... Mol Pharmacol. 2005 May;67(5):1797-807. Epub 2005 Feb 18. Pedemonte N, Sonawane ND, Taddei A, Hu J, Zegarra-Moran O, Suen YF, Robins LI, Dicus CW, Willenbring D, Nantz MH, Kurth MJ, Galietta LJ, Verkman AS
Phenylglycine and sulfonamide correctors of defective delta F508 and G551D cystic fibrosis transmembrane conductance regulator chloride-channel gating.
Mol Pharmacol. 2005 May;67(5):1797-807. Epub 2005 Feb 18., [PMID:15722457]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel cause cystic fibrosis. The delta F508 mutation produces defects in channel gating and cellular processing, whereas the G551D mutation produces primarily a gating defect. To identify correctors of gating, 50,000 diverse small molecules were screened at 2.5 microM (with forskolin, 20 microM) by an iodide uptake assay in epithelial cells coexpressing delta F508-CFTR and a fluorescent halide indicator (yellow fluorescent protein-H148Q/I152L) after delta F508-CFTR rescue by 24-h culture at 27 degrees C. Secondary analysis and testing of >1000 structural analogs yielded two novel classes of correctors of defective delta F508-CFTR gating ("potentiators") with nanomolar potency that were active in human delta F508 and G551D cells. The most potent compound of the phenylglycine class, 2-[(2-1H-indol-3-yl-acetyl)-methylamino]-N-(4-isopropylphenyl)-2-phenylace tamide, reversibly activated delta F508-CFTR in the presence of forskolin with K(a) approximately 70 nM and also activated the CFTR gating mutants G551D and G1349D with K(a) values of approximately 1100 and 40 nM, respectively. The most potent sulfonamide, 6-(ethylphenylsulfamoyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic acid cycloheptylamide, had K(a) approximately 20 nM for activation of delta F508-CFTR. In cell-attached patch-clamp experiments, phenylglycine-01 (PG-01) and sulfonamide-01 (SF-01) increased channel open probability >5-fold by the reduction of interburst closed time. An interesting property of these compounds was their ability to act in synergy with cAMP agonists. Microsome metabolism studies and rat pharmacokinetic analysis suggested significantly more rapid metabolism of PG-01 than SF-03. Phenylglycine and sulfonamide compounds may be useful for monotherapy of cystic fibrosis caused by gating mutants and possibly for a subset of delta F508 subjects with significant delta F508-CFTR plasma-membrane expression.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
223 C, D1152H-CFTR cells. Login to comment
241 Cells were also tested from a subject having D1152H and ⌬F508 CFTR mutations, with the former mutation affecting the second nucleotide-binding domain and causing a decrease in channel activity (Vankeerberghen et al., 1998). Login to comment
242 The D1152H/⌬F508 cells maintained at 37°C showed large CFTR currents in response to PG-01 (Fig. 7C). Login to comment
283 The phenyglycines corrected defective gating in a number of CF-causing CFTR mutants including ⌬F508, G551D, G1349D, and D1152H. Login to comment
294 The best phenylglycine was also effective on cells cultured from subjects with CF having G551D and D1152H CFTR mutations, supporting the possible use of this class of compounds for monotherapy of CF caused by some mutations. Login to comment

[hide] The impact of cystic fibrosis and PSTI/SPINK1 gene... Clin Lab Med. 2005 Mar;25(1):79-100. Cohn JA, Mitchell RM, Jowell PS
The impact of cystic fibrosis and PSTI/SPINK1 gene mutations on susceptibility to chronic pancreatitis.
Clin Lab Med. 2005 Mar;25(1):79-100., [PMID:15749233]

Abstract [show]
This article reviews current concepts regarding the pathobiology of cystic fibrosis pancreatic disease. It summarizes recent studies on the relationship between CFTR mutations and pancreatitis, and it reviews several unresolved issues in the field.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 When these six nominal CF carriers were tested further by DNA sequencing, rare mutations were identified in five cases (D1152H, P574H, G1069R, 3120G > A; each detected rare mutation is mild-variable [18,30,48,49]. Login to comment
90 Table 1 Abnormal CFTR and PSTI genotypes detected in two studies of idiopathic chronic pancreatitis* CFTR genotype category N Genotypes detected in individual subjects US study (Noone et al [47]) CFsev / CFm-v compound heterozygotes 8 DF508 / R117H-7T**; DF508 / 5T; DF508 / 5T; DF508 / D1152H; DF508 / D1152H; DF508 / P574H; DF508 / 3120G>A; 621þ1G>T/G1069R CFm-v / CFm-v compound heterozygotes 1 5T / 5T** CFsev / - (CF carriers) 1 N1303K / - CFm-v / - 7 R117H-7T / -; 5T / -**; 5T / -; 5T / -; 5T / -; 5T / -; 5T / - Normal (- / -) CFTR genotype 22 1 was homozygous for the N34S PSTI mutation; 5 were N34S carriers European study (Audrezet et al [50]) CFsev / CFm-v compound heterozygotes 4 DF508/R352Q; DF508/P5L; DF508/Q1476X; W1282X/5T*** CFm-v / CFm-v compound heterozygotes 2 V562I/5T; E217G/A1136T CFsev / - (CF carriers)**** 3 DF508 / -; DF508 / -; G542X / - CFm-v / - 9 L967S/-**; IVS18-20T>C/-**; c.4575þ2G>A/-; IVS3-6T>C; 5T/-; 5T/-; 5T/-; 5T/-; 5T/- Normal (- / -) CFTR genotype 17 1 was homozygous for the N34S PSTI mutation; 1 was a N34S carrier * CFTR mutations were classified as causing either severe (CFsev ) or mild-variable loss-of-function (CFm-v ) [18,47]; all detected CFsev mutations are CF-causing mutations according to current consensus criteria [79]. Login to comment

[hide] Reduced CFTR function and the pathobiology of idio... J Clin Gastroenterol. 2005 Apr;39(4 Suppl 2):S70-7. Cohn JA
Reduced CFTR function and the pathobiology of idiopathic pancreatitis.
J Clin Gastroenterol. 2005 Apr;39(4 Suppl 2):S70-7., [PMID:15758663]

Abstract [show]
Idiopathic chronic pancreatitis (ICP) is the leading cause of chronic pancreatitis in children and nonalcoholic adults. The risk of developing ICP is increased in individuals who have mutations of the cystic fibrosis gene (CFTR) and of a trypsin inhibitor gene (PSTI). In studies from the United States and France, the risk of ICP is increased about 40-fold by having two abnormal copies of the CFTR gene, about 14-fold by having the N34S PSTI mutation, and about 500-fold by having both. When ICP patients have two abnormal copies of the CFTR gene, there is also evidence of reduced residual CFTR protein function in extrapancreatic tissues based on clinical findings and nasal ion transport responses. Thus, pancreatitis risk is highest in individuals who have abnormalities in both the pancreatic ducts (CFTR) and acini (PSTI). These findings indicate that PSTI is a modifier gene for CFTR-related ICP and have implications for the diagnosis and pathogenesis of pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 nominal CF carriers were further tested by DNA sequencing, rare mutations were identified in 5 cases (D1152H, P574H, G1069R, 3120G.A); each detected rare mutation is mild to variable.18,30,48,49 Among the 9 compound heterozygotes, only one would have been corrected classified by CF carrier screening (1). Login to comment
69 Abnormal CFTR and PSTI Genotypes Detected in Two Studies of ICP CFTR Genotype Category* N Genotypes Detected in Individual Subjects U.S. study (Noone et al47 ) CFsev / CFm-v compound heterozygotes 8 DF508 / R117H-7T †; DF508 / 5T; DF508 / 5T; DF508 / D1152H; DF508 / D1152H; DF508 / P574H; DF508 / 3120G.A; 621 + 1G.T/G1069R CFm-v / CFm-v compound heterozygotes 1 5T / 5T † CFsev / 2 (CF carriers) 1 N1303K / 2 CFm-v / 2 7 R117H-7T / 2; 5T / 2 †; 5T / 2; 5T / 2; 5T / 2; 5T / 2; 5T / 2 Normal (2 / 2) CFTR genotype 22 1 was homozygous for the N34S PSTI mutation; 5 were N34S carriers French study (Audrezet et al50 ) CFsev / CFm-v compound heterozygotes 4 DF508/R352Q; DF508/P5L; DF508/Q1476X; W1282X/5T‡ CFm-v / CFm-v compound heterozygotes 2 V562I/5T; E217G/A1136T CFsev / 2 (CF carriers)§ 3 DF508 / 2; DF508 / 2; G542X / 2 CFm-v / 2 9 L967S/2 †; IVS18-20T.C/ 2†; c.4575+2G.A/2; IVS3-6T.C; 5T/2; 5 /2; 5T/ 2; 5T/2; 5T/ 2 Normal (2 / 2) CFTR genotype 17 1 was homozygous for the N34S PSTI mutation; 1 was a N34S carriers *Mutations of the cystic fibrosis (CF) gene (CFTR) were classified as causing either severe (CFsev ) or mild-variable loss-of-function (CFm-v )18,47 ; all detected CFsev mutations are CF-causing mutations according to current consensus criteria.68 In the U.S. study, most patients were tested for rare mutations by DNA sequencing47 ; in the French study, most patients were tested by dHPL.50 †These patients were also carriers for the N34S mutation of a trypsin inhibitor gene (PSTI). Login to comment

[hide] Pancreatitis among patients with cystic fibrosis: ... Pediatrics. 2005 Apr;115(4):e463-9. Epub 2005 Mar 16. De Boeck K, Weren M, Proesmans M, Kerem E
Pancreatitis among patients with cystic fibrosis: correlation with pancreatic status and genotype.
Pediatrics. 2005 Apr;115(4):e463-9. Epub 2005 Mar 16., [PMID:15772171]

Abstract [show]
OBJECTIVE: Pancreatitis is an infrequent complication among patients with cystic fibrosis (CF). It has mainly been reported for patients with pancreatic sufficiency (PS). Previous studies involved only a small number of patients because they contained data from single centers. The aim of this study was to evaluate the incidence of pancreatitis in a large heterogeneous CF population, to determine the relationship with pancreatic function, and to assess whether pancreatitis is associated with specific CFTR mutations. METHODS: Physicians caring for patients with CF were approached through the CF Thematic Network or through the European Cystic Fibrosis Foundation newsletter. They were asked to provide data on their current patient cohort through a standardized questionnaire and to report how many patients they had ever diagnosed as having pancreatitis. A detailed questionnaire was then sent, to be filled out for all of their patients for whom pancreatitis had ever occurred. We defined pancreatitis as an episode of acute abdominal pain associated with serum amylase levels elevated above the ranges established by each participating center's laboratory. General clinical data included age, genotype, age at diagnosis of CF, sweat chloride concentrations, pancreatic status, biometric findings, and respiratory status. CFTR mutations were also reported according to the functional classification of classes I to V. Patients were categorized as having PS, pancreatic insufficiency (PI), or PI after an initial period of PS. PI was defined as a 72-hour stool fat loss of >7 g/day, fat absorption of <93%, or fecal elastase levels of <200 microg/g feces. Clinical data on pancreatitis included age at the first episode, amylase and lipase levels, possible triggers, and occurrence of relapses or complications. RESULTS: A total of 10071 patients with CF, from 29 different countries, who were undergoing follow-up monitoring in 2002 were surveyed. Among this group, pancreatitis had ever been diagnosed for 125 patients (1.24%; 95% confidence interval [CI]: 1.02-1.46%). There was variability in the reported rates of pancreatitis for different countries. Twenty-six centers in 15 different countries sent detailed clinical data on their patients with pancreatitis and on their whole CF clinic. This involved 3306 patients with CF and 61 cases of pancreatitis, leading to a prevalence of 1.84% (95% CI: 1.39-2.30%). The mean age of the patients with pancreatitis ever was 24.4 years (SD: 10.8 years). The first episode of pancreatitis occurred at a mean age of 19.9 years (SD: 9.6 years). The median serum amylase level at the time of pancreatitis was 746 IU/L (interquartile range: 319-1630 IU/L), and the median lipase level was 577 IU/L (interquartile range: 229-1650 IU/L). The majority of patients had PS (34 of 61 patients, 56%; 95% CI: 43-68%). Pancreatitis occurred for 15 patients with PI (25%; 95% CI: 14-35%). Eight patients developed PI after initial PS. The occurrence of pancreatitis among patients with PS was 34 cases per 331 patients, ie, 10.27% (95% CI: 7.00-13.55%); the occurrence of pancreatitis among patients with PI was 15 cases per 2971 patients, ie, 0.5% (95% CI: 0.25-0.76%). The mean age (in 2002) of the CF cohort with pancreatitis did not differ between the PS and PI subgroups. The forced expiratory volume in 1 second was significantly lower among the patients with PI than among the patients with PS, ie, 65% (SEM: 7%) vs 79% (SEM: 4%). The mean age at the occurrence of pancreatitis and the amylase and lipase levels during pancreatitis were not different for patients with pancreatitis and PI versus PS. In the group with PS, 31 of 34 patients carried at least 1 class IV or V CFTR mutation. In the groups with PI and PI after PS, 5 of 15 patients and 3 of 8 patients, respectively, carried 2 class I, II, or III CFTR mutations. Relapses and/or evolution to chronic pancreatitis occurred for 42 patients. Pancreatitis preceded the diagnosis of CF in 18 of 61 cases. These patients were significantly older than the rest of the cohort, ie, age of 28.4 years (SEM: 3.4 years) vs 22.7 years (SEM: 1.3 years). Their median age at the diagnosis of CF was also significantly greater, ie, 21.5 years (interquartile range: 11.9-31 years) vs 7.6 years (interquartile range: 0.4-17.0 years). However, the ages at the occurrence of pancreatitis were similar, ie, 21.0 years (SEM: 3.0 years) vs 19.5 years (SEM: 1.2 years). CONCLUSIONS: This study of 10071 patients with CF from 29 different countries revealed an estimated overall occurrence of pancreatitis among patients with CF of 1.24% (95% CI: 1.02-1.46%). The incidence of pancreatitis was much higher among patients with PS. However, pancreatitis was also reported for 15 patients with PI from 11 centers in 9 different countries. A correct diagnosis of pancreatitis for the reported patients with PI was supported by amylase and lipase levels increased above 500 IU/L, similar to those for patients with PS and pancreatitis. A correct diagnosis of PI for these patients with pancreatitis was supported by the adequacy of the methods used. We chose the cutoff values used to distinguish between patients with PI and control subjects without gastrointestinal disease. For one half of the patients, the diagnosis of PI was established on the basis of low levels of stool elastase (mean: 97 mug/g stool). With a cutoff value of 200 microg/g stool, this noninvasive test has high sensitivity (>95%) and high specificity (>90%) to differentiate patients with PI from control subjects with normal pancreatic function. For the other one half of the patients with PI in the cohort, the pancreatic status was determined on the basis of the 3-day fecal fat balance, with the widely used cutoff value of >7 g of fat loss per day. The most likely reason for pancreatitis occurring among patients with PI is that some residual pancreatic tissue is present among these patients. Pancreatitis is a rare complication among patients with CF. It occurred for 1.24% (95% CI: 1.02-1.46%) of a large CF cohort. Pancreatitis occurs mainly during adolescence and young adulthood. It is much more common among patients with CF and PS (10.3%), but it can occur among patients with PI (0.5%). Pancreatitis can be the first manifestation of CF. Pancreatitis was reported for patients carrying a wide range of mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
136 Class IV and V mutations reported among the patients with PI included D1152H (n ϭ 2), A455E (n ϭ 2), R1066H (n ϭ 1), S13F (n ϭ 1), and 1898ϩ3AϾG (n ϭ 1). Login to comment

[hide] Genetic factors in pancreatitis. Rom J Gastroenterol. 2005 Mar;14(1):53-61. Grigorescu M, Grigorescu MD
Genetic factors in pancreatitis.
Rom J Gastroenterol. 2005 Mar;14(1):53-61., [PMID:15800694]

Abstract [show]
The understanding of pathogenesis of acute and chronic pancreatitis has benefited from the progress made in genetic investigations. The discoveries of the gain of function mutations of cationic trypsinogen gene (PRSS1) and the loss of function mutations of pancreatic secretory trypsin inhibitor (SPINK 1) or other potential defects in genes that regulate pancreatic secretory function or modulate inflammatory response to pancreatic injury has changed our current concepts on the pathogenesis of pancreatitis. Genetic factors play an important role in the susceptibility to pancreatic injury, severity and evolution of inflammatory process, leading in some cases to chronic inflammation and/or fibrosis. Acute pancreatitis is viewed as an event and chronic pancreatitis as a process, sequentially linked, reflecting a complex interaction between genetic and environmental factors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 More than 1200 CFTR gene polymorphism have been reported which can be divided into six classes, based on the functional consequences of the polymorphisms on channel function: - class I-III mutations are severe (CFTRsev ), comprising: class I: defective protein synthesis (R553X, W1282X, 3950 del T); class II: abnormal processing trafficking (del 508, N1303K); class III: defective activation (G551D) and all result in functional loss of CFTR from the epithelial cell surface; - class IV mutations (R117H, R347P, D1152H) are mild-variable mutations (CFTRm-v ) and result in reduction but not absence of channel ion conductance; - class V mutations (3849+10KbC >T) diminish protein synthesis or stability and - class VI mutations may affect the regulatory function of CFTR on other ion channels (71-73). Login to comment

[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]

Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

[hide] Mutation spectrum of the CFTR gene in Taiwanese pa... Hum Reprod. 2005 Sep;20(9):2470-5. Epub 2005 May 19. Wu CC, Alper OM, Lu JF, Wang SP, Guo L, Chiang HS, Wong LJ
Mutation spectrum of the CFTR gene in Taiwanese patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2005 Sep;20(9):2470-5. Epub 2005 May 19., [PMID:15905293]

Abstract [show]
BACKGROUND: Clinically affected cystic fibrosis (CF) patients present a spectrum of genital phenotypes ranging from normal fertility to moderately impaired spermatogenesis and congenital bilateral absence of vas deferens (CBAVD). Little is known about the CF incidence in the Taiwanese population. It has been shown that the CBAVD in men without clinical evidence of CF is associated with a high incidence of mutated CFTR (cystic fibrosis transmembrane conductance regulator) alleles. In order to understand the involvement of the CFTR gene in the aetiology of Asian/Taiwanese male infertility, we screened the entirety of the CFTR gene in 36 infertile males with CBAVD. METHODS: Temporal temperature gradient gel electrophoresis (TTGE) followed by direct DNA sequencing was used. RESULTS: Five mutations, p.V201M, p.N287K, c.-8G > C (125G > C), p.M469I and p.S895N, were found in five of the patients. p.N287K occurred in the first transmembrane-spanning domain, p.M469I in the first ATP-binding domain and p.S895N in the second transmembrane-spanning domain, were novel. In addition, seven homozygous and seven heterozygous 5T alleles in the intron 8 poly(T) tract were found. The overall frequency of CFTR mutant alleles in Taiwanese CBAVD males was 26 out of 72 = 36%. This finding was lower than the published frequency of CFTR mutations in other ethnic CBAVD patients (ranging from 50 to 74%). The frequency of p.M470V in Taiwanese CBAVD patients is not significantly different from that in the general population (P = 0.12). CONCLUSIONS: The results of this study add to the short list of Taiwanese/Asian CFTR mutations. Unlike Caucasian patients, the CFTR mutations cannot account for the majority of Taiwanese CBAVD. This is consistent with the low incidence of CF in the Asian/Taiwanese population. Furthermore, the mutation spectrum of CFTR in CBAVD patients does not overlap with the Caucasian CFTR mutation spectrum.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
161 and numerous CFTR mutations in Caucasians, the Turkish study found a p.D1152H mutation that occurred at an unexpected high frequency (15%), suggesting that a specific mutation profile may be responsible for CBAVD patients in a particular population (Dayangac et al., 2004). Login to comment

[hide] Mutation spectrum in Jewish cystic fibrosis patien... Am J Med Genet A. 2005 Jul 30;136(3):246-8. Quint A, Lerer I, Sagi M, Abeliovich D
Mutation spectrum in Jewish cystic fibrosis patients in Israel: implication to carrier screening.
Am J Med Genet A. 2005 Jul 30;136(3):246-8., 2005-07-30 [PMID:15948195]

Abstract [show]
We have tested 144 unrelated Jewish patients suffering from the classical form of cystic fibrosis. The patients were screened for a panel of 12 mutations including the six Ashkenazi founder mutations (DeltaF508, W1282X, N1303K, G542X, 3849 + 10 kb C-->T, 1717-1G > A) and six mutations that were found in non-Ashkenazi Jewish patients (S549R (T-->G), G85E, 405 + 1G-->A, W1089X, Y1092, and D1152H). Patients of Georgian origin were tested also for the Q359K/T360K mutation. In addition, all the patients were tested for the IVS-8 variant (9T/7T/5T). Of all the cystic fibrosis (CF)-bearing chromosomes, 94% (264/281) were accounted for by one of the known mutations, and none of the patients had the 5T allele of the IVS-8 variant. Single strand conformation polymorphism (SSCP) analysis of the coding sequence of the CFTR gene followed by sequencing showed eight mutations on ten CF chromosomes, leaving seven chromosomes (2.5%) with unknown mutations. We identified three mutations in two or more CF chromosomes, 2571 + 1insT in Jews from Iraq, 3121-1G > A in patients from Kurdistan and I1234V in Yemenite Jewish patients. The other five mutations appeared on a single allele and are considered "private mutations." In this study we have identified 99% of CF alleles in Ashkenazi Jewish patients, 91% in Jews of North African origin and 75% in Jewish patients from Iraq. The significance of these findings to the population screening in Israel is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 MUTATION ANALYSIS The following mutations are routinely tested in Jewish patients: the Ashkenazi founder mutations, DF508, W1282X, N1303K, G542X, 3849 þ 10 kb C!T, 1717-1G > A [Abeliovich et al., 1992], mutations commonly found in non-Ashkenazi patients, S549R (T!G), G85E, 405 þ 1G!A, W1089X, Y1092X, D1152H. Login to comment
58 Mutations in the CF Bearing Alleles in the Jewish Patients According to the Ethnic Origin Country of origin Ashkenazi Morocco Tunisia Balkan Iraq Iran/ Kurdistan Georgia Yemen Total Number of alleles (%) 193 (69.0) 34 (12.1) 12 (4.3) 21 (7.5) 8 (2.8) 3 (0.7) 8 (2.8) 2 (0.7) 281 W1282X (%) 83 (42.8) 1 (8.3) 4 (19.0) 88 (31.3) DF508 (%) 65 (33.5) 24 (70.6) 3 (25.0) 7 (33.3) 1 100 (35.6) N1303K (%) 10 (5.2) 10 (3.6) G542X (%) 19 (10.3) 4 (19.0) 24 (8.5) 3849-10 kbC!T (%) 10 (5.1) 1 (2.9) 2 (9.5) 13 (4.6) 1717-1G!A (%) 2 (1.0) 2 (0.7) D1152H (%) 1 (0.5) 1 (0.4) S549R (T!G) (%) 4 (11.8) 4 (1.4) G85E (%) 2 (9.5) 2 (0.7) 405 þ 1G!A (%) 8 (66.7) 8 (2.8) Y1092X (%) 3 (37.5) 3 (1.1) W1089X (%) 2 (9.5) 2 (0.7) Q359K/T360K (%) 8 (100) 8 (2.8) I1234V (%) 2 (100) 2 (0.7) 2751 þ 1insT (%) 2 (25.0) 2 (0.7) 3121-1G > A (%) 1 1 (0.4) M952I (%) 1 (12.5) 1 (0.4) L165S (%) 1 (0.5) 1 (0.4) A455E (%) 1 (0.5) 1 (0.4) L997F (%) 1 (2.9) 1 (0.4) G1244E (%) 1 (2.9) 1 (0.4) Unkown (%) 1 (0.5) 3 (8.8) 2 (25.0) 1 7 (2.5) Mutation Spectrum in Jewish CF Patients [Wahab, 2003]. Login to comment
61 The IVS-8 5T variant and the D1152H mutation are both common in the general Jewish population (Ashkenazi and non-Ashkenazi). Login to comment
62 It is important to note that while the D1152H mutation is common (0.9%) in the general Jewish population [Orgad et al., 2001], it is rare among patients with classical CF. Login to comment
65 Therefore, we recommend that the D1152H mutation and IVS-8 5T variant not be included in the panel of mutations that are tested in the carrier-screening program, a recommendation that was adopted by the Israeli Medical Genetic Organization. Login to comment

[hide] A CFTR mutation (D1152H) in a family with mild lun... Clin Genet. 2005 Jul;68(1):88-90. Highsmith WE Jr, Friedman KJ, Burch LH, Spock A, Silverman LM, Boucher RC, Knowles MR
A CFTR mutation (D1152H) in a family with mild lung disease and normal sweat chlorides.
Clin Genet. 2005 Jul;68(1):88-90., [PMID:15952991]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Letter to the Editor A CFTR mutation (D1152H) in a family with mild lung disease and normal sweat chlorides To the Editor: Over 1000 mutations in the cystic fibrosis transmembrane regulator (CFTR) gene have been reported to cause cystic fibrosis (CF); however, only a few are associated with mild disease (1, 2). Login to comment
1 We report a novel mutation (D1152H) in three siblings with unusually mild CF, surviving past age 64 with pancreatic exocrine sufficiency, normal sweat chloride (Cl- ) concentrations, and reduced CFTR-mediated Cl-conductance across the nasal epithelium. Login to comment
3 This nucleotide change results in an aspartic acid to histidine substitution at position 1152 of the mature protein (D1152H). Login to comment
15 The three siblings with the clinical syndrome of CF were compound heterozygotes, D1152H/G542X. Login to comment
22 Recent work by Vankeerberghen et al. has demonstrated reduced whole cell Cl- currents when a D1152H-bearing CFTR cDNA is expressed in Xenopus oocytes, confirming that D1152H is a type IV mutation (9). Login to comment
23 Since our initial report to the Cystic Fibrosis Gene Analysis Consortium (10, 11), D1152H has been detected frequently in men with congenital bilateral absence of vas deferens (CBAVD) from three continents (12-16). Login to comment
24 One large study found D1152H to be the fourth most common CFTR mutation in men with CBAVD (17). Login to comment
29 The lung disease attributable to the D1152H/G542X genotype in this family, even with the additional insult of prolonged smoking, is associated with survival into the seventh and eighth decade of life. Login to comment
34 The frequent appearance of this mutation among CBAVD men, and now in very mild CF, highlights the prevalence of D1152H and suggests it is sufficiently common to warrant further research and potentially a higher clinical profile. Login to comment
36 Sweat gland and nasal epithelial physiologic properties in two siblings with cystic fibrosis and the D1152H mutation Sweat glanda Nasal bioelectric propertiesb Patients Sweat duct PDc (mV) Secretion after isoproterenold (nl/min/gland) Mean PD (mV) Maximal PD (mV) Amiloride inhibition (%) Cl- diffusion PD (mV) Isoproterenol augmentation (mV) 1 À41 0 À41 À46 75 þ2 Not done 2 Not done 0 À21 À24 57 þ1 À5 Normal subjects À10 to À45 0.2-3.0 À21.7 Æ 6.1 À32.5 Æ 6.1 56.6 Æ 15.5 À16.7 Æ 6.6 À16.0 Æ 6.1 Cystic fibrosis À45 to À80 0 À47.7 Æ 6.5 À67.5 Æ 9.8 74.8 Æ 8.0 þ5.3 Æ 1.6 À0.1 Æ 1.1 Cl- , chloride; PD, potential difference. Login to comment
86 Friedman KJ, Highsmith WE Jr, Zhou Z et al. D1152H: a common CFTR mutation associated with highly variable disease expression. Login to comment

[hide] The prevalence and clinical characteristics of cys... Arch Dis Child. 2005 Jul;90(7):675-9. Mei-Zahav M, Durie P, Zielenski J, Solomon M, Tullis E, Tsui LC, Corey M
The prevalence and clinical characteristics of cystic fibrosis in South Asian Canadian immigrants.
Arch Dis Child. 2005 Jul;90(7):675-9., [PMID:15970608]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is considered to be rare among individuals from the Indian subcontinent. Furthermore, affected individuals are reported to experience a more severe clinical course. AIMS: It was hypothesised that CF is under diagnosed in people of South Asian origin and therefore the prevalence may be higher than previously estimated. METHODS: The prevalence of CF in the South Asian and in the general population living in the same geographic region (Metropolitan Toronto) were compared between 1996 and 2001. Population data were obtained from the Canadian census survey. CF phenotype and genotype data were obtained from the Toronto CF database. RESULTS: Among 381 patients with CF, 15 were of South Asian descent. The age related prevalence of CF among the South Asian and general populations was: 0-14 years, 1:9200 versus 1:6600; 15-24 years, 1:13,200 versus 1:7600; older than 25 years, 1:56,600 versus 1:12,400. Age at diagnosis, duration and severity of symptoms at diagnosis, current nutritional status, and FEV(1) were similar in the two groups. While not significant, FEV1 tended to be lower (48% versus 57% predicted) among adult South Asians, compared to the general CF population. Also, the percentage with pancreatic sufficiency was higher (27% versus 16%) and the frequency of DeltaF508 allele was lower (50% versus 65.1%). CONCLUSIONS: These data suggest that the prevalence and natural history of CF in South Asians is similar to that among individuals of European origin. The relatively lower prevalence among older South Asians may reflect an improving recognition of CF in this ethnic subgroup.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
237 Two were homozygous for rare mutations (1868A.G and D1152H) and four were heterozygous for DF508 (R117H/7T(2), R117H/5T, 5T). Login to comment
238 The patients with R117H/7T, 5T, and homozygous D1152H all had nasal potential difference testing which confirmed CF. Login to comment

[hide] Complete cystic fibrosis transmembrane conductance... Gut. 2005 Oct;54(10):1456-60. Epub 2005 Jun 29. Weiss FU, Simon P, Bogdanova N, Mayerle J, Dworniczak B, Horst J, Lerch MM
Complete cystic fibrosis transmembrane conductance regulator gene sequencing in patients with idiopathic chronic pancreatitis and controls.
Gut. 2005 Oct;54(10):1456-60. Epub 2005 Jun 29., [PMID:15987793]

Abstract [show]
BACKGROUND: Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene-many of which cause cystic fibrosis-have also been reported in patients with chronic pancreatitis. The authors examine whether mild or severe CFTR mutations, homozygous or compound heterozygous CFTR mutations, or even simple cystic fibrosis carrier status alone increases the risk of developing pancreatitis. METHODS: After exclusion of patients with trypsinogen (PRSS1) mutations, cystic fibrosis, or pulmonary disease, and with known risk factors for pancreatitis 67 patients with idiopathic chronic pancreatitis (ICP) from northwest Germany and 60 geographically and ethnically matched controls were recruited. The entire coding region of the CFTR gene was sequenced in all patients and controls. ICP patients were also analysed for serine protease inhibitor Kazal type 1 (SPINK1) gene mutations. RESULTS: Abnormal CFTR alleles were found to be twice as frequent in ICP patients as in controls (25/134 v 11/120; p<0.05). Three of four severe CFTR mutations detected in patients were compound heterozygous with another abnormal CFTR allele, whereas among controls three severe CFTR mutations were found in heterozygous cystic fibrosis carriers. In ICP patients 19 uncommon/mild mutations, including combinations of the 5T allele with 12TG repeats, were identified compared with only five in controls (p = 0.012). Heterozygous SPINK1 mutations were detected in eight ICP patients (15% v 1% in controls) but only one also carried an additional mild CFTR mutation. CONCLUSIONS: These data show that not only compound heterozygosity, but also cystic fibrosis carrier status for different types of CFTR mutations, including uncommon/mild mutations, significantly increase the risk of developing pancreatitis. Although 45% of the study's ICP patients carried predisposing genetic risk factors (for example, mutations in CFTR or SPINK1), the authors found no evidence that the risk conveyed by CFTR mutations depends on co-inherited SPINK1 mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
233 CFTR mutations in idiopathic pancreatitis www.gutjnl.com Three of the four compound heterozygous ICP patients carried one severe DF508 mutation (genotypes: DF508/ R117H, DF508/A1087P, DF508/D1152H) and one carried two mild mutations (S1235R/R668C). Login to comment
256 The reason why numbers for compound heterozygous ICP patients in these studies are diverse (4/67 = 6% in our study) may be due to differences Table 1 CFTR and SPINK1 sequence variations identified in 30 of the 67 ICP patients PatientSex CFTR mutation T allele TG repeats PSTI mutation 1 M DF508/R117H 7/7 9/10 -/- 2 W DF508/A1087P 7/9 10/11 -/- 3 M DF508/D1152H 7/9 10/10 -/- 4 M S1235R/R668C 7/7 11/12 -/- 5 M 2184insA/- 7/7 10/12 -/- 6 M R31C/- 7/7 10/11 -/- 7 M R75Q/- 7/7 11/11 -/- 8 M R347P/- 7/7 11/12 -/- 9 M S1235R/- 7/7 11/12 -/- 10 W S1235R/- 7/7 11/12 -/- 11 M G576A/- 7/7 10/10 -/- 12 W M348V/- 7/9 10/10 -/- 13 M V754M/- 7/7 10/11 -/- 14 M -/- 5/7 11/12 -/- 15 W -/- 5/7 11/12 -/- 16 M -/- 5/7 11/12 -/- 17 W -/- 5/9 11/12 -/- 18 M -/- 5/7 11/12 -/- 19 M -/- 5/7 10/10 -/- 20 W -/- 5/7 10/10 -/- 21 W -/- 5/7 11/12 N34S/- 22 W -/- 7/7 10/11 N34S/- 23 M -/- 7/9 10/11 N34S/- 24 M -/- 7/7 11/11 N34S/- 25 M -/- 7/7 11/11 N34S/- 26 W -/- 7/7 11/11 N34S/- 27 M -/- 7/7 11/11 N34S/- 28 W -/- 7/7 10/11 N34S/- 29 W -/- 7/7 11/11 P55S/- 30 W -/- 7/7 11/11 IVS3+2TC/- Table 2 CFTR sequence variations identified in 11 of 60 healthy controls Control group Number DF508/- 3 R117H/- 2 I148T/- 1 L997F/- 1 5T/12TG 1 5T/11TG 3 in patient recruitment, the catchment populations, or the stringency with which cystic fibrosis patients were excluded. Login to comment

[hide] Gender-sensitive association of CFTR gene mutation... Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26. Morea A, Cameran M, Rebuffi AG, Marzenta D, Marangon O, Picci L, Zacchello F, Scarpa M
Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility.
Mol Hum Reprod. 2005 Aug;11(8):607-14. Epub 2005 Aug 26., [PMID:16126774]

Abstract [show]
Human infertility in relation to mutations affecting the cystic fibrosis transmembrane regulator (CFTR) gene has been investigated by different authors. The role of additional variants, such as the possible forms of the thymidine allele (5T, 7T and 9T) of the acceptor splice site of intron 8, has in some instances been considered. However, a large-scale analysis of the CFTR gene and number of thymidine residues, alone and in combination, in the two sexes had not yet been addressed. This was the aim of this study. Two groups were compared, a control group of 20,532 subjects being screened for perspective reproduction, and the patient group represented by 1854 idiopathically infertile cases. Analyses involved PCR-based CFTR mutations assessment, reverse dot-blot IVS8-T polymorphism analyses, denaturing gradient gel electrophoresis (DGGE) and DNA sequencing. The expected 5T increase in infertile men was predominantly owing to the 5/9 genotypic class. The intrinsic rate of 5T fluctuated only slightly among groups, but some gender-related differences arose when comparing their association. Infertile men showed a significantly enriched 5T + CFTR mutation co-presence, distributed in the 5/9 and 5/7 classes. In contrast, females, from both the control and the infertile groups, showed a trend towards a pronounced reduction of such association. The statistical significance of the difference between expected and observed double occurrence of 5T + CFTR traits in women suggests, in line with other reports in the literature, a possible survival-hampering effect. Moreover, regardless of the 5T status, CFTR mutations appear not to be involved in female infertility. These results underline the importance of (i) assessing large sample populations and (ii) considering separately the two genders, whose genotypically opposite correlations with these phenomena may otherwise tend to mask each other.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T. Login to comment
77 All these rare mutations, having been sought only in one partner, and only in the appropriate cases, are not included in the data discussed in Tables I, II and IV. Finally, as regards the mutations found in women of the control group, who bore 5T and a CFTR mutation, these 15 subjects presented eight cases of ∆F508 and single instances of the following: R117H, G542X, W1282X, R1162X, N1303K, 2183 aa/g and D1152H. Login to comment
79 Concerning instead the mutations found in the male group, besides ∆F508 the following have been found: 2789+5 g/a, 711+5 g/a, D1152H, G85E, N1303K, Q552X, R1158X, R117H, R334Q, R334W and R553X. Login to comment
101 Mutations Women (987) Men (867) N IVS8-T genotype N IVS8-T genotype ∆F508 16 15(7/9); 1(9/9) 26 15(7/9)*; 11(5/9) N1303K 4 4(7/9) 1 7/7 3849+10KbC→T 1 5/7 1 5/7 G542X 2 7/9 1 7/9† 2183AA→G 2 7/7 4 7/7 R553X 2 7/7 0 - R1162X 2 7/7 6 5(7/7)‡; 1(7/9) D1152H 0 - 3 2(7/7); 7/9† 711+5G→A 0 - 3 7/7 1717-8G→A 0 - 1 5/7 1717-1G→A 1 7/7 0 - Y577F 0 - 1 7/7 R117H 1 7/7 1 7/9* 621+3A→G 1 7/9 0 - W1282X 1 7/7 0 - deltaI1507 1 7/7 0 - T3381 1 7/7 1 7/9 R1066H 0 - 1 7/7§ R334Q 0 - 1 7/9 2789+5G→A 1 7/7 2 7/7‡§ Total 36¶ 53¶ records, all these mutations are normally found in trans with respect of 5T. Login to comment

[hide] The cystic fibrosis transmembrane conductance regu... Hum Genet. 2005 Dec;118(3-4):372-81. Epub 2005 Sep 29. Bishop MD, Freedman SD, Zielenski J, Ahmed N, Dupuis A, Martin S, Ellis L, Shea J, Hopper I, Corey M, Kortan P, Haber G, Ross C, Tzountzouris J, Steele L, Ray PN, Tsui LC, Durie PR
The cystic fibrosis transmembrane conductance regulator gene and ion channel function in patients with idiopathic pancreatitis.
Hum Genet. 2005 Dec;118(3-4):372-81. Epub 2005 Sep 29., [PMID:16193325]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations are associated with cystic fibrosis (CF)-related monosymptomatic conditions, including idiopathic pancreatitis. We evaluated prospectively enrolled patients who had idiopathic recurrent acute pancreatitis or idiopathic chronic pancreatitis, healthy controls, CF heterozygotes, and CF patients (pancreatic insufficient or sufficient) for evidence of CFTR gene mutations and abnormalities of ion transport by sweat chloride and nasal potential difference testing. DNA samples from anonymous blood donors were controls for genotyping. At least one CFTR mutation or variant was carried in 18 of 40 patients (45%) with idiopathic chronic pancreatitis and in 6 of 16 patients (38%) with idiopathic recurrent acute pancreatitis but in only 11 of the 50 controls (22%, P=0.005). Most identified mutations were rare and would not be identified in routine genetic screening. CFTR mutations were identified on both alleles in six patient (11%). Ion transport measurements in patients with pancreatitis showed a wide range of results, from the values in patients with classically diagnosed CF to those in the obligate heterozygotes and healthy controls. In general, ion channel measurements correlated with the number and severity of CFTR mutations. Twelve of 56 patients with pancreatitis (21%) fulfilled current clinical criteria for the diagnosis of CF, but CFTR genotyping alone confirmed the diagnosis in only two of these patients. We concluded that extensive genotyping and ion channel testing are useful to confirm or exclude the diagnosis of CF in the majority of patients with idiopathic pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Sex Type of pancreatitis Age, years CFTR genotype TG repeata Sweat chloride, mmol/lb NTPD DClÀ free+ Iso, mVc Normal Borderline Abnormal Normal Abnormal 1 F Chronic 19 F508deld /L206W 63 Not done 2 M Acute 16 F508deld /R117H(7T)d 10 60 5.0 3 F Chronic 43 F508deld /L967S 46 À2.5 4 F Acute 16 W1282Xd /5T 12 38 1.0 5 F Acute 10 F508deld /D1152H 33 17.0 6 F Chronic 19 5T/5T 11/11 6 15.0 7 F Chronic 33 F508deld /À 69 7.4 8 M Chronic 25 F508deld /À 54 7.0 9 M Chronic 15 F508deld /À 33 14.0 10 F Chronic 33 F508deld /À 26 7.0 11 M Chronic 12 F508deld /À 24 6.0 12 M Chronic 21 2183AA fi G/À 124 Not done 13 F Acute 19 5T/À 11 71 11.0 14 M Chronic 71 5T/À 11 39 19.0 15 F Chronic 38 5T/À 11 20 30.0 16 F Chronic 21 5T/À 11 18 Not done 17 F Chronic 17 5T/À 11 17 Not done 18 F Chronic 26 5T/À No DNA 12 38.0 19 F Chronic 45 5T/À 11 5 34.0 20 F Chronic 40 R75Q/À 32 16.0 21 F Chronic 11 S1235R/À 31 46.0 22 F Acute 1 R170H/À 19 Not done 23 F Acute 14 1716G fi A/À 14 26.0 24 F Chronic 23 1716G fi A/À 12 12.0 25 M Acute 8 À/À 51 15.0 26 M Chronic 67 À/À 46 11.0 27 M Acute 13 À/À 44 36.0 28 F Acute 28 À/À 35 3.0 29 F Chronic 21 À/À 22 6.0 TG12. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Tohoku J Exp Med. 2005 Dec;207(4):279-85. Uzun S, Gokce S, Wagner K
Cystic fibrosis transmembrane conductance regulator gene mutations in infertile males with congenital bilateral absence of the vas deferens.
Tohoku J Exp Med. 2005 Dec;207(4):279-85., [PMID:16272798]

Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) is characterized by azoospermia and male infertility. Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene are associated with cystic fibrosis (CF), the most common autosomal recessive disorder in Caucasians. Recent publications on CBAVD raised the question whether CFTR gene mutations are responsible for CBAVD occurrence or not. This study was conducted to explore the role of CFTR gene mutations in the occurrence of CBAVD-dependent male infertility. Forty-four chromosomes of 22 CBAVD patients from Austrian ancestry were studied. For detection of the most common mutation DeltaF508, a deletion of phenylalanine at the 508th position of mature CFTR chloride channel protein, the 10th exon of the gene was screened by heteroduplex analysis. In order to identify non-DeltaF508 mutations, we also analyzed the entire coding regions, exon/intron boundaries of 27 exons and the 5'- and 3'-untranslated regions of the gene by denaturing gradient gel electrophoresis (DGGE) after polymerase chain reaction. All exons showing different banding patterns on the DGGE gels were sequenced to define existing DNA sequence variations. Among the analyzed 44 chromosomes of 22 patients, disease producing mutations were found in 31.8% (14/44). The most common mutation was DeltaF508 with a frequency of 43% (6/14), followed by R117H with 29% (4/14). Our results indicate that CFTR gene mutations are common but not the only reason for the occurrence of CBAVD-dependent male infertility. We recommend screening of the CFTR gene in these patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 Other CF mutations, G542X, G551D, D1152H, M470W, R334W, R74W, M952I, W1282X, N1303K, and G85E, are known to be involved in CBAVD etiology (Wang et al. 2002; Danziger et al. 2004). Login to comment
35 Homozygosity of a mild allele or compound heterozygosity of mutant alleles, such as R117H/D1152H (mild/mild) or R117H/ΔF508 (mild/severe), could cause a mild form of CF (Dean et al. 1990; Kerem et al. 1990; Pignatti 1994) or male infertility without other clinical signs (Gervais et al. 1993; Oates and Amos 1993). Login to comment
63 The remaining two patients were heterozygous for the nonsense mutation G542X and missense mutation D1152H (Table 1). Login to comment
88 R117H / 621 + 1 G- > T 1635 D1152H Missense mutation, het. Login to comment
89 D1152H / -- 1725 ΔF508 mut. het ΔF508 / -- 1827 G542X Nonsense mutation, het. Login to comment
98 D1152H Mutation. A missense mutation caused by a G to C transversion at nucleotide 3586 in exon 18. Login to comment

[hide] Cystic fibrosis: terminology and diagnostic algori... Thorax. 2006 Jul;61(7):627-35. Epub 2005 Dec 29. De Boeck K, Wilschanski M, Castellani C, Taylor C, Cuppens H, Dodge J, Sinaasappel M
Cystic fibrosis: terminology and diagnostic algorithms.
Thorax. 2006 Jul;61(7):627-35. Epub 2005 Dec 29., [PMID:16384879]

Abstract [show]
There is great heterogeneity in the clinical manifestations of cystic fibrosis (CF). Some patients may have all the classical manifestations of CF from infancy and have a relatively poor prognosis, while others have much milder or even atypical disease manifestations and still carry mutations on each of the CFTR genes. It is important to distinguish between these categories of patients. The European Diagnostic Working Group proposes the following terminology. Patients are diagnosed with classic or typical CF if they have one or more phenotypic characteristics and a sweat chloride concentration of >60 mmol/l. The vast majority of CF patients fall into this category. Usually one established mutation causing CF can be identified on each CFTR gene. Patients with classic CF can have exocrine pancreatic insufficiency or pancreatic sufficiency. The disease can have a severe course with rapid progression of symptoms or a milder course with very little deterioration over time. Patients with non-classic or atypical CF have a CF phenotype in at least one organ system and a normal (<30 mmol/l) or borderline (30-60 mmol/l) sweat chloride level. In these patients confirmation of the diagnosis of CF requires detection of one disease causing mutation on each CFTR gene or direct quantification of CFTR dysfunction by nasal potential difference measurement. Non-classic CF includes patients with multiorgan or single organ involvement. Most of these patients have exocrine pancreatic sufficiency and milder lung disease. Algorithms for a structured diagnostic process are proposed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
303 Conversely, a patient with D1152H plus F508del with a sweat chloride level of 45 mmol/l may have escaped early diagnosis and may have had several episodes of lower respiratory tract disease leading to widespread bronchiectasis by the age of 18 years. Login to comment

[hide] Cystic fibrosis mutations with widely variable phe... Pediatr Pulmonol. 2006 Mar;41(3):250-4. Mussaffi H, Prais D, Mei-Zahav M, Blau H
Cystic fibrosis mutations with widely variable phenotype: the D1152H example.
Pediatr Pulmonol. 2006 Mar;41(3):250-4., [PMID:16429425]

Abstract [show]
D1152H is a type IV cystic fibrosis transmembrane regulator (CFTR) mutation associated with abnormal chloride gating. Although comprising 5-6% of mutations on genetic screening, clinical reports of cystic fibrosis (CF) are rare, suggesting that the disease is mild, atypical, or even absent. We describe our experience, which contrasts with this assumption, in a retrospective case series encompassing 91 CF patients (74 Jewish) aged 8 months to 56 years, from 2000-2005. Nine patients of varied Jewish ethnic origins were homozygous (2 patients) or compound heterozygous for D1152H with 11 of 182 potential alleles (6%). Five were diagnosed at age 33-49 years. Of 4 infants, 1 was diagnosed by prenatal screening, 1 had a prenatal dilated bowel, and 1 had pulmonary symptoms. Sweat chloride was 28-120 meq/l. Three adults had chronic mucoid Pseudomonas aeruginosa in sputum, and a forced expired volume in 1 sec (FEV1) of 20-55%. One was on bilevel positive airway pressure (BIPAP) ventilation. The infants had pulmonary symptoms that responded well to therapy. All 9 patients had good nutrition, 6 were pancreatic-sufficient, and 3 adults had subclinical pancreatic insufficiency. Three adults had recurrent pancreatitis. None had a bowel obstruction. Two of 3 adult males were fertile. Although asymptomatic at times, the D1152H mutation is associated with a broad clinical spectrum. This information is crucial for genetic counseling. Lung disease may be evident from infancy, and is severe in some adults, although all have outlived the median life expectancy of CF. Hopefully, with early diagnosis and therapy, prognosis can be good. A multicenter study of this mutation is warranted.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 D1152H is a type IV cystic fibrosis transmembrane regulator (CFTR) mutation associated with abnormal chloride gating. Login to comment
4 Nine patients of varied Jewish ethnic origins were homozygous (2 patients) or compound heterozygous for D1152H with 11 of 182 potential alleles (6%). Login to comment
15 Although asymptomatic at times, the D1152H mutation is associated with a broad clinical spectrum. Login to comment
22 ß 2006 Wiley-Liss, Inc. Key words: cystic fibrosis; genetic counseling; phenotype; atypical CF; D1152H; pancreatic sufficient. Login to comment
25 In cases where testing reveals CFTR mutations associated with a variable phenotype, prenatal counseling is fraught with difficulties and must be based on maximal information regarding possible clinical scenarios.6 The D1152H mutation is associated with residual CFTR function and abnormal chloride gating, making it a typeIV CFmutation.7 Since 2000, it has been includedin routine prenatal and carrier genetic screening in Israel,8 and for various ethnic groups in the United States.9,10 Descriptions of clinical disease, first published in 1992,11 have been limited mainly to a congenital bilateral absence of the vas deferens (CBAVD)12 and late-onset mild disease, with almost normal sweat chloride values.13 Interestingly, D1152H was found in 6.27% of referrals for carrier screening among Hispanics, while the disease 1 Kathy and Lee Graub Cystic Fibrosis Center and Pulmonary Unit, Schneider Children`s Medical Center of Israel, Petah Tikva, Israel. Login to comment
31 Our experience contrasts markedly with published observations regarding clinical disease associated with the D1152H mutation. Login to comment
36 All other patients included in the analysis met the criteria for diagnosis of CF as proposed by the statement of the CF Foundation Consensus Panel.4 Patients who were either homozygous or compound-heterozygous for the D1152H mutation were identified. Login to comment
43 In children, percent ideal body weight was calculated, with !90% considered a normal nutritional state.15 RESULTS Of 91 patients reviewed, 9 (10%) were either homozygous or heterozygous for the D1152H mutation, with a total of 11/182 alleles (6%). Login to comment
51 The last 4 patients described were all infants, diagnosed due to pulmonary symptoms despite pancreatic sufficiency (patients 6 and 7), dilated bowel loops on fetal ultrasound (patient 8), or the recent introduction of D1152H in prenatal genetic tests (patient 9). Login to comment
53 Although this feature suggested the possibility of meconium ileus and a more severe CF phenotype, the TABLE 1-Demographics, Genotype, Sweat Chloride, and Mode of Presentation of D1152H Subjects1 Patient no. Login to comment
54 Age (y)/gender Age (y) at diagnosis Ethnic origin (all Jewish) Other CF mutation Sweat ClÀ (meq/l)2 Presentation 1 54/m 46 Ashkenazi W1282X 120 Bronchiectasis 2 39/m 33 Turkey/Iraq D1152H 49 CBAVD 3 46/f 41 Ashkenazi DF508 54 Bronchiectasis 4 49/m 44 Ashkenazi DF508 113 Bronchiectasis 5 51/f 49 Ashkenazi DF508 50 Pancreatitis 6 1.5/m 0.5 Iran/Turkey/Bulgaria D1152H 53 Lung disease 7 2/m 1.3 Iran/Bulgaria W1282X 70 Lung disease 8 1/f Prenatal Ashkenazi DF508 80 Prenatal dilated bowel 9 0.8/m Prenatal Tunis/Ashkenazi DF508 28 Prenatal screening 1 Patients 4 and 5 are siblings. Login to comment
87 DISCUSSION In this paper, we describe 9 CF patients carrying the D1152H mutation, in a clinic of 91 patients from infancy to 56 years, at the Graub CF Center (Schneider Children`s Medical Center of Israel). Login to comment
89 The D1152H mutation was first described in 1992,11 and was included in the screening panels of major laboratories testing Jewish populations since the year 2000. Login to comment
92 Based on previous case reports of mild phenotype, the Israel Medical Genetic Organization recently decided not to include this mutation in the panel tested in the carrier-screening program.16 In contrast to the above, the prevalence of D1152H in our clinic population clearly demonstrates that this mutation is associated with significant though atypical clinical disease. Login to comment
93 Comparing 148 potential alleles in our clinic`s 74 Jewish patients, 12 (8%) were D1152H. Login to comment
97 Undoubtedly, a multicenter analysis of clinical pictures associated with the D1152H mutation is needed. Login to comment
102 Thenatural historyofinfants withthe D1152H mutation is unknown, and some of our adult patients describe pulmonary symptoms from early childhood for which they received no specific CF treatment. Login to comment
105 Pancreatic sufficiency appears to be the most constant feature of young patients with D1152H mutations. Login to comment
112 The cardinal importance of this series description is to enable more informed genetic counseling for carriers of the D1152H mutation and in the prenatal setting. Login to comment
116 Subjects with the D1152H mutation are an example of an ever-increasing population of patients with atypical CF. Login to comment

[hide] The relevance of sweat testing for the diagnosis o... Clin Biochem Rev. 2005 Nov;26(4):135-53. Mishra A, Greaves R, Massie J
The relevance of sweat testing for the diagnosis of cystic fibrosis in the genomic era.
Clin Biochem Rev. 2005 Nov;26(4):135-53., [PMID:16648884]

Abstract [show]
Cystic fibrosis (CF) is the most common inherited disorder of childhood. The diagnosis of CF has traditionally been based on clinical features with confirmatory evidence by sweat electrolyte analysis. Since 1989 it has been possible to also use gene mutation analysis to aid the diagnosis. Cloning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has advanced our understanding of CF, in particular the molecular basis of an expanded CF phenotype. However, because there are over 1000 mutations and 200 polymorphisms, many without recognised effects on CFTR, the molecular diagnosis can be troublesome. This has necessitated measurement of CFTR function with renewed interest in the sweat test. This review provides an overview of the clinical features of CF, the diagnosis and complex genetics. We provide a detailed discussion of the structure and function of CFTR and the classification of CFTR mutations. Sweat electrolyte analysis is discussed, from the physiology of sweating to the rigours of a properly performed sweat test and its interpretation. With this information it is possible to understand the relevance of the sweat test in the genomic era.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
244 Highsmith and colleagues (1994) studied 23 patients with pulmonary disease characteristic of CF but with a normal sweat test and identified a point mutation in intron 19 of the CFTR gene, termed 3849+10kb C-T.15 This mutation produces an alternative splicing site and decreased amounts of CFTR mRNA can be detected.16 Thus, according to the classification of the CFTR mutations, this mutation falls into Class V.16,67 Other mutations associated with normal or borderline sweat electrolytes are R117H, D1152H, A455E, G551S and 2789+5G - A.9,24,78 An interesting phenotype, presenting with elevated sweat chloride concentration in the absence of other CF symptoms, has been described in a patient with a nonsense mutation, S1455X.105 This mutation truncates 26 amino acids from the C-terminus of the protein product. Login to comment

[hide] CFTR chloride channel drug discovery--inhibitors a... Curr Pharm Des. 2006;12(18):2235-47. Verkman AS, Lukacs GL, Galietta LJ
CFTR chloride channel drug discovery--inhibitors as antidiarrheals and activators for therapy of cystic fibrosis.
Curr Pharm Des. 2006;12(18):2235-47., [PMID:16787252]

Abstract [show]
The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a cAMP-activated chloride channel expressed in epithelia in the lung, intestine, pancreas, testis and other tissues, where it facilitates transepithelial fluid transport. In the intestine CFTR provides the major route for chloride secretion in certain diarrheas. Mutations in CFTR cause the hereditary disease cystic fibrosis, where chronic lung infection and deterioration in lung function cause early death. CFTR is a well-validated targeted for development of inhibitors for therapy of secretory diarrheas and activators for therapy in cystic fibrosis. Our lab has identified and optimized small molecule inhibitors of CFTR, as well as activators of DeltaF508-CFTR, the most common mutant CFTR causing cystic fibrosis. High-throughput screening of small molecule collections utilizing a cell-based fluorescence assay of halide transport yielded thiazolidinone and glycine hydrazide CFTR inhibitors that block enterotoxin-mediated secretory diarrhea in rodent models, including a class of non-absorbable inhibitors that target the CFTR pore at its external entrance. Benzothiophene, phenylglycine and sulfonamide potentiators were identified that correct the defective gating of DeltaF508-CFTR chloride channels, and other small molecules that correct its defective cellular processing. Small molecule modulators of CFTR function may be useful in the treatment of cystic fibrosis, secretory diarrhea and polycystic kidney disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
221 Phenylglycines had another interesting property in being able to activate other CFTR mutants including G551D, G1349D, and D1152H (Fig. 7C). Login to comment

[hide] Identification of CFTR, PRSS1, and SPINK1 mutation... Pancreas. 2006 Oct;33(3):221-7. Keiles S, Kammesheidt A
Identification of CFTR, PRSS1, and SPINK1 mutations in 381 patients with pancreatitis.
Pancreas. 2006 Oct;33(3):221-7., [PMID:17003641]

Abstract [show]
OBJECTIVES: Chronic pancreatitis is a progressive inflammatory disorder leading to irreversible exocrine and/or endocrine impairment. It is well documented that mutations in the cationic trypsinogen (PRSS1) gene can cause hereditary pancreatitis. Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) and the serine protease inhibitor Kazal type 1 (SPINK1) genes are also associated with pancreatitis. METHODS: We analyzed 381 patients with a primary diagnosis of chronic or recurrent pancreatitis using the Ambry Test: Pancreatitis to obtain comprehensive genetic information for the CFTR, SPINK1, and PRSS1 genes. RESULTS: The results identified 32% (122/381) of patients with 166 mutant CFTR alleles, including 12 novel CFTR variants: 4375-20 A>G, F575Y, K598E, L1260P, G194R, F834L, S573C, 2789 + 17 C>T, 621+83 A>G, T164S, 621+25 A>G, and 3500-19 G>A. Of 122 patients with CFTR mutations, 5.5% (21/381) also carried a SPINK1 mutation, and 1.8% (7/381) carried a PRSS1 mutation. In addition, 8.9% (34/381) of all patients had 1 of 11 different SPINK1 mutations. Another 6.3% (24/381) of the patients had 1 of 8 different PRSS1 mutations. Moreover, 1.3% of the patients (5/381) had 1 PRSS1 and 1 SPINK1 mutation. A total 49% (185/381) of the patients carried one or more mutations. CONCLUSIONS: Comprehensive testing of the CFTR, PRSS1, and SPINK1 genes identified genetic variants in nearly half of all subjects considered by their physicians as candidates for genetic testing. Comprehensive test identified numerous novel variants that would not be identified by standard clinical screening panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Patients With More Than 1 CFTR Mutation CFTR Mutation 1 CFTR Mutation 2 CFTR Mutation 3 No. of Patients deltaF508 5T 3 deltaF508 D1152H 1 deltaF508 deltaF508 1 deltaF508 F575Y 1 deltaF508 K598E 1 deltaF508 T164S 1 deltaF508 R74W D1270N 1 deltaF508 Q1476X 1 deltaF508 L997F 1 R553X D1152H 1 R553X G1069R 1 2789+5 G9A 2183 AA9G 1 3849+10kb C9T L1260P 1 711+3 A to G I1139V 1 1341+1 G9A G194R 5T 1 621+25 A9G 3500-19 C9T 1 R74W V855I 1 G542X R117H 1 G551D F311L 1 G576A R668C 2 K710X L997F 1 L997F L320V 1 G1069R 5T 1 1818+18 G9A 5T 1 F1074L 5T 1 F834L 5T 1 R74Q R297Q 1 R74Q R297Q 5T 1 R785Q 5T 1 R117H 5T 3 deltaF508 I1027T 1 Total patients 36 MutationsinboldfacewouldnothavebeendetectedbytheAmericanCollegeofObstetrics and Gynecology (ACOG)/American College of Medical Genetics (ACMG) mutation panel. Login to comment
71 Patients With 1 CFTR Mutation CFTR Mutation 1 No. of Patients 1717-1 G9A 1 2789+5 G9A 1 3849+10kb C9T 2 3849+45 G9A 1 621+3 A9G 2 A1364V 1 A349V 1 A455E 1 D1152H 1 D1445N 1 deltaF508 16 E217G 1 F1286C 1 F316L 1 G542X 1 G551D 1 I148T 1 I807M 1 L206W 1 L967S 2 L997F 2 P55S 1 Q179K 1 Q220X 1 R117H 3 R1453W 1 R297Q 1 R31C 1 R668C 2 S1235R 1 S573C 1 S945L 1 V562A 1 V754M 2 Y1092X 1 Total patients 58 MutationsinboldfacewouldnothavebeendetectedbytheACOG/ACMGmutationpanel. Login to comment

[hide] Prospective analysis of cystic fibrosis transmembr... Chest. 2006 Oct;130(4):995-1002. Ziedalski TM, Kao PN, Henig NR, Jacobs SS, Ruoss SJ
Prospective analysis of cystic fibrosis transmembrane regulator mutations in adults with bronchiectasis or pulmonary nontuberculous mycobacterial infection.
Chest. 2006 Oct;130(4):995-1002., [PMID:17035430]

Abstract [show]
BACKGROUND: Bronchiectasis and pulmonary infection with nontuberculous mycobacteria (NTM) may be associated with disease-causing mutations in the cystic fibrosis transmembrane regulator (CFTR). METHODS: Fifty adult patients at Stanford University Medical Center with a diagnosis of bronchiectasis and/or pulmonary NTM infection were prospectively characterized by sweat chloride measurement, comprehensive mutational analysis of CFTR, and sputum culture results. RESULTS: A de novo diagnosis of cystic fibrosis (CF) was established in 10 patients (20%). Patients with CF were more likely than those without CF to have mucus plugging seen on chest high-resolution CT, and women with a CF diagnosis were thinner, with a significantly lower mean body mass index than the non-CF subjects. Thirty CFTR mutations were identified in 24 patients (50% prevalence). Sweat chloride concentration was elevated > 60 mEq/dL (diagnostic of CF) in seven patients (14%), and from 40 to 60 mEq/dL in eight patients (16%). The frequency of CFTR mutations was elevated above that expected in the general population: heterozygous DeltaF508 (12% vs 3%), R75Q (14% vs 1%), and intron 8 5T (17% vs 5 to 10%). Other known CFTR mutations identified were V456A, G542X, R668C, I1027T, D1152, R1162L, W1282X, and L183I. Three novel CFTR mutations were identified: A394V, F650L, and C1344S. CONCLUSIONS: Mutations in CFTR that alter RNA splicing and/or functional chloride conductance are common in this population, and are likely to contribute to the susceptibility and pathogenesis of adult bronchiectasis and pulmonary NTM infection. Careful clinical evaluation for disease cause should be undertaken in this clinical context.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 Other identified mutations included R75Q, G542X, V4566A, D1152H, F650L, I1027T, W1282X, and the intron 8 polymorphism IVS 8 5T. Login to comment
94 Comparison of pulmonary function test data did not demonstrate significant differences between the Table 1-Subjects With Diagnosis of CF* Patient No. Age, yr Sex Bronch NTM† Other Infection‡ CFTR Mutations M470V Alleles IVS8 PolyT§ Sweat Chloride Level, mEq/dL 1 63 F Y MAC, Mch ⌬F508, I1027T 1 7T/9T 41 2 58 F Y MAC 2 7T/7T 65 3 66 F Y MAC, Mka PA 1 7T/7T 70 4 62 F Y MAC R75Q 2 5T/7T 67 5 53 F Y MAC G542X 0 5T/7T 60 6 74 F Y MAC SA ⌬F508, D1152H 1 9T/9T 46 7 33 F Y N PA ⌬F508, V456A 1 9T/9T 74 8 49 M Y N 1 7T/7T 77 9 73 F Y N S malto W1282X 1 7T/7T 63 10 52 F N Msi 2 2 7T/7T 68 *Bronch ϭ bronchiectasis (Bronch); F ϭ female; M ϭ male; Y ϭ yes; N ϭ no. Login to comment

[hide] Detection of cystic fibrosis transmembrane conduct... Hum Reprod. 2007 May;22(5):1285-91. Epub 2007 Feb 28. Ratbi I, Legendre M, Niel F, Martin J, Soufir JC, Izard V, Costes B, Costa C, Goossens M, Girodon E
Detection of cystic fibrosis transmembrane conductance regulator (CFTR) gene rearrangements enriches the mutation spectrum in congenital bilateral absence of the vas deferens and impacts on genetic counselling.
Hum Reprod. 2007 May;22(5):1285-91. Epub 2007 Feb 28., [PMID:17329263]

Abstract [show]
BACKGROUND: Mutations in the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene have been widely detected in infertile men with congenital bilateral absence of the vas deferens (CBAVD). Despite extensive analysis of the CFTR gene using varied screening methods, a number of cases remain unsolved and could be attributable to the presence of large gene rearrangements, as recently shown for CF patients. METHODS: We carried out a complete CFTR gene study in a group of 222 CBAVD patients with strict diagnosis criteria and without renal anomaly, and searched for rearrangements using a semi-quantitative assay in a subgroup of 61 patients. RESULTS: The overall mutation detection rate was 87.8%, and 82% of patients carried two mutations. Ten out of the 99 different mutations accounted for 74.6% of identified alleles. Four large rearrangements were found in patients who already carried a mild mutation: two known partial deletions (exons 17a to 18 and 22 to 23), a complete deletion and a new partial duplication (exons 11 to 13). The rearrangements accounted for 7% of the previously unknown alleles and 1% of all identified alleles. CONCLUSIONS: Screening for rearrangements should be part of comprehensive CFTR gene studies in CBAVD patients and may have impacts on genetic counselling for the patients and their families.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 CFTR mutations were detected in 387 out of 444 alleles (87.2%), most of them being previously described in patients with CF of varying severity, CBAVD or other CFTR diseases: 45% of identified alleles consisted of severe CF mutations (e.g. F508del, W1282X, 2183AA.G); 13.8% of mild or variable CF mutations (e.g. L206W, 3272-26A.G, R117H, D1152H); 36.7% of mild CFTR defects which are currently not considered CF-causing (e.g. IVS8(T)5, Q1352H, the complex alleles [D443Y;G576A;R668C] and [R74W;D1270N]) and 4.5% of rare missense mutations whose effect is difficult to predict (e.g. A959V, G1069R, V1153E). Login to comment
69 Frequent cystic fibrosis transmembrane conductance regulator (CFTR) defects found in congenital bilateral absence of the vas deferens (CBAVD) patients (above 1% among the identified alleles) Mutation No. of alleles % of the 390 identified alleles F508dela 119 30.5 IVS8(T)5a,b 107 27.4 (TG)12(T)5 82 (TG)13(T)5 16 (TG)11(T)5b 9 R117Ha 25 6.4 R668C 9 2.3 [D443Y;G576A;R668C] 6 [G576A;R668C] 2 R668C 1 L206W 7 1.8 D1152H 6 1.5 W1282Xa 5 1.3 [V562I;(TG)11(T)5] 5 1.3 [R74W;D1270 N] 4 1.0 [R74W;D1270 N] 3 [R74W;V201M;D1270 N] 1 Q1352H(G . Login to comment
93 1 Two CFTR mutations 15 0-15 0 [R117H] þ [(TG)13(T)5] 1 [R117H] þ [(TG)12(T)5] 1 [R117H] þ [(TG)11(T)5] 1 [R117H] þ [M952I] 1 [D1152H] þ [(TG)12(T)5] 2 [D1152H] þ [Y1032C] 1 [(TG)11(T)5;V562I] þ [L997F] 1 [(TG)11(T)5;V562I] þ [S977F] 1 [E1473X] þ [(TG)13(T)5] 1 [V232D] þ [(TG)12(T)5] 1 [R334W] þ [(TG)12(T)5] 1 [G622D] þ [(TG)12(T)5] 1 [3272-26A . Login to comment
149 Some genotypes had already been described in patients with moderate or late CF, such as those combining F508del with L206W, D1152H, 3272-26A.G or 2789 þ 5G.A. Login to comment

[hide] Clinical evaluation of isolated nonvisualized feta... Prenat Diagn. 2007 Aug;27(8):699-703. Ochshorn Y, Rosner G, Barel D, Bronshtein M, Muller F, Yaron Y
Clinical evaluation of isolated nonvisualized fetal gallbladder.
Prenat Diagn. 2007 Aug;27(8):699-703., [PMID:17510919]

Abstract [show]
OBJECTIVE: Isolated nonvisualized fetal gallbladder (INVFGB) is relatively rare. In most cases, the gallbladder will eventually be detected. In some cases however, INVFGB may be associated with serious abnormalities, cystic fibrosis (CF), aneuploidy, and agenesis of the gall bladder. We describe a clinical evaluation of prenatally diagnosed INVFGB. METHODS: Cases of nonvisualized gallbladder were first evaluated by serial scans. Cases with no additional malformations were designated as INVFGB, and were further evaluated by mutation analysis for CF, and amniocentesis for karyotype and microvillar membrane enzymes (MME). RESULTS: A total of 22 cases of nonvisualized gallbladder were detected. Of these, 2 had additional malformations, and 3 were excluded because of incomplete evaluation. Of the remaining 17 cases, 3 (17.6%) had adverse outcomes: 1 case of CF, 1 case of 47,XXX, and 1 case of multiple congenital anomalies detected only postnatally. Abnormal levels of MMEs were detected in 3 cases, 1 of which was diagnosed with CF. In 2 cases, the gallbladder was not detected even after birth, but development is normal. CONCLUSION: Evaluation of INVFGB should include genetic counselling, amniocentesis for karyotype and MME analysis, CFTR mutation analysis and repeated ultrasound scans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Mutation analysis for cystic fibrosis: The mutation panel included cystic fibrosis transmembrane conductance regulator (CFTR) mutations that are common in the Israeli population, including F508del, W1282X, N1303K, G542X, and D1152H. Login to comment
75 Inability to demonstrate the gallbladder on ultrasound scans may also be the result of 'technical difficulties` such as, aberrant location of the Table1-Clinicalcharacteristicsof17caseswithisolatednonvisualizedfetalgallbladder(INVFGB) Case InitialU/S scan(weeks) Subsequent scans(weeks) Subsequent findings Amniotic fluidMME* KaryotypeCFmutationanalysis Pregnancy outcome Gallbladder detectedDiagnosis 11617,19NoneNormal46,XXNormalDeliveryYesThyroidaplasia 21517NoneNormal47,XXXPaternalcarrier(W1282X)TOPYesTripleX 31517,21NoneNormal46,XXNormalDeliveryYesNormal 41517NoneNormal46,XYNormalDeliveryYesNormal 51517,20NoneNormal46,XXNormalDeliveryYesNormal 61517,21FEBAlllow46,XXFetusaffectedTOPYes (atrophic) Cysticfibrosis 71622NoneNormal46,XYPaternalcarrier(D1152H)DeliveryYesNormal 81519NoneNormal46,XYNormalDeliveryNoNormal 91517,23NoneNormal46,XYMaternalcarrier(F508)DeliveryYesNormal 101517NoneNormal46,XYNormalDeliveryYesNormal 111517NoneNormal46,XXNormalDeliveryYesNormal 121517,19,24NoneLowiALKP46,XYFetuscarrier(5T)DeliveryNoNormal 131517,22NoneHighGGTPandAMP NormaliALKP 46,XYNormalDeliveryYesNormal 141520,22SmallVSDNormal46,XXNormalDeliveryYesNormal 151518NoneNormal46,XXNormalDeliveryYesNormal 161518NoneNormal46,XXNormalDeliveryYesNormal 171524NoneNormal46,XXNormalDeliveryYesNormal *lowlevels:<1stpercentile,highlevels>99thpercentile. Login to comment

[hide] Analysis of Y chromosome microdeletions and CFTR g... Vojnosanit Pregl. 2007 Apr;64(4):253-6. Dinic J, Kusic J, Nikolic A, Divac A, Ristanovic M, Radojkovic D
Analysis of Y chromosome microdeletions and CFTR gene mutations as genetic markers of infertility in Serbian men.
Vojnosanit Pregl. 2007 Apr;64(4):253-6., [PMID:17580535]

Abstract [show]
BACKGROUND/AIM: Impaired fertility of a male partner is the main cause of infertility in up to one half of all infertile couples. At the genetic level, male infertility can be caused by chromosome aberrations or gene mutations. The presence and types of Y chromosome microdeletions and cystic fybrosis transmembrane conductance regulator (CFTR) gene mutations as genetic cause of male infertility was tested in Serbian men. The aim of this study was to analyze CFTR gene mutations and Y chromosome microdelations as potential causes of male infertility in Serbian patients, as well as to test the hypothesis that CFTR mutations in infertile men are predominantly located in the several last exons of the gene. METHODS: This study has encompassed 33 men with oligo- or azoospermia. The screening for Y chromosome microdeletions in the azoospermia factor (AZF) region was performed by multiplex PCR analysis. The screening of the CFTR gene was performed by denaturing gradient gel electrophoresis (DGGE) method. RESULTS: Deletions on Y chromosome were detected in four patients, predominantly in AZFc region (four of total six deletions). Mutations in the CFTR gene were detected on eight out of 66 analyzed chromosomes of infertile men. The most common mutation was F508del (six of total eight mutations). CONCLUSION: This study confirmed that both Y chromosome microdeletions and CFTR gene mutations played important role in etiology of male infertility in Serbian infertile men. Genetic testing for Y chromosome microdeletions and CFTR gene mutations has been introduced in routine daignostics and offered to couples undergoing assisted reproduction techniques. Considering that both the type of Y chromosome microdeletion and the type of CFTR mutation have a prognostic value, it is recomended that AZF and CFTR genotyping should not only be performed in patients with reduced sperm quality before undergoing assisted reproduction, but also for the purpose of preimplantation and prenatal diagnostics in couples in which in vitro fertilization has been performed successfully.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Mutations in the CFTR gene were detected on eight out of 66 analyzed chromosomes of infertile men, while the presence of 5T Table 1 Y chromosome microdeletions and CFTR gene mutations detected in infertile men Group of patients Number of patients Y chromosome microdeletion CFTR gene mutation / polymorphism 1 AZFc F508del / 711+3A/G 1 AZFb - 3 - F508del / 5T Obstructive azoospermia (n = 10) 1 - F508del 1 - F508del / D1152H 2 - 5T Impaired spermatogenesis (n = 11) 1 AZFa + AZFc - 1 AZFc - Unknown cause of infertility (n = 12) 1 - 5T Volumen 64, Broj 4 VOJNOSANITETSKI PREGLED Strana Dinić J, et al. Vojnosanit Pregl 2007; 64(4): 253-256. variant of Tn polymorphism was detected on six chromosomes. Login to comment
72 This patient was a compound heterozygote for F508del and D1152H mutations. Login to comment
73 Mutation D1152H is considered to be mild, exerting with borderline or even normal levels of chloride in sweat, with relatively preserved permeability of the chloride channel, but severely reduced cAMP-activated flow of the chloride ions in the cell 14 . Login to comment
84 In two patients who were found to be compound heterozygotes for CFTR mutations (F508del/711+3A→G and F508del/D1152H) azoospermia and impaired spermatogenesis could be explained by the presence of mutations on both alleles of the CFTR gene. Login to comment

[hide] Does cystic fibrosis neonatal screening detect aty... Clin Genet. 2007 Jul;72(1):39-46. Narzi L, Ferraguti G, Stamato A, Narzi F, Valentini SB, Lelli A, Delaroche I, Lucarelli M, Strom R, Quattrucci S
Does cystic fibrosis neonatal screening detect atypical CF forms? Extended genetic characterization and 4-year clinical follow-up.
Clin Genet. 2007 Jul;72(1):39-46., [PMID:17594398]

Abstract [show]
The neonatal screening protocol for cystic fibrosis (CF) is based on a first determination of blood immunoreactive trypsin (IRT1), followed by a first level genetic test that includes the 31 worldwide most common mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene (DNA31), and a second determination of blood immunoreactive trypsin (IRT2). This approach identifies, in addition to affected subjects, a high proportion of newborns with hypertrypsinaemia at birth, in whom only one mutation is identified and who have a negative or borderline sweat test and pancreatic sufficiency. Although it has been suggested that hypertrypsinaemia may be caused by a single CFTR mutation, whether such neonates should be merely considered as healthy carriers remains a matter of debate as hypertrypsinaemia at birth may be a biochemical marker of a CFTR malfunction because of a second mild mutation. We analyzed, by means of an extended sequencing protocol, 32 newborns who tested positive at an IRT1/DNA31/IRT2 screening protocol and in whom only one CFTR mutation was found. The results obtained demonstrate that 62.5% of these newborns were also carrying a second mild CFTR mutation. The high proportion of compound heterozygous subjects, combined with the results of a 4-year follow-up in nine of these subjects all of whom displaying initial CF clinical symptoms, suggest that it may be possible to use the IRT1/DNA31/IRT2 protocol of neonatal screening to identify newborns with atypical forms of CF. In view of these findings, an extended genetic search for subjects with compound heterozygosity and a periodic clinical assessment should be considered.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 CFTR genotypes, IRT2 and sweat test values of the 32 newborns analyzed Newborn CFTR genotype IRT2 Sweat test (mmol/l [Cl2 ]) at enrolment True heterozygous subjects 1 N1303K/1 Negative 18 2 2183AAtoG/1 Negative 11 3 G85E/1 Positive 19 4 F508del/1 Negative 21 5 F508del/1 Negative 20 6 R117H/1 Negative 6 7 1717-1GtoA/1 Positive 7 8 W1282X/1 Negative 14 9 278915GtoA/1 Negative 23 10 N1303K/1 Negative 19 11 F508del/1 Negative 14 12 G542X/1 Negative 39 % of positivity ¼ 16.7% Average Æ SD ¼ 18 Æ 9 Compound heterozygous subjects 13 F508del/D806G Positive 24 14 F508del/D836Y Negative 12 15 R347P/R1162L Negative 18 16 F508del/P5L (TG)11T5 Negative 16 17 F508del/L997F Positive 32 18 R347P/D1152H Positive 42 19 F508del/P5L Negative 42 20 278915GtoA/71113AtoG Positive 33 21 F508del/P5L Positive 39 22 F508del (TG)12T7/(TG)12T5 Negative 23 23 N1303K/S1235R (TG)12T7 Negative 30 24 F508del/L997F Positive 34 25 F508del/(TG)12T5 Negative 34 26 R117H/(TG)12T7 Positive 22 27 F508del/P1013L Positive 8 28 F508del/L997F Negative 28 29 N1303K/(TG)12T5 Positive 13 30 F508del/L997F Positive 50 31 R1162X/P5L Negative 31 32 L997F/S549R(AtoC) Positive 38 % of positivity ¼ 55.0% Average Æ SD ¼ 29 Æ 12 CFTR, cystic fibrosis transmembrane conductance regulator. Login to comment
75 Discussion The majority of the mutations found (F508del, R347P, D1152H, 2789 1 5G-.A, 711 1 3A-.G, N1303K, R117H, R1162X, S549R(A-.C), 2183AA-.G, G85E, 1717-1G-.A, G542X, and W1282X) have an established pathogenic role (26-44). Login to comment

[hide] The changing face of the exocrine pancreas in cyst... Eur J Gastroenterol Hepatol. 2008 Mar;20(3):164-8. Augarten A, Ben Tov A, Madgar I, Barak A, Akons H, Laufer J, Efrati O, Aviram M, Bentur L, Blau H, Paret G, Wilschanski M, Kerem BS, Yahav Y
The changing face of the exocrine pancreas in cystic fibrosis: the correlation between pancreatic status, pancreatitis and cystic fibrosis genotype.
Eur J Gastroenterol Hepatol. 2008 Mar;20(3):164-8., [PMID:18301294]

Abstract [show]
OBJECTIVES: The aims of this study were to determine the current pancreatic status of the entire cystic fibrosis (CF) population of Israel, to analyze the clinical characteristics of the pancreatic sufficient (PS) patients, and to characterize the correlation between pancreatic status, pancreatitis, and CF genotype. METHODS: The Israeli CF database includes 505 patients. These patients were defined as being PS or insufficient according to their fecal pancreatic elastase level or by coefficient fat absorption findings. Mutations were categorized as severe (DeltaF508, W1282X, G542X, S549R, N1303K, Q359K/T360K, 405+1G, and 1717) or mild/variable (3849+10 kb, D1152H, G85E, I1234V, R334W, and 5T) based on disease severity in patients carrying these mutations. Age at diagnosis, presenting symptoms, sweat-chloride concentrations, occurrence of pancreatitis, presence of diabetes, and liver disease were recorded. RESULTS: One hundred and thirty-nine (27.5%) of the CF patients were PS. None carried two mutations associated with severe disease. Over one third (34%) had normal or borderline sweat tests; 20 of these 139 patients had pancreatitis (14.3%) but none of the 366 pancreatic insufficient patients had it. Four initially PS patients became pancreatic insufficient: conversion followed several events of pancreatitis in three of them. Nasal potential differences were all pathological in 35 tested PS patients. None had either diabetes or liver disease. CONCLUSIONS: A substantial number of CF patients are PS. All of them carry at least one mild mutation enabling production of a sufficient amount of normal mRNA to maintain exocrine pancreatic function. Pancreatitis occurs only in CF patients who are PS. These patients are at risk of progressing to pancreatic insufficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 The mutations DF508, W1282X, G542X, S549R, Q359K/T360K, 405 + 1G, 1717, and N1303K were defined as severe and the mutations 3849 + 10 kb, D1152H, G85E, I1234V, R334W, and 5T were defined as mild/variable. Login to comment
46 of patients W1282X/3849 + 10 kb 15 W1282X/5T 15 DF508/5T 7 DF508/D1152H 6 DF508/3849 + 10 kb 5 W1282X/D1152H 5 W1282X/I1234V 2 3849 + 10 kb/405 + 1G- > A 2 R334W/R334W 2 5T/5T 2 D1152H/D1152H 1 D1152H/5T 1 D1152H/3849 + 10 kb 1 DF508/UKN 13 W1282X/UKN 11 5T/UKN 7 D1152H/UKN 3 1717/UNK 1 G85E/UKN 1 Q359K/T360K/UKN 1 S549R/UKN 1 3849 + 10 kb/UKN 1 UKN/UKN 36 CF, cystic fibrosis; CFTR, cystic fibrosis transmembrane regulator. Login to comment
69 Table 3 The clinical characteristics of the PS patients who became PI Age at CF diagnosis Presenting symptom Age at first pancreatitis event Age at transition PS-PI Genetic profile Sweat Clmmol/l 19 years Pulmonary 19 yearsa 22 years W1282X/G85E 66 6 months Affected sibling 3 yearsa 14 years W1282X/I1234V 82 1 month Affected sibling (None) 12 years DF508/G85E 32 28 years Pancreatitis 28 yearsa 34 years D1152H/5T 30 CF, cystic fibrosis; PI, pancreatic insufficient; PS, pancreatic sufficient. Login to comment
72 The other mutations carried by the PS group (D1152H, G85E, I1234V, and R334W) were also found to cause variable clinical expressions [7-10]. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Clin Gastroenterol. 2008 Aug;42(7):810-4. Segal I, Yaakov Y, Adler SN, Blau H, Broide E, Santo M, Yahav Y, Klar A, Lerner A, Aviram M, Ellis I, Mountford R, Shteyer E, Kerem E, Wilschanski M
Cystic fibrosis transmembrane conductance regulator ion channel function testing in recurrent acute pancreatitis.
J Clin Gastroenterol. 2008 Aug;42(7):810-4., [PMID:18360295]

Abstract [show]
GOALS: To understand the relationship between acute recurrent pancreatitis and cystic fibrosis transmembrane conductance regulator (CFTR) dysfunction. BACKGROUND: An emerging number of patients present with a nonclassic phenotype of cystic fibrosis (CF) with partial features or single-organ disease only. The association between the phenotype of recurrent pancreatitis CFTR dysfunction is unclear. METHODS: Patients with idiopathic recurrent pancreatitis were referred for electrophysiologic investigation. RESULTS: Thirty-three patients (18 males) aged 20+/-12 years with recurrent pancreatitis were studied. Three patients had mild asthma and 1 patient had mild ulcerative colitis. There was no family history of CF. All patients had normal imaging of the pancreatic duct by endoscopic retrograde cholangiopancreatography or magnetic resonance cholangiopancreatography. No patient was pancreatic insufficient. Mean sweat chloride values were 41+/-14 meq/L (range: 18 to 64). Nasal potential difference (NPD) measurement was pathologic in 7 patients. Mean basal potential difference in these 7 patients was -33+/-13 mV and there was an abnormal response to chloride-free and isoproterenol solutions. There was no difference in sweat chloride concentration between the 2 groups. Mutation analysis revealed W1282X/5T, D1152H/5T, and W1282X/- in 3 patients with abnormal NPD and 1 W1282X allele was found in 1 patient with normal NPD. CONCLUSIONS: In this series, 21% of patients with recurrent pancreatitis have abnormalities of CFTR function. Patients presenting with recurrent, "idiopathic" pancreatitis require CFTR function testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 Mutation analysis revealed W1282X/5T, D1152H/5T, and W1282X/ À in 3 patients with abnormal NPD and 1 W1282X allele was found in 1 patient with normal NPD. Login to comment
71 One patient in the normal PD group was found to be heterozygous for the W1282X mutation, whereas 3 of the 7 patients in the pathologic PD group were found to have mutations in the CFTR gene: 1 patient was compound heterozygous W1282X/5T, 1 patient heterozygous for W1282X, and another patient with compound heterozygous D1152H/5T (Table 3). Login to comment
79 Demographics, Clinical, and Laboratory Data of 33 Patients With Recurrent Acute Pancreatitis Mean age 20 ± 12 years (range: 7-49) Sex 15 females, 18 males Symptoms 27: recurrent pancreatitis 3: recurrent pancreatitis+mild asthma 1: recurrent pancreatitis+ulcerative disease 1: recurrent pancreatitis+infertility 1: recurrent 1: recurrent pancreatitis+polycystic kidneys Mean sweat chloride 41 ± 14 mmol/L (range: 18-64) CFTR mutations 2: W1282X/ À 1: W1282X/5T 1: D1152H/5T TABLE 2. Summary of NPD Measurements Normal PD Abnormal PD Patients no. Login to comment
92 The reported prevalence of these mutations in the CF Israeli Jewish population is W1282X 46.3%, and D1152H 5.3%.22 We confirm the findings of Bishop et al10 that ion transport studies correlates with the number and severity of CFTR mutations. Login to comment
99 Sex Age (y) CFTR Genotype Sweat Chloride (mmol/L) NPD DClÀ free+iso (mV) Exp (DClÀ free+iso/DAmil) 1 M 40 W1282X/ À 60 1 1.09 2 M 9 W1282X/5T 44 0 1 3 F 15 À / À 43 À 4 0.83 4 F 14 À / À 45 À 9 0.81 5 F 10.5 À / À 27 À 1 0.96 6 F 7 À / À 61 2 1.09 7 M 34 D1152H/5T 30 4 2.72 0 0.7 1.4 2.1 2.8 3.5 ΔΔ FIGURE 2. Login to comment

[hide] CFTR mutations in Turkish and North African cystic... Genet Test. 2008 Mar;12(1):25-35. Lakeman P, Gille JJ, Dankert-Roelse JE, Heijerman HG, Munck A, Iron A, Grasemann H, Schuster A, Cornel MC, Ten Kate LP
CFTR mutations in Turkish and North African cystic fibrosis patients in Europe: implications for screening.
Genet Test. 2008 Mar;12(1):25-35., [PMID:18373402]

Abstract [show]
AIMS: To obtain more insight into the variability of the CFTR mutations found in immigrant cystic fibrosis (CF) patients who are living in Europe now, and to estimate the test sensitivity of different frequently used methods of DNA analysis to detect CF carriers or patients among these Turkish or North African immigrants. METHODS: A survey among 373 European CF centers asking which CFTR mutations had been found in Turkish and North African CF patients. RESULTS: 31 and 26 different mutations were reported in Turkish and North African patients, identifying 64.2% (113/176) and 87.4% (118/135) alleles, respectively (p < 0.001). The mean sensitivity (detection rate) of three most common CFTR mutation panels to detect these mutations differed between Turkish and North African people, 44.9% (79/176) versus 69.6% (94/135) (p < 0.001), and can be increased to 57.4% (101/176) and 79.3% (107/135) (p < 0.001), respectively, by expanding these panels with 13 mutations which have been found on two or more alleles. CONCLUSION: 35.8% and 12.6%, respectively, of CF alleles in Turkish and North African patients living in Europe now had not been identified. Among these populations, the test sensitivity of common CFTR mutation panels is insufficient for use in screening programs in Europe, even after expansion with frequent Turkish and North African mutations. This raises questions about whether and how to implement CF carrier and neonatal screening in a multiethnic society.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 Thirteen mutations that were reported for two or more Turkish and=or North African alleles do not belong to the mutation panels of these three frequently used methods of DNA analysis: L227R, 1677delTA, 2184insA, R709Â, L732Â, del exon 1-4 (121_620-694del (53.498 bp)ins53 bp), del exon 19, 3601-2A > G, D1152H, E1104Â, S1159F, S977F, and 2347delG. Login to comment
113 Identity and Frequency of CFTR Mutations on Unrelated Turkish (Tr) and North African (NA) CF alleles Total number of allelesa Number of CF patients with this mutationb Mutation Exon All Tr NA Homozygote Compound heterozygote: two mutations found Compound heterozygote: one mutation found F508delc 10 73 33 40 27 11 6 N1303K 21 22 12 10 10 5 2 711 þ 1G > T Intron 5 14 - 14 7 2 0 G542X 11 14 6 8 7 1 0 R1162X 19 11 - 11 1 5 2 2183AA > G 13 9 9 - 3 3 1 W1282X 20 7 3 4 2 3 1 2789 þ 5G > A Intron 14b 6 3 3 1 4 1 L227R 6a 4 - 4 3 1 0 1677delTA 10 4 4 - 2 1 1 2184insA 13 4 4 - 1 2 0 R334W 7 4 4 - 1 1 1 G85E 3 4 3 1 1 2 0 R709X 13 3 - 3 2 0 0 L732X 13 3 3 - 2 0 0 2184delA 13 3 3 - 0 3 0 del exon 1-4d 1-4 3 3 - 1 1 0 del exon 19 19 2 2 - 2 0 0 3849 þ 10kbC > T Intron 19 2 - 2 1 0 0 S549N 11 2 1 1 0 1 1 3120 þ G > A Intron 16 2 2 - 1 0 0 3601-2A > G Intron 18 2 2 - 1 0 0 D1152H 18 2 2 - 1 0 0 E1104X 17b 2 - 2 1 0 0 S1159F 19 2 2 - 1 0 0 S977F 16 2 - 2 0 1 0 2347delG 13 2 - 2 1 0 0 4096-3C > G Intron 21 1 1 - 1 0 0 E831X 14a 1 1 - 1 0 0 L619S 13 1 1 - 1 0 0 1525-1G > Ac Intron 9 1 1 - 1 0 0 F1052V 17b 1 1 - 1 0 0 3130delA 17a 1 1 - 1 0 0 R352Q 7 1 - 1 0 1 0 1812-1G > A Intron 11 1 - 1 0 1 0 R553X 11 1 - 1 0 0 1 IVS8-5T Intron 8 1 1 - 0 1 0 R1066C 17b 1 - 1 0 1 0 3129del4 17a 1 - 1 0 1 0 D110H 4 1 1 - 0 1 0 R117H 4 1 - 1 0 1 0 S945L 15 1 - 1 0 1 0 1716G=A 10 1 - 1 0 0 1 711 þ 3A > G Intron 5 1 1 - 0 1 0 R75X 3 1 1 - 0 1 0 R764X 13 1 - 1 0 1 0 S1196X 19 1 1 - 0 1 0 S492F 10 1 - 1 0 1 0 G551D 11 1 - 1 1 0 0 del exon 2 2 1 1 - 1 0 0 Subtotal 231 113 118 - No mutation 80 63 17 - Total 311 176 135 88 60 18 a n ¼ 311 alleles, based on 166 CF patients (332 alleles) with both parents and 22 CF patients (22 alleles) with one parent from Turkey or North Africa, minus 43 alleles of homozygous CF patients with consanguineous parents of whom only one allele was taken into account. Login to comment

[hide] Atypical cystic fibrosis and CFTR-related diseases... Clin Rev Allergy Immunol. 2008 Dec;35(3):116-23. Paranjape SM, Zeitlin PL
Atypical cystic fibrosis and CFTR-related diseases.
Clin Rev Allergy Immunol. 2008 Dec;35(3):116-23., [PMID:18493878]

Abstract [show]
Cystic fibrosis (CF), which is among the most common life-shortening recessive illnesses, is caused by mutations of the CF transmembrane conductance regulator (CFTR) and typically involves chronic infection and progressive obstruction of the respiratory tract as well as pancreatic exocrine insufficiency. Disease severity, to some extent, correlates with organ sensitivity to CFTR dysfunction and to the amount of functional protein, which is influenced by the type of mutation. Atypical CF represents approximately 2% of affected individuals, and includes cases presenting in adolescence or adulthood with pancreatic exocrine sufficiency, normal or borderline sweat chloride concentrations, or with a single predominant clinical feature. This review briefly describes diagnostic methods and phenotypic characteristics of classic and atypical CF, as well as CFTR-related diseases, conditions in which mutated CFTR may contribute to the pathogenesis but do not strictly fit established diagnostic criteria.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Determination of the transepithelial nasal potential difference has been beneficial in establishing a CF Table 1 Mutations, sites, and molecular consequences associated with either an atypical presentation of CF respiratory disease or pancreatic sufficiency or late-onset pancreatic insufficiency (http:// www.genet.sickkids.on.ca) Mutation Site Consequence Atypical presentation M1210I Exon 19 Met to Ile at 1210 S1455X Exon 24 Ser to Stop at 1455 1811+18G→A Intron 11 mRNA splicing defect L346P Exon 7 Leu to Pro at 346 Y161D Exon 4 Tyr to Asp at 161 R31C Exon 2 Arg to Cys at 31 I752S Exon 13 Ile to Ser at 752 2811G/T Exon 15 Sequence variation Pancreatic sufficiency or late-onset pancreatic insufficiency R600G Exon 13 Arg to Gly at 600 D1152H Exon 18 Asp to His at 1152 Y89C Exon 3 Tyr to Cys at 89 R117H Exon 4 Arg to His at 117 D110E Exon 4 Asp to Glu at 110 296 + 3insT Intron 2 mRNA splicing defect E217G Exon 6a Glu to Gly at 217 V392G Exon 8 Val to Gly at 392 N1088D Exon 17b Asn to Asp at 1088 S737F Exon 13 Missense 1716+1G→A Intron 10 mRNA splicing defect R334W Exon 7 Arg to Trp at 334 R347P Exon 7 Arg to Pro at 347 A455E Exon 9 Ala to Glu at 455 P574H Exon 12 Pro to His at 574 3850-3T→G Intron 19 mRNA splicing defect diagnosis in many atypical cases. Login to comment

[hide] Atomic model of human cystic fibrosis transmembran... Cell Mol Life Sci. 2008 Aug;65(16):2594-612. Mornon JP, Lehn P, Callebaut I
Atomic model of human cystic fibrosis transmembrane conductance regulator: membrane-spanning domains and coupling interfaces.
Cell Mol Life Sci. 2008 Aug;65(16):2594-612., [PMID:18597042]

Abstract [show]
We describe herein an atomic model of the outward-facing three-dimensional structure of the membrane-spanning domains (MSDs) and nucleotide-binding domains (NBDs) of human cystic fibrosis transmembrane conductance regulator (CFTR), based on the experimental structure of the bacterial transporter Sav1866. This model, which is in agreement with previous experimental data, highlights the role of some residues located in the transmembrane passages and directly involved in substrate translocation and of some residues within the intracellular loops (ICL1-ICL4) making MSD/NBD contacts. In particular, our model reveals that D173 ICL1 and N965 ICL3 likely interact with the bound nucleotide and that an intricate H-bond network (involving especially the ICL4 R1070 and the main chain of NBD1 F508) may stabilize the interface between MSD2 and the NBD1F508 region. These observations allow new insights into the ATP-binding sites asymmetry and into the molecular consequences of the F508 deletion, which is the most common cystic fibrosis mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
205 The fact that the CF-causing mutations M1137V, I1139V, D1152H and D1154G also interfere with the proper gating of the chloride channel [71] is in good agreement with such an hypothesis. Login to comment

[hide] Localization studies of rare missense mutations in... Hum Mutat. 2008 Nov;29(11):1364-72. Krasnov KV, Tzetis M, Cheng J, Guggino WB, Cutting GR
Localization studies of rare missense mutations in cystic fibrosis transmembrane conductance regulator (CFTR) facilitate interpretation of genotype-phenotype relationships.
Hum Mutat. 2008 Nov;29(11):1364-72., [PMID:18951463]

Abstract [show]
We have been investigating the functional consequences of rare disease-associated amino acid substitutions in the cystic fibrosis transmembrane conductance regulator (CFTR). Mutations of the arginine residue at codon 1070 have been associated with different disease consequences; R1070P and R1070Q with "severe" pancreatic insufficient cystic fibrosis (CF) and R1070W with "mild" pancreatic sufficient CF or congenital bilateral absence of the vas deferens. Intriguingly, CFTR bearing each of these mutations is functional when expressed in nonpolarized cells. To determine whether R1070 mutations cause disease by affecting CFTR localization, we created polarized Madin Darby canine kidney (MDCK) cell lines that express either wild-type or mutant CFTR from the same genomic integration site. Confocal microscopy and biotinylation studies revealed that R1070P was not inserted into the apical membrane, R1070W was inserted at levels reduced from wild-type while R1070Q was present in the apical membrane at levels comparable to wild-type. The abnormal localization of CFTR bearing R1070P and R1070W was consistent with deleterious consequences in patients; however, the profile of CFTR R1070Q was inconsistent with a "severe" phenotype. Reanalysis of 16 patients with the R1070Q mutation revealed that 11 carried an in cis nonsense mutation, S466X. All 11 patients carrying the complex allele R1070Q-S466X had severe disease, while 4 out of 5 patients with R1070Q had "mild" disease, thereby reconciling the apparent discrepancy between the localization studies of R1070Q and the phenotype of patients bearing this mutation. Our results emphasize that localization studies in relevant model systems can greatly assist the interpretation of the disease-causing potential of rare missense mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
171 Of those with CBAVD, one patient carried a mutation known to cause pancreatic insufficient CF (S549N [c.1646G4A; p.Ser549Asn]), a second patient carried a mutation associated with CBAVD (D1152 H [c.3454G4C; p.Asp1152His]), and the third carried a mutation of unknown disease association (F1337 V [c.4009T4G; Phe1337Val]). Login to comment

[hide] [The diagnosis of cystic fibrosis in adults: lesso... Rev Mal Respir. 2009 Jan;26(1):67-73. Coman T, Fajac I, Bienvenu T, Desmazes-Dufeu N, Hubert D, Kanaan R, Dusser D, Burgel PR
[The diagnosis of cystic fibrosis in adults: lessons from a family story].
Rev Mal Respir. 2009 Jan;26(1):67-73., [PMID:19212293]

Abstract [show]
INTRODUCTION: Cystic fibrosis is usually diagnosed during the first years of life. Diagnosis may be achieved in adults with milder forms of the disease at any age. CASE REPORTS: We report the diagnosis of cystic fibrosis in three adults within the same family. A 39 yr old man, was diagnosed with congenital absence of the vas deferens; the diagnosis of cystic fibrosis was achieved based on a positive chloride sweat test and the identification of two mutations in the CFTR gene. His mother experienced repeated bronchial infections that began when she was 12 years old. The diagnosis of cystic fibrosis was considered at the age of 74 yr after her son was diagnosed with this disease. Sweat test showed normal chloride concentrations and cystic fibrosis was suspected based on elevated basal transepithelial nasal potential difference. Genetic testing for the 33 most frequent mutations in the CFTR gene showed only one mutation. A second rare mutation was identified by complete sequencing of the CFTR gene, confirming the diagnosis of cystic fibrosis. A third case of pauci-symptomatic cystic fibrosis was diagnosed in a brother of the index case. CONCLUSION: These observations illustrate the challenge of diagnosing milder forms of cystic fibrosis in adult subjects. The recognition of this diagnosis may lead to improvement in patient's care and to genetic counselling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Un séquençage complet du gène CFTR met en évidence une seconde mutation (D1152H), confirmant le diagnostic de mucoviscidose (génotype W1282X :D1152H). Login to comment

[hide] Mutation-specific potency and efficacy of cystic f... J Pharmacol Exp Ther. 2009 Sep;330(3):783-91. Epub 2009 Jun 2. Caputo A, Hinzpeter A, Caci E, Pedemonte N, Arous N, Di Duca M, Zegarra-Moran O, Fanen P, Galietta LJ
Mutation-specific potency and efficacy of cystic fibrosis transmembrane conductance regulator chloride channel potentiators.
J Pharmacol Exp Ther. 2009 Sep;330(3):783-91. Epub 2009 Jun 2., [PMID:19491324]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel. The mutations G551D and G1349D, which affect the nucleotide-binding domains (NBDs) of CFTR protein, reduce channel activity. This defect can be corrected pharmacologically by small molecules called potentiators. CF mutations residing in the intracellular loops (ICLs), connecting the transmembrane segments of CFTR, may also reduce channel activity. We have investigated the extent of loss of function caused by ICL mutations and the sensitivity to pharmacological stimulation. We found that E193K and G970R (in ICL1 and ICL3, respectively) cause a severe loss of CFTR channel activity that can be rescued by the same potentiators that are effective on NBD mutations. We compared potency and efficacy of three different potentiators for E193K, G970R, and G551D. The 1,4-dihydropyridine felodipine and the phenylglycine PG-01 [2-[(2-1H-indol-3-yl-acetyl)-methylamino]-N-(4-isopropylphenyl)-2-phenylac etamide] were strongly effective on the three CFTR mutants. The efficacy of sulfonamide SF-01 [6-(ethylphenylsulfamoyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic acid cycloheptylamide], another CFTR potentiator, was instead significantly lower than felodipine and PG-01 for the E193K and G970R mutations, and almost abolished for G551D. Furthermore, SF-01 modified the response of G551D and G970R to the other two potentiators, an effect that may be explained by an allosteric antagonistic effect. Our results indicate that CFTR potentiators correct the basic defect caused by CF mutations residing in different CFTR domains. However, there are differences among potentiators, with felodipine and PG-01 having a wider pharmacological activity, and SF-01 being more mutation specific. Our observations are useful in the prioritization and development of drugs targeting the CF basic defect.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 We also considered D1152H, a mutation residing at the end of last transmembrane segment, which has a reduced activity and showed responsiveness to potentiators in primary cultures of airway epithelial cells (Vankeerberghen et al., 1998; Pedemonte et al., 2005a). Login to comment
98 D1152H was significantly more active than E193K and G970R but approximately five times less than the wild-type protein. Login to comment
116 E193K, G970R, and D1152H. Login to comment
220 We took into consideration various mutations in ICL1, G970R in ICL3, and D1152H, which lies between the last transmembrane segment and NBD2. Login to comment
221 Our results show that E193K, G970R, and, to a lesser extent, D1152H cause a marked decrease in CFTR activity. Login to comment

[hide] Sweat gland bioelectrics differ in cystic fibrosis... Thorax. 2009 Nov;64(11):932-8. Epub 2009 Sep 3. Gonska T, Ip W, Turner D, Han WS, Rose J, Durie P, Quinton P
Sweat gland bioelectrics differ in cystic fibrosis: a new concept for potential diagnosis and assessment of CFTR function in cystic fibrosis.
Thorax. 2009 Nov;64(11):932-8. Epub 2009 Sep 3., [PMID:19734129]

Abstract [show]
BACKGROUND: For nearly 50 years the diagnosis of cystic fibrosis (CF) has depended on measurements of sweat chloride concentration. While the validity of this test is universally accepted, increasing diagnostic challenges and the search for adequate biomarker assays to support curative-orientated clinical drug trials have created a new demand for accurate, reliable and more practical CF tests. A novel concept is proposed that may provide a more efficient real-time method for assessing CFTR function in vivo. METHODS: Cholinergic and beta-adrenergic agonists were iontophoresed to stimulate sweating. The bioelectric potential from stimulated sweat glands (SPD) was measured in vivo using a standard ECG electrode applied to the skin surface. SPD and sweat chloride concentrations were compared in cohorts predicted to express a range of CFTR function as presented by healthy controls (HC), heterozygotes (Hz), pancreatic sufficient (CFPS) and pancreatic insufficient patients with CF (CFPI). RESULTS: The median SPD was hyperpolarized in patients with CF compared with control subjects (-47.4 mV vs -14.5 mV, p<0.001). In distinguishing between control and CF subjects, SPD (area under receiver operator curve (AUC) = 0.997) was similar to sweat chloride concentration (AUC = 0.986). Sequential cholinergic/beta-adrenergic sweat stimulation dramatically depolarised the SPD in patients with CF (p<0.001) but had no effect in control subjects (p = 0.6) or on the sweat chloride concentration in either group (p>0.5). Furthermore, the positive SPD response was larger in CFPI than in CFPS subjects (p = 0.04). CONCLUSION: These results support the concept that skin surface voltages arising from stimulated sweat glands can be exploited to assess expressed CFTR function in vivo and may prove to be a useful diagnostic tool.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Table 1 Summary of study subjects ID Category Sex Age Genotype ID Category Sex Age Genotype 1 HC F 49 +/+ 21 CFPS M 46 deltaF508/P67L 2 HC F 39 +/+ 22 CFPS F 41 deltaF508/R117C 3 HC M 32 +/+ 23 CFPS F 57 G542X/D1152H 4 HC M 23 +/+ 24 CFPS M 34 deltaF508/M1101K 5 HC F 28 +/+ 25 CFPS F 29 deltaF508/L1335P 6 HC M 26 +/+ 26 CFPS F 48 deltaF508/+ 7 HC M 26 R75Q/+ 27 CFPS M 26 deltaF508/R117H 8 HC M 30 +/+ 28 CFPS M 44 deltaF508/3272_26A.G 9 HC M 22 +/+ 29 CFPS M 46 deltaF508/R117H 5T 10 HC M 22 +/+ 30 CFPS M 48 R347P/2753-2A.G 11 Hz F 26 deltaF508/+ 31 CFPI M 29 deltaF508/deltaF508 12 Hz F 54 deltaF508/+ 32 CFPI M 29 deltaF508/2194inA 13 Hz F 24 deltaF508/+ 33 CFPI F 40 G551D/621+1 G.T 14 Hz F 33 deltaF508/+ 34 CFPI M 33 deltaF508/deltaF508 15 Hz M 25 deltaF508/+ 35 CFPI M 27 deltaF508/deltaF508 16 Hz F 37 deltaF508/+ 36 CFPI M 25 deltaF508/deltaF508 17 Hz F 49 deltaF508/+ 37 CFPI M 27 deltaF508/deltaF508 18 Hz M 49 deltaF508/+ 38 CFPI M 29 deltaF508/deltaF508 19 Hz F 55 deltaF508/+ 20 Hz M 61 deltaF508/+ CFPI, pancreatic-insufficient CF patients; CFPS, pancreatic-sufficient CF patients; HC, healthy controls; Hz, heterozygotes. Login to comment

[hide] Non-classic cystic fibrosis associated with D1152H... Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15. Burgel PR, Fajac I, Hubert D, Grenet D, Stremler N, Roussey M, Siret D, Languepin J, Mely L, Fanton A, Labbe A, Domblides P, Vic P, Dagorne M, Reynaud-Gaubert M, Counil F, Varaigne F, Bienvenu T, Bellis G, Dusser D
Non-classic cystic fibrosis associated with D1152H CFTR mutation.
Clin Genet. 2010 Apr;77(4):355-64. Epub 2009 Oct 15., [PMID:19843100]

Abstract [show]
BACKGROUND: Limited knowledge exists on phenotypes associated with the D1152H cystic fibrosis transmembrane conductance regulator (CFTR) mutation. METHODS: Subjects with a D1152H allele in trans with another CFTR mutation were identified using the French Cystic Fibrosis Registry. Phenotypic characteristics were compared with those of pancreatic insufficient (PI) and pancreatic sufficient (PS) cystic fibrosis (CF) subjects in the Registry (CF cohort). RESULTS: Forty-two subjects with D1152H alleles were identified. Features leading to diagnosis included chronic sinopulmonary disease (n = 25), congenital absence of the vas deferens (n = 11), systematic neonatal screening (n = 4), and genetic counseling (n = 2). Median age at diagnosis was 33 [interquartile range (IQR, 24-41)] years in D1152H subjects. Median sweat chloride concentrations were 43.5 (39-63) mmol/l in D1152H subjects and were markedly lower than in PI and PS CF subjects (p < 0.05). Bronchiectasis was present in 67% of D1152H subjects, but Pseudomonas aeruginosa colonization and pancreatic insufficiency were present in <30% of subjects. Estimated rates of decline in forced expiratory volume in 1 s (FEV(1)) were lower in D1152H subjects vs PI CF subjects (p < 0.05). None of the D1152H subjects identified since 1999 had died or required lung transplantation. CONCLUSIONS: When present in trans with a CF-causing mutation, D1152H causes significant pulmonary disease, but all subjects had prolonged survival.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 All rights reserved (c) 2009 John Wiley & Sons A/S CLINICAL GENETICS doi: 10.1111/j.1399-0004.2009.01294.x Short Report Non-classic cystic fibrosis associated with D1152H CFTR mutation Burgel P-R, Fajac I, Hubert D, Grenet D, Stremler N, Roussey M, Siret D, Languepin J, Mely L, Fanton A, Labb´e A, Domblides P, Vic P, Dagorne M, Reynaud-Gaubert M, Counil F, Varaigne F, Bienvenu T, Bellis G, Dusser D. Login to comment
2 Non-classic cystic fibrosis associated with D1152H CFTR mutation. Clin Genet 2010: 77: 355-364. Login to comment
3 (c) John Wiley & Sons A/S, 2009 Background: Limited knowledge exists on phenotypes associated with the D1152H cystic fibrosis transmembrane conductance regulator (CFTR) mutation. Login to comment
4 Methods: Subjects with a D1152H allele in trans with another CFTR mutation were identified using the French Cystic Fibrosis Registry. Login to comment
6 Results: Forty-two subjects with D1152H alleles were identified. Login to comment
8 Median age at diagnosis was 33 [interquartile range (IQR, 24-41)] years in D1152H subjects. Login to comment
9 Median sweat chloride concentrations were 43.5 (39-63) mmol/l in D1152H subjects and were markedly lower than in PI and PS CF subjects (p < 0.05). Login to comment
10 Bronchiectasis was present in 67% of D1152H subjects, but Pseudomonas aeruginosa colonization and pancreatic insufficiency were present in <30% of subjects. Login to comment
11 Estimated rates of decline in forced expiratory volume in 1 s (FEV1) were lower in D1152H subjects vs PI CF subjects (p < 0.05). Login to comment
12 None of the D1152H subjects identified since 1999 had died or required lung transplantation. Login to comment
13 Conclusions: When present in trans with a CF-causing mutation, D1152H causes significant pulmonary disease, but all subjects had prolonged survival. Login to comment
14 P-R Burgela, I Fajaca, D Huberta, D Grenetb, N Stremlerc, M Rousseyd, D Sirete , J Languepinf , L Melyg , A Fantonh, A Labb ´ei, P Domblidesj, P Vick, M Dagorned, M Reynaud-Gaubertl , F Counilm, F Varaignen, T Bienvenua, G Belliso and D Dussera aH ˆopital Cochin, APHP, Universit ´e Paris Descartes, Paris, France, bH ˆopital Foch, Suresnes, France, cCHU de la Timone, Marseille, France, dCHU de Rennes, Universit ´e Rennes 1, France, eCH de St Nazaire, St Nazaire, France, fCHU de Limoges, Limoges, France, gCRCM du Var, Giens, France, hCHU le Bocage, Universit ´e de Bourgogne, Dijon, France, iCHRU de Clermont Ferrand, Clermont Ferrand, France, jCHU de Bordeaux, Bordeaux, France, kCentre Hospitalier de Cornouaille, Quimper, France, l CHU Sud Sainte Marguerite, Marseille, France, m CHU Arnaud de Villeneuve, Montpellier, France, n H ˆopital Bretonneau, Tours, France, and o Institut National d`Etudes D ´emographiques, Paris, France Key words: bronchiectasis - congenital absence of the vas deferens - cystic fibrosis transmembrane conductance regulator - D1152H - exocrine pancreatic insufficiency Corresponding author: Pierre-R ´egis Burgel, MD, PhD, Service de Pneumologie, H ˆopital Cochin, 27 rue du Faubourg St Jacques, 75679 Paris Cedex 14, France. Login to comment
20 D1152H is a CFTR mutation characterized by G-to-C base change at base number 3586 (exon 18), resulting in an aspartic acid to histidine substitution at position 1152 of the mature protein (9). Login to comment
21 D1152H is a class IV mutation associated with residual CFTR function (9) and has not been considered consistently as a CF-causing mutation (10, 11). Login to comment
23 The D1152H mutation has been identified in few symptomatic CF subjects (14-16), in male subjects with congenital bilateral absence of the vas deferens (CBAVD) (17, 18), and in limited numbers of subjects undergoing antenatal diagnosis or systematic neonatal screening (15, 19). Login to comment
24 Furthermore, D1152H was recently added to screening panels that are used for pre-marital and pre-natal carrier screening in selected populations (12). Login to comment
26 The D1152H mutation was first reported in a 57-year-old subject with mild pulmonary disease, pancreatic sufficiency and normal sweat chloride values (20). Login to comment
28 Mussaffi et al. studied nine CF subjects carrying the D1152H mutation and concluded that their phenotypes were widely variable: although some subjects showed no sign of disease, lung disease was evident from infancy in others and was severe in some adults (15). Login to comment
29 Thus, characterization of the clinical phenotype associated with D1152H mutation in the CFTR gene in large series of subjects appears important to provide guidance for pre-natal counseling and information for families of children diagnosed by neonatal screening. Login to comment
30 In the present study, we analyzed phenotypic manifestations in subjects carrying two CFTR mutations, including a D1152H allele, on separate chromosomes (i.e. in trans) using data from the French Cystic Fibrosis Registry, which represent more than 80% of the French CF population. Login to comment
32 Methods Identification of D1152H subjects The French Cystic Fibrosis Registry contains data from CF subjects collected by the CF care centers (n = 4744 subjects), representing more than 80% of the French CF population. Login to comment
34 The Registry was screened from 1999 to 2005 to identify subjects carrying the D1152H mutation in trans with another CF mutation. Login to comment
40 The p.D1152H mutation (abbreviated D1152H) is a CFTR mutation characterized by G-to-C base change at base number 3586 (exon 18, c.3454 according to the recommended international nomenclature with the A of the ATG start codon numbered as +1), resulting in an aspartic acid to histidine substitution at position 1152 of the mature protein (9). Login to comment
43 The D1152H mutation is not included in this panel and is also not included in the panel used in the systematic neonatal screening performed in France since 2002 (CF30 Elucigen ARMS Kit). Login to comment
44 Thus, the D1152H mutation was identified in all patients by extensive CFTR mutation analysis after the finding of one common CFTR mutation and/or because of clinical suspicion of CF (10). Login to comment
55 In D1152H subjects, pancreatic status was further confirmed using fecal elastase measurements. Login to comment
61 Selection of the CF cohort subjects To compare the D1152H subjects with a group of CF cohort subjects, we selected subjects from the French Cystic Fibrosis Registry cohort as follows. Login to comment
65 We compared age at diagnosis, age at last evaluation, sweat chloride concentrations, pancreatic and nutritional status, and airway colonization by Pseudomonas aeruginosa between D1152H and PI and PS CF cohort subjects. Login to comment
66 Severity of pulmonary involvement was evaluated using FEV1 and FVC (percentage predicted); in these studies, data were available only in subjects over 6 years (n = 39 for D1152H subjects vs n = 2900 for CF subjects). Login to comment
68 Comparisons of data obtained in D1152H subjects and in PI and PS CF cohort subjects were performed using anova test followed by Tukey`s test for multiple comparisons (for normally distributed variables) or chi-squared tests (for categorical variables). Login to comment
71 Results Genotypes and clinical characteristics at diagnosis in D1152H subjects We identified 42 subjects carrying at least one D1152H allele in trans with another CFTR mutation (41 compound heterozygotes and 1 homozygote) in a nationwide basis in France. Login to comment
77 Sweat chloride concentrations and nasal PDs in D1152H and in CF cohort subjects Sweat chloride concentrations were available in 38 of 42 (90.5%) D1152H subjects and in 2300 of 3570 (64%) CF cohort subjects. Login to comment
78 Sweat chloride concentrations were lower in D1152H subjects than in PI and in PS CF subjects (p < 0.05; Fig. 1). Login to comment
79 Sweat chloride concentrations were normal (<40 mmol/l) in 13 of 38 (34.2%) D1152H subjects vs 10 of 1887 (0.5%) PI CF subjects and 25 of 413 (6.1%) PS CF subjects. Login to comment
80 Concentrations in the intermediate range (40-60 mmol/l) were found in 14 of 38 (36.8%) D1152H subjects vs 53 of 1887 (2.8%) PI CF subjects and 43 of 413 (10.4%) PS CF subjects. Login to comment
81 Elevated concentrations (>60 mmol/l) were found in 11 of 38 (29.0%) D1152H subjects vs 1824 of 1887 (96.7%) PI CF subjects and 345 of 413 (83.5%) PS CF subjects. Login to comment
82 D1152H subjects were less likely to have sweat chloride concentrations >60 mmol/l compared with PI CF subjects (p < 0.0001) and with PS CF subjects (p = 0.07; chi-squared test). Login to comment
83 Nasal PD measurements were performed in eight D1152H subjects in a single center (see Table 2). Login to comment
87 In subject #7, who had normal PD and normal Wilschanski`s index (0.3), the sweat test was also normal and it was the finding of the common 394delTT mutation that prompted the complete CFTR genotyping and the finding of the D1152H mutation. Login to comment
88 Classification of the D1152H subjects according to the consensus report on the diagnosis of CF (10) Based on the recent consensus report on the diagnosis of CF (10), 10 subjects could be classified as having classic CF (sweat chloride >60 mmol/l and clinical symptoms, Fig. 2). Login to comment
91 Four of the F508del/D1152H asymptomatic subjects were diagnosed by systematic neonatal screening and were under 2-year old; the last asymptomatic F508del/D1152H (#33) was diagnosed by genetic counseling and was aged 16 years at last evaluation. Login to comment
92 Characteristics of the D1152H homozygous subject The only D1152H/D1152H subject was diagnosed with male infertility related to CBAVD at the age of 34 years. Login to comment
97 Comparison of clinical characteristics in D1152H and in CF cohort subjects Age at diagnosis and at last evaluation In D1152H subjects, not diagnosed by neonatal screening (n = 38), median age at diagnosis Table 1. Login to comment
98 Diagnostic features in 42 D1152H subjects according to the other CFTR mutation class Subject Sex (M/F) Other CFTR mutation Sweat Cl- mean (mmol/l) Age at diagnosis (years) Presentation at diagnosis Class I mutations 1 F W1282X 58 4 Pneumonia recurrent bronchitis 2 F W1282X 25 74 Bronchiectasis 3 M W1282X 43 33 CBAVD 4 M G542X 48 39 CBAVD 5 M G542X 72 27 CBAVD 6 F S1206X 18 13 Recurrent bronchitis+ diarrhea 7 F 394delTT 19 41 Bronchiectasis 8 F 394delTT 25 18 Bronchiectasis 9 F Q552X 56 43 Bronchiectasis Class II mutations 10 F F508del 13 42 Bronchiectasis 11 F F508del 40 32 Bronchiectasis 12 F F508del 52 23 Bronchiectasis 13 M F508del 51 15 Bronchiectasis 14 F F508del 100 24 Bronchiectasis 15 M F508del 79 26 Bronchiectasis 16 F F508del - 43 Bronchiectasis 17 M F508del - 23 Bronchiectasis 18 F F508del 19 55 Bronchiectasis 19 F F508del 25 33 Bronchiectasis 20 F F508del 78 15 Bronchiectasis 21 M F508del 90 40 Bronchiectasis 22 F F508del 44 42 Bronchiectasis 23 M F508del 88 11 Bronchiectasis 24 F F508del 63 47 Bronchiectasis 25 F F508del 43 33 Bronchiectasis 26 M F508 del 62 49 Bronchiectasis 27 M F508del 20 - CBAVD 28 M F508del - 27 CBAVD 29 M F508del 42 36 CBAVD 30 M F508del 36 34 CBAVD 31 M F508del 40 36 CBAVD 32 M F508del 41 30 CBAVD 33 M F508del 82 9 Asymptomatic genetic counseling 34 M F508del - 0 Neonatal screening 35 F F508del 53 0 Neonatal screening 36 F F508del 35 0 Neonatal screening 37 M F508del 35 0 Neonatal screening Class III mutation 38 F S549N 75 31 Bronchiectasis Class IV mutations 39 M E116K 80 41 ABPA+ diarrhea 40 M D1152H 34 34 CBAVD 41 M R1070Q 56 38 CBAVD Class V mutation 42 M 3849+10kbC>T 31 40 Asymptomatic genetic counseling ABPA, allergic bronchopulmonary aspergillosis; CBAVD, congenital bilateral absence of the vas deferens. Login to comment
100 When compared to PI (n = 3041) and PS (n = 529) CF subjects not diagnosed by neonatal screening in the Registry, age at diagnosis and age at last evaluation were markedly higher in D1152H subjects (p < 0.05; see Fig. 3). Login to comment
101 None of the D1152H subjects identified in this study (n = 42) had died or required lung transplantation at the time of writing. Login to comment
102 Respiratory manifestations Respiratory symptoms were present in 34 of the 42 (80.9%) D1152H subjects; among them, 28 (66.7%) had bronchiectasis (as demonstrated by D1152HCF cohort 0 50 100 150 Sweat chloride concentrations (mmol/l) PI PS P<0.05 P<0.05 P<0.05 Fig. 1. Login to comment
103 Sweat chloride concentrations in CF cohort and in D1152H subjects. Login to comment
104 Sweat chloride concentrations were compared using available data obtained in pancreatic insufficient (PI, n = 1887) and in pancreatic sufficient (PS, n = 413) CF cohort subjects and in D1152H subjects (n = 38). Login to comment
107 Bronchial colonization with at least one pathogen characteristic of CF (H. influenzae, P. aeruginosa, Staphylococcus aureus, and S. maltophilia) was present in 29 of the 42 (69.0%) D1152H subjects. Login to comment
108 Pulmonary function tests were available in all D1152H subjects except in three young children. Login to comment
110 Estimated annual rates of decline in FEV1 and in FVC were considerably lower in D1152H compared with PI CF cohort subjects. Login to comment
111 Decline in lung function in D1152H subjects was not significantly different from PS CF cohort subjects (Table 3 and Fig. 4). Login to comment
112 Colonization with P. aeruginosa was present in only 11 of the 42 (26.2%) D1152H subjects, a rate that was lower than in PI CF cohort subjects, but was comparable with findings in PS CF subjects (see Table 3). Login to comment
113 Within the D1152H group, subjects colonized with P. aeruginosa (n = 11) had a higher estimated annual rate of decline in FEV1 and in FVC compared to those non-colonized with P. aeruginosa (n = 28): 1.00 ± 0.59% vs 0.45 ± 0.72% (p = 0.03) and 0.65 ± 0.42% vs 0.34 ± 0.59% (p = 0.13), respectively. Login to comment
114 Nutritional and pancreatic status In adults (age > 16 years), median BMI was higher in D1152H adult subjects (n = 37) compared with adult PI and PS CF cohort subjects (p < 0.05, Table 3). Login to comment
115 None of the D1152H adult subjects had a BMI < 18 kg/m2 and the five D1152H children had normal nutritional status (IBW > 90% predicted, not shown). Login to comment
116 Pancreatic insufficiency was diagnosed in 12 of the 42 (28.6%) D1152H subjects (11 adults and 1 child, all with a second class I or class II mutation), and was significantly less prevalent than in CF cohort subjects (p < 0.001, Table 3). Login to comment
120 Nasal epithelial physiologic properties in eight CF subjects carrying the D1152H mutation Nasal bioelectric properties Subject Other CFTR mutation Sweat Cl- mean (mmol/l) Maximal PD (mV) Amil (mV) Cl-/amil (mV) Iso/Cl- (mV) Wilchanski`s indexa Class I mutations 2 W1282X 25 -44 38 -2 -14 0.7 3 W1282X 43 -34 9 -1 1 1.0 4 G542X 48 -16 12 -3 -1 0.7 6 S1206X 18 -44 28 -11 0 0.7 7 394delTT 19 -25 25 -15 -15 0.3 8 394delTT 25 -42 23 -4 -4 0.7 Class II mutation 18 F508del 19 -19 9 0 0 1.0 Class V mutation 42 3849+10 kb C>T 31 -19 9 1 3 1.6 Cl- , chloride; PD, potential difference; Amil, amiloride; Iso, isoproterenol. Login to comment
122 D1152H subjects n=42 sweat chloride concentrations Clinical symptoms* Yes No n=13 n=1 Asymptomatic at age 16 yr. F508del 40-59 mmol/l n=14 Yes No n=10 n=1 ≤39 mmol/l n=13 unknown n=4 ≤60 mmol/l n=11 Yes No n=10 n=3 Nonclassic CF asymptomatic at age 1 yr. F508del asymptomatic at age • 1yr (n=1). Login to comment
126 Clinical features in 42 D1152H subjects according to sweat chloride concentrations and symptoms. Login to comment
129 Comparison of clinical characteristics between CF cohort and D1152H subjects CF cohort (n = 3570) Variables PI (n = 3041) PS (n = 529) D1152H (n = 42) Male, n (%) 1620 (53) 273 (52) 22 (52) FEV1, percentage predicteda 70 (45; 91) 82 (57; 99)c 89 (56; 100)c Estimated annual loss in FEV1, percentage predicted 1.56 (0.54; 2.56) 0.78 (0.09; 1.61)c 0.37 (0.00; 0.89)c FVC, percentage predicteda 83 (64; 98) 90 (74; 102)c 92 (72; 105) Estimated annual loss in FVC, percentage predicted 0.86 (0.12; 1.74) 0.42 (-0.13; 1.12) 0.24 (-0.16; 0.77) Pseudomonas aeruginosa colonization, n (%)b 1586 (54.8) 137 (30.0)c 11 (26.2)c BMI, kg/m2 Median (IQR) 19.4 (17.9; 21.1) 20.9 (19.3; 22.7)c 21.9 (20.7; 24.9)c,d BMI ≥ 20, n (%) 650 (39.9) 198 (64.3)c 30 (81.1)c,d BMI < 20, n (%) 981 (60.1) 110 (35.7)c 7 (18.9)c,d All data are shown as median (IQR) or numbers of patients (%) in each group. Login to comment
132 a Based on available data in D1152H subjects (n = 39), PI CF subjects (n = 2483) and PS CF subjects (n = 442) over 6 years. Login to comment
133 bBased on available data in D1152H subjects (n = 39), PI CF subjects (n = 2897) and PS CF subjects (n = 457). Login to comment
136 with a D1152H CFTR mutation in trans with another CFTR mutation. Login to comment
139 Comparison of age at diagnosis (left) and age at last evaluation (right) between cystic fibrosis (CF) cohort subjects and D1152H subjects. Login to comment
140 Age at diagnosis and age at last evaluation were compared in subjects not diagnosed by systematic neonatal screening in pancreatic insufficient (n = 3041) and pancreatic sufficient (n = 529) CF cohort subjects vs D1152H subjects (n = 38). Login to comment
142 Estimated annual decline (% predicted) 0 1.5 3 4.5 -0.5 P<0.05 D1152H FEV1 CF cohort PI PS NS P<0.05 D1152H FVC CF cohort PI PS NS NS P<0.05 FEV1 PI PS FVC PI PS FEV1FEV1 FVCFVC Fig. 4. Login to comment
143 Estimated annual decline in forced expiratory volume in 1 s (FEV1) and in forced vital capacity (FVC) in cystic fibrosis (CF) cohort and in D1152H subjects. Login to comment
144 Estimated annual decline in FEV1 and FVC were calculated as described in Methods (27), using available data obtained in pancreatic insufficient (PI, n = 2483) and in pancreatic sufficient (PS, n = 442) CF cohort subjects and in D1152H subjects (n = 39). Login to comment
147 However, the estimated annual rate of decline in FEV1 was extremely low in D1152H subjects and two-third of these subjects had an FEV1 > 80% at the time of last evaluation. Login to comment
149 Asymptomatic subjects were infrequent in subjects carrying D1152H with a severe CFTR mutation and were found exclusively among neonates and children. Login to comment
150 We conclude that D1152H is a mutation that when present in trans with a CF-causing mutation, can cause a variable phenotype, ranging from normal to CF, usually characterized by mild pulmonary disease and pancreatic sufficiency. Login to comment
152 However, it is likely that all subjects carrying the D1152H mutation in trans with another CFTR mutation in France were not identified. Login to comment
153 First, subjects with milder forms of the disease (e.g. CFTR-related disease) are less likely to be diagnosed based on clinical symptoms, suggesting that our cohort represents the most severe aspects of D1152H-associated disease. Login to comment
154 Next, in the 2005 French Cystic Fibrosis Registry, 11.7% of the subjects has at least one unidentified CFTR mutation; it is conceivable that D1152H mutation was not identified in some of these subjects. Login to comment
155 However, due to the low frequency of the D1152H mutation in France, the possible number (if any) of undiagnosed D1152H mutation among CF subjects with unidentified mutation is probably very low and is unlikely to alter our conclusions. Login to comment
156 Our data confirm and extend the report by Mussaffi et al. who studied nine D1152H subjects and suggested that subjects carrying the D1152H mutation in trans with another CFTR mutation may show a wide range of disease severities (15). Login to comment
157 Part of the phenotypic variability found in D1152H subjects may be related to the other CFTR mutations, which determine the residual level of CFTR function. Login to comment
158 Variable phenotypes were also found in subjects with the same CFTR genotype (e.g. F508del/D1152H). Login to comment
160 The design of this Registry study did not allow for extensive characterization of disease modifying variants in D1152H subjects. Login to comment
161 Clearly, additional studies will be required to fully understand mechanisms of phenotypic variability in D1152H subjects. Login to comment
162 The clinical significance of the D1152H mutation in trans with another CFTR mutation has been matter of debate because only limited numbers of subjects with this genotype have been studied (14, 15). Login to comment
163 Thus, in a recent consensus report on the diagnosis of CF, D1152H was not included in the list of CF-causing mutations (10). Login to comment
164 In another recent consensus report, it was suggested that D1152H/F508del subjects may show a clinical spectrum ranging from CBAVD to CF; these authors suggested that D1152H was a 'borderline` mutation that could be classified either as CF-causing or CFTR-related disorders associated mutation (11). Login to comment
165 Our results combined with previous literature indicate that (i) D1152H causes a change in amino sequence that affects CFTR function in vitro (9), (ii) D1152H is detected in a set number of unrelated individuals with CF as shown in our study, (iii) frequency in the general population is probably low: we found only one D1152H homozygous subject in France. Login to comment
166 Furthermore, in an analysis of 116 healthy subjects in a single genetic laboratory, we found no D1152H mutation (frequency 0 of the 232 alleles; personal communication, Dr Bienvenu). Login to comment
167 (iv) Asymptomatic D1152H/F508del subjects were infrequent and always found in neonates or children in whom clinical manifestations may occur later due to the age-related progression of the disease. Login to comment
168 Although our findings may need to be replicated in another cohort, these results strongly support the recent statement (11) that D1152H should be added to the list of CF-causing mutations and CFTR-related associated mutations. Login to comment
169 Prolonged survival has been previously reported in subjects carrying the D1152H mutation as well as in subjects carrying class IV or class V CFTR mutations (5, 30). Login to comment
171 However, it is noteworthy that none of the D1152H subjects identified since 1999 had died or required lung transplantation. Login to comment
172 More than 50% of D1152H subjects were >40 years at last evaluation. Login to comment
173 Taken together, these results indicate that D1152H allele is associated with one of the most prolonged survival in CF subjects, as previously suggested in case reports (14, 20, 25, 31) and in a small series of cases (15). Login to comment
174 In summary, we report on the first large series of subjects with a D1152H in trans with another CFTR mutation and we suggest that D1152H is a disease causing mutation. Login to comment
176 Although individual outcomes remain unpredictable, these data provide important information that may be of particular interest to subjects and to parents of children who receive a diagnosis of D1152H-associated CF. Login to comment

[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT. Login to comment
89 Mutations found in the homozygous (n=2) and heterozygous (n=20) diagnosed foetuses are the following: ΔF508/ΔF508 (n=1), 711+5G→A/711+5G→A (n=1), ΔF508/P5L (n=1), 2183AA→G/S42F (n=1), ΔF508/ D1445N (n=1), 711+5G→A/ΔF508 (n=1), G542X/E527G (n=1), N1303K/1717-1 G→A (n=1), R117H/E527G (n=1), ΔF508/2183AA→G (n=1), ΔF508/D1152H (n=1), R347H/ ΔF508 (n=1), ΔF508/G542X (n=2), ΔF508/N1303K (n=2), R1162X/ΔF508 (n=3), N1303K/D1152H (n=3). Login to comment
97 CF mutation General adult population MAR population n=1879 n=236 ΔF508 42.6 45.7 2183AA→G 5.9 5.9 R1162X 5.7 8.2 N1303K 5.4 5.9 G542X 4.2 3.7 D1152H 3.9 5.0 R553X 3.7 3.1 R117H 3.3 1.8 711+5G→A 2.8 4.1 Q552X 2.8 0.4 2789+5G→A 2.2 3.1 1717-1G→A 2.6 2.8 E527G 2.4 - G85E 2.4 0.9 R334Q 0.9 0.4 W1282X 0.7 0.9 R334W 0.6 - 1898+3A→G 0.5 0.4 R1158X 0.4 - R1066H 0.4 0.4 T338I 0.4 1.8 3849+10Kb C→T 0.4 1.3 3272-26 A→G - 0.9 3132delTG - 0.9 3659 del C - 0.4 4016 ins T - 0.4 1717-8G→A - 0.4 R347H - 0.4 ΔI507 - 0.4 R1070Q - 0.4 Other (16) 5.4 - Table 2a List of CFTR compound heterozygotes in the adult general population. Mutation Health status Disorder Gender Age (years) Notes and refs ΔF508/A238V Infertile CBAVD M 36 (A) ΔF508/R352W Infertile CBAVD M 45 (A) R553X/R334Q M 38 ΔF508/R347H M 53 [17] S42F/D372E (1251T→G) M 39 (A) (B) ΔF508/D110H Infertile M 38 ΔF508/L1414S (4373T→C) Infertile CBAVD M 44 (A) (B) ΔF508/V201M, D1270N & R74W Infertile CBAVD M 44 (A) [18,19] 2183AA→G/L206W Infertile CBAVD M 40 (A) 711+5G→A/ L206W Infertile CBAVD M 40 (A) Table 2b List of CFTR compound heterozygotes in the population enrolled for medically assisted reproduction. Login to comment
98 Mutation Disorder Gender Age (years) Notes and refs ΔF508/R117H M 47 (C) [20,21] ΔF508/R117H F 36 (C) [20,21] ΔF508/R117H M 43 (C) [20,21] G542X/D1152H M 40 (C) R1162X/2789+5G→A CBAVD M 44 (C) R117H/2789+5G→A CBAVD M 42 (C) N1303K/D110H CBAVD M 32 (C) N1303K/D1152H M 40 (C) 2789+5G→A/R1066H M 40 (C) Abbreviations: CBAVD: Congenital Bilateral Absence of the Vas Deference; M: Male; F: Female. Login to comment
105 Among the subjects tested, 9 resulted to be compound heterozygotes: ΔF508/R117H (n=3), G542X/D1152H (n=1), R1162X/2789+5G→A (n=1), R117H/2789 + 5G→A (n = 1), N1303K/D110H (n = 1), N1303K/D1152H (n = 1), 2789 + 5G→A/R1066H (n = 1) (Table 2b). Login to comment

[hide] Cystic Fibrosis Foundation practice guidelines for... J Pediatr. 2009 Dec;155(6 Suppl):S106-16. Borowitz D, Parad RB, Sharp JK, Sabadosa KA, Robinson KA, Rock MJ, Farrell PM, Sontag MK, Rosenfeld M, Davis SD, Marshall BC, Accurso FJ
Cystic Fibrosis Foundation practice guidelines for the management of infants with cystic fibrosis transmembrane conductance regulator-related metabolic syndrome during the first two years of life and beyond.
J Pediatr. 2009 Dec;155(6 Suppl):S106-16., [PMID:19914443]

Abstract [show]
Through early detection, newborn screening (NBS)(1) for cystic fibrosis (CF) offers the opportunity for early intervention and improved outcomes. NBS programs screen for hypertrypsinogenemia, and most also identify mutations in the CF transmembrane conductance regulator (CFTR) gene. Individuals identified by NBS are diagnosed with CF if they have an elevated sweat chloride level or if they have inherited 2 disease-causing mutations in the CFTR gene. Mutations in the CFTR gene can cause CF, but not all CFTR mutations are disease-causing. The term CFTR-related metabolic syndrome (CRMS) is proposed to describe infants identified by hypertrypsinogenemia on NBS who have sweat chloride values <60 mmol/L and up to 2 CFTR mutations, at least 1 of which is not clearly categorized as a "CF-causing mutation," thus they do not meet CF Foundation guidelines for the diagnosis of CF. With what is now near-universal CF NBS in the United States, an increasing number of infants with CRMS are being identified. Given our inadequate knowledge of the natural history of CRMS, standards for diagnosis, monitoring, and treatment are absent. This document aims to help guide the monitoring and care of individuals with CRMS while our knowledge base on appropriate management evolves.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Up to 7% of infants screened with a trypsinogen/DNA multimutation algorithm in which 2 mutations are identified will have 1 CF-causing mutation and R117H-T7.6 Some individuals with a CF-causing mutation on 1 allele and R117H associated with the T7 intron-8 polythymidine sequence on the other allele may have development of CF-like symptoms (although symptoms are rarely seen in early childhood and may not develop until adulthood.7,8 Others will not develop symptoms.9,10 Some CFTR mutations, including D1152H, have widely variable phenotypes.11 If mutations such as D1152H are found in trans with other phenotypically variable CFTR mutations, such as R117H-T7, an already confounded picture becomes more complicated. Login to comment
58 Mutations such as D1152H and R117H, when compound heterozygous with a disease-causing CFTR mutation may lead to isolated symptoms later in life, such as pancreatitis.12 Intronic Mutations that Affect Splicing Efficiency. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Reprod Biomed Online. 2009 Nov;19(5):685-94. Gallati S, Hess S, Galie-Wunder D, Berger-Menz E, Bohlen D
Cystic fibrosis transmembrane conductance regulator mutations in azoospermic and oligospermic men and their partners.
Reprod Biomed Online. 2009 Nov;19(5):685-94., [PMID:20021716]

Abstract [show]
The objective of this study was to investigate the contribution of cystic fibrosis transmembrane conductance regulator (CFTR) to human infertility and to define screening and counselling procedures for couples asking for assisted reproduction treatment. Extended CFTR mutation screening was performed in 310 infertile men (25 with congenital absence of the vas deferens (CAVD), 116 with non-CAVD azoospermia, 169 with severe oligospermia), 70 female partners and 96 healthy controls. CFTR mutations were detected in the majority (68%) of CAVD patients and in significant proportions in azoospermic (31%) and oligospermic (22%) men. Carrier frequency among partners of infertile men was 16/70, exceeding that of controls (6/96) significantly (P = 0.0005). Thus, in 23% of infertile couples both partners were carriers, increasing the risk for their offspring to inherit two mutations to 25% or 50%. This study emphasizes the necessity to offer extended CFTR mutation screening and counselling not only to patients with CAVD but also to azoospermic and oligozoospermic men and their partners before undergoing assisted reproduction techniques. The identification of rare and/or mild mutations will not be a reason to abstain from parenthood, but will allow adequate treatment in children at risk for atypical or mild cystic fibrosis as soon as they develop any symptoms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 In 70 women whose partners had tested positive for either CFTR mutations or 5T alleles, extended screening of the CFTR gene was also performed revealing a mutation spectrum similar to that of oligospermic men including four 5T alleles, three S1235R, three F508del and one I148T, V754M, V920M, D1152H, 3905insT and Q1352H each (Table 1). Login to comment
99 Couple no. Infertile male CFTR mutation Female partner CFTR mutation Offspring genotype Risk for genotype (%) 01 F508del/wt azoospermia F508del/wt F508del/ F508del 25 F508del/wt 50 wt/wt 25 02 F508del/T5 CAVD F508del/wt F508del/ F508del 25 F508del/T5 25 F508del/wt 25 T5/wt 25 03 F508del/S13Ya azoospermia T5/wt F508del/T5 25 S13Y/T5 25 F508del/wt 25 S13Y/wt 25 04 I148T/wt oligospermia F508del/wt F508del/ I148T 25 I148T/wt 25 F508del/wt 25 wt/wt 25 05 1717À1G>A/wt oligospermia T5/wt 1717À1G>A/ T5 25 1717À1G>A/ wt 25 T5/wt 25 wt/wt 25 06 T5/wt oligospermia 3905insT/wt 3905insT/T5 25 3905insT/wt 25 T5/wt 25 wt/wt 25 07 T5/wt azoospermia D1152H/wt D1152H/T5 25 D1152H/wt 25 T5/wt 25 wt/wt 25 08 T5/F1052V oligospermia S1235R/wt F1052V/ S1235R 25 S1235R/T5 25 F1052V/wt 25 T5/wt 25 09 S1235R/wt oligospermia T5/wt S1235R/T5 25 S1235R/wt 25 T5/wt 25 wt/wt 25 10, 11 T5/wt oligospermia S1235R/wt S1235R/T5 25 S1235R/wt 25 T5/wt 25 wt/wt 25 12 V754M/wt oligospermia T5/wt V754M/T5 25 V754M/wt 25 T5/wt 25 wt/wt 25 13 T5/wt oligospermia Q1352H/wt Q1352H/T5 25 Q1352H/wt 25 T5/wt 25 wt/wt 25 (continued on next page)(continued) female partner is a carrier. Login to comment

[hide] Genetic aspects of pancreatitis. Annu Rev Med. 2010;61:413-24. Whitcomb DC
Genetic aspects of pancreatitis.
Annu Rev Med. 2010;61:413-24., [PMID:20059346]

Abstract [show]
Acute pancreatitis and chronic pancreatitis are complex inflammatory disorders of the pancreas with unpredictable severity, complications, and clinical courses. Growing evidence for genetic risk and modifying factors, plus strong evidence that only a minority of patients with these disorders are heavy alcohol drinkers, has revolutionized our concept of these diseases. Once considered a self-inflicted injury, pancreatitis is now recognized as a complex inflammatory condition like inflammatory bowel disease. Genetic linkage and candidate gene studies have identified six pancreas-targeting factors that are associated with changes in susceptibility to acute and/or chronic pancreatitis, including cationic trypsinogen (PRSS1), anionic trypsinogen (PRSS2), serine protease inhibitor Kazal 1 (SPINK1), cystic fibrosis transmembrane conductance regulator (CFTR), chymotrypsinogen C (CTRC) and calcium-sensing receptor (CASR). Patients with mutations in these genes are at increased risk of pancreatitis caused by a variety of stresses including hyperlipidemia and hypercalcemia. Multiple studies are reporting new polymorphisms, as well as complex gene x gene and gene x environmental interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
154 Other recent case reports and small studies have associated pancreatitis with the following CFTR mutations: D1152H/D1152H (54), W1282X/5T, D1152H/5T, W1282X/- (55), and in Hispanics, S531P/S531P (56). Login to comment
155 Other recent case reports and small studies have associated pancreatitis with the following CFTR mutations: D1152H/D1152H (54), W1282X/5T, D1152H/5T, W1282X/- (55), and in Hispanics, S531P/S531P (56). Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

[hide] Association of cystic fibrosis genetic modifiers w... Fertil Steril. 2010 Nov;94(6):2122-7. Epub 2010 Jan 25. Havasi V, Rowe SM, Kolettis PN, Dayangac D, Sahin A, Grangeia A, Carvalho F, Barros A, Sousa M, Bassas L, Casals T, Sorscher EJ
Association of cystic fibrosis genetic modifiers with congenital bilateral absence of the vas deferens.
Fertil Steril. 2010 Nov;94(6):2122-7. Epub 2010 Jan 25., [PMID:20100616]

Abstract [show]
OBJECTIVE: To investigate whether genetic modifiers of cystic fibrosis (CF) lung disease also predispose to congenital bilateral absence of the vas deferens (CBAVD) in association with cystic fibrosis transmembrane conductance regulator (CFTR) mutations. We tested the hypothesis that polymorphisms of transforming growth factor (TGF)-beta1 (rs 1982073, rs 1800471) and endothelin receptor type A (EDNRA) (rs 5335, rs 1801708) are associated with the CBAVD phenotype. DESIGN: Genotyping of subjects with clinical CBAVD. SETTING: Outpatient and hospital-based clinical evaluation. PATIENT(S): DNA samples from 80 subjects with CBAVD and 51 healthy male controls from various regions of Europe. This is one of the largest genetic studies of this disease to date. INTERVENTION(S): None. MAIN OUTCOME MEASURE(S): Genotype analysis. RESULT(S): For single nucleotide polymorphism (SNP) rs 5335, we found increased frequency of the CC genotype among subjects with CBAVD. The difference was significant among Turkish patients versus controls (45.2% vs. 19.4%), and between all cases versus controls (36% vs. 15.7%). No associations between CBAVD penetrance and polymorphisms rs 1982073, rs 1800471, or rs 1801708 were observed. CONCLUSION(S): Our findings indicate that endothelin receptor type A polymorphism rs 5335 may be associated with CBAVD penetrance. To our knowledge, this is the first study to investigate genetic modifiers relevant to CBAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Portuguese CFTR alleles Spanish CFTR alleles Turkish CFTR alleles 5T 22 F508del 11 5T 20 F508del 14 5T 9 D1152H 14 R334W 5 D443Ya 3 D110H 3 R117H 3 G576Aa 3 F508del 2 S1235R 3 R668Ca 3 3041-11del7 2 N1303K 2 G542X 2 1767del6 2 P205S 2 R117H 2 2789þ5G>A 2 D614G 2 V232D 2 CFTRdele2(ins186) 2 G542X 1 L997F 1 3120þ1G>A 1 L206W 1 H609R 1 G1130A 1 V562I 1 N1303H 1 M952I 1 I507del 1 L206W 1 365insT 1 3272-26A>G 1 3272-26A/G 1 E585X 1 2789þ5G>A 1 L15P 1 2752-15C>G 1 G576Aa 1 R347H 1 R334Q 1 R668Ca 1 2689insG 1 R347H 1 CFTRdele2,3 1 R1070W 1 E831X 1 L1227S 1 I 1027T 1 R1070W 1 E831X 1 3272-26A>G 1 L997F 1 I853F 1 A349V 1 6T 1 Note: CFTR ¼ cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Am J Respir Crit Care Med. 2010 May 15;181(10):1078-84. Epub 2010 Feb 18. Bienvenu T, Sermet-Gaudelus I, Burgel PR, Hubert D, Crestani B, Bassinet L, Dusser D, Fajac I
Cystic fibrosis transmembrane conductance regulator channel dysfunction in non-cystic fibrosis bronchiectasis.
Am J Respir Crit Care Med. 2010 May 15;181(10):1078-84. Epub 2010 Feb 18., 2010-05-15 [PMID:20167849]

Abstract [show]
RATIONALE: Although in patients with diffuse bronchiectasis (DB) and a normal sweat test the presence of one mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene is frequently observed, its pathogenic role in the development of DB remains unclear. OBJECTIVES: To evaluate the association between CFTR heterozygosity and CFTR protein dysfunction in the airways of patients with DB. METHODS: Nasal potential difference was measured in 122 patients with DB of unknown origin and with a normal sweat test (Cl(-) < 60 mmol/L). They were classified according to the presence of CFTR mutations: zero (85 patients), one (22 patients), or two mutations (15 patients). Control groups comprised 26 healthy subjects, 38 obligate heterozygotes for CFTR, and 92 patients with classic cystic fibrosis (CF) with an abnormal sweat test (Cl(-) > or = 60 mmol/L). Patients classified as mild-CF were carrying at least one mild mutation and patients classified as severe-CF were homozygous for the F508del mutation. MEASUREMENTS AND MAIN RESULTS: There was a continuum of airway CFTR dysfunction in the study population as shown by nasal potential difference measurements, ranging from normal values in healthy subjects, to intermediate values in subjects with DB, to highly abnormal values in subjects classified as severe-CF. This continuum of airway CFTR dysfunction was thus strongly associated with defects in the CFTR gene. Moreover, among patients with DB, a similar continuum in intermediate nasal potential difference was identified that was associated with the bearing of zero, one, or two CFTR mutations. These electrophysiological phenotypes and CFTR genotypes were also associated with the clinical phenotype, as shown by the frequency of Staphylococcus aureus and Pseudomonas aeruginosa bronchial colonization. CONCLUSIONS: Our study supports the hypothesis that a unique CFTR mutation may have pathogenic consequences in patients with DB.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 GENOTYPE AND PHENOTYPE OF PATIENTS WITH DIFFUSE BRONCHIECTASIS BEARING TWO CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR MUTATIONS Patient No. Age (yr) Sex (M/F) CFTR Mutations Sweat Cl2 (mmol/L) Basal PD (mV) NPD Index Age at Onset (yr) FEV1 (% pred) Bacteria Colonization 1 55 F F508del/D1152H 19 219 1.00 54 99 Sa 2 71 F F508del/G576A-R668C 29 223 0.44 70 114 None 3 24 M G542X/3849110kbCT 52 224 1.22 10 78 Pa 4 41 F 394delTT/D1152H 19 225 0.30 41 89 Sa 5 31 M 3849110kbC.T/3849110kbC.T 35 230 0.64 2 30 Sa/Pa 6 74 F G542X/S912L 40 233 0.19 60 106 None 7 50 M W1282X/D1152H 35 236 1.00 10 32 Pa 8 42 F F508del/D1152H 13 240 0.68 30 32 Pa 9 56 F F508del/IVS8-5T 30 242 0.70 10 70 None 10 45 F 394delTT/D1152H 25 242 0.71 18 62 Sa/Pa 11 74 F W1282X/D1152H 25 244 0.66 12 56 Pa 12 23 F S1206X/D1152H 19 244 0.68 13 107 None 13 41 F R553X/R851L-T351S 31 248 0.50 35 72 Pa 14 58 M F508del/R117H-7T 46 251 0.61 45 35 Sa/Pa 15 53 F F508del/R347H 49 258 0.63 40 77 Pa Definition of abbreviations: Cl2 5 chloride; F 5 female; M 5 male; NPD index 5 nasal potential difference index 5 e(response to øCl2 and iso/response to amil); a cut off . Login to comment
157 Moreover, 11 patients had at least one mutation (D1152H, 3849110kbC.T, IVS8-5T, R117H) that has been associated with normal or borderline sweat chloride level (36). Login to comment

[hide] Genetic testing in pancreatitis. Gastroenterology. 2010 Jun;138(7):2202-6, 2206.e1. Epub 2010 Apr 20. Ooi CY, Gonska T, Durie PR, Freedman SD
Genetic testing in pancreatitis.
Gastroenterology. 2010 Jun;138(7):2202-6, 2206.e1. Epub 2010 Apr 20., [PMID:20416310]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 aMutations, such as D1152H and F1074L, may be present in CF and CFTR-related disorders. Login to comment

[hide] Identification of the second CFTR mutation in pati... Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26. Giuliani R, Antonucci I, Torrente I, Grammatico P, Palka G, Stuppia L
Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols.
Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26., [PMID:20657600]

Abstract [show]
Congenital bilateral absence of vas deferens (CBAVD) is a manifestation of the mildest form of cystic fibrosis (CF) and is characterized by obstructive azoospermia in otherwise healthy patients. Owing to the availability of assisted reproductive technology, CBAVD patients can father children. These fathers are at risk of transmitting a mutated allele of the CF transmembrane conductance regulator (CFTR) gene, responsible for CF, to their offspring. The identification of mutations in both CFTR alleles in CBAVD patients is a crucial requirement for calculating the risk of producing a child with full-blown CF if the female partner is a healthy CF carrier. However, in the majority of CBAVD patients, conventional mutation screening is not able to detect mutations in both CFTR alleles, and this difficulty hampers the execution of correct genetic counselling. To obtain information about the most represented CFTR mutations in CBAVD patients, we analysed 23 CBAVD patients, 15 of whom had a single CFTR mutation after screening for 36 mutations and the 5T allele. The search for the second CFTR mutation in these cases was performed by using a triplex approach: (i) first, a reverse dot-blot analysis was performed to detect mutations with regional impact; (ii) next, multiple ligation-dependent probe amplification assays were conducted to search for large rearrangements; and (iii) finally, denaturing high-performance liquid chromatography was used to search for point mutations in the entire coding region. Using these approaches, the second CFTR mutation was detected in six patients, which increased the final detection rate to 60.8%.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] Total pancreatectomy and islet cell autotransplant... Surgery. 2010 Oct;148(4):676-85; discussion 685-6. Sutton JM, Schmulewitz N, Sussman JJ, Smith M, Kurland JE, Brunner JE, Salehi M, Choe KA, Ahmad SA
Total pancreatectomy and islet cell autotransplantation as a means of treating patients with genetically linked pancreatitis.
Surgery. 2010 Oct;148(4):676-85; discussion 685-6., [PMID:20846557]

Abstract [show]
BACKGROUND: For patients with severe chronic pancreatitis, total or completion pancreatectomy with islet cell autotransplantation (IAT) can alleviate pain and avoid the complications of diabetes. Several genetic mutations, specifically, PRSS1, CFTR, and SPINK1, are associated with chronic pancreatitis. Few reports have focused on the benefit of this operation for this subset of patients. METHODS: Between February 2000 and July 2009, 118 patients were treated with total pancreatectomy and IAT for chronic pancreatitis. Patients with known genetic mutations were then selected for further analysis. RESULTS: Of the 188 patients, 16 (13.6%) patients were identified as having genetic mutations, including CFTR (n = 10), PRSS1 (n = 4), and SPINK1 (n = 2) mutations. Mean patient age was 31.4 years (range, 15-59) with an equal male-to-female ratio (50:50). Preoperatively, patients required an average of 185 +/- 60 morphine equivalents (MEQ) (median, 123 MEQ) for preoperative pain control. No patients were taking insulin before operation. After resection with IAT, patients were discharged from the hospital with a daily average of 22 +/- 4 units of insulin with 6 (38%) patients requiring fewer than 15 units of insulin at the time of discharge. At a mean follow-up of 22 months, mean insulin requirements decreased to 15 U/d (P = .0172). A total of 7 (44%) patients required 15 or fewer units daily, and 4 (25%) patients were completely insulin-independent. Average daily narcotic usage at most recent follow-up decreased to 70 MEQ (median, 0) with 10 (63%) patients currently narcotic-independent. Analyses of the 36-item short-form health survey and the McGill Pain Questionnaire demonstrated a significant improvement in quality-of-life parameters and pain assessment. CONCLUSION: In patients who suffer from genetically linked chronic pancreatitis, pancreatic resection with IAT should be considered as an early therapeutic option to decrease chronic abdominal pain while preserving endogenous endocrine function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 Patient demographics Descriptive statistics Data mean (SEM) Range Age, y 32 (3) 15-59 Weight, kg 73 (6) 39-127 Body mass index, kg/m2 24 (2) 15-35 Chronic pancreatitis, y 14 (2) 3-47 Sex Male, n = 8 Female, n = 8 Previous pancreatic operations Puestow, n =3 Whipple, n = 3 Genetic mutations and loci, n (%) CFTR 10 (62.5) R297Q 2 DF508 + R117H 1 R553X + M470V 1 DF508 1 R117H 1 P750L 1 D1152H 1 R31C 1 S1235R 1 PRSS1 4 (25) R122H 3 Unknown* 1 SPINK1 2 (12.5) N34S 2 *One patient was identified as having a PRSS1 mutation, but the specific locus mutation was unknown at the time of publication. Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Distribution of CFTR mutations in Eastern Hungaria... J Cyst Fibros. 2011 May;10(3):217-20. doi: 10.1016/j.jcf.2010.12.009. Epub 2011 Feb 4. Ivady G, Madar L, Nagy B, Gonczi F, Ajzner E, Dzsudzsak E, Dvorakova L, Gombos E, Kappelmayer J, Macek M Jr, Balogh I
Distribution of CFTR mutations in Eastern Hungarians: relevance to genetic testing and to the introduction of newborn screening for cystic fibrosis.
J Cyst Fibros. 2011 May;10(3):217-20. doi: 10.1016/j.jcf.2010.12.009. Epub 2011 Feb 4., [PMID:21296036]

Abstract [show]
BACKGROUND: The aim of this study was characterization of an updated distribution of CFTR mutations in a representative cohort of 40 CF patients with the classical form of the disease drawn from Eastern Hungary. Due to the homogeneity of the Hungarian population our data are generally applicable to other regions of the country, including the sizeable diaspora. METHODS: We utilized the recommended "cascade" CFTR mutation screening approach, initially using a commercial assay, followed by examination of the common "Slavic" deletion CFTRdele2,3(21kb). Subsequently, the entire CFTR coding region of the CFTR gene was sequenced in patients with yet unidentified mutations. RESULTS: The Elucigene CF29(Tm) v2 assay detected 81.25% of all CF causing mutations. An addition of the CFTRdele2,3(21kb) increased the mutation detection rate to 86.25%. DNA sequencing enabled us to identify mutations on 79/80 CF alleles. Mutations [CFTRdele2,3(21kb), p.Gln685ThrfsX4 (2184insA) were found at an unusually high frequency, each comprising 5.00% of all CF alleles. CONCLUSION: We have identified common CF causing mutations in the Hungarian population with the most common mutations (p.Phe508del, p.Asn1303Lys, CFTRdele2,3(21kb), 2184insA, p.Gly542X, and p.Leu101X), comprising over 93.75% of all CF alleles. Obtained data are applicable to the improvement of DNA diagnostics in Hungary and beyond, and are the necessary prerequisite for the introduction of a nationwide "two tier" CF newborn screening program.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 The Elucigene CF29Tm v2 Kit is capable of detecting the following mutations: p.Asp1152His (c.3454 GNC), c.1585-1 GNA, p.Gly542X (c.1624 GNT), p.Trp1282X (c.3846 GNA), p.Asn1303Lys (c.3909 C NG), p.Phe508del (c.1521_ 1523delCTT), c.3717+12191 CNT, p.Leu88IlefsX22 (c.262_ 263delTT), c.489+1 GNT, p.Ser1251Asn (c.3752 GNA), p.Gly551Asp (c.1652 GNA), p.Arg117His (c.350 GNA), p.Arg1162X (c.3484 CNT), p.Arg334Trp (c.1000 CNT), p.Ala455Glu (c.1364 CNA), p.Lys684SerfsX38 (c.2051_ 2052delAAinsG), p.Lys1177SerfsX15 (c. Login to comment

[hide] Preconceptional identification of cystic fibrosis ... J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22. Coiana A, Faa' V, Carta D, Puddu R, Cao A, Rosatelli MC
Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program.
J Cyst Fibros. 2011 May;10(3):207-11. doi: 10.1016/j.jcf.2011.02.006. Epub 2011 Mar 22., [PMID:21429822]

Abstract [show]
BACKGROUND: In Sardinia the mutational spectrum of CFTR gene is well defined. A mutation detection rate of 94% can be achieved by screening for 15 CFTR mutations with a frequency higher than 0.5%. The efficiency of this molecular test suggests that Sardinians may represent a suitable population for a preconceptional screening. METHODS: Five hundred couples of Sardinia descent were screened for 38 mutations using a semi-automated reverse-dot blot and PCR-gel electrophoresis assays. This mutation panel included the 15 most frequent CF alleles in Sardinia. RESULTS: We identified 38 CF carriers, revealing an overall frequency of 1/25 (4%). The most common CF allele was the p.Thr338Ile (T338I) (65%), followed by the p.Phe508del (F508del) (22.5%). We also identified one couple at risk and an asymptomatic female homozygote for the p.Thr338Ile allele. CONCLUSIONS: In spite of the low number of the couples tested, the results herein reported demonstrate the efficacy and efficiency of the preconceptional screening program and the high participation rate of the Sardinian population (99%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 Mutation nomenclaturea Alleles (%) T338I (p.Thr338Ile) 26 (65.0) F508del (p.Phe508del) 9 (22.5) N1303K (p.Asn1303Lys) 1 (2.5) 2183AANG (c.2051_2052delAAinsG) 1 (2.5) 621+1GNT (c.489+1GNT) 1 (2.5) exon 2 del (c.54-5811_164+2187del8108ins182) 1 (2.5) R347P (p.Arg347Pro) 1 (2.5) The 3849+10kbCNT (c.3717+12191CNT), G85E (p.Gly85Glu), 2789+5GNA (c.2657+5GNA), W1282X (p.Trp1282X), G1244E (p.Gly1244Glu), 711+5GNA (c.579+5GNA), 711+1GNT (c.579+1GNA), 4016insT (p.Ser1297PhefsX5), G542X (p.Gly542X), 1717-1GNA (c.1585-1GNA), R553X (p.Arg553X), Q552X (p.Gln552X), G551D (p.Gly551Asp), S549R (ANC) (p.Ser549Arg), I507del (p.Ile507del), F508C (p.Phe508Cys), I502T (p.Ile502Thr), 1706del17 (p.Gln525LeufsX37), 1677delTA (p.Tyr515X), R117H (p.Arg117His), D1152H (p.Asp1152His), L1065P (p.Leu1065Pro), R1066H (p.Arg1066His), L1077P (p.Leu1077Pro), 4382delA (p.Glu1418ArgfsX14), R1162X (p.Arg1162X), R1158X (p.Arg1158X), 1259 insA (p.Gln378AlafsX4), 852del22 (p.Gly241GlufsX13), S912X (p.Ser912X), and 991del5bp (p.Asn287LysfsX19) mutations included in the CF panel were not detected in the population tested. Login to comment

[hide] Cystic fibrosis carrier testing in an ethnically d... Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7. Rohlfs EM, Zhou Z, Heim RA, Nagan N, Rosenblum LS, Flynn K, Scholl T, Akmaev VR, Sirko-Osadsa DA, Allitto BA, Sugarman EA
Cystic fibrosis carrier testing in an ethnically diverse US population.
Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7., [PMID:21474639]

Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) and the frequency of specific disease-causing mutations vary among populations. Affected individuals experience a range of serious clinical consequences, notably lung and pancreatic disease, which are only partially dependent on genotype. METHODS: An allele-specific primer-extension reaction, liquid-phase hybridization to a bead array, and subsequent fluorescence detection were used in testing for carriers of 98 CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations among 364 890 referred individuals with no family history of CF. RESULTS: One in 38 individuals carried one of the 98 CFTR mutations included in this panel. Of the 87 different mutations detected, 18 were limited to a single ethnic group. African American, Hispanic, and Asian individuals accounted for 33% of the individuals tested. The mutation frequency distribution of Caucasians was significantly different from that of each of these ethnic groups (P < 1 x 10(1)). CONCLUSIONS: Carrier testing using a broad mutation panel detects differences in the distribution of mutations among ethnic groups in the US.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 The median fluorescent intensity was determined, and the presence or absence of mutant and wild-type alleles was evaluated from the ratio of the mutant signal to the wild-type signal for the following mutations: c.1155_1156dupTA, c.2657ϩ5GϾA, c.3717ϩ12191CϾT, p.A455E, p.D1152H, p.F508del, p.G542X, p.G551D, p.I507del, p.L206W, p.N1303K, p.R117H, p.W1282X, and c.54-5940_ 273ϩ10250del21kb. Login to comment
123 CFTR mutationsa Individuals, n p.F508del/p.R117H 16 5T/9T 1 7T/9T 15 p.F508del/p.D1152H 3 p.R117H/p.R117H, 7T/7T 2 p.D1152H/p.D1152H 2 p.W1282X/p.D1152H 2 p.D1152H/p.G551D 1 c.3717ϩ12191CϾT/p.R352Q 1 c.3717ϩ12191CϾT/c.3717ϩ12191CϾT 1 p.F508del/c.3717ϩ12191CϾT 1 p.F508del/p.L206W 1 p.F508del/p.R117C 1 p.F508del/p.R347H 1 p.F508del/p.R347P 1 p.R117H/p.W1282X, 7T/7T 1 p.R117H/p.G551D, 7T/7T 1 p.R117H/p.G542X, 7T/9T 1 a Human Genome Variation Society nomenclature [Ogino et al. (23)]. Login to comment
127 Eighteen different mutations were identified in Ashkenazi Jewish individuals; 5 non-ACMG mutations (p.D1152H, c.54-5940_273ϩ10250del21kb, p.S549R, p.W1089X, p. Login to comment

[hide] The etiology of acute recurrent pancreatitis in ch... Pancreas. 2011 May;40(4):517-21. Lucidi V, Alghisi F, Dall'Oglio L, D'Apice MR, Monti L, De Angelis P, Gambardella S, Angioni A, Novelli G
The etiology of acute recurrent pancreatitis in children: a challenge for pediatricians.
Pancreas. 2011 May;40(4):517-21., [PMID:21499205]

Abstract [show]
OBJECTIVES: To assess specific etiologies of acute recurrent pancreatitis at a single Italian pediatric cystic fibrosis (CF) center. METHODS: We studied, retrospectively, 78 young patients (39 female subjects; mean age at diagnosis, 8.8 +/- 5.1 years) affected by acute recurrent episodes of pancreatitis, remained etiologically undiagnosed at first-level assessment. All patients were submitted to endoscopic retrograde cholangiopancreatography to exclude biliopancreatic malformations and tested for CF by a sweat chloride test. Most patients also were studied for the research of CFTR, PRSS1, and SPINK1 gene mutations. RESULTS: A high percentage of family history for chronic pancreatitis was observed (20.5%). The sweat test identified 8 subjects (10.3%) with classic CF (2 patients) or at risk for CF (6 patients). Genetic analysis showed mutations in CFTR, SPINK1, and PRSS1 genes in 39.6%, 7.1%, and 4.5% of patients, respectively. A biliopancreatic malformation was diagnosed in 15 patients (19.2%). We also observed biliary lithiasis (5 patients [6.5%]), congenital pancreatic polycystosis (2 patients), a case of dyslipidemia, and 1 patient with a posttransplantation, drug-induced pancreatitis. CONCLUSIONS: Recurrent pancreatitis in children has several etiologies. Genetic testing confirms the high frequency of CFTR mutations. This suggests that it is of some value to identify patients with late-onset CF and CFTR-related disorders.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Genetic Findings Observed in Our Study Population and Related Clinical Features CFTR PRSS1 SPINK1 Clinical CharacteristicsMutations IVS8 F508del/UN 9T/9T S181G/- NEG No respiratory symptoms 3849+10KbC9T/UN 7T/7T NEG NEG No respiratory symptoms UN/UN 7T/7T NEG N34S/- UN/UN 5T/7T NEG NEG No respiratory symptoms 1899-136T/C/UN 5T/7T NEG NEG No respiratory symptoms F508del/UN 5T/9T NEG NEG No respiratory symptoms D1152H/D1152H NEG NEG No respiratory symptoms R75Q/UN 5T/7T NEG NEG No respiratory symptoms L997F/UN 7T/9T NEG NEG No respiratory symptoms UN/UN 7T/7T NEG N34S/- W1282X/I148T 7T/9T NEG NEG No respiratory symptoms NEG N34S/- R75Q/F1052V NEG NEG No respiratory symptoms F508del/D1152H NEG NEG Bronchiectasis-CF 406-6T/C/E528E 7T/7T NEG NEG No respiratory symptoms F508del/UN 7T/9T Mild respiratory symptomsYCF L967S/L997F NEG NEG No respiratory symptoms E528E/UN 5T/7T Crohn disease, food allergy 1716 G/A/UN 7T/7T NEG NEG No respiratory symptoms 1898+1G9A/UN 7T/7T No respiratory symptoms R31C/UN No respiratory symptoms R75Q/UN 7T/7T NEG NEG No respiratory symptoms N29T;V212I; D217Y NEG F508del/UN 7T/9T NEG NEG Pancreas divisum S1235R/UN 7T/9T NEG NEG Duodenal stenosis Entries in bold font undelines the detection of mutations or polymorphisms in the studied genes. Login to comment
77 The second one had a borderline sweat test and 2 CFTR gene mutations, F508del/D1152H; this patient was diagnosed as having CF when he developed bronchiectasis, 5 years after the diagnosis of ARP. Login to comment
78 In another patient, we identified 2 CFTR mutations (D1152H/D1152H), a positive familial history for CP and CF, a negative sweat test, and no lung involvement, to date, at 24 years old, but a diagnosis of CF for this patient is unlikely.17,18 The D1152H mutation, as the most CFTR mutations, has not been clearly shown to be a CF-causing mutation; it shows a wide phenotypic variability,19,20 confirming that the genetic mechanisms are more complex than our current knowledge. Login to comment

[hide] Defective CFTR expression and function are detecta... PLoS One. 2011;6(7):e22212. Epub 2011 Jul 21. Sorio C, Buffelli M, Angiari C, Ettorre M, Johansson J, Vezzalini M, Viviani L, Ricciardi M, Verze G, Assael BM, Melotti P
Defective CFTR expression and function are detectable in blood monocytes: development of a new blood test for cystic fibrosis.
PLoS One. 2011;6(7):e22212. Epub 2011 Jul 21., [PMID:21811577]

Abstract [show]
BACKGROUND: Evaluation of cystic fibrosis transmembrane conductance regulator (CFTR) functional activity to assess new therapies and define diagnosis of cystic fibrosis (CF) is cumbersome. It is known that leukocytes express detectable levels of CFTR but the molecule has not been characterized in these cells. In this study we aim at setting up and validating a blood test to evaluate CFTR expression and function in leukocytes. DESCRIPTION: Western blot, PCR, immunofluorescence and cell membrane depolarization analysis by single-cell fluorescence imaging, using the potential-sensitive DiSBAC(2)(3) probe were utilized. Expression of PKA phosphorylated, cell membrane-localized CFTR was detected in non-CF monocytes, being undetectable or present in truncated form in monocytes derived from CF patients presenting with nonsense mutations. CFTR agonist administration induced membrane depolarization in monocytes isolated from non-CF donors (31 subjects) and, to a lesser extent, obligate CFTR heterozygous carriers (HTZ: 15 subjects), but it failed in monocytes from CF patients (44 subjects). We propose an index, which values in CF patients are significantly (p<0.001) lower than in the other two groups. Nasal Potential Difference, measured in selected subjects had concordant results with monocytes assay (Kappa statistic 0.93, 95%CI: 0.80-1.00). RESULTS AND SIGNIFICANCE: CFTR is detectable and is functional in human monocytes. We also showed that CFTR-associated activity can be evaluated in 5 ml of peripheral blood and devise an index potentially applicable for diagnostic purposes and both basic and translational research: from drug development to evaluation of functional outcomes in clinical trials.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
202 Case Gender Age at diagnosis (years) CFTR genotype* Age (years) Sweat Cl- mEq/L** FEV1 % mean values 2009 Pa PI NPD results*** CF-index 1 F 0 3132delTG 1497delGG 34 129 75 yes yes nd 222,10 2 F 0 R1162X R1162X 43 144 52 yes yes nd 229,65 3 M 0 R1162X R1162X 10 102 59 no yes 1,02 210,18 4 M 0 R1162X R1162X 25 115 81 no yes 1,07 267,11 5 M 7 G542X 711+5 G.A 24 105 59 yes yes nd 25,84 6 M 1 CFTRdele1 G542X 36 107 22 yes yes nd 2113,92 7 M 0 G542X G542X 16 110 71 yes yes 0,97 280,20 8 F 1 Q552X CFTRdele17a-18 35 99 72 yes yes 2,08 2219,81 9 M 16 R1162X 3849+10 Kb C.T 42 74 43 yes no 1,02 271,47 10 M 0 R1162X R1162X 32 105 45 yes yes 1,43 2114,67 11 M 1 F508del F508del 16 86 71 no yes nd 260,04 12 F 0 F508del F508del 16 88 118 no yes nd 248,20 13 M 0 F508del F508del 33 118 51 yes yes nd 265,49 14 M 7 F508del F508del 37 89 37 yes yes nd 2359,82 15 F 0 F508del F508del 27 118 71 yes yes nd 267,26 16 F 8 1717-1 G.A F508del 38 140 74 yes yes nd 2136,80 17 F 0 R1158X F508del 32 95 60 yes yes 1,77 228,31 18 M 7 G542X F508del 39 110 46 yes yes nd 247,52 19 M 0 Q39X F508del 17 101 79 no yes 1,11 264,20 20 F 1 R1162X F508del 41 188 60 no yes 0,94 296,73 21 M 13 3849+10 Kb C.T F508del 24 76 78 yes no 4,67 26,33 22 M 0 W1282X 621+1G.T 33 119 77 yes yes 1,27 242,74 23 F 4 R553X 2789+5 G.A 31 92 44 yes no 7,4 260,94 24 F 11 F508del R553X 39 116 55 yes yes nd 2113,67 25 M 12 F508del 3849+10 Kb C.T 27 51 71 yes no 1,12 298,84 26 F 0 F508del G542X 19 109 109 yes yes nd 2173,24 27 F 0 F508del R1162X 32 94 86 yes yes 1,34 270,16 28 F 0 F508del W57X (TAG) 27 99 78 yes yes 1,21 269,33 29 M 0 F508del Q552X 24 94 41 yes yes 1,50 272,75 30 M 20 F508del 3849+10 Kb C.T 43 58 60 no no 1,13 2112,56 31 M 0 F508del R1162X 12 99 65 no yes 2,14 280,92 32 M 4 F508del 3849+10 Kb C.T 17 60 100 no no nd 2121,31 33 F 1 F508del 1717-1 G.A 26 105 73 yes yes 2,05 255,66 34 F 11 F508del 3849+10 Kb C.T 40 85 59 yes no nd 2152,23 35 F 4 F508del 1717-1 G.A 44 130 97 yes yes nd 2116,56 36 M 13 F508del 3849+10 Kb C.T 43 70 65 yes no CF 265,10 37 F 19 F508del unknown 29 95 100 no no nd 240,53 38 M 6 F508del unknown 15 92 87 yes no nd 270,17 39 F 0 G542X N1303K 34 108 97 yes yes nd 296,14 40 M 50 G1249R IVS8 T5TG12 50 61 74 no no nd 2199,15 41 F 10 2183 AA.G IVS8 T5TG15/T7TG10 45 79 29 yes no 1,9 286,27 42 F 1 G85E unknown 43 120 107 yes no nd 249,21 43 F 0 3272-26 A.G I507del 21 113 88 no no nd 236,79 44 M 8 F508del D1152H 10 77 107 no no nd 210,85 *Cystic Fibrosis mutation database reference: http://www3.genet.sickkids.on.ca/cftr/app. Login to comment

[hide] Relationships between nasal potential difference a... Eur Respir J. 1998 Dec;12(6):1295-300. Fajac I, Hubert D, Bienvenu T, Richaud-Thiriez B, Matran R, Kaplan JC, Dall'Ava-Santucci J, Dusser DJ
Relationships between nasal potential difference and respiratory function in adults with cystic fibrosis.
Eur Respir J. 1998 Dec;12(6):1295-300., [PMID:9877480]

Abstract [show]
This study investigated the relations between nasal transepithelial electric potential difference (PD) and the phenotype and genotype of cystic fibrosis (CF) adult patients. Basal nasal PD was measured in 95 adult CF patients who were classified into three groups of nasal PD (expressed as absolute values) according to the 10th and the 90th percentiles (28.3 and 49.2 mV, respectively), which defined group 1 (nasal PD < or =28.3 mV), group 2 (nasal PD 28.3-49.2 mV) and group 3 (nasal PD > or =49.2 mV). Patients from group 1 had a higher forced vital capacity (FVC) than patients from groups 2 and 3 (76.5+/-22.4 versus 57.4+/-21.2 and 55.7+/-21.1% predicted, respectively, p<0.05) and a higher forced expiratory volume in one second (FEV1) (69.3+/-24.0 versus 42.5+/-22.4 and 42.2+/-21.4% pred, respectively, p<0.01). Among patients with severe mutations (deltaF508 homozygotes, or one deltaF508 mutation plus another "severe" mutation, or two "severe" mutations), patients from group 1 had a higher FVC, FEV1 and arterial oxygen tension than patients from groups 2 and 3 (p<0.05 for each comparison). The results show that in adult cystic fibrosis patients a normal basal nasal potential difference is related to milder respiratory disease, irrespective of the severity of the genotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Only three patients had a normal sweat test: one was homozygotic for the ∆F508 mutation and two patients were compound heterozygotic for the G542X and 3849+10 kb cytosine (C) → thymine (T) mutations and for the R1070Q and D1152H mutations, respectively. Login to comment

[hide] Validation of double gradient denaturing gradient ... Clin Chem. 1999 Jan;45(1):35-40. Cremonesi L, Carrera P, Fumagalli A, Lucchiari S, Cardillo E, Ferrari M, Righetti SC, Zunino F, Righetti PG, Gelfi C
Validation of double gradient denaturing gradient gel electrophoresis through multigenic retrospective analysis.
Clin Chem. 1999 Jan;45(1):35-40., [PMID:9895335]

Abstract [show]
Among established techniques for the identification of either known or new mutations, denaturing gradient gel electrophoresis (DGGE) is one of the most effective. However, conventional DGGE is affected by major drawbacks that limit its routine application: the different denaturant gradient ranges and migration times required for different DNA fragments. We developed a modified version of DGGE for high-throughput mutational analysis, double gradient DGGE (DG-DGGE), by superimposing a porous gradient over the denaturant gradient, which maintains the zone-sharpening effect even during lengthy analyses. Because of this innovation, DG-DGGE achieves the double goals of retaining full effectiveness in the detection of mutations while allowing identical run time conditions for all fragments analyzed. Here we use retrospective analysis of a large number of well-characterized mutations and polymorphisms, spanning all predicted melting domains and the whole genomic sequence of three different genes--the cystic fibrosis transmembrane conductance regulator (CFTR), the beta-globin, and the p53 genes--to demonstrate that DG-DGGE may be applied to the rapid scanning of any sequence variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Mutations and polymorphisms analyzed in the CFTR gene. Position Denaturant gradient Mutation Exon 1 40-90% 125G/Ca,b M1V (A3G at 133) 175insT 182delT Exon 3 10-60% W57G (T3G at 301) 356G/Aa G85E (G3A at 386) Exon 4 20-70% R117H (G3A at 482) 541delC 621ϩ1G3T I148T (T3C at 575) Exon 5 20-70% E193K (G3A at 709) Intron 5 20-70% 711ϩ3A3G Exon 7 20-70% 1078delT R334W (C3T at 1132) T338I (C3T at 1145) R347P (G3C at 1172)b R347H (G3A at 1172) R352Q (G3A at 1187) Exon 10 20-70% M470V (1540A/G)a ⌬F508 (del 3 bp at 1652) Intron 10 10-60% 1717-1G3A Exon 11 10-60% G542X (G3T at 1756) 1784delG R553X (C3T at 1789) Exon 12 10-60% D579G (A3G at 1868) E585X (G3T at 1885) Intron 12 10-60% 1898ϩ3A3G Exon 13 30-80% 2183AA3G E730X (G3T at 2320) L732X (T3G at 2327) 2347delG Exon 14a 10-60% T854T (2694T/G)a V868V (2736G/A)a Intron 14b 30-80% 2789ϩ5G3A Exon 15 20-70% M952I (G3C at 2988)b Exon 17a 20-70% L997F (G3C at 3123)b Exon 17b 20-70% F1052V (T3G at 3286) R1066C (C3T at 3328) R1066H (G3A at 3329) A1067T (G3A at 3331) Exon 18 20-70% D1152H (G3C at 3586)b Exon 19 30-80% R1158X (C3T at 3604) Exon 20 20-70% S1251N (G3A at 3384) W1282X (G3A at 3978) Exon 21 20-70% N1303K (C3G at 4041)b Exon 22 30-80% G1349D (G3A at 4178) 4382delA Exon 24 30-80% Y1424Y (4404C/T)a a Polymorphism. Login to comment

[hide] The role of common single-nucleotide polymorphisms... Hum Mutat. 2004 Aug;24(2):120-9. Steiner B, Truninger K, Sanz J, Schaller A, Gallati S
The role of common single-nucleotide polymorphisms on exon 9 and exon 12 skipping in nonmutated CFTR alleles.
Hum Mutat. 2004 Aug;24(2):120-9., [PMID:15241793]

Abstract [show]
Classic cystic fibrosis (CF) is caused by two loss-of-function mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, whereas patients with nonclassic CF have at least one copy of a mutant gene that retains partial function of the CFTR protein. In addition, there are several other phenotypes associated with CFTR gene mutations, such as idiopathic chronic pancreatitis. In CFTR-associated disorders and in nonclassic CF, often only one CFTR mutation or no CFTR mutations can be detected. In this study, we screened 23 patients with CFTR-associated disorders for CFTR mutations by complete gene testing and quantitative transcript analysis. Mutations were found in 10 patients. In cells from respiratory epithelium, we detected aberrant splicing of CFTR mRNA in all investigated individuals. We observed a highly significant association between the presence of coding single-nucleotide polymorphisms (coding SNPs, or cSNPs) and increased skipping of exon 9 and 12. This association was found both in patients and in normal individuals carrying the same cSNPs. The cSNPs c.1540A>G, c.2694T>G, and c.4521G>A may have affected pre-mRNA splicing by changing regulatory sequence motifs of exonic splice enhancers, leading to lower amounts of normal transcripts. The analysis of CFTR exons indicated that less frequent and weak exonic splicing enhancer (ESE) motifs make exon 12 vulnerable to skipping. The number of splice variants in individuals with cSNPs was similar to previously reported values for the T5 allele, suggesting that cSNPs may enhance susceptibility to CFTR related diseases. In addition, cSNPs may be responsible for variation in the phenotypic expression of CFTR mutations. Quantitative approaches rather than conventional genomic analysis are required to interpret the role of cSNPs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 RESULTS Characterization of the CFTR Gene Mutations Mutations (c.575T4C (p.I148T), c.2890G4A (p.V920M), c.3586G4C (p.D1152H), and c.3837T4G (p.S1235R)) were found in 4 out of 66 healthy individuals (6%), a nonsignificant increase compared to the 4% carrier frequency reported in the literature for the Swiss population [Hergersberg et al., 1997]. Login to comment

[hide] Increased risk of idiopathic chronic pancreatitis ... Hum Mutat. 2005 Oct;26(4):303-7. Cohn JA, Neoptolemos JP, Feng J, Yan J, Jiang Z, Greenhalf W, McFaul C, Mountford R, Sommer SS
Increased risk of idiopathic chronic pancreatitis in cystic fibrosis carriers.
Hum Mutat. 2005 Oct;26(4):303-7., [PMID:16134171]

Abstract [show]
Cystic fibrosis (CF) is a recessive disease caused by mutations of the CF transmembrane conductance regulator (CFTR) gene. The risk of idiopathic chronic pancreatitis (ICP) is increased in individuals who have CFTR genotypes containing a CF-causing mutation plus a second pathogenic allele. It is unknown whether the risk of ICP is increased in CF carriers who have one CF-causing mutation plus one normal allele. In this study, 52 sporadic cases of ICP were ascertained through the European Registry of Hereditary Pancreatitis and Familial Pancreatic Cancer. Individuals with pathogenic cationic trypsinogen mutations were excluded. DNA was comprehensively tested for CFTR mutations using a robotically enhanced, multiplexed, and highly redundant form of single-strand conformation polymorphism (SSCP) analysis followed by DNA sequencing. Fifteen subjects had a total of 18 pathogenic CFTR alleles. Eight subjects had common CF-causing mutations. This group included seven CF carriers in whom the second CFTR allele was normal (4.3 times the expected frequency, P=0.0002). Three subjects had compound heterozygotes genotypes containing two pathogenic alleles (31 times the expected frequency, P<0.0001). A variant allele of uncertain significance (p.R75Q) was detected in eight of the 52 ICP subjects and at a similar frequency (13/96) in random donors. ICP differs from other established CFTR-related conditions in that ICP risk is increased in CF carriers who have one documented normal CFTR allele. Having two CFTR mutations imparts a higher relative risk, while having only one mutation imparts a higher attributable risk.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 Abnormal CFTR Genotypes Detected in 52 Patients with ICPa Genotype categorya ] Patients Genotypes detectedb Compound heterozygotes and homozygotes 3 p.F508del / p.L967S p.D1152H / p.D1152H p.V920M / p.L967S Heterozygotes, common mutation causing classic CFa 7 p.F508del /^ ('ve subjects)c p.R560T/^ p.G542X /^ Heterozygotes, uncommon mutation causing variable phenotype 3 p.S1235R /^ p.A209S /^ p.L997F/^ Heterozygotes, common CBAVD-associated mutation 2 IVS8(5T) /^ (two subjects) a Common CF-mutations consistently cause classic CF in compound heterozygotes and homozygotes [Rosenstein and Cutting, 1998]. Login to comment

[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]

Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4. Login to comment

[hide] Outcomes of a cystic fibrosis carrier testing clin... Med J Aust. 2009 Nov 2;191(9):499-501. Christie LM, Ingrey AJ, Turner GM, Proos AL, Watts GE
Outcomes of a cystic fibrosis carrier testing clinic for couples.
Med J Aust. 2009 Nov 2;191(9):499-501., 2009-11-02 [PMID:19883345]

Abstract [show]
OBJECTIVE: To review the outcomes of offering carrier testing for cystic fibrosis (CF) to couples considering pregnancy, and to women in early pregnancy and their partners. METHODS: An after-hours clinic was established in Newcastle for discussion of issues related to prenatal testing. Couples were offered CF carrier testing by extracting DNA from a mouthwash sample. An expanded one-step model was used with both partners being tested initially for the p.F508del cystic fibrosis transmembrane conductance regulator gene (CFTR) mutation. If one partner was a p.F508del carrier, the other partner was tested for an additional 28 CFTR mutations. RESULTS: Of 1000 individuals who were offered CF carrier testing, none declined. No re-collections of mouthwash samples were required, and results were available within 14 days. There were 730 individuals who had no family history of CF (73%); 27 were carriers (4%; 95% CI, 2.4%-5.3%), and there were two high-risk couples where both partners were carriers of p.F508del. There were 270 individuals who had an affected family member with CF or a child identified as a CF carrier through newborn screening; 126 were carriers (46%; 95% CI, 40.6%-52.8%), and there were two high-risk couples - one couple where both partners were carriers of p.F508del, and another couple where the woman was homozygous for p.F508del and the man was a p.F508del carrier. The information on carrier status led the four high-risk couples to change their reproductive decisions to avoid having a child with CF. CONCLUSION: CF carrier testing for couples using an expanded one-step model will detect about 80% of high-risk couples and enables various reproductive choices. We believe that all couples considering pregnancy, and women in early pregnancy and their partners, should be offered CF carrier testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 This provides each individual with information on their carrier status, and accurate residual risks of 1 CFTR mutations tested for in individuals whose partner was a carrier of p.F508del* p.F508del p.F316leufsX p.I507del p.R347P p.G542X p.S1251N p.G551D p.E60X p.N1303K p.W1282X c.1585-1G>A p.D1152H p.R553X c.2988+1G>A c.489+G>T c.2657+5G>A p.R117H c.1766+1G>A p.R1162X c.579+1G>A c.3717+10kbC>T p.G85E p.R334W p.K684fs p.A455E p.I148T p.K684fs p.R560T p.T1176fs CFTR = gene encoding cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] UMD-CFTR: a database dedicated to CF and CFTR-rela... Hum Mutat. 2010 Sep;31(9):1011-9. Bareil C, Theze C, Beroud C, Hamroun D, Guittard C, Rene C, Paulet D, Georges M, Claustres M
UMD-CFTR: a database dedicated to CF and CFTR-related disorders.
Hum Mutat. 2010 Sep;31(9):1011-9., [PMID:20607857]

Abstract [show]
With the increasing knowledge of cystic fibrosis (CF) and CFTR-related diseases (CFTR-RD), the number of sequence variations in the CFTR gene is constantly raising. CF and particularly CFTR-RD provide a particular challenge because of many unclassified variants and identical genotypes associated with different phenotypes. Using the Universal Mutation Database (UMD) software we have constructed UMD-CFTR (freely available at the URL: http://www.umd.be/CFTR/), the first comprehensive relational CFTR database that allows an in-depth analysis and annotation of all variations identified in individuals whose CFTR genes have been analyzed extensively. The system has been tested on the molecular data from 757 patients (540 CF and 217 CBAVD) including disease-causing, unclassified, and nonpathogenic alterations (301 different sequence variations) representing 3,973 entries. Tools are provided to assess the pathogenicity of mutations. UMD-CFTR also offers a number of query tools and graphical views providing instant access to the list of mutations, their frequencies, positions and predicted consequences, or correlations between genotypes, haplotypes, and phenotypes. UMD-CFTR offers a way to compile not only disease-causing genotypes but also haplotypes. It will help the CFTR scientific and medical communities to improve sequence variation interpretation, evaluate the putative influence of haplotypes on mutations, and correlate molecular data with phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Several sequence changes initially reported as causing disease have subsequently been reported to be neutral sequence variants (a typical illustration is the variant p.Ile148Thr) [Claustres et al., 2004; Rohlfs et al., 2004] or mutations with reduced penetrance (only some patients will develop CF or CFTR-related disorder; example: p.Arg117His) [Kiesewetter et al., 1993; Rosenstein and Cutting, 1998; Thauvin-Robinet et al., 2009] or mutations with variable expressivity (some patients develop mild rather than severe symptoms; examples include p.Leu206Trp [Desgeorges et al., 1995; Rozen et al., 1995] or p.Asp1152His [Burgel et al., 2010; Mussaffi et al., 2006]). Login to comment

[hide] Mutations of the cystic fibrosis gene in patients ... Ann Rheum Dis. 2011 Apr;70(4):653-9. Epub 2010 Dec 3. Puechal X, Bienvenu T, Genin E, Berthelot JM, Sibilia J, Gaudin P, Marcelli C, Lasbleiz S, Michou L, Cornelis F, Kahan A, Dusser DJ
Mutations of the cystic fibrosis gene in patients with bronchiectasis associated with rheumatoid arthritis.
Ann Rheum Dis. 2011 Apr;70(4):653-9. Epub 2010 Dec 3., [PMID:21131649]

Abstract [show]
OBJECTIVES: In cystic fibrosis, mutations of the CFTR gene lead to diffuse bronchiectasis (DB). DB is also associated with other diseases including rheumatoid arthritis (RA) in which the role of genetic factors in the predisposition to DB remains unclear. METHODS: A family-based association study was carried out to determine whether the frequency of CFTR mutations was higher in patients with RA-associated DB and to determine whether a causal relationship could be established between the variant and the disease by evaluating its cosegregation with DB within families. Families of probands with RA-DB were included if one first-degree relative had RA and/or DB. The controls comprised healthy subjects requesting genetic counselling because their partner had cystic fibrosis. RESULTS: The frequency of CFTR mutations was higher in family members with RA-DB or DB only than in unaffected relatives (p<0.005 for each comparison) and in unrelated healthy controls (p<0.001 for each comparison) but not in family members with RA only. CFTR mutations were more frequent in family members with RA-DB than in those with RA only (OR 5.30, 95% CI 2.48 to 11.33; p<5x10(-5)). They cosegregated with RA-DB in the families (sib-TDT=10.82, p=0.005). CONCLUSIONS: RA-DB should be added to the list of phenotypes in which CFTR mutations are pathogenic. CFTR mutation is the first genetic defect linked to an extra-articular feature of RA to be described. CFTR mutations in patients with RA appear to be an important marker of the risk of associated DB, which has been linked to a less favourable prognosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 Both sisters carried the p.Asp1152His mutation, which has previously been identified as a Group A or Group B mutation, and the Group A c.262 263delTT mutation.13 Thus, 18 of the 30 patients with RA-DB (60%) carried at least one mutant CFTR allele and 3 of these 30 patients (10%) were compound heterozygous (table 1). Login to comment

[hide] Mutation distribution in expanded screening for cy... Clin Chem. 2011 Jun;57(6):799-801. Epub 2011 Apr 7. Schrijver I
Mutation distribution in expanded screening for cystic fibrosis: making up the balance in a context of ethnic diversity.
Clin Chem. 2011 Jun;57(6):799-801. Epub 2011 Apr 7., [PMID:21474640]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 Strom et al. raise the point that expanded panels frequently include mutations of unvetted clinical significance, such as p.D1152H. Login to comment

[hide] CFTR mutation combinations producing frequent comp... Hum Mutat. 2012 Nov;33(11):1557-65. doi: 10.1002/humu.22129. Epub 2012 Jul 2. El-Seedy A, Girodon E, Norez C, Pajaud J, Pasquet MC, de Becdelievre A, Bienvenu T, des Georges M, Cabet F, Lalau G, Bieth E, Blayau M, Becq F, Kitzis A, Fanen P, Ladeveze V
CFTR mutation combinations producing frequent complex alleles with different clinical and functional outcomes.
Hum Mutat. 2012 Nov;33(11):1557-65. doi: 10.1002/humu.22129. Epub 2012 Jul 2., [PMID:22678879]

Abstract [show]
Genotype-phenotype correlations in cystic fibrosis (CF) may be difficult to establish because of phenotype variability, which is associated with certain CF transmembrane conductance regulator (CFTR) gene mutations and the existence of complex alleles. To elucidate the clinical significance of complex alleles involving p.Gly149Arg, p.Asp443Tyr, p.Gly576Ala, and p.Arg668Cys, we performed a collaborative genotype-phenotype correlation study, collected epidemiological data, and investigated structure-function relationships for single and natural complex mutants, p.[Gly576Ala;Arg668Cys], p.[Gly149Arg;Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala;Arg668Cys]. Among 153 patients carrying at least one of these mutations, only three had classical CF and all carried p.Gly149Arg in the triple mutant. Sixty-four had isolated infertility and seven were healthy individuals with a severe mutation in trans, but none had p.Gly149Arg. Functional studies performed on all single and natural complex mutants showed that (1) p.Gly149Arg results in a severe misprocessing defect; (2) p.Asp443Tyr moderately alters CFTR maturation; and (3) p.Gly576Ala, a known splicing mutant, and p.Arg668Cys mildly alter CFTR chloride conductance. Overall, the results consistently show the contribution of p.Gly149Arg to the CF phenotype, and suggest that p.[Arg668Cys], p.[Gly576Ala;Arg668Cys], and p.[Asp443Tyr;Gly576Ala;Arg668Cys] are associated with CFTR-related disorders. The present study emphasizes the importance of comprehensive genotype-phenotype and functional studies in elucidating the impact of mutations on clinical phenotype. Hum Mutat 33:1557-1565, 2012. (c) 2012 Wiley Periodicals, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 [2002C>T;3718-2477C>T] p.Gln689X 2 CSD Nasal polyposis 14 y,16 y NA, 29 p.[Gly576Ala;Arg668Cys] NI 3 IP 35-39 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 IP Bronchitis 49 y NA p.[Gly576Ala;Arg668Cys] p.PheF508del 1 IP 42 y NA p.[Gly576Ala;Arg668Cys] p.Arg668Cys 1 IP NA NA p.[Gly576Ala;Arg668Cys] c.1210_34TG[12]T[5] 4 IP 19-69 y NA p.[Gly576Ala;Arg668Cys] NI 1 Cholestasis 60 y NA p.[Gly576Ala;Arg668Cys] c.1584G>A 33 CBAVD 27-50 y 9-82 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 2 CBAVD 30 y,36 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.2051_2052delAAinsG 1 CBAVD 34 y 72 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Trp1282X 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 CBAVD 35 y 65-66 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Ser549Asn 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.3605delA 1 CBAVD 30 y 41-69 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gln1411X 1 CBAVD 31 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg347His 3 CBAVD 29 y, 34 y, NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Gly542X 1 CBAVD 35 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.946delT 1 CBAVD 26 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] c.4242_4242+1delGGinsT 1 CBAVD 41 y 31 p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg117His 1 CBAVD 32 y NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr338Ile 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Glu379Lys 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Met1137Val 1 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Thr1246Ile 2 CBAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] NI 1 CBAVD 34 NA p.[Gly576Ala;Arg668Cys] p.Asn1303Lys 8 CBAVD 30-42 y NA p.[Gly576Ala;Arg668Cys] NI 1 CBAVD 27 y NA p.Arg668Cys p.Phe508del 1 CBAVD 30 y NA p.Arg668Cys NI 1 CUAVD NA NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Phe508del 1 CUAVD NA NA p.[Gly576Ala;Arg668Cys] NI 1 CUAVD Renal agenesis NA NA p.[Gly576Ala;Arg668Cys] NI 1 Hypofertility (not CBAVD) CF carrier`s partner NA NA p.[Gly576Ala;Arg668Cys] p.Asp1152His 1 FBA Mild CF considered possible, 2 older brothers with the same genotype, one with a very mild phenotype, the other being asymptomatic 22 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Asn1303Lys 1 FBA TOP for de novo chromosomal translocation; not CF 21 wg NA p.[Asp443Tyr;Gly576Ala;Arg668Cys] p.Arg31Cys 1 FBA Not CF at birth 28 wg <30 p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Unknown outcome 23 wg NA p.[Gly576Ala;Arg668Cys] p.Phe508del 1 FBA Not CF at birth 21 wg <30 p.[Gly576Ala;Arg668Cys] p.Trp846X (Continued) Table 1. Login to comment

[hide] beta-Adrenergic Sweat Secretion as a Diagnostic Te... Am J Respir Crit Care Med. 2012 Oct 15;186(8):732-9. doi: 10.1164/rccm.201205-0922OC. Epub 2012 Aug 2. Quinton P, Molyneux L, Ip W, Dupuis A, Avolio J, Tullis E, Conrad D, Shamsuddin AK, Durie P, Gonska T
beta-Adrenergic Sweat Secretion as a Diagnostic Test for Cystic Fibrosis.
Am J Respir Crit Care Med. 2012 Oct 15;186(8):732-9. doi: 10.1164/rccm.201205-0922OC. Epub 2012 Aug 2., [PMID:22859523]

Abstract [show]
Rationale: beta-Adrenergically induced sweat secretion offers an expedient method to assess native cystic fibrosis transmembrane conductance regulator (CFTR) secretory function in vivo. Objectives: To evaluate the sensitivity, specificity, and reliability of a test based on the activity and secretory function of CFTR in the sweat gland. Methods: Primary and validation trials with prospectively ascertained healthy control subjects, obligate heterozygotes, and patients with a CFTR-related disorder and CF (pancreatic sufficient and insufficient). Measurements and Main Results: Diagnostic accuracy and reliability of beta-adrenergic sweat secretory rates using an evaporimeter was assessed and compared with sweat chloride concentrations. The cholinergically stimulated mean sweat rate did not differ among groups. The mean maximal beta-adrenergically stimulated sweat rate in heterozygotes was about half the rate of healthy control subjects, and completely absent in pancreatic-insufficient patients with CF and pancreatic-sufficient patients with CF (P < 0.0001). Subjects with a CFTR-related disorder showed reduced or absent beta-adrenergic sweat secretion. The beta-adrenergic secretory response demonstrated high diagnostic accuracy (area under a characteristic receiver-operator curve = 0.99; 95% confidence interval, 0.97-1.00) and reliability (intraclass correlation, 0.90; 95% confidence interval, 0.81-0.95). The diagnostic cutoff level for CF, derived from the primary trial, correctly identified all control subjects, heterozygotes, and patients with CF in the validation cohort, whereas concurrent sweat chloride measurements misclassified one heterozygote and five subjects with CF. The cholinergic and beta-adrenergic sweat secretion rates were lower in women compared with men (P < 0.001). Conclusions: beta-Adrenergic sweat secretion rate determined by evaporimetry is an accurate and reliable technique to assess different levels of CFTR function and to identify patients with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 DIAGNOSTIC CHARACTERISTICS OF PARTICIPANTS IN THE VALIDATION COHORT Group Age (yr) Sex Genotype Sweat Cl2 (mmol/L) Cholinergic b-Adrenergic Ratio b/Chol Healthy 38 M 2/2 15 64.45 72.79 1.13 Healthy 39 M 2/2 18 81.61 86.08 1.05 Healthy 54 F 2/2 29 48.90 47.30 0.97 Healthy 64 F 2/2 28 50.64 57.54 1.14 Healthy 54 F 2/2 11 68.63 52.30 0.76 Hetero. 64 M F508del/2 16 68.21 36.78 0.54 Hetero. 56 M F508del/2 53 82.44 59.57 0.72 Hetero. 27 F F508del/2 11 78.30 46.30 0.59 Hetero. 29 F F508del/2 16 65.63 26.13 0.40 Hetero. 51 F G551D/2 62 39.13 16.50 0.42 CFTR-RD CBAVD 41 M W1282X/5T 55 84.61 20.69 20.01 CFTR-RD CBAVD 52 M F508del/R117H (7T) 57 70.39 20.61 20.01 CFTR-RD CBAVD 41 M F508del/5T 40 68.00 22.29 20.03 CFTR-RD CBAVD 47 M G551D/R117H (7T) 57 65.93 10.08 0.15 CFTR-RD CBAVD 40 M L206W/W216C 42 67.80 17.00 0.25 CFTR-RD CBAVD 26 M 36599delC15T/7T 55 91.55 0.18 0.00 CFTR-RD Sinopulm 65 F F508del/c.876-9_876-6delGATT 51 74.30 32.20 0.43 CFTR-RD Sinopulm 39 F R764X/2 12 24.64 3.49 0.14 CFTR-RD Sinopulm 17 F 5T/2 50 52.95 14.24 0.27 CFPS 21 M F508del/2 97 46.19 0.56 0.01 CFPS 33 M F508del/3849110kbC.T 50 76.22 22.94 20.04 CFPS 58 M 71111G.T/A455E 72 70.19 23.06 20.04 CFPS 41 M G551D/3849110kbC.T 88 87.37 0.08 0.00 CFPS 54 F F508del/R117C 59 36.74 1.06 0.03 CFPS 23 F F508del/A455E 82 64.85 3.46 0.05 CFPS 30 F D1152H/D1152H 31 41.52 23.54 20.09 CFPS 55 F G551D/2 99 67.62 21.78 20.03 CFPS 42 F F508del/1002-2A.G 94 27.64 2.63 0.10 CFPS 46 F 3849110kbC.T/3849110kbC.T 53 24.43 21.16 20.05 CFPS 14 F R1162X/3849110kbC.T 46 50.19 20.49 20.01 CFPI 32 M F508del/F508del 108 73.93 1.41 0.02 CFPI 28 M F508del/F508del 84 95.13 3.45 0.04 CFPI 24 F F508del/F508del 109 60.48 4.06 0.07 CFPI 34 F F508del/F508del 115 79.24 0.99 0.01 CFPI 35 F F508del/F508del 87 79.79 23.02 20.04 CFPI 44 F F508del/F508del 112 80.60 1.23 0.02 CFPI 23 F F508del/G551D 90 45.80 0.80 0.02 Definition of abbreviations: CBAVD ¼ congenital bilateral absence of vas deference; CF ¼ cystic fibrosis; CFPI ¼ pancreatic-insufficient patients with CF; CFPS ¼ pancreatic-sufficient patients with CF; CFTR ¼ CF transmembrane regulator; CFTR-RD ¼ CFTR-related disorder; hetero ¼ heterozygotes; sinopulm ¼ chronic sinopulmonary disease. Login to comment
92 Of note, four of these patients with CFPS carrying 3849110kbC.T or D1152H on one or two alleles had sweat chloride results between 31 and 52 mmol/L, whereas one subject with CFPS carried F508del/R117C with sweat [Cl2 ] 59 mmol/L. Login to comment
145 In addition, b-adrenergic sweat test confirmed CF disease in individuals carrying mutations (e.g., 3849110kBC.T and D1152H) that commonly exhibit normal or borderline sweat [Cl2 ] (23, 24). Login to comment
43 DIAGNOSTIC CHARACTERISTICS OF PARTICIPANTS IN THE VALIDATION COHORT Group Age (yr) Sex Genotype Sweat Cl2 (mmol/L) Cholinergic b-Adrenergic Ratio b/Chol Healthy 38 M 2/2 15 64.45 72.79 1.13 Healthy 39 M 2/2 18 81.61 86.08 1.05 Healthy 54 F 2/2 29 48.90 47.30 0.97 Healthy 64 F 2/2 28 50.64 57.54 1.14 Healthy 54 F 2/2 11 68.63 52.30 0.76 Hetero. 64 M F508del/2 16 68.21 36.78 0.54 Hetero. 56 M F508del/2 53 82.44 59.57 0.72 Hetero. 27 F F508del/2 11 78.30 46.30 0.59 Hetero. 29 F F508del/2 16 65.63 26.13 0.40 Hetero. 51 F G551D/2 62 39.13 16.50 0.42 CFTR-RD CBAVD 41 M W1282X/5T 55 84.61 20.69 20.01 CFTR-RD CBAVD 52 M F508del/R117H (7T) 57 70.39 20.61 20.01 CFTR-RD CBAVD 41 M F508del/5T 40 68.00 22.29 20.03 CFTR-RD CBAVD 47 M G551D/R117H (7T) 57 65.93 10.08 0.15 CFTR-RD CBAVD 40 M L206W/W216C 42 67.80 17.00 0.25 CFTR-RD CBAVD 26 M 36599delC15T/7T 55 91.55 0.18 0.00 CFTR-RD Sinopulm 65 F F508del/c.876-9_876-6delGATT 51 74.30 32.20 0.43 CFTR-RD Sinopulm 39 F R764X/2 12 24.64 3.49 0.14 CFTR-RD Sinopulm 17 F 5T/2 50 52.95 14.24 0.27 CFPS 21 M F508del/2 97 46.19 0.56 0.01 CFPS 33 M F508del/3849110kbC.T 50 76.22 22.94 20.04 CFPS 58 M 71111G.T/A455E 72 70.19 23.06 20.04 CFPS 41 M G551D/3849110kbC.T 88 87.37 0.08 0.00 CFPS 54 F F508del/R117C 59 36.74 1.06 0.03 CFPS 23 F F508del/A455E 82 64.85 3.46 0.05 CFPS 30 F D1152H/D1152H 31 41.52 23.54 20.09 CFPS 55 F G551D/2 99 67.62 21.78 20.03 CFPS 42 F F508del/1002-2A.G 94 27.64 2.63 0.10 CFPS 46 F 3849110kbC.T/3849110kbC.T 53 24.43 21.16 20.05 CFPS 14 F R1162X/3849110kbC.T 46 50.19 20.49 20.01 CFPI 32 M F508del/F508del 108 73.93 1.41 0.02 CFPI 28 M F508del/F508del 84 95.13 3.45 0.04 CFPI 24 F F508del/F508del 109 60.48 4.06 0.07 CFPI 34 F F508del/F508del 115 79.24 0.99 0.01 CFPI 35 F F508del/F508del 87 79.79 23.02 20.04 CFPI 44 F F508del/F508del 112 80.60 1.23 0.02 CFPI 23 F F508del/G551D 90 45.80 0.80 0.02 Definition of abbreviations: CBAVD &#bc; congenital bilateral absence of vas deference; CF &#bc; cystic fibrosis; CFPI &#bc; pancreatic-insufficient patients with CF; CFPS &#bc; pancreatic-sufficient patients with CF; CFTR &#bc; CF transmembrane regulator; CFTR-RD &#bc; CFTR-related disorder; hetero &#bc; heterozygotes; sinopulm &#bc; chronic sinopulmonary disease. Login to comment
93 Of note, four of these patients with CFPS carrying 3849110kbC.T or D1152H on one or two alleles had sweat chloride results between 31 and 52 mmol/L, whereas one subject with CFPS carried F508del/R117C with sweat [Cl2 ] 59 mmol/L. Login to comment
146 In addition, b-adrenergic sweat test confirmed CF disease in individuals carrying mutations (e.g., 3849110kBC.T and D1152H) that commonly exhibit normal or borderline sweat [Cl2 ] (23, 24). Login to comment

[hide] Management of male infertility due to congenital b... Andrologia. 2012 Oct;44(5):358-62. doi: 10.1111/j.1439-0272.2012.01288.x. Epub 2012 Mar 6. Grzegorczyk V, Rives N, Sibert L, Dominique S, Mace B
Management of male infertility due to congenital bilateral absence of vas deferens should not ignore the diagnosis of cystic fibrosis.
Andrologia. 2012 Oct;44(5):358-62. doi: 10.1111/j.1439-0272.2012.01288.x. Epub 2012 Mar 6., [PMID:22390181]

Abstract [show]
Microsurgical or percutaneous epididymal sperm aspiration and intracytoplasmic sperm injection (ICSI) are proposed to overcome male infertility due to congenital bilateral absence of vas deferens (CBAVD). CBAVD has been associated with mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and consequently, genetic counselling has to be addressed before beginning ICSI procedure. However, management of male infertility due to CBAVD should not ignore a mild form of cystic fibrosis. We describe the case of cystic fibrosis late diagnosis performed in a 49-year-old infertile men with CBAVD. CFTR molecular testing detected two mutations F508del and A455E corresponding to a cystic fibrosis genotype. Pneumological evaluation revealed a severe obstructive respiratory disease, bronchiectasis and high sweat chloride levels. Symptoms consistent with a cystic fibrosis have to be identified in infertile men with CBAVD before beginning assisted reproductive procedures.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
49 Some genotypes had been described in patients with moderate or late CF, such as those with F508del/L206W, F508del/D1152H, F508del/A455E like in our patient. Login to comment

[hide] Cystic fibrosis: insight into CFTR pathophysiology... Clin Biochem. 2012 Oct;45(15):1132-44. doi: 10.1016/j.clinbiochem.2012.05.034. Epub 2012 Jun 12. Lubamba B, Dhooghe B, Noel S, Leal T
Cystic fibrosis: insight into CFTR pathophysiology and pharmacotherapy.
Clin Biochem. 2012 Oct;45(15):1132-44. doi: 10.1016/j.clinbiochem.2012.05.034. Epub 2012 Jun 12., [PMID:22698459]

Abstract [show]
Cystic fibrosis is the most common life-threatening recessively inherited disease in Caucasians. Due to early provision of care in specialized reference centers and more comprehensive care, survival has improved over time. Despite great advances in supportive care and in our understanding of its pathophysiology, there is still no cure for the disease. Therapeutic strategies aimed at rescuing the abnormal protein are either being sought after or under investigation. This review highlights salient insights into pathophysiology and candidate molecules suitable for CFTR pharmacotherapy. Clinical trials using Ataluren, VX-809 and ivacaftor have provided encouraging data. Preclinical data with inhibitors of phosphodiesterase type 5, such as sildenafil and analogs, have highlighted their potential for CFTR pharmacotherapy. Because sildenafil and analogs are in clinical use for other clinical applications, research on this class of drugs might speed up the development of new therapies for CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
982 Class Mutation prototypes Consequences Severe CF phenotype I G542X, W1282X, R553X, 3950delT CFTR is not synthesized because of stop codons or splicing defects II F508del, N1303K CFTR is synthesized but in an immature form (only partly glycosylated, misfolded, not released from the endoplasmic reticulum) and is mostly degraded by the ubiquitin-proteasomal pathway III G551D CFTR is synthesized and transported to the plasma membrane, but its activation and regulation by ATP or cAMP are disrupted Milder CF phenotype IV R334W, G314E, R347P, D1152H CFTR is synthesized and expressed at the plasma membrane, but chloride conductance is reduced V 3849+10 kb C>T, 3272-26 A>G CFTR synthesis or processing is partly defective Severe CF phenotype VI 1811+1.6 kb A>G CFTR is synthesized, but membrane stability or conductance of ions other than chloride is reduced Fig. 2. Login to comment

[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]

Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

[hide] Retrospective analysis of stored dried blood spots... J Cyst Fibros. 2012 Jul;11(4):332-6. doi: 10.1016/j.jcf.2012.01.001. Epub 2012 Feb 1. Barben J, Gallati S, Fingerhut R, Schoeni MH, Baumgartner MR, Torresani T
Retrospective analysis of stored dried blood spots from children with cystic fibrosis and matched controls to assess the performance of a proposed newborn screening protocol in Switzerland.
J Cyst Fibros. 2012 Jul;11(4):332-6. doi: 10.1016/j.jcf.2012.01.001. Epub 2012 Feb 1., [PMID:22300503]

Abstract [show]
BACKGROUND: Newborn screening (NBS) for Cystic Fibrosis (CF) has been introduced in many countries, but there is no ideal protocol suitable for all countries. This retrospective study was conducted to evaluate whether the planned two step CF NBS with immunoreactive trypsinogen (IRT) and 7 CFTR mutations would have detected all clinically diagnosed children with CF in Switzerland. METHODS: IRT was measured using AutoDELFIA Neonatal IRT-Kit in stored NBS cards. RESULTS: Between 2006 and 2009, 66 children with CF were reported, 4 of which were excluded for various reasons (born in another country, NBS at 6 months, no informed consent). 98% (61/62) had significantly higher IRT compared to matched control group. There was one false negative IRT result in an asymptomatic child with atypical CF (normal pancreatic function and sweat test). CONCLUSIONS: All children but one with atypical CF would have been detected with the planned two step protocol.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 CFTR mutations Alleles found Percentage of total Homozygous (n) F508del a 86 68.2 30 3905insT a 4 3.2 1 G542X a 3 2.4 - R553X a 3 2.4 1 W1282X a 2 1.6 - 1717-1 GNA a 2 1.6 - N1303K a 0 0.0 - S549R 3 2.4 1 Q525X 3 2.4 - Y1092X 2 1.6 - 3120+1 GNA b 2 1.6 1 2347delG 2 1.6 - 2176insC 1 0.8 - 3659delC 1 0.8 - 3359delCTCTG 1 0.8 - W1089X 1 0.8 - 711+1 GNT 1 0.8 - D1152H 1 0.8 - G1244E 1 0.8 - R1066C 1 0.8 - R31C 1 0.8 - R347P 1 0.8 - R74W 1 0.8 - S945L 1 0.8 - T501I 1 0.8 - K68X 1 0.8 - Total 126 100.0% 34 a Seven most common CF-gene mutations in Switzerland ("Swiss panel")=79.4% (100/126) of alleles. Login to comment

[hide] Link between CFTR mutations and ABPA: a systematic... Mycoses. 2012 Jul;55(4):357-65. doi: 10.1111/j.1439-0507.2011.02130.x. Epub 2011 Oct 17. Agarwal R, Khan A, Aggarwal AN, Gupta D
Link between CFTR mutations and ABPA: a systematic review and meta-analysis.
Mycoses. 2012 Jul;55(4):357-65. doi: 10.1111/j.1439-0507.2011.02130.x. Epub 2011 Oct 17., [PMID:21999194]

Abstract [show]
Summary There is a biological plausibility on the link between cystic fibrosis transmembrane conductance regulator (CFTR) mutations and allergic bronchopulmonary aspergillosis (ABPA). The aim of the systematic review was to investigate this link by determining the frequency of CFTR mutations in ABPA. We searched the PubMed and EmBase databases for studies reporting CFTR mutations in ABPA. We pooled the odds ratio (OR) and 95% confidence intervals (CI) from individual studies using both fixed and random effects model. Statistical heterogeneity was evaluated using the I(2) test and the Cochran-Q statistic. Publication bias was assessed using both graphical and statistical methods. Our search yielded four studies (79 ABPA, 268 controls). The odds of encountering CFTR mutation was higher in ABPA compared with the control group (OR 10.39; 95% CI, 4.35-24.79) or the asthma population (OR 5.53; 95% CI 1.62-18.82). There was no evidence of statistical heterogeneity or publication bias. There is a possible pathogenetic link between CFTR mutations and ABPA. However, because of the small numbers of patients, further studies are required to confirm this finding. Future studies should adopt a uniform methodology and should screen for the entire genetic sequence of the CFTR gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 (1996)[30] 11ABPA53chronic bronchitis Asthma,pulmonaryinfiltrates,CB, immediateAfskintestpositivity,totalIgE >1000ngml)1 ,positiveAfprecipitins, elevatedAfIgG/IgE,bloodeosinophilia, sweatchloride<40mmoll)1 /(United States) BothgroupssixmutationsF508del, G542X,GS51D,R553X,W1282X andN1303K;ninemoremutations inABPA:R117H,R347P,R347H, R334W,A455E,G551S, 2789+5G>A,D1152H,and 3849+10kbC>T ReverseASOanalysis andDGGEwithDNA sequencing 1patientcarried2CF (F508del;R347H)and5 carried1CF(4F508del; 1R117H).Mutationsseenin 6/11ABPAvs.1/53 controls Aronetal. Login to comment

[hide] Ivacaftor potentiation of multiple CFTR channels w... J Cyst Fibros. 2012 May;11(3):237-45. doi: 10.1016/j.jcf.2011.12.005. Epub 2012 Jan 30. Yu H, Burton B, Huang CJ, Worley J, Cao D, Johnson JP Jr, Urrutia A, Joubran J, Seepersaud S, Sussky K, Hoffman BJ, Van Goor F
Ivacaftor potentiation of multiple CFTR channels with gating mutations.
J Cyst Fibros. 2012 May;11(3):237-45. doi: 10.1016/j.jcf.2011.12.005. Epub 2012 Jan 30., [PMID:22293084]

Abstract [show]
BACKGROUND: The investigational CFTR potentiator ivacaftor (VX-770) increased CFTR channel activity and improved lung function in subjects with CF who have the G551D CFTR gating mutation. The aim of this in vitro study was to determine whether ivacaftor potentiates mutant CFTR with gating defects caused by other CFTR gating mutations. METHODS: The effects of ivacaftor on CFTR channel open probability and chloride transport were tested in electrophysiological studies using Fischer rat thyroid (FRT) cells expressing different CFTR gating mutations. RESULTS: Ivacaftor potentiated multiple mutant CFTR forms with defects in CFTR channel gating. These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations. CONCLUSION: These in vitro data suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support investigation of the potential clinical benefit of ivacaftor in CF patients who have CFTR gating mutations beyond G551D.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 Other CFTR gene mutations associated with residual CFTR function include A445E, R347H, D1152H, and certain splice mutations (3849 +10kbC→T) [4,29-30]. Login to comment
140 Other CFTR gene mutations associated with residual CFTR function include A445E, R347H, D1152H, and certain splice mutations (3849 +10kbC࢐T) [4,29-30]. Login to comment

[hide] Genetic prevalence and characteristics in children... J Pediatr Gastroenterol Nutr. 2012 May;54(5):645-50. Sultan M, Werlin S, Venkatasubramani N
Genetic prevalence and characteristics in children with recurrent pancreatitis.
J Pediatr Gastroenterol Nutr. 2012 May;54(5):645-50., [PMID:22094894]

Abstract [show]
AIMS: The causes of chronic (CP) and recurrent acute pancreatitis (RAP) in children include anatomic abnormalities and hereditary, metabolic, and autoimmune disorders, with a significant proportion of cases being labeled as idiopathic. Genetic pancreatitis (GP) is associated with mutations of cystic fibrosis transmembrane conductor regulator gene (CFTR), cationic trypsinogen (PRSS1) gene, and serine protease inhibitor Kazal type 1 (SPINK1). There literature is sparse regarding the clinical profile of GP in children. The aim of the present study was to estimate the prevalence and describe the clinical characteristics and outcome of genetic pancreatitis. METHODS: We reviewed the charts of children ages 18 years or younger with RAP or CP diagnosed from 2000 to 2009 at the Children's Hospital of Wisconsin, Milwaukee. Twenty-nine patients with RAP or CP were identified, of whom 23 (79%) were positive for mutations in >/=1 of the above-mentioned genes, and were included for review. RESULTS: The median age of symptom onset was 5 years (range 9 months-15 years) with diagnosis at 6.5 years (range 1-16 years). Twenty-one were white; 14 were girls. The most common presenting symptoms were abdominal pain and vomiting. Patients with RAP had 2 to 8 episodes of pancreatitis during 3.6-year average follow-up. Family history was positive in 5 of 29 of gene-tested patients. CFTR, SPINK1, or PRSS1 mutations were seen in 14 (48%), 8 (27%), and 7 (24%) patients, respectively. Two patients were homozygous for CFTR mutations, 6 heterozygote and 4 patients had 5 T variants. Two other patients had double heterozygous mutations in F508 del/2789 + 5G > A and F508 del/5T variant. Six patients with CP had a combination of CFTR and SPINK1 or PRSS1 mutations. Eleven of 29 (38%) patients met radiological criteria for CP. All of the heterozygote patients with a combination of CFTR and SPINK1 or PRSS1 mutations had CP. Eight patients developed a chronic pain syndrome and 2 developed exocrine pancreatic insufficiency during follow-up. CONCLUSIONS: We found a high prevalence of genetic mutations in patients without anatomic or metabolic abnormalities known to be associated with pancreatitis. Studies are needed to ascertain the genetic causes of RAP and CP and examine the relation between single CFTR mutations and single mutations in the PRSS1 and SPINK1 genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Six patients were heterozygous for the CFTR mutation (F508del, R297W, D1152H, R297Q, and I148T). Login to comment
137 Other mutations (R297Q, D1152H, R297Q, and I148T) may be present in CF and CFTR-related disorders such as pancreatitis and obstructive azoospermia (25). Login to comment
145 CFTR mutations and functional consequences CFTR mutations Clinical significance (reference) F508 del Cystic fibrosis (21) 2789 þ 5G>A Cystic fibrosis (21) 5T CFTR-related disorder (pancreatitis, obstructive azoospermia) (21) R533X Cystic fibrosis (22) A349V Unknown clinical significance (26) p.L997F Unknown clinical significance (21), possible CFTR-related disorder (pancreatitis) (7) R297Q Unknown clinical significance (21) D1152H Cystic fibrosis and CFTR-related disorder (21) I 148T Cystic fibrosis (27) CFTR ¼ cystic fibrosis transmembrane conductor regulator. Login to comment

[hide] A large deletion causes apparent homozygosity for ... Gene. 2012 Apr 10;497(1):90-2. Epub 2012 Jan 31. Diana A, Tesse R, Polizzi AM, Santostasi T, Manca A, Leonetti G, Seia M, Porcaro L, Cavallo L
A large deletion causes apparent homozygosity for the D1152H mutation in the cystic fibrosis transmembrane regulator (CFTR) gene.
Gene. 2012 Apr 10;497(1):90-2. Epub 2012 Jan 31., [PMID:22310382]

Abstract [show]
We report the case of a patient with an apparent homozygosity for the D1152H mutation located in exon 18 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The parents had no personal history of cystic fibrosis (CF) and referred to our laboratory after the diagnosis of fetal bowel hyperechogenicity. The proband presented with meconium ileus and normal sweat chloride test. Sequencing of the CFTR exon 18 together with quantitative genomic assays, such as real-time PCR and the multiplex ligation probe amplification (MLPA) techniques, were performed and revealed that the father was heterozygous for the D1152H mutation and the mother carried a large deletion of the CFTR gene encompassing the genomic sequence including the same mutation. The child inherited D1152H from his father and the large deletion of the CFTR gene from his mother. We suggest that D1152H likely acts as a mild mutation with a dominant effect on the severe deletion of exon 18, considering that after 3 years of clinical examinations the child shows no classical signs and symptoms of CF. Not testing for large deletions in subjects with apparent homozygosity for a mutated CFTR allele could lead to the misidentification of CFTR mutation carrier status.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Short Communication A large deletion causes apparent homozygosity for the D1152H mutation in the cystic fibrosis transmembrane regulator (CFTR) gene Anna Diana a, ⁎,1 , Riccardina Tesse a,1 , Angela M. Polizzi a , Teresa Santostasi a , Antonio Manca a , Giuseppina Leonetti a , Manuela Seia b , Luigi Porcaro b , Luciano Cavallo a a Department of Biomedicine of the Developing Age, Apulian Referral Center for Cystic Fibrosis, Policlinico, University of Bari, Bari, Italy b Medical Genetics Laboratory, Fondazione IRCCS Policlinico, Mangiagalli, Regina Elena, Milan, Italy a b s t r a c ta r t i c l e i n f o Article history: Accepted 21 January 2012 Available online 31 January 2012 Keywords: CFTR Cystic fibrosis Homozygosis Large deletion Phenotype We report the case of a patient with an apparent homozygosity for the D1152H mutation located in exon 18 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Login to comment
3 Sequencing of the CFTR exon 18 together with quantitative genomic assays, such as real-time PCR and the multiplex ligation probe amplification (MLPA) techniques, were performed and revealed that the father was heterozygous for the D1152H mutation and the mother carried a large deletion of the CFTR gene encompassing the genomic sequence including the same mutation. Login to comment
4 The child inherited D1152H from his father and the large deletion of the CFTR gene from his mother. Login to comment
5 We suggest that D1152H likely acts as a mild mutation with a dominant effect on the severe deletion of exon 18, considering that after 3 years of clinical examinations the child shows no classical signs and symptoms of CF. Login to comment
19 We firstly report the case of a patient with an apparent homozygosity for the D1152H mutation located in exon 18 and commonly associated with a variable CF phenotype, in presence of a non compatible molecular analysis in his parents and a peculiar disease expression, investigated by specific genomic assays of CFTR rearrangements detection. Login to comment
29 The father resulted heterozygous for the D1152H mutation, while the mother apparently did not show any tested genetic variation for the CFTR gene. Login to comment
33 The genetic investigation of the newborn by RDB assay showed an apparent homozygosity for D1152H, not compatible with the parents' genetic status. Login to comment
34 To bear out the unexpected result, sequencing of the CFTR exon 18 was performed by means of the ABI Prism 310 (Applied Biosystems, Foster City, CA), confirming the homozygosity for D1152H in the child, the heterozygosity for the same mutation in his father and the wild-type status of his mother (Fig. 1). Login to comment
37 The second possibility was the hemizygosity of the proband bearing D1152H on one allele (inherited from father) and a large deletion of the CFTR gene encompassing the same sequence region, including D1152H, on the second allele (derived from mother). Login to comment
45 We describe for the first time a CF patient having D1152H/ dele17a-18 genotype with a history of hyperechogenic bowel loops and MI, but non classic form CF phenotype. Login to comment
52 The D1152H is a type IV CFTR mutation, which is associated with residual CFTR function and abnormal chloride gating (Vankeerberghen et al., 1998). Login to comment
54 D1152H is often associated with non classical forms of CF and it has been detected frequently in men with congenital bilateral absence of vas deferens (CBAVD) (Highsmith et al., 2005). Login to comment
55 In our case the D1152H is in compound heterozygosity with dele17a-18 (3120+1Kbdel8.6Kb) which was firstly described in Palestinian Arab CF patients with a severe CF phenotype (Lerer et al., 1999). Login to comment
58 Sequence electropherograms showing by continuous arrows the homozygosity for D1152H in exon 18 of CFTR gene in the proband (A), the heterozygosity for the same mutation in his father (B), and the wild-type status of his mother (C). Login to comment
63 We speculate that the D1152H, acting as a mild mutation, has a dominant effect on the severe dele17a-18. Login to comment
64 Orgad et al. (2002) reported a case of hyperechogenic bowel loops and MI in a fetus carrying the combination of D1152H and G542X mutations, but they did not describe the clinical follow-up of the newborn. Login to comment
65 Moreover Yalçin et al. (2008) reported a 16-year-old boy with the rare 2183AA>G/D1152H genotype, presenting with MI in the neonatal period and a mild clinical phenotype later in life with no evidence of PI. Login to comment
68 Furthermore, we suggest the importance of the inclusion of D1152H mutation in the screening panel for CF diagnosis. Login to comment
62 We speculate that the D1152H, acting as a mild mutation, has a dominant effect on the severe dele17a-18. Login to comment
67 Furthermore, we suggest the importance of the inclusion of D1152H mutation in the screening panel for CF diagnosis. Login to comment

[hide] CFTR, SPINK1, CTRC and PRSS1 variants in chronic p... Gut. 2012 Mar 17. Rosendahl J, Landt O, Bernadova J, Kovacs P, Teich N, Bodeker H, Keim V, Ruffert C, Mossner J, Kage A, Stumvoll M, Groneberg D, Kruger R, Luck W, Treiber M, Becker M, Witt H
CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated?
Gut. 2012 Mar 17., [PMID:22427236]

Abstract [show]
OBJECTIVE: In chronic pancreatitis (CP), alterations in several genes have so far been described, but only small cohorts have been extensively investigated for all predisposing genes. DESIGN: 660 patients with idiopathic or hereditary CP and up to 1758 controls were enrolled. PRSS1, SPINK1 and CTRC were analysed by DNA sequencing, and cystic fibrosis transmembrane conductance regulator (CFTR) by melting curve analysis. RESULTS: Frequencies of CFTR variants p.R75Q, p.I148T, 5T-allele and p.E528E were comparable in patients and controls. We identified 103 CFTR variants, which represents a 2.7-fold risk increase (p<0.0001). Severe cystic fibrosis (CF)-causing variants increased the risk of developing CP 2.9-fold, and mild CF-causing variants 4.5-fold (p<0.0001 for both). Combined CF-causing variants increased CP risk 3.4-fold (p<0.0001), while non-CF-causing variants displayed a 1.5-fold over-representation in patients (p=0.14). CFTR compound heterozygous status with variant classes CF-causing severe and mild represented an OR of 16.1 (p<0.0001). Notably, only 9/660 (1.4%) patients were compound heterozygotes in this category. Trans-heterozygosity increased CP risk, with an OR of 38.7, with 43/660 (6.5%) patients and 3/1667 (0.2%) controls being trans-heterozygous (p<0.0001). CONCLUSIONS: Accumulation of CFTR variants in CP is less pronounced than reported previously, with ORs between 2.7 and 4.5. Only CF-causing variants reached statistical significance. Compound and trans-heterozygosity is an overt risk factor for the development of CP, but the number of CFTR compound heterozygotes in particular is rather low. In summary, the study demonstrates the complexity of genetic interactions in CP and a minor influence of CFTR alterations in CP development.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 The following CFTR variants were analysed with specific FRET probes: p.E60X, p.R75Q, p.G85E, p.R117H, p.I148T, c.621 +1G>T (IVS4+1G>T), c.711+1G>T (IVS5+1G>T), c.1078delT, p.R334W, p.R347P, 9-13TG, 5-9T, p.A455E, p.M470V, p.F508del, c.1716G>A (p.E528E), c.1717-1G>A (IVS10-1G>A), p.G542X, p.S549N, p.R553X, p.R560T, c.1898+1G>A (IVS12 +1G>A), c.2143delT, c.2183AA>G, c.2562T>G, c.2657+5G>A (IVS14B+5G>A), p.L997F, p.I1005R, p.Y1092X, p.D1152H, p.R1162X, c.3659delC, p.S1235R, p.S1251N, p.W1282X, p.N1303K, and c.4389G>A. Login to comment
140 Variant distribution in patients aged >20 and <20 years In younger patients, overall PRSS1 variants were 2.9-fold more common (>20 years: 9/239, 3.8%; <20 years: 46/421, 10.9%; p¼0.001, OR 3.1, 95% CI 1.5 to 6.5), whereas overall SPINK1 variants were similarly distributed (56/239, 23.4%; 73/421, Table 2 CFTR variants detected by melting curve analysis Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing, severe) p.F508del 44/660 (6.7%) 48/1758 (2.7%) <0.0001 2.5 (1.7 to 3.9) p.R117H (5T/7T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.G542X 1/660 (0.2%) 1/1758 (0.06%) NS e c.1717-1G>A 3/660 (0.5%) 1/1758 (0.06%) NS e p.E585X 0/660 1/1758 (0.06%) NS e c.2183AA>G 0/660 1/1758 (0.06%) NS e p.R1158X 1/660 (0.2%) 0/1758 NS e p.R1162X 1/660 (0.3%) 0/1758 NS e p.N1303K 3/660 (0.5%) 0/1758 NS e Total 55/660 (8.3%) 53/1758 (3%) <0.0001 2.9 (2 to 4.3) CFTR (CF-causing mild) p.R117H (7T/7T) 13/660 (2%) 8/1758 (0.5%) 0.0009 4.4 (1.8 to 10.7) p.R117H (7T/9T) 3/660 (0.5%) 1/1758 (0.06%) NS e p.R347H 1/660 (0.2%) 0/1758 NS e p.R347P 1/660 (0.2%) 0/1758 NS e p.A455E 1/660 (0.2%) 0/1758 NS e c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.D1152H 3/660 (0.5%) 5/1758 (0.3%) NS e Total 23/660 (3.5%) 14/1758 (0.8%) <0.0001 4.5 (2.3 to 8.8) CFTR (non CF-causing) p.R74Q 2/660 (0.3%) 0/1758 NS e p.R75Q (het)* 29/660 (4.4%) 59/1758 (3.4%) NS e p.R75Q (hom)* 2/660 (0.3%) 1/1758 (0.06%) NS e p.Y84H 0/660 1/1758 (0.06%) NS e p.A120T 0/660 1/1758 (0.06%) NS e p.I148T* 4/660 (0.6%) 11/1758 (0.6%) NS e p.I507V 1/660 (0.2%) 2/1758 (0.1%) NS e p.F508C 1/660 (0.2%) 0/1758 NS e c.1716+12T>C 0/660 1/1758 (0.06%) NS e p.E528E (het)* 36/660 (5.5%) 82/1758 (4.7%) NS e p.E528E (hom)* 0/660 2/1758 (0.1%) NS e c.1898+8C>G 0/660 1/1758 (0.06%) NS e p.H667Y 1/660 (0.2%) 0/1758 NS e p.R668C 5/660 (0.8%) 3/1758 (0.2%) NS e p.G691R 0/660 1/1758 (0.06%) NS e p.L997F 5/660 (0.8%) 6/1758 (0.3%) NS e p.S1235R 10/660 (1.5%) 18/1758 (1.0%) NS e Total (excluded)* 25/660 (3.8%) 45/1758 (2.6%) NS e CFTR (CF-causing) Total (all) 78/660 (11.8%) 67/1758 (3.8%) <0.0001 3.4 (2.4 to 4.8) CFTR (all) Total (excluded)* 103/660 (15.6%) 112/1758 (6.4%) <0.0001 2.7 (2 to 3.6) The table is divided into three parts. Login to comment
154 yVariant p.D1152H can have a broad phenotype and might be classified as a CF-causing severe variant. Login to comment
69 The following CFTR variants were analysed with specific FRET probes: p.E60X, p.R75Q, p.G85E, p.R117H, p.I148T, c.621 +1G>T (IVS4+1G>T), c.711+1G>T (IVS5+1G>T), c.1078delT, p.R334W, p.R347P, 9-13TG, 5-9T, p.A455E, p.M470V, p.F508del, c.1716G>A (p.E528E), c.1717-1G>A (IVS10-1G>A), p.G542X, p.S549N, p.R553X, p.R560T, c.1898+1G>A (IVS12 +1G>A), c.2143delT, c.2183AA>G, c.2562T>G, c.2657+5G>A (IVS14B+5G>A), p.L997F, p.I1005R, p.Y1092X, p.D1152H, p.R1162X, c.3659delC, p.S1235R, p.S1251N, p.W1282X, p.N1303K, and c.4389G>A. Login to comment
135 Variant distribution in patients aged >20 and <20 years In younger patients, overall PRSS1 variants were 2.9-fold more common (>20 years: 9/239, 3.8%; <20 years: 46/421, 10.9%; p&#bc;0.001, OR 3.1, 95% CI 1.5 to 6.5), whereas overall SPINK1 variants were similarly distributed (56/239, 23.4%; 73/421, Table 2 CFTR variants detected by melting curve analysis Gene Variant Patients Controls p Value OR (95% CI) CFTR (CF-causing, severe) p.F508del 44/660 (6.7%) 48/1758 (2.7%) <0.0001 2.5 (1.7 to 3.9) p.R117H (5T/7T) 2/660 (0.3%) 1/1758 (0.06%) NS e p.G542X 1/660 (0.2%) 1/1758 (0.06%) NS e c.1717-1G>A 3/660 (0.5%) 1/1758 (0.06%) NS e p.E585X 0/660 1/1758 (0.06%) NS e c.2183AA>G 0/660 1/1758 (0.06%) NS e p.R1158X 1/660 (0.2%) 0/1758 NS e p.R1162X 1/660 (0.3%) 0/1758 NS e p.N1303K 3/660 (0.5%) 0/1758 NS e Total 55/660 (8.3%) 53/1758 (3%) <0.0001 2.9 (2 to 4.3) CFTR (CF-causing mild) p.R117H (7T/7T) 13/660 (2%) 8/1758 (0.5%) 0.0009 4.4 (1.8 to 10.7) p.R117H (7T/9T) 3/660 (0.5%) 1/1758 (0.06%) NS e p.R347H 1/660 (0.2%) 0/1758 NS e p.R347P 1/660 (0.2%) 0/1758 NS e p.A455E 1/660 (0.2%) 0/1758 NS e c.2657+5G>A 1/660 (0.2%) 0/1758 NS e p.D1152H 3/660 (0.5%) 5/1758 (0.3%) NS e Total 23/660 (3.5%) 14/1758 (0.8%) <0.0001 4.5 (2.3 to 8.8) CFTR (non CF-causing) p.R74Q 2/660 (0.3%) 0/1758 NS e p.R75Q (het)* 29/660 (4.4%) 59/1758 (3.4%) NS e p.R75Q (hom)* 2/660 (0.3%) 1/1758 (0.06%) NS e p.Y84H 0/660 1/1758 (0.06%) NS e p.A120T 0/660 1/1758 (0.06%) NS e p.I148T* 4/660 (0.6%) 11/1758 (0.6%) NS e p.I507V 1/660 (0.2%) 2/1758 (0.1%) NS e p.F508C 1/660 (0.2%) 0/1758 NS e c.1716+12T>C 0/660 1/1758 (0.06%) NS e p.E528E (het)* 36/660 (5.5%) 82/1758 (4.7%) NS e p.E528E (hom)* 0/660 2/1758 (0.1%) NS e c.1898+8C>G 0/660 1/1758 (0.06%) NS e p.H667Y 1/660 (0.2%) 0/1758 NS e p.R668C 5/660 (0.8%) 3/1758 (0.2%) NS e p.G691R 0/660 1/1758 (0.06%) NS e p.L997F 5/660 (0.8%) 6/1758 (0.3%) NS e p.S1235R 10/660 (1.5%) 18/1758 (1.0%) NS e Total (excluded)* 25/660 (3.8%) 45/1758 (2.6%) NS e CFTR (CF-causing) Total (all) 78/660 (11.8%) 67/1758 (3.8%) <0.0001 3.4 (2.4 to 4.8) CFTR (all) Total (excluded)* 103/660 (15.6%) 112/1758 (6.4%) <0.0001 2.7 (2 to 3.6) The table is divided into three parts. Login to comment
148 yVariant p.D1152H can have a broad phenotype and might be classified as a CF-causing severe variant. Login to comment

[hide] Role of Cystic Fibrosis Transmembrane Conductance ... Chest. 2012 Mar 15. Gonska T, Choi P, Stephenson A, Ellis L, Martin S, Solomon M, Dupuis A, Dorfman R, Zielenski J, Ooi CY, Weiser W, Durie PR, Tullis E
Role of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) in patients with chronic sinopulmonary disease.
Chest. 2012 Mar 15., [PMID:22423042]

Abstract [show]
ABSTRACT INTRODUCTION:Previous studies report a high frequency of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene in patients with idiopathic bronchiectasis. However, most studies have based their findings on pre-selected patient groups or have performed limited testing for CFTR dysfunction. The objective of our study was to evaluate the prevalence of CFTR gene mutations and/or CFTR-related ion channel abnormalities among subjects with idiopathic chronic sinopulmonary disease and the prevalence of CF or a CFTR-related disorder in this population. METHODS:We evaluated 72 prospectively enrolled patients from 1995-2005 at the Hospital for Sick Children and St. Michael's Hospital with idiopathic chronic sinopulmonary disease for evidence of CFTR-mediated abnormalities. We performed CFTR genotyping and assessed CFTR function using sweat testing and nasal potential difference testing. The results were compared with data from healthy controls, CF heterozygotes and CF patients. RESULTS:The CFTR functional tests in idiopathic sinopulmonary patients showed a continuous spectrum, ranging from normal to values typically seen in individuals with CF. Forty eight patients (66%) demonstrated CFTR mutations and/or abnormalities of CFTR function. Twenty two (31%) fulfilled criteria for a CF diagnosis and 26 (36%) for a CFTR-related disorder with a strong female preponderance. Functional tests, more than genotyping, were instrumental in establishing a CF diagnosis. Clinical features failed to distinguish CF subjects from those with CFTR-related or idiopathic disease. CONCLUSION:The high prevalence of CF and CFTR dysfunction among patients with idiopathic chronic sinopulmonary disease underscores the need for extensive diagnostic evaluation for CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 All P values are two-sided with a Table 2-CFTR Genotypes Identified in Subjects With Idiopathic Sinopulmonary Disease CF Causing/CF Causing CF Causing/CFTR Mutation CFTR Mutation/CFTR Mutation CF Causing/Unknown CFTR Mutation/Unknown F508del/A455E 3x F508del /D1152H 2x D579G/D579G 2x F508del /26x R764X/2 F508del/S1251N R75X/V456A 758delC/2 F508del/L967S 1716G.A/5T 1716G.A/2 F508del/5T R75Q/5T R117H (7T)/23x F508del/3212T.C 5T/23x G542X/D1152H 1717-1G.A/Q1291H Patients are grouped according to the identified CFTR alterations on allele 1/allele 2. Login to comment

[hide] Extensive molecular analysis of patients bearing C... J Mol Diagn. 2012 Jan;14(1):81-9. Epub 2011 Oct 20. Amato F, Bellia C, Cardillo G, Castaldo G, Ciaccio M, Elce A, Lembo F, Tomaiuolo R
Extensive molecular analysis of patients bearing CFTR-related disorders.
J Mol Diagn. 2012 Jan;14(1):81-9. Epub 2011 Oct 20., [PMID:22020151]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR)-related disorders (CFTR-RDs) may present with pancreatic sufficiency, normal sweat test results, and better outcome. The detection rate of mutations is lower in CFTR-RD than in classic CF: mutations may be located in genes encoding proteins that interact with CFTR or support channel activity. We tested the whole CFTR coding regions in 99 CFTR-RD patients, looking for gene mutations in solute carrier (SLC) 26A and in epithelial Na channel (ENaC) in 33 patients who had unidentified mutations. CFTR analysis revealed 28 mutations, some of which are rare. Of these mutations, RT-PCR demonstrated that the novel 1525-1delG impairs exon 10 splicing; by using minigene analysis, we excluded the splicing effect of three other novel intronic variants. Analysis of SLC26A genes revealed several variants, some of which are novel, that did not affect mRNA expression. Other mutations occurred in the ENaC genes encoding the ENaC subunits, but their frequency did not significantly differ between patients and controls. Our data, although obtained on a preliminary cohort of CFTR-RD patients, exclude a role of mutations in SLC26A and in SCNN genes in the pathogenesis of such disease; we confirm that CFTR analysis has a relevant role in CFTR-RD patients; and it appears mandatory to use CFTR scanning techniques and approaches to reveal the effect of novel mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 Allele Frequency and CFTR Mutations in Patients Bearing CFTR-RDs Mutation (traditional name) HGVS nomenclature15 CBAVD (118 alleles)* RP (42 alleles)* DB (38 alleles)* Total (198 alleles)* TG12-T5-470V 34 (28.8) 2 (4.8) 10 (26.3) 46 (23.2) F508del c.1521_1523del 19 (16.1) 7 (16.7) 4 (10.5) 30 (15.2) 3195del6 c.3063_3069del 9 (7.6) 0 0 9 (4.5) N1303K c.3909CϾG 3 (2.5) 1 (2.4) 4 (10.5) 8 (4.0) G542X c.1624GϾT 4 (3.4) 1 (2.4) 1 (2.6) 6 (3.0) D1152H c.3454GϾC 1 (0.8) 2 (4.8) 2 (5.3) 5 (2.5) G85E c.254GϾA 2 (1.7) 3 (7.1) 0 5 (2.5) 1525-1delG c.1394de 3 (2.5) 1 (2.4) 0 4 (3.0) 4016insT c.3885insT 2 (1.7) 1 (2.4) 0 3 (1.5) 2789ϩ5GϾA c.2657ϩ5GϾA 0 3 (7.1) 0 3 (1.5) Q1476X c.4426CϾT 3 (2.5) 0 0 3 (1.5) 2183AAϾG c.2051_2052delinsG 1 (0.8) 1 (2.4) 0 2 (1.0) R553X c.1657CϾT 1 (0.8) 1 (2.4) 0 2 (1.0) L568F c.1704GϾT 2 (1.7) 0 0 2 (1.0) R1158X c.3472CϾT 2 (1.7) 0 0 2 (1.0) V920M c.2758GϾA 1 (0.8) 0 1 (2.6) 2 (1.0) 711ϩ1GϾT c.579ϩ1GϾT 0 1 (2.4) 0 1 (0.5) D614G c.1841AϾG 1 (0.8) 0 0 1 (0.5) 2184insA c.2052del 0 1 (2.4) 0 1 (0.5) 621ϩ1GϾT c.489ϩ1GϾT 1 (0.8) 0 0 1 (0.5) R1438W c.4312CϾT 0 1 (2.4) 0 1 (0.5) E193X c.577GϾT 0 1 (2.4) 0 1 (0.5) G1244E c.3731GϾA 1 (0.8) 0 0 1 (0.5) K68E c.202AϾG 1 (0.8) 0 0 1 (0.5) R347P c.1040GϾC 1 (0.8) 0 0 1 (0.5) 621ϩ3AϾG c.489ϩ3AϾG 1 (0.8) 0 0 1 (0.5) L997F c.2991GϾC 0 1 (2.4) 0 1 (0.5) F508C c.1523TϾG 1 (0.8) 0 0 1 (0.5) Total 94 (79.7) 28 (66.7) 22 (57.9) 144 (72.7) Undetected 24 (20.3) 14 (33.3) 16 (42.1) 54 (27.3) *Data are given as number (percentage). Login to comment
86 Six mutations were present in Ͼ2.0% of chromosomes (namely, 3195del6, N1303K, G542X, D1152H, 1525-1delG, and G85E). Login to comment

[hide] Measurements of CFTR-Mediated Cl(-) Secretion in H... PLoS One. 2012;7(10):e47708. doi: 10.1371/journal.pone.0047708. Epub 2012 Oct 17. Sousa M, Servidoni MF, Vinagre AM, Ramalho AS, Bonadia LC, Felicio V, Ribeiro MA, Uliyakina I, Marson FA, Kmit A, Cardoso SR, Ribeiro JD, Bertuzzo CS, Sousa L, Kunzelmann K, Ribeiro AF, Amaral MD
Measurements of CFTR-Mediated Cl(-) Secretion in Human Rectal Biopsies Constitute a Robust Biomarker for Cystic Fibrosis Diagnosis and Prognosis.
PLoS One. 2012;7(10):e47708. doi: 10.1371/journal.pone.0047708. Epub 2012 Oct 17., [PMID:23082198]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is caused by approximately 1,900 mutations in the CF transmembrane conductance regulator (CFTR) gene encoding for a cAMP-regulated chloride (Cl(-)) channel expressed in several epithelia. Clinical features are dominated by respiratory symptoms, but there is variable organ involvement thus causing diagnostic dilemmas, especially for non-classic cases. METHODOLOGY/PRINCIPAL FINDINGS: To further establish measurement of CFTR function as a sensitive and robust biomarker for diagnosis and prognosis of CF, we herein assessed cholinergic and cAMP-CFTR-mediated Cl(-) secretion in 524 freshly excised rectal biopsies from 118 individuals, including patients with confirmed CF clinical diagnosis (n = 51), individuals with clinical CF suspicion (n = 49) and age-matched non-CF controls (n = 18). Conclusive measurements were obtained for 96% of cases. Patients with "Classic CF", presenting earlier onset of symptoms, pancreatic insufficiency, severe lung disease and low Shwachman-Kulczycki scores were found to lack CFTR-mediated Cl(-) secretion (<5%). Individuals with milder CF disease presented residual CFTR-mediated Cl(-) secretion (10-57%) and non-CF controls show CFTR-mediated Cl(-) secretion >/=30-35% and data evidenced good correlations with various clinical parameters. Finally, comparison of these values with those in "CF suspicion" individuals allowed to confirm CF in 16/49 individuals (33%) and exclude it in 28/49 (57%). Statistical discriminant analyses showed that colonic measurements of CFTR-mediated Cl(-) secretion are the best discriminator among Classic/Non-Classic CF and non-CF groups. CONCLUSIONS/SIGNIFICANCE: Determination of CFTR-mediated Cl(-) secretion in rectal biopsies is demonstrated here to be a sensitive, reproducible and robust predictive biomarker for the diagnosis and prognosis of CF. The method also has very high potential for (pre-)clinical trials of CFTR-modulator therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 In contrast, for the 28 individuals in the ''CF suspicion`` group who showed lumen-negative responses, i.e., normal CFTR function (Isc-CCH(IBMX/Fsk) = 2153.38615.33 mA/ cm2 vs Isc-CCH(IBMX/Fsk) = 2162.07619.64 mA/cm2 in the non-CF control group) we could only detect one CF-causing mutation (F508del) in one individual (being thus a CF-carrier) and 2 other mutations in two individuals who were thus compound heterozygous: W1282X/4428insGA and F508del/D1152H, respectively (Table S1). Login to comment
93 Based on their clinical characteristics (only obstructive azoospermia and bronchiectasis), values of CFTR colonic function (within the normal range) and CFTR genotypes, these two individuals were thus classified as CFTR-RD and both 4428insGA and D1152H were regarded as CFTR-RD mutations. Login to comment
180 doi:10.1371/journal.pone.0047708.g004 Class III [42], whereas significant CFTR-mediated Cl2 secretion was found in two patients bearing 4428insGA and D1152H (84 and 64%, respectively). Login to comment

[hide] Prenatal and newborn screening for CFTR mutations:... Clin Biochem. 2011 May;44(7):485-6. Schwarz MJ
Prenatal and newborn screening for CFTR mutations: the difficulties of prediction.
Clin Biochem. 2011 May;44(7):485-6., [PMID:22036338]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 For example, the mutations D1152H (p.Asp1152His) and 3272-26ANG (c.3140-26ANG) may be associated with late-onset bronchiectasis and an absence of any significant symptoms in infancy and childhood. Login to comment

[hide] The D1152H cystic fibrosis mutation in prenatal ca... J Med Screen. 2011;18(4):169-72. Epub 2011 Dec 7. Peleg L, Karpati M, Bronstein S, Berkenstadt M, Frydman M, Yonath H, Pras E
The D1152H cystic fibrosis mutation in prenatal carrier screening, patients and prenatal diagnosis.
J Med Screen. 2011;18(4):169-72. Epub 2011 Dec 7., [PMID:22156145]

Abstract [show]
OBJECTIVE: To assess the frequency of the D1152H mutation in the CFTR gene in normal individuals, in cystic fibrosis (CF) patients and in the setting of prenatal diagnosis. SETTING: A database analysis of sequential screening results seen at the Sheba Medical Center, Israel, between 2001 and 2010. METHODS: We retrospectively analyzed the frequency of D1152H in a large cohort of healthy individuals who were screened as part of a routine prenatal care programme, in individuals referred due to CF-related symptoms and in the setting of prenatal diagnosis. RESULTS: We found one asymptomatic homozygous female and 195 D1152H carriers among 49,940 healthy individuals screened, establishing a carrier rate of 1:255 for this mutation. We detected D1152H in nine of 103 individuals referred due to CF-related symptoms. Four suffered from respiratory symptoms and five from congenital bilateral absence of the vas deferens (CBAVD). During this period D1152H was detected in three pregnancies, two of which were aborted. CONCLUSION: The increased frequency of D1152H in individuals referred due to CF-related symptoms compared with healthy individuals included in the CF carrier screening programme (P < 0.001) clearly indicates that it is a disease-causing mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
137 Objective To assess the frequency of the D1152H mutation in the CFTR gene in normal individuals, in cystic fibrosis (CF) patients and in the setting of prenatal diagnosis. Login to comment
139 Methods We retrospectively analyzed the frequency of D1152H in a large cohort of healthy individuals who were screened as part of a routine prenatal care programme, in individuals referred due to CF-related symptoms and in the setting of prenatal diagnosis. Login to comment
140 Results We found one asymptomatic homozygous female and 195 D1152H carriers among 49,940 healthy individuals screened, establishing a carrier rate of 1:255 for this mutation. Login to comment
141 We detected D1152H in nine of 103 individuals referred due to CF-related symptoms. Login to comment
143 During this period D1152H was detected in three pregnancies, two of which were aborted. Login to comment
144 Conclusion The increased frequency of D1152H in individuals referred due to CF-related symptoms compared with healthy individuals included in the CF carrier screening programme (P , 0.001) clearly indicates that it is a disease-causing mutation. Login to comment
148 The D1152H mutation is associated with residual CFTR function and abnormal chloride gating.10 Initially this mutation in its homozygous form or in conjunction with another CFTR mutation was associated mainly with CBAVD and mild, late onset pulmonary disease; with borderline or normal sweat chloride values.7,11 Moreover, among Hispanics D1152H was found in 6% of the referrals for routine screening but in no Hispanic CF patients, questioning whether D1152H is no more then a functional polymorphism;12 and in a recent consensus report D1152H was not categorized as a disease-causing mutation.13 We have included D1152H in our CF carrier screening programme and in patient screening since 2001. Login to comment
149 During these years we have detected D1152H in healthy individuals who took part in our screening programme, in patients, and in three fetuses studied prenatally. Login to comment
157 One hundred and ninety-five individuals were found heterozygous for the D1152H mutation and one 30-year-old female without any CF-related symptoms was found homozygous for D1152H. Login to comment
162 Of the 37 patients with two mutations, D1152H was found in nine (Table 3), comprising 16.9% of the mutations detected among suspected patients. Login to comment
163 Four were homozygous for D1152H, and five were compound heterozygotes. Login to comment
164 Two of the D1152H homozygotes were referred because of CBAVD and two due to respiratory symptoms. Login to comment
166 D1152H was not detected in any of the nine patients with a single mutation. Login to comment
167 Between 2001 and 2010 we detected three D1152H compound heterozygote fetuses (Table 4). Login to comment
173 Carrier rate Total individuals screened 49,940 Total CF carriers 1524 1:33 D1152H carriers 195 1:255 Table 3 D1152H in conjunction with CF-related symptoms No. Mutations Age Sex Reason for referral 1 D1152H/ W1282X 30 F Mild asthma during childhood that disappeared in adulthood. Login to comment
174 No pancreatic insufficiency. 2 D1152H/ F508del 36 M CBAVD, no respiratory symptoms or pancreatic insufficiency. 3 D1152H/ F508del 40 M CBAVD no respiratory symptoms or pancreatic insufficiency. 4 D1152H/ D1152H 31 M CBAVD no respiratory symptoms or pancreatic insufficiency. 5 D1152H/ D1152H 8 M Recurrent pneumonias since infancy. Login to comment
176 No pancreatic insufficiency. 6 D1152H/ D1152H 40 M CBAVD, no respiratory symptoms or pancreatic insufficiency. 7 D1152H/ W1282X 30 F Recurrent pneumonia during childhood. Login to comment
178 No pancreatic insufficiency. 8 D1152H/ W1282X 21 M CBAVD, no respiratory symptoms or pancreatic insufficiency. 9 D1152H/ D1152H 17 M Bronchiectasis, recurrent lung infections, lately with Aspergillus, nasal polyps, no pancreatic insufficiency. Login to comment
180 of mutations Group of mutations 2001 Ashkenazi Jews 7 Group A Non-Ashkenazi Jews 11 Group A þ B Georgian Jews 12 Group A þ B þ T360K/Q359K 9.2004-7.2005 Yemenite Jews 12 Groups A þ B þ I1234V Iraqi Jews 12 Groups A þ B þY1092X 8.2005-12.2007 Iraqi Jews 14 Groups A þ B þY1092X þ 3121-1G-A 1.2008-2010 14 mutations for all 14 Groups A þ B þ C Georgian Jews 15 Groups A þ B þ C þ T360K/Q359K Arabic population 19 Groups A þ B þ C þ D Group A: G542X, W1282X, N1303K, F508del, 3849 þ 10KbC-T, 1717-1G-A, D1152H Group B: W1089X, G85E, 405 þ 1G-A, S549R(T-G) Group C: Y1092X, 3121-1G-A, I1234V Group D: 4010delTATT, S549I, 3120 þ 1Kbdel18.6Kb, 2183AA-G, R75X Between 2005-2008 the Iraqi population was screened for an additional mutation 2751 þ 1insT. Login to comment
181 In 2009 the Israeli Society of Medical Genetics recommended excluding this mutation from the screening programmes due to its low prevalence DISCUSSION In this report we present our experience with the D1152H mutation in a low-risk healthy population screened for CF carrier state, in symptomatic referrals and in prenatal diagnosis. Over representation of a mutation in patients, compared with the general population is considered one of the cornerstones in differentiating a mutation from a benign polymorphism. Login to comment
182 We found a much higher frequency of the D1152H allele in individuals referred due to possible CF (13 of 206 alleles) compared with individuals who took part in the screening programme (195 of 99,880; P , 0.0001). Login to comment
183 These results stand in sharp contrast to those of Sugerman et al., who found D1152H in 6% of the Hispanic population but not in Hispanic CF patients.12 A carrier rate of 1:255 for D1152H combined with a general carrier rate of 1:33 implies that roughly 1:33,000 individuals is a compound heterozygote or homozygote for D1152H, afigure in line with the single asymptomatic homozygote that we have detected in our screening programme. Login to comment
184 In this study, the overwhelming representation of D1152H compound heterozygotes and homozygotes in the patient cohort (9 of 103) serves as additional evidence that D1152H is associated with clinical symptoms thus supporting two recent publications. Login to comment
185 In 2006 Mussaffi et al. described nine patients, two homozygous for D1152H and seven compound heterozygotes, aged eight months to 54 years with variable CF manifestations which included lung and pancreatic involvement, and CBAVD.14 Although the symptoms were often mild, the authors concluded that D1152H-associated lung disease can appear in early infancy and in adults diagnosed at a late age can be quite severe. Login to comment
186 Burgel et al. described 42 patients with the D1152H mutation; 80% presented with respiratory symptoms and 25% with CBAVD.15 Clinical manifestations among patients presented in our study are similar to those reported in the two previous series. Login to comment
187 Four of our patients presented with respiratorysymptoms and although onewas diagnosed at the age of eight months, all of the others were diagnosed at an older age, indicating that D1152H is associated with a relatively mild disease. Login to comment
189 Mussaffi et al. found that two of the three adult males in their study had children, suggesting that homozygosity or compound heterozygosity for D1152H in males does not invariably result in infertility. Login to comment
191 The atypical disease and relatively mild symptoms pose an ever increasing counselling problem when faced with a fetus homozygous or compound heterozygous for D1152H as exemplified by the three cases described above. Login to comment
196 In contrast to the decision made by these parents, Mussaffi et al. described a fetus with dilated bowel loops and the D1152H/F508del genotype, where the parents elected to continue the pregnancy.14 Normal meconium was passed 16 hours after birth and subsequent studies did not reveal pancreatic insufficiency, although long-term follow-up revealed mild pulmonary symptoms and hyperinflation on a chest X-ray. Login to comment

[hide] Borderline sweat test: Utility and limits of genet... Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24. Seia M, Costantino L, Paracchini V, Porcaro L, Capasso P, Coviello D, Corbetta C, Torresani E, Magazzu D, Consalvo V, Monti A, Costantini D, Colombo C
Borderline sweat test: Utility and limits of genetic analysis for the diagnosis of cystic fibrosis.
Clin Biochem. 2009 May;42(7-8):611-6. Epub 2009 Jan 24., [PMID:19318035]

Abstract [show]
OBJECTIVE: The sweat test remains the gold standard for the diagnosis of Cystic Fibrosis (CF) even despite the availability of molecular analysis of Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR). We investigated the relationship between CFTR mutation analysis and sweat chloride concentration in a cohort of subjects with borderline sweat test values, in order to identify misdiagnosis of CF. DESIGN AND METHODS: In the period between March 2006 and February 2008 we performed 773 sweat tests in individuals referred for suspect CF. Ninety-one subjects had chloride values in the border-line range. Clinicians required CFTR gene complete scanning on 66 of them. RESULTS: The mean value of sweat chloride in the DNA negative subjects was lower than in those with at least one CFTR mutation. Our data indicate that 39 mEq/l is the best sensitivity trade off for the sweat test with respect to genotype. CONCLUSIONS: To optimise diagnostic accuracy of reference intervals, it may be useful to modify from 30 to 39 mEq/l the threshold for sweat chloride electrolytes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported. Login to comment
92 It is known that some mutations as D1152H and R117H-7T/R117C-7Tare associated with negative or borderline sweat chloride value. Login to comment
99 Moreover, we identified with a high frequency the L997F variant (3.85%) and the D1152H mutation (2.31%). Login to comment
102 Out of 5 subjects carrying the L997F variant, 4 presented pulmonary symptoms (three of them in paediatric age) and the other one pancreatitis. Login to comment
104 The D1152H mutation is caused by a guanine to cytosine substitution at nucleic acid position 3586 of the CFTR gene, resulting in replacement of aspartic acid by histidine at amino acid 1152 of the protein. Login to comment
106 In our borderline population, 3 subjects were compound heterozygous for D1152H with L997F, Q522X and F508del respectively. Login to comment
107 Out of 773 subjects who underwent sweat test, we also identified an infant carrying D1152H/F508del whose sweat value was negative. Login to comment
108 Based on our data, for the D1152H mutation, there appears to be an increase in sweat chloride values with age as documented for other CFTR mutations such as 3849+10 kb CNT [23]. Login to comment
57 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported. Login to comment
90 It is known that some mutations as D1152H and R117H-7T/R117C-7Tare associated with negative or borderline sweat chloride value. Login to comment
97 Moreover, we identified with a high frequency the L997F variant (3.85%) and the D1152H mutation (2.31%). Login to comment
105 Out of 773 subjects who underwent sweat test, we also identified an infant carrying D1152H/F508del whose sweat value was negative. Login to comment

[hide] Validation of high-resolution DNA melting analysis... J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7. Audrezet MP, Dabricot A, Le Marechal C, Ferec C
Validation of high-resolution DNA melting analysis for mutation scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7., [PMID:18687795]

Abstract [show]
High-resolution melting analysis of polymerase chain reaction products for mutation scanning, which began in the early 2000s, is based on monitoring of the fluorescence released during the melting of double-stranded DNA labeled with specifically developed saturation dye, such as LC-Green. We report here the validation of this method to scan 98% of the coding sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. We designed 32 pairs of primers to amplify and analyze the 27 exons of the gene. Thanks to the addition of a small GC-clamp at the 5' ends of the primers, one single melting domain and one identical annealing temperature were obtained to co-amplify all of the fragments. A total of 307 DNA samples, extracted by the salt precipitation method, carrying 221 mutations and 21 polymorphisms, plus 20 control samples free from variations (confirmed by denaturing high-performance liquid chromatography analysis), was used. With the conditions described in this study, 100% of samples that carry heterozygous mutations and 60% of those with homozygous mutations were identified. The study of a cohort of 136 idiopathic chronic pancreatitis patients enabled us to prospectively evaluate this technique. Thus, high-resolution melting analysis is a robust and sensitive single-tube technique for screening mutations in a gene and promises to become the gold standard over denaturing high-performance liquid chromatography, particularly for highly mutated genes such as CFTR, and appears suitable for use in reference diagnostic laboratories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Continued Exon Primer Sequences GC length Amplicon length (bp) Introns Number of heterozygous- positive controls Number of homozygous- positive controls Recommended control 16 LSCFE16Fmod 5Ј-CCGCTGAATGCGTCTACTGTGATCCA-3Ј 3 299 bp 77 6 G970R LSCFE16Rmod 5Ј-CCGTAGACAGGACTTCAA CCCTCAATCAA-3Ј 3 87 3120ϩ1GϾA 17a LSCFE17AFmod 5Ј-CCGCCGGACACACTTTG TCCACTT-3Ј 6 286 bp 49 13 3121-1GϾA LSCFE17ARmod 5Ј-CCGCCGTCAAATAGCTCTTATAGCTTTTTT ACAAGATG-3Ј 6 25 I1027T 17b LSCF17BAFmod 5Ј-CCGCCGCCCCGCCGTCAGGTACA AGATATTATG-3Ј 14 56 11 3272-26AϾG LSCF17BARmod 5Ј-CCGCCGCCGCAGTGTTGACAGGT ACAAGAAC-3Ј 7 247 bp A1067T LSCF17BBFmod 5Ј-CCGCCCTTACTTTGAAACTCTGTT CCACAAAGC-3Ј 4 247 bp T1095T LSCF17BBRmod 5Ј-CCGCCGTTGATAACCTATAGAATG CAG-3Ј 6 62 E1104X 18 LSCFE18Fmod 5Ј-CCGCCGAGTCGTTCACAGAAGA GAGAAATAAC-3Ј 6 236 bp 34 2 D1152H LSCFE18Rmod 5Ј-CCGCCGCCGCGGTACTTTGTT ACTTGTCTGAATTTTTTT-3ЈCATAA 12 25 3547delA 19 LSCF19i5mod 5Ј-CCGCCGCCGCGCATCAAACTA ATTGTGAAATTGTCTGCC-3Ј 10 408 bp 73 10 S1235R LSCF19i3mod 5Ј-CCGCCGCCGCACACATTGCT TCAGGCTACTGGGA-3Ј 11 49 R1162L 20 LSCF20i5mod 5Ј-CCGCCGCCGCCGCTACTGAATTATGT TTATGGCATGG-3Ј 13 323 bp 44 13 W1282X LSCF20i3mod 5Ј-CCGCCGCCGCTCTTGAGTACAAGTA TCAAATAGCAG-3Ј 10 50 4005ϩ33GϾA 21 LSCFe21F 5Ј-CCGCCGCCGCGCAAGTTATTCATA CTTTCTTCTTCTTT-3Ј 12 217 bp 15 5 1 N1303K LSCFe21R 5Ј-CCGCCGCCGCTATATCAGCCA TTTGTG-3Ј 8 47 Q1313X 22 LSCFe22FmodC LSCFe22 RmodD 5Ј-CCGCCGAGAATGTCAAC TGCTTGAGTGT-3Ј 6 311 bp 41 2 R1358S 5Ј-CCGCCGGCAGGCATAATGA TTCTGTTCCCAC-3Ј 10 51 I1366T 23 LSCFE23Fmod 5Ј-CCGCCGCCGCAAGGTAAAT ACAGATCAT-3Ј 9 259 bp 44 3 4374ϩ1GϾT 4374ϩ13AϾG LSCFE23Rmod: 5Ј-CCGGCAGGAACTATCACAT GTGAGATTG-3Ј 3 53 24 LSCFE24FmodB 5Ј-CCGCCGCTTTGAGCCTGT GCCAGTTTCTGT-3Ј 6 378 bp 58 5 1 Q1463Q LSE24RmodB 5Ј-CCGCCGACGAGCTCCAATTC CATGAGGTGA-3Ј 6 62 Y1424Y the same technique: the majority of our samples were extracted by a classical saline technique or an automated extraction and their quality was adequate. Login to comment
171 Results of CFTR Analysis by HRM on 136 Samples of Patients with Idiopathic Chronic Pancreatitis (ICP) Exon Number of positive samples Mutations identified Variants identified New positive controls 1 14 14 125GϾC 2 1 1 R31C 3 9 1 G85E 7 R75Q 1 R74W 4 4 1 R117G 1 I148T R117G 1 R117H 1 A120T 5 1 1 L188P L188P 6a 5 1 V201M 1 A221A A221A 3 875ϩ40 AϾG 6b 27 1 M284T 26 1001ϩ11CϾT M284T 7 1 1 L320V L320V 8 0 0 9 1 1 D443Y 10 16 8 F508del 8 E528E 11 1 1 G542X 12 6 4 G576A 1 Y577Y L568F 1 L568F 13 7 1 S737F 4 R668C S737F 1 V754M L644L 1 L644L 14a 53 52 T854T T854TϩI853I 1 T854TϩI853I 14b 0 0 15 3 1 L967S T908S 1 T908S 1 S945L 16 0 0 17a 10 7 L997F 1 3271ϩ18CϾT 3271 ϩ 3AϾG 1 3271 ϩ 3 AϾG 1 Y1014C 17b 3 1 L1096L L1096L 1 H1054DϩG1069R 1 3272-33AϾG H1054DϩG1069R 3272-33AϾG 18 2 1 D1152H E1124del 1 E1124del 19 5 5 S1235R poly 20 7 1 W1282X 5 P1290P 1 D1270N 21 2 1 N1303K 1 T1299T 22 0 0 23 1 0 4374ϩ13 AϾG 24 43 40 Q1463Q 2 Y1424Y 1 Q1463QϩY1024Y ing domain of a gene brings an excellent sensitivity for heterozygote detection that is very close to 100%. Login to comment

[hide] Consensus on the use and interpretation of cystic ... J Cyst Fibros. 2008 May;7(3):179-96. Castellani C, Cuppens H, Macek M Jr, Cassiman JJ, Kerem E, Durie P, Tullis E, Assael BM, Bombieri C, Brown A, Casals T, Claustres M, Cutting GR, Dequeker E, Dodge J, Doull I, Farrell P, Ferec C, Girodon E, Johannesson M, Kerem B, Knowles M, Munck A, Pignatti PF, Radojkovic D, Rizzotti P, Schwarz M, Stuhrmann M, Tzetis M, Zielenski J, Elborn JS
Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice.
J Cyst Fibros. 2008 May;7(3):179-96., [PMID:18456578]

Abstract [show]
It is often challenging for the clinician interested in cystic fibrosis (CF) to interpret molecular genetic results, and to integrate them in the diagnostic process. The limitations of genotyping technology, the choice of mutations to be tested, and the clinical context in which the test is administered can all influence how genetic information is interpreted. This paper describes the conclusions of a consensus conference to address the use and interpretation of CF mutation analysis in clinical settings. Although the diagnosis of CF is usually straightforward, care needs to be exercised in the use and interpretation of genetic tests: genotype information is not the final arbiter of a clinical diagnosis of CF or CF transmembrane conductance regulator (CFTR) protein related disorders. The diagnosis of these conditions is primarily based on the clinical presentation, and is supported by evaluation of CFTR function (sweat testing, nasal potential difference) and genetic analysis. None of these features are sufficient on their own to make a diagnosis of CF or CFTR-related disorders. Broad genotype/phenotype associations are useful in epidemiological studies, but CFTR genotype does not accurately predict individual outcome. The use of CFTR genotype for prediction of prognosis in people with CF at the time of their diagnosis is not recommended. The importance of communication between clinicians and medical genetic laboratories is emphasized. The results of testing and their implications should be reported in a manner understandable to the clinicians caring for CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1236 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment
1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Table 1. Continued CFTR location Amino acid change Nucleotide change 141 IVS 16 Splicing defect 3120 ϩ 1GϾA 142 IVS 16 Splicing defect 3121 - 2AϾG 143 IVS 16 Splicing defect 3121 - 2AϾT 144 E 17a Frameshift 3132delTG 145 E 17a I1005R 3146TϾG 146 E 17a Frameshift 3171delC 147 E 17a Frameshift 3171insC 148 E 17a del V1022 and I1023 3199del6 149 E 17a Splicing defect 3271delGG 150 IVS 17a Possible splicing defect 3272 - 26AϾG 151 E 17b G1061R 3313GϾC 152 E 17b R1066C 3328CϾT 153 E 17b R1066S 3328CϾA 154 E 17b R1066H 3329GϾA 155 E 17b R1066L 3329GϾT 156 E 17b G1069R 3337GϾA 157 E 17b R1070Q 3341GϾA 158 E 17b R1070P 3341GϾC 159 E 17b L1077P 3362TϾC 160 E 17b W1089X 3398GϾA 161 E 17b Y1092X (TAA) 3408CϾA 162 E 17b Y1092X (TAG) 3408CϾG 163 E 17b L1093P 3410TϾC 164 E 17b W1098R 3424TϾC 165 E 17b Q1100P 3431AϾC 166 E 17b M1101K 3434TϾA 167 E 17b M1101R 3434TϾG 168 IVS 17b 3500 - 2AϾT 3500 - 2AϾT 169 IVS 17b Splicing defect 3500 - 2AϾG 170 E 18 D1152H 3586GϾC 171 E 19 R1158X 3604CϾT 172 E 19 R1162X 3616CϾT 173 E 19 Frameshift 3659delC 174 E 19 S1196X 3719CϾG 175 E 19 S1196T 3719TϾC 176 E 19 Frameshift and K1200E 3732delA and 3730AϾG 177 E 19 Frameshift 3791delC 178 E 19 Frameshift 3821delT 179 E 19 S1235R 3837TϾG 180 E 19 Q1238X 3844CϾT 181 IVS 19 Possible splicing defect 3849 ϩ 4AϾG 182 IVS 19 Splicing defect 3849 ϩ 10 kb CϾT 183 IVS 19 Splicing defect 3850 - 1GϾA 184 E 20 G1244E 3863GϾA 185 E 20 G1244V 3863GϾT 186 E 20 Frameshift 3876delA 187 E 20 G1249E 3878GϾA 188 E 20 S1251N 3884GϾA 189 E 20 T1252P 3886AϾC 190 E 20 S1255X 3896CϾA and 3739AϾG in E19 191 E 20 S1255L 3896CϾT 192 E 20 Frameshift 3905insT 193 E 20 D1270N 3940GϾA 194 E 20 W1282R 3976TϾC 195 E 20 W1282X 3978GϾA 196 E 20 W1282C 3978GϾT 197 E 20 R1283M 3980GϾT 198 E 20 R1283K 3980GϾA 199 IVS 20 Splicing defect 4005 ϩ 1GϾA 200 E 21 Frameshift 4010del4 201 E 21 Frameshift 4016insT 202 E 22 Inframe del E21 del E21 203 E 21 N1303K 4041CϾG 204 E 24 Frameshift 4382delA Genomic and Synthetic Template Samples Where possible, native genomic DNA was collected. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 Spectrum of CFTR Sequence Variants in 257 Hispanic Patients Who Underwent Diagnostic DNA Testing for CF Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) ACMG/ACOG recommended 25 mutation panel* DeltaF508 53 28.96 10.31 G542X 7 3.83 1.36 R334W 2 1.09 0.39 R553X 2 1.09 0.39 DeltaI507 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 3120 ϩ 1 GϾA 1 0.55 0.19 7 different mutations 67 36.61 13.04 All mutations included ACMG/ACOG 1248 ϩ 1 GϾA 1 0.55 0.19 1249 - 29delAT 1 0.55 0.19 1288insTA1288insTA 1 0.55 0.19 1341 ϩ 80 GϾA1341 ϩ 80 GϾA 1 0.55 0.19 1429del71429del7 1 0.55 0.19 1525 - 42 GϾA1525 - 42 GϾA 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 1717 - 8 GϾA 2 1.09 0.39 1811 ϩ 1 GϾA1811 ϩ 1 GϾA 1 0.55 0.19 2055del9-ϾA 3 1.64 0.58 2105-2117del13insAGAAA 1 0.55 0.19 2215insG 1 0.55 0.19 2585delT2585delT 1 0.55 0.19 2752 - 6 TϾC 1 0.55 0.19 296 ϩ 28 AϾG 1 0.55 0.19 3120 ϩ 1 GϾ A 1 0.55 0.19 3271 ϩ 8 AϾG3271 ϩ 8 AϾG 1 0.55 0.19 3271delGG 1 0.55 0.19 3272 - 26 AϾG 2 1.09 0.39 3876delA 2 1.09 0.39 4016insT 1 0.55 0.19 406 - 1 GϾA 6 3.28 1.17 406 - 6 TϾC 1 0.55 0.19 4374 ϩ 13 A ϾG 1 0.55 0.19 663delT 1 0.55 0.19 874insTACA874insTACA 1 0.55 0.19 A1009T 2 1.09 0.39 A559T 1 0.55 0.19 D1152H 1 0.55 0.19 D1270N 3 1.64 0.58 D1445N 2 1.09 0.39 D836Y 1 0.55 0.19 DeltaF311 1 0.55 0.19 DeltaF508 53 28.96 10.31 DeltaI507 1 0.55 0.19 E116K 2 1.09 0.39 E585X 1 0.55 0.19 E588VE588V 2 1.09 0.39 E831X 1 0.55 0.19 F311L 1 0.55 0.19 F693L 1 0.55 0.19 G1244E 1 0.55 0.19 G542X 7 3.83 1.36 G576A 1 0.55 0.19 H199Y 3 1.64 0.58 I1027T 3 1.64 0.58 I285FI285F 1 0.55 0.19 L206W 3 1.64 0.58 L320V 1 0.55 0.19 L967S 1 0.55 0.19 L997F 3 1.64 0.58 P1372LP1372L 1 0.55 0.19 P205S 1 0.55 0.19 P439SP439S 1 0.55 0.19 Q1313X 1 0.55 0.19 Q890X 2 1.09 0.39 Q98R 1 0.55 0.19 R1066C 1 0.55 0.19 R1066H 1 0.55 0.19 (Table continues) missense variant, I1027T (3212TϾC), in exon 17a.25 Family studies have not been performed to identify which allele carries two mutations. Login to comment
186 Table 3. Continued CFTR mutations Alleles Relative mutation frequency (%) (of 317) G567A 1 Ͻ1 S573C 1 Ͻ1 E585X 1 Ͻ1 T604S 1 Ͻ1 F693L 1 Ͻ1 V754 mol/L 1 Ͻ1 2108delA 1 Ͻ1 2184delA 1 Ͻ1 2215insG 1 Ͻ1 2585delT 1 Ͻ1 2752 - 6TϾC 1 Ͻ1 E831X 1 Ͻ1 D836Y 1 Ͻ1 Y913X 1 Ͻ1 S945L 1 Ͻ1 L967S 1 Ͻ1 3171delC 1 Ͻ1 3199del6 1 Ͻ1 3271 ϩ 8AϾG 1 Ͻ1 R1066H 1 Ͻ1 R1070W 1 Ͻ1 Y1092X 1 Ͻ1 W1098C 1 Ͻ1 3500 - 2AϾT 1 Ͻ1 4016insT 1 Ͻ1 4374 ϩ 13AϾG 1 Ͻ1 D1152H 1 Ͻ1 R1158X 1 Ͻ1 R1162X 1 Ͻ1 W1282X 1 Ͻ1 N1303K 1 Ͻ1 Q1313X 1 Ͻ1 P1372L 1 Ͻ1 R1438W 1 Ͻ1 Total 317 100 Table 3. Login to comment

[hide] Genotype and phenotype correlations in patients wi... Gastroenterology. 2002 Dec;123(6):1857-64. Durno C, Corey M, Zielenski J, Tullis E, Tsui LC, Durie P
Genotype and phenotype correlations in patients with cystic fibrosis and pancreatitis.
Gastroenterology. 2002 Dec;123(6):1857-64., [PMID:12454843]

Abstract [show]
BACKGROUND & AIMS: Pancreatitis is known to occur in some patients with cystic fibrosis (CF), but the prevalence, natural history, and genotypic basis are unclear. We examined a well-defined cohort of patients with CF to answer these questions. METHODS: Patients with CF were identified from a computerized database (1966-1996). Chart audit identified all patients with CF and pancreatitis. RESULTS: Among 1075 patients with CF, 937 (87%) were pancreatic insufficient at diagnosis, 28 (3%) were pancreatic sufficient but developed pancreatic insufficiency after diagnosis, and 110 (10%) have remained pancreatic sufficient. No patients with pancreatic insufficiency developed pancreatitis. Nineteen patients (17.3%) with pancreatic sufficiency experienced one or more attacks of pancreatitis. The mean age at diagnosis of pancreatitis was 22.7 +/- 10.3 years (range, 10-35 years), and pancreatitis was recognized before the diagnosis of CF in 6 patients (32%). The diagnosis of CF in pancreatic-sufficient patients, with and without pancreatitis, was established at a significantly older age than in those with pancreatic insufficiency (P < 0.0001). Genotyped patients with pancreatic insufficiency carried 2 severe mutant alleles. All genotyped patients with pancreatic sufficiency and pancreatitis carried at least one mild mutation. No specific genotype was predictive of pancreatitis. CONCLUSIONS: Patients with CF with pancreatic sufficiency carry at least one mild mutant allele and are at a significant risk of developing pancreatitis. Symptoms of pancreatitis may precede the diagnosis of CF. Pancreatitis is associated with an otherwise mild CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
124 of episodes of pancreatitis Genotype 1 0.3 12 21.7 2 ⌬F508/S1251N 2 0.3 34 30.0 1 ⌬F508/R347H 3 4.4 13 42.5 3 / 4 4.4 21 36.5 1 ⌬F508/ 5 7.3 26 40.8 10 ⌬F508/P67L 6 9.6 29 29.9 (D) 1 ⌬F508/ 7 12.0 18 39.9 1 ⌬F508/R347P 8 12.9 37 40.9 2 G542X/D1152H 9 13.0 30 50.3 1 ⌬F508/3849 ϩ 10Kbc Ͼ T 10 14.7 13 21.5 1 DF508/R117H 11 15.6 34 40.8 1 ⌬F508/2789ϩ5G Ͼ T 12 15.6 10 26.0 10 ⌬F508/R117H 13 16.0 10 22.0 14 ⌬F/508/3849 ϩ 10kbC Ͼ T 14 16.0 18 21.2 (D) 1 R1066C/3849 ϩ 10kbC Ͼ T 15 19.9 15 40.8 5 No DNA 16 23.2 19 23.2 15 ⌬F508/11234V 17 24.1 40 47.6 (D) 1 No DNA 18 26.9 25 43.3 12 No DNA 19 27.4 35 50.3 (D) 2 ⌬F508/A455E NOTE. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 b 3905insT, 1811+1.6kbA>G, S945L, S1251N, Y122X, 2711delT, R117H, E60X, 2184insA, E585X, L558S, S1235R, D1152H, K710X, Q493X, A455E, G178R, I148T, 574delA. Login to comment
115 The most frequent were F508del (21.75%), the 5T allele (16.31%), and R117H (4.37%), followed by D1152H (1.19%), and D443Y (0.93%). Login to comment
153 Four mutations were detected on a 7T or a 9T background: L206W, R347H, D1152H, 3272-26A>G. Login to comment
171 CFTR Mutation Genotypes Identified Both in Cystic Fibrosis (CF) and in Congenital Bilateral Absence of the Vas Deferens (CBAVD) CF CBAVD F508del/5T 3 143 F508del/2789+5G>A 53 1 F508del/3272-26A>G 17 4 F508del/R117H* 10 39 F508del/R117C 2 2 F508del/L206W 12 4 F508del/R347H 10 5 F508del/R347L 1 1 F508del/D443Y 1 5 F508del/Y569C 1 1 F508del/P574H 3 1 F508del/G628R(G>A) 2 1 F508del/V920M 1 1 F508del/R1070W 2 3 F508del/D1152H 6 8 F508del/S1235R 3 1 F508del/T1246I 1 1 F508del/D1270N+R74W 2 3 F508delN1303I 1 1 3659delC/R347H 1 1 G542X/T338I 2 2 R347H/R1066H 1 1 *The only case with CF whose alleles at IVS8(T)n were reported had mutation R117H associated with a 5T allele. Login to comment

[hide] Screening practices for mutations in the CFTR gene... Hum Mutat. 2000;15(2):135-49. Girodon-Boulandet E, Cazeneuve C, Goossens M
Screening practices for mutations in the CFTR gene ABCC7.
Hum Mutat. 2000;15(2):135-49., [PMID:10649490]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) gene studies are now one of the most frequent activities in clinical molecular genetics laboratories. The number of requests is growing, owing to the increasingly wide range of recognized CFTR gene diseases (cystic fibrosis, congenital bilateral absence of the vas deferens, disseminated bronchiectasis, allergic bronchopulmonary aspergillosis and chronic pancreatitis), and the availability of efficient molecular tools for detecting mutations. A growing number of tests capable of simultaneously detecting several frequent CF mutations are being developed, and commercial kits are now available. The most recent kits detect nearly 90% of defective alleles in Caucasians, a rate high enough for carrier screening and for the majority of diagnostic requests. However, because of the wide variety of molecular defects documented in the CFTR gene, only a limited number of laboratories have mastered the entire panoply of necessary techniques, while other laboratories have to refer certain cases to specialized centers with complementary and/or scanning tools at their disposal. A good knowledge of CFTR diseases and their molecular mechanisms, together with expertise in the various techniques, is crucial for interpreting the results. Diagnostic strategies must take into account the indication, the patient's ethnic origin, and the time available in the framework of genetic counseling. This review presents the methods most frequently used for detecting CFTR gene mutations, and discusses the strategies most suited to the different clinical settings.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 However, it still fails to cover several mutations frequent in certain geographical areas, such as 394delTT, 405+1G>A, 2143delT, 1677delTA, Y1092X, R1066C, 3272- 26A>G and 1811+1.6kbA>G, and other mutations frequent in CBAVD patients, such as IVS8-5T, D443Y, R668C and D1152H. Login to comment

[hide] Genotype-phenotype correlations for the paranasal ... Am J Respir Crit Care Med. 1999 May;159(5 Pt 1):1412-6. Jorissen MB, De Boeck K, Cuppens H
Genotype-phenotype correlations for the paranasal sinuses in cystic fibrosis.
Am J Respir Crit Care Med. 1999 May;159(5 Pt 1):1412-6., [PMID:10228103]

Abstract [show]
Genotype-phenotype correlations in cystic fibrosis (CF) have been found for lung and pancreatic function, but not for paranasal sinus disease. Because such correlations may have pathophysiological and clinical implications, the correlation of mutations, in particular DeltaF508, with paranasal sinus disease was investigated in 113 CF patients with known genotype. The clinical importance of paranasal sinus disease was evaluated using three parameters: polyps, overall clinical severity of upper airway problems, and surgery. Polyps were evaluated by nasal endoscopy and graded on a five-point scale. Four severity groups were distinguished based on history, clinical records, and examination: no upper airway problems; more problems than in control subjects; severe, recurrent or chronic problems; and paranasal sinus surgery cases. DeltaF508 homozygosity correlated with clinical severity (p < 0.02) and with the presence of polyps on endoscopy (p < 0.05). The relative risk for paranasal sinus surgery in DeltaF508 homozygous CF patients was 2.33. In conclusion, there are genotype-phenotype correlations for paranasal sinus disease in CF. DeltaF508 homozygosity is a risk factor for paranasal sinus disease in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 of Patients in Surgical Group ⌬F508 Genotype Homozygosity 69 61 22 Compound heterozygosity 33 29 5 Negative 11 10 1 Mutations ⌬F508 171 75.7 27 Non-⌬F508 55 24.3 6 R117H (4) C276X (1) 394delT (1) W401X (2,† ) A455E (1) G542X (4,‡ ) G551D (1) R553X (1) G628R(G→C) (1) Y1092X (1) D1152H (1) S1251N (1) W1282X (3) N1303K (8) W1310X (1) 1717-1G→A (3,† ) 1898ϩ1G→C (1) 2183AA-G (3,†† ) 3659delC (2) 3272-26A→G (2,† ) 4218-insT (2) unknown (11,‡ ) * The genotype and mutations are given for the 113 patients with CF. Login to comment
121 of Patients in Surgical Group DF508 Genotype Homozygosity 69 61 22 Compound heterozygosity 33 29 5 Negative 11 10 1 Mutations DF508 171 75.7 27 Non-DF508 55 24.3 6 R117H (4) C276X (1) 394delT (1) W401X (2,ߤ ) A455E (1) G542X (4,ߥ ) G551D (1) R553X (1) G628R(G࢐C) (1) Y1092X (1) D1152H (1) S1251N (1) W1282X (3) N1303K (8) W1310X (1) 1717-1G࢐A (3,ߤ ) 189811G࢐C (1) 2183AA-G (3,ߤߤ ) 3659delC (2) 3272-26A࢐G (2,ߤ ) 4218-insT (2) unknown (11,ߥ ) * The genotype and mutations are given for the 113 patients with CF. Login to comment

[hide] Characterization of mutations located in exon 18 o... FEBS Lett. 1998 Oct 16;437(1-2):1-4. Vankeerberghen A, Wei L, Teng H, Jaspers M, Cassiman JJ, Nilius B, Cuppens H
Characterization of mutations located in exon 18 of the CFTR gene.
FEBS Lett. 1998 Oct 16;437(1-2):1-4., [PMID:9804160]

Abstract [show]
In order to get a better insight into the function of amino acid residues located in the second transmembrane domain of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, all exon 18 mutations found in cystic fibrosis (CF) patients were characterized at the protein and at the electrophysiological level. Of the different mutations present in transmembrane helix 12 (M1137V, M1137R, I11139V and deltaM1140), and the intracytoplasmic loop connecting TM12 and NBD2 (D1152H and D1154G), only M1137R interfered with the proper maturation of the protein. Permeability studies performed after injection of the different wild-type and mutant cRNAs in Xenopus laevis oocytes indicated that the mutations did not alter the permeability sequence of the CFTR channels. The whole cell cAMP activated chloride currents, however, were significantly reduced for M1137V, I1139V, D1152H and D1154G and close to zero for deltaM1140, indicating that these mutations interfere with the proper gating of the chloride channels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 Of the different mutations present in transmembrane helix 12 (M1137V, M1137R, I1139V and vvM1140), and the intracytoplasmic loop connecting TM12 and NBD2 (D1152H and D1154G), only M1137R interfered with the proper maturation of the protein. Login to comment
3 The whole cell cAMP activated chloride currents, however, were significantly reduced for M1137V, I1139V, D1152H and D1154G and close to zero for vvM1140, indicating that these mutations interfere with the proper gating of the chloride channels. Login to comment
31 Six di¡erent mutations: a3541g ( = M1137V), t3542g ( = M1137R), a3547g ( = I1139V), deletion of atg from 3550 ( = vM1140), g3586c ( = D1152H) and a3593g ( = D1154G) were introduced using the Transformer Site-Directed Mutagenesis kit (Clontech). Login to comment
78 COS1 cells transfected with wild-type, M1137V, M1137R, I1139V, vM1140, D1152H and D1154G CFTR were metabolically labelled, chased, CFTR was immunoprecipitated and separated on an SDS-PAGE gel. Login to comment
80 M1137V, M1137R, I1139V and vM1140 are located in transmembrane helix 12 and D1152H and D1154G are located in the intracytoplasmic loop connecting TM12 and NBD. Login to comment
83 Four mutants, M1137V, I1139V, D1152H and D1154G showed a signi'cantly reduced current, when compared to wild type, and two other mutants, M1137R and vM1140 were not activated by cAMP (Fig. 3). Login to comment
89 The same permeation sequence was found for the four mutants, M1137V, I1139V, D1152H and D1154G (Fig. 2D). Login to comment
90 Mutations D1152H and D1154G are located in the intracytoplasmic loop that connects TM12 and NBD2 and thus only a¡ect the cAMP inducible whole cell currents. Login to comment
77 COS1 cells transfected with wild-type, M1137V, M1137R, I1139V, vM1140, D1152H and D1154G CFTR were metabolically labelled, chased, CFTR was immunoprecipitated and separated on an SDS-PAGE gel. Login to comment
79 M1137V, M1137R, I1139V and vM1140 are located in transmembrane helix 12 and D1152H and D1154G are located in the intracytoplasmic loop connecting TM12 and NBD2. Login to comment
82 Four mutants, M1137V, I1139V, D1152H and D1154G showed a signi'cantly reduced current, when compared to wild type, and two other mutants, M1137R and vM1140 were not activated by cAMP (Fig. 3). Login to comment
88 The same permeation sequence was found for the four mutants, M1137V, I1139V, D1152H and D1154G (Fig. 2D). Login to comment

[hide] Genetic findings in congenital bilateral aplasia o... Hum Mutat. 1998;11(6):480. de Meeus A, Guittard C, Desgeorges M, Carles S, Demaille J, Claustres M
Genetic findings in congenital bilateral aplasia of vas deferens patients and identification of six novel mutatations. Mutations in brief no. 138. Online.
Hum Mutat. 1998;11(6):480., [PMID:10200050]

Abstract [show]
Congential bilateral aplasia of vas deferens (CBAVD), a form of male sterility, has been suggested to represent a "genital" form of cystic fibrosis (CF), as mutations in the CFTR gene have been identified in most patients with this condition. Interestingly, the 5T allele in intron 8 appeared to be the most frequent mutation associated with CBAVD. However, the molecular basis of CBAVD is not completely understood. We have analysed the complete coding and flanking CFTR sequences by PCR-DGGE in 64 men with CBAVD from southern France with the aim to list any sequence alteration. Fourty-two of the 64 patients (65.6%) had mutations on both copies of the CFTR gene, including one patient with two mutations in the same copy (DF508 + A1067T). The 5T allele was present in 21/64 cases (33%). Six of the 28 different mutations identified in this study had never been described previously, and appeared to be specific to CBAVD (P111L, M244K, A1364V, G544V, 2896insAG,-33G->A).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 However, some genotypes (DF508/L206W, DF508/R347H, DF508/D1152H, DF508/R117H, W1282X/D1152H and even DF508/5T) can induce both CF and CBAVD phenotypes. Login to comment
83 Phenotype CFTRamutations Intron 8, Poly(T) tract 1 3 crisis of acute pancreatitis F508 / L206W 9/7 2 F508 / L206W 9/9 3 frequent bronchitis F508 / R347H 9/9 4 F508 / R347H 9/9 5 F508 / M244K 9/7 6 F508 / A1364V 9/7 7 F508 / D1152H 9/7 8 chronic sinusitis and bronchitis F508 / D1152H 9/7 9 F508 / R117H 9/7 10 F508 / R117H 9/7 11 F508 / M952I 9/7 12 D443Y / G542X 7/9 13 D443Y / G542X 7/9 14 2184delA / D443Y 7/7 15 2184delA / D443Y 7/7 16 R347H / D443Y 9/7 17 seminal vesicles agenesia R117H / G1349D 7/7 18 R117H / G1244E 7/7 19 N1303K / P111L 9/7 20 chronic sinusitis, nasal polyps W1282X / D1152H 7/7 21 chronic sinusitis R347H / Y1092X 7/7 22 seminal vesicles agnesia 297-3C-GTT / 4279insA 7/7 23 G544V / F508C 7/7 24 D1152H / 2896insAG 7-9 25 F508 / - 9/5 26 F508 / - 9/5 27 F508 / - 9/5 28 F508 / - 9/5 29 F508 / - 9/5 30 chronic sinusitis, bronchitis F508 / - 9/5 31 sinusitis and allergy F508 / - 9/5 32 allergy F508 / - 9/5 33 F508 / - 9/5 34 F508 / - 9/5 35 F508 / - 9/5 36 F508 / - 9/5 37 bronchitis, asthma F508 / - 9/5 38 chronic sinusitis F508+A1067T / - 9/5 39 chronic sinusitis D1152H / - 7/5 40 2184delA / - 7/5 41 R764X / - 7/5 42 711+1G-GTT / - 7/5 43 F508 / - 9/7 44 F508 / - 9/7 45 F508 / - 9/7 46 F508 / - 9/9 47 R553X / - 7/7 48 -33G-GTA / - 7/7 49 K710X / - 7/7 50 - / - 5/5 51 - / - 5/7 52 - / - 5/7 53 - / - 7/7 54 - / - 7/7 55 - / - 7/7 56 - / - 7/7 57 - / - 7/7 58 - / - 7/7 59 - / - 7/7 60 - / - 7/7 61 - / - 7/9 62 - / - 7/9 63 NIDDb - / - 7/9 64 - / - 7/9 a : Cystic Fibrosis Transmembrane Regulator gene b : Non Insulino-Dependant Diabetis References Anguiano A, Oates RD, Amos JA, Dean M, Gerrard B, Stewart C, Maher TA, White MB, Milunsky A (1992) Congenital absence of the vas deferens: a primarily genital form of cystic fibrosis. Login to comment

[hide] Distinct spectrum of CFTR gene mutations in congen... Hum Genet. 1997 Sep;100(3-4):365-77. Dork T, Dworniczak B, Aulehla-Scholz C, Wieczorek D, Bohm I, Mayerova A, Seydewitz HH, Nieschlag E, Meschede D, Horst J, Pander HJ, Sperling H, Ratjen F, Passarge E, Schmidtke J, Stuhrmann M
Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens.
Hum Genet. 1997 Sep;100(3-4):365-77., [PMID:9272157]

Abstract [show]
Congenital absence of the vas deferens (CAVD) is a frequent cause for obstructive azoospermia and accounts for 1%-2% of male infertility. A high incidence of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has recently been reported in males with CAVD. We have investigated a cohort of 106 German patients with congenital bilateral or unilateral absence of the vas deferens for mutations in the coding region, flanking intron regions and promotor sequences of the CFTR gene. Of the CAVD patients, 75% carried CFTR mutations or disease-associated CFTR variants, such as the "5T" allele, on both chromosomes. The distribution of mutation genotypes clearly differed from that observed in cystic fibrosis. None of the CAVD patients was homozygous for delta F508 and none was compound heterozygous for delta F508 and a nonsense or frameshift mutation. Instead, homozygosity was found for a few mild missense or splicing mutations, and the majority of CAVD mutations were missense substitutions. Twenty-one German CAVD patients were compound heterozygous for delta F508 and R117H, which was the most frequent CAVD genotype in our study group. Haplotype analysis indicated a common origin for R117H in our population, whereas another frequent CAVD mutation, viz. the "5T allele" was a recurrent mutation on different intragenic haplotypes and multiple ethnic backgrounds. We identified a total of 46 different mutations and variants, of which 15 mutations have not previously been reported. Thirteen novel missense mutations and one unique amino-acid insertion may be confined to the CAVD phenotype. A few splice or missense variants, such as F508C or 1716 G-->A, are proposed here as possible candidate CAVD mutations with an apparently reduced penetrance. Clinical examination of patients with CFTR mutations on both chromosomes revealed elevated sweat chloride concentrations and discrete symptoms of respiratory disease in a subset of patients. Thus, our collaborative study shows that CAVD without renal malformation is a primary genital form of cystic fibrosis in the vast majority of German patients and links the particular expression of clinical symptoms in CAVD with a distinct subset of CFTR mutation genotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 This study L997F G→C at 3123 exon 17a 1 A2 Fanen et al. (1992) Y1032C A→G at 3227 exon 17a 1 B3 This study 3272-26 A→G A→G at 3272-26 intron 17a 2 D3 Fanen et al. (1992) D1152H G→C at 3586 exon 18 3 C2, A2 Highsmith et al. (pers. comm.) V1153E T→A at 3590 exon 18 1 B3 This study 3659delC deletion of C at 3659 exon 19 1 C2 Kerem et al. (1990) W1282X G→A at 3978 exon 20 1 D3 Vidaud et al. (1991) N1303K C→G at 4041 exon 21 1 B1 Osborne et al. (1991) K1351E A→G at 4183 exon 22 1 A2 This study D1377H G→C at 4261 exon 22 1 C1 Costes et al. (1995) L1388Q T→A at 4295 exon 23 1 n.p. Login to comment
90 Minor haplotypes are shown in italics; (n.p.) phase unknown f Personal communications to the Cystic Fibrosis Genetic Analysis Consortium (http://www.genet.sickkids.on.ca/cftr.html): M265R by M. Schwarz, A. Haworth and G. Malone, D1152H by W. E. Highsmith jr., L. Burch, K. J. Friedman, B. M. Wood, A. Spock, L. M. Silverman and M. Login to comment
95 D979A and V1153E are non-conservative amino-acid changes in exons 16 and 18, respectively, at positions adjacent to other known CBAVD mutations, viz. I980K and D1152H (Bienvenu et al. 1996; W. E. Highsmith et al. personal communication). Login to comment
137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level. Login to comment
145 Maldigestion 13 25 5T/D58N 184 99 55 - 14 34 5T/̃L138 177 80 53 - 15 33 5T/1078delT 187 87 56 Recurrent bronchitis 16 31 5T/G542X 181 85 79 - 17 31 5T/2184insA n.d. n.d. 60 Borderline pancreatic sufficiency 18 31 5T/D979A n.d. n.d. 55 Recurrent infections, FEVI 76% 19 29 5T/D1152H n.d. n.d. 57 - 20 32 5T/W1282X 180 76 n.d. Recurrent infections, nasal polyposis 21 37 5T/unknown 180 74 n.d. Nasal polyposis 22 28 D110H/D110H 175 80 n.d Asthma bronchiale, obstipation 23 33 R334L/I336K 170 65 n.d. Recurrent infections, nasal polyposis, maldigestion, salt depletion episodes 24 35 N1303K/R347H 167 77 93 - 25 30 V938G/174delA n.d. n.d. 42 - 26 29 V938G/V938G 197 115 n.d. Asthma bronchiale Fig.2 Spectrum of CFTR mutation genotypes in CF patients (left) and in patients with congenital absence of the vas deferens (right). Login to comment
153 A few other genotypes overlapped with those previously observed in some CF adults with mild or very mild disease, e.g. compound heterozygosity for ∆F508 and mutations R334W, R347H, 3272-26 A→G or D1152H. Login to comment
195 Previous studies have reported few homozygous CBAVD patients for mutations R117H, D1152H and "5T" (Costes et al. 1995; Rave-Harel et al. 1995; Zielenski et al. 1995). Login to comment
202 Thus, there seem to be two classes of mild CFTR mutations in males: those that primarily target the male genital tract (e.g. R117H, "5T", D1152H) and those that may leave the vas deferens patent but exert deleterious effects at a more advanced age and lead to late-onset disease of the pulmonary tract, as is often observed for the 3849+10kb C→T mutation. Login to comment

[hide] A cystic fibrosis transmembrane conductance regula... Am J Respir Crit Care Med. 1997 Jun;155(6):1914-20. Kerem E, Rave-Harel N, Augarten A, Madgar I, Nissim-Rafinia M, Yahav Y, Goshen R, Bentur L, Rivlin J, Aviram M, Genem A, Chiba-Falek O, Kraemer MR, Simon A, Branski D, Kerem B
A cystic fibrosis transmembrane conductance regulator splice variant with partial penetrance associated with variable cystic fibrosis presentations.
Am J Respir Crit Care Med. 1997 Jun;155(6):1914-20., [PMID:9196095]

Abstract [show]
Some patients express various features of cystic fibrosis (CF) even though essential characteristics of the disease might be absent. Such patients may suffer from respiratory disease without pancreatic insufficiency and normal sweat chloride levels. Others may present as male infertility because of congenital bilateral aplasia of the vas deferens (CBAVD) with no other signs of CF. The 5T allele, a DNA variant in a noncoding region of the cystic fibrosis transmembrane conductance regulator (CFTR) gene that reduces the level of the normal CFTR transcripts, was found in increased frequency among male patients with CBAVD. The purpose of this study was to investigate the possibility that the 5T allele is associated with dysfunction of organs other than the male reproductive system, leading to CF or atypical CF. Analysis of the 5T allele was performed on 148 subjects (29 with CF, 61 with atypical CF, and 58 with CBAVD) carrying 232 chromosomes with unidentified CFTR mutations, and on 142 non-CF chromosomes from healthy subjects of Ashkenazi origin. The frequency of the 5T allele among chromosomes from patients of Jewish Ashkenazi origin with CF and atypical CF (six of 33; 18%) was significantly higher than the frequency in the normal Ashkenazi population (eight of 142; 6%; p = 0.03). Analysis of the clinical presentation of the five patients with CF and the 12 patients with atypical CF carrying the 5T allele indicated that most patients suffered from respiratory disease presenting as asthma like symptoms, nasal polyposis, chronic sinusitis, chronic bronchitis, or bronchiectasis. Six patients had pancreatic insufficiency, two with meconium ileus. Sweat Cl- levels ranged from normal to elevated. Of the six male patients with respiratory disease who were old enough to be evaluated for fertility status, five were fertile and one had pancreatic insufficiency. Among male patients with CBAVD, 41% suffered from respiratory symptoms. Thus, the 5T allele is a variant with partial penetrance causing disease with an extreme variability of clinical presentation: from normal healthy fertile subjects or male patients with CBAVD to those with atypical or typical clinical phenotype of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 In cases in which family members were not available, the assignment was performed by the complete correlation between the 9T allele and the AF508 and the N1303K, and between the 7T allele and the W1282X, G85E, D1152H, and W1089X mutations. Login to comment
70 The frequency of the 5T allele among normal chromosomes was significantly lower than its frequency among chromosomes carried by CF patients and patients with atypical TABLE 1 MUTATIONS AND POLYTHYMIDINE VARIANTS ON THE OTHER CHROMOSOME OF UNRELATED PATIENTS WITH 5T ALLELE Mutation CF and Atypical CF CBAVD Total AF508 4 8 12 W1282X 1 6 7 N1303K 0 2 2 G85E 1 1 2 D1152H 1 0 1 W 1089X 1 0 1 G542X 0 1 1 ST 0 3 3 7T' 7 9 16 9T* 2 2 4 Total 17 32 49 Definition of abbreviations: CF = cystic fibrosis; CBAVD = congenital bilateral aplasia of the vas deferens. Login to comment

[hide] Rapid characterization of the variable length poly... Hum Mutat. 1997;10(2):108-15. Friedman KJ, Heim RA, Knowles MR, Silverman LM
Rapid characterization of the variable length polythymidine tract in the cystic fibrosis (CFTR) gene: association of the 5T allele with selected CFTR mutations and its incidence in atypical sinopulmonary disease.
Hum Mutat. 1997;10(2):108-15., [PMID:9259194]

Abstract [show]
The CFTR intron 8 variable length polythymidine tract modulates the cystic fibrosis (CF) phenotype associated with the mutation R117H. To explore whether other mutations reside on multiple intron 8 backgrounds with discernible impacts on phenotype, we developed an allele-specific PCR assay to characterize this locus. Our approach types samples rapidly without the use or radioisotopes. Polythymidine alleles were identified for mutations either associated with a wide range of clinical phenotypes (R117H, R347P, G85E, D1152H, R334W, 2789 + 5 G > A, 3849 + 10kb C > T), and/or located at hypermutable CpG loci (R117H, 3845 + 10kb C > T, R553X, R334W, S945L and R75Q). R117H was detected in cis with each of three alleles (5T, 7T, 9T) at the intron 8 locus. The novel R117H-9T association was detected in a 10-month African-American male with borderline-to-mildly elevated sweat chloride values (approximately 50-66 mEq/L). All other mutations studied were associated with 7T except 3849 + 10kb C > T, which was detected on both 7T and 9T backgrounds, but not 5T. Three individuals with a delta F508/3849 + 10kb C > T genotype were 9T,9T and had pancreatic sufficiency and normal sweat chloride values, whereas 15 others who carried 3849 + 10kb C > T on a 7T background had variable pancreatic function (sufficient, n = 12, insufficient, n = 3), and variable sweat chloride values (normal, n = 12, elevated, n = 3). Surprisingly, when not associated with known CFTR mutations, 5T was detected with elevated frequency among individuals with sinopulmonary disease of ill-defined etiology, but with some characteristics of variant CF. In summary, the 5T allele was not found in cis with CF-causing mutations besides R117H, but an elevated 5T allele frequency in variant CF patients suggests 5T may be associated with disease in some situations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Polythymidine alleles were identified for mutations either associated with a wide range of clinical phenotypes (R117H, R347P, G85E, D1152H, R334W, 2789+5 G>A, 3849+10kb C>T), and/or located at hypermutable CpG loci (R117H, 3849+10kb C>T, R553X, R334W, S945L and R75Q). Login to comment
37 We report the development of a rapid, nonisotopic assay that facilitates typing of this locus and utilize it to explore the role of the polythymidine tract alleles in thepathogenesisofCF.Mutationsassociatedwithclini- calheterogeneity(R347P,G85E,D1152H,R334W,and 3849 + 10kb C>T) and/or occurring at hypermutable loci (3849 + 10kb C>T, R334W, S945L, R553X, and R75Q) were analyzed for their association with different intron 8 alleles in CF and atypical patients. Login to comment
39 Mutation screening was performed for R553X (Cutting et al., 1990), R334W (Gasparini et al., 1991), G85E (Zielenski et al., 1991a), S945L (Claustres et al., 1993), 3849 + 10kb C>T (Highsmith et al., 1994), R117H and R347P (Dean et al., 1990), 2789+5G>A (Highsmith et al., 1997), D1152H (Highsmith, per. Login to comment
44 R117H, R347P, D1152H, and R75Q required electrophoresis at 230 V for 5 hr in a 10% polyacrylamide gel. Login to comment
94 Association of Selected CFTR Mutations with Intron 8 Polythymidine Alleles Chromosomes In cis with In cis with In cis with Mutation Site CpG locus 5T 7T 9T R75Qa EXON 3 Y 0 8 0 G85E EXON 3 N 0 5 0 R117H EXON 4 Y 8 5 1 R334W EXON 7 Y 0 4 0 R347P EXON 7 N 0 7 0 R553X EXON 11 Y 0 7 0 2789+5 G>A INTRON 14B N 0 5 0 S945L EXON 15 Y 0 3 0 D1152H EXON 18 N 0 7 0 3849+10kb C>T INTRON 19 Y 0 15 2 a Sequence variant. Login to comment

[hide] Genotype-phenotype relationships in a cohort of ad... Eur Respir J. 1996 Nov;9(11):2207-14. Hubert D, Bienvenu T, Desmazes-Dufeu N, Fajac I, Lacronique J, Matran R, Kaplan JC, Dusser DJ
Genotype-phenotype relationships in a cohort of adult cystic fibrosis patients.
Eur Respir J. 1996 Nov;9(11):2207-14., [PMID:8947061]

Abstract [show]
In cystic fibrosis (CF), relationships between genotype and phenotype have been shown for pancreatic status but not for pulmonary disease. One hundred and ten adult CF patients were classified according to the expected effect of their mutations on cystic fibrosis transmembrane conductance regulator (CFTR) protein: Group 1 (n=48) included deltaF508 homozygotes; Group 2 (n=26), patients with two "severe" mutations and no expected CFTR production; Group 3 (n=17), patients with expected partly functional CFTR corresponding to at least one "mild" mutation; Group 4 (n=19), patients with no mutation identified or only one identified "severe" mutation. As compared to Groups 1 and 2: patients from Groups 3 and 4 had higher arterial oxygen tension (Pa,O2) (9.5+/-1.9 and 9.9+/-1.5 vs 8.8+/-1.5 and 8.3+/-1.7 kPa, respectively p<0.02); and a slower decline in their pulmonary function, estimated by the mean annual loss in forced vital capacity (FVC) (1.2+/-1.0 and 1.5+/-1.1 vs 2.0+/-0.9 and 2.2+/-1.0%, respectively; p<0.01) and in forced expiratory volume in one second (FEV1) (1.7+/-1.1 and 1.9+/-1.3 vs 2.6+/-1.0 and 2.8+/-1.0%, respectively; p<0.005). They had fewer episodes of colonization of the airways by Pseudomonas aeruginosa, and colonization occurred at a more advanced age (median age 25 and 19 vs 15 and 17 yrs, respectively; p<0.01) and required fewer intravenous antibiotic courses (p<0.01). Pancreatic insufficiency was less frequent in Groups 3 (23%) and 4 (63%) than in Groups 1 (100%) and 2 (96%). This study suggests that the phenotype of adult cystic fibrosis patients, including the severity of the lung disease, is related to the severity of the cystic fibrosis transmembrane conductance regulator mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Only three patients had a normal sweat test: two related patients, who were compound heterozygotes for the G542X and 3849+10 kb cytosine (C)→thymine (T) mutations, and one patient who was compound heterozygote for the R1070Q and D1152H mutations. Login to comment
77 - Genotype of the 110 CF patients: details of the CF mutations and classification into four groups Genotype Genotype Pts groups n 1 ∆F508/∆F508 48* 2 ∆F508/G542X 6 ∆F508/E827X 3† ∆F508/R553X 2 ∆F508/W1282X 2 ∆F508/E595X 1 ∆F508/E60X 1 ∆F508/W846X 1 ∆F508/1078delT 1 ∆F508/2143delT 1 ∆F508/2347delG 1 ∆F508/3659delC 1 ∆F508/4382delA 1 ∆F508/2183 AA→G 1 ∆F508/1717-1 G→A 1 ∆F508/1811+1.6 kb A→G 1 E595X/Y1092X 1 1717-1 G→A/1078delT 1 3 ∆F508/I336K 1 ∆F508/G27E 1 ∆F508/D192N 1 ∆F508//I980K 1 ∆F508/P205S 1 ∆F508/2789+5 G→A 1 ∆F508/3272-26 A→G 1 G542X/3849+10 kb C→T 2‡ G542X/2789+5 G→A 1 W361R/297-3 C→T 1 G551D/1717-1 G→A 1 N1303H/2183 AA→G 1 2789+5 G→A/2183 AA→G 1 R1070Q/D1152H 1 R1070Q/unidentified 1 S1251N/unidentified 1 4 ∆F508/unidentified 7 ∆I507/unidentified 2 1811+1.6 kb A→G/unidentified 1 1161delC/unidentified 1 unidentified/unidentified 8 *: two patients are brothers; †: three brothers; ‡: two sisters. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Am J Hum Genet. 1996 Jul;59(1):45-51. Miller PW, Hamosh A, Macek M Jr, Greenberger PA, MacLean J, Walden SM, Slavin RG, Cutting GR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in allergic bronchopulmonary aspergillosis.
Am J Hum Genet. 1996 Jul;59(1):45-51., [PMID:8659542]

Abstract [show]
The etiology of allergic bronchopulmonary aspergillosis (ABPA) is not well understood. A clinical phenotype resembling the pulmonary disease seen in cystic fibrosis (CF) patients can occur in some individuals with ABPA. Reports of familial occurrence of ABPA and increased incidence in CF patients suggest a possible genetic basis for the disease. To test this possibility, the entire coding region of the cystic fibrosis transmembrane regulator (CFTR) gene was analyzed in 11 individuals who met strict criteria for the diagnosis of ABPA and had normal sweat electrolytes (< or = 40 mmol/liter). One patient carried two CF mutations (deltaF508/R347H), and five were found to carry one CF mutation (four deltaF508; one R117H). The frequency of the deltaF508 mutation in patients with ABPA was significantly higher than in 53 Caucasian patients with chronic bronchitis (P < .0003) and the general population (P < .003). These results suggest that CFTR plays an etiologic role in a subset of ABPA patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 DNA samples from ABPA patients were screened for nine additional mutations associated with pancreatic sufficient and atypical CF: R117H (ASO), R347P (NcoI digest) and R347H (HhaI digest), R334W (MspI digest), A455E (ASO and BamHI digest), G551S (ASO) (Strong et al. 1991), 2789+5G-*A (ASO), D1152H (ASO) (Tsui 1992), and 3849+10kbC-*T (ASO and HphI digest) (Highsmith et al. 1994). Login to comment

[hide] Mutation characterization of CFTR gene in 206 Nort... Hum Mutat. 1996;8(4):340-7. Hughes DJ, Hill AJ, Macek M Jr, Redmond AO, Nevin NC, Graham CA
Mutation characterization of CFTR gene in 206 Northern Irish CF families: thirty mutations, including two novel, account for approximately 94% of CF chromosomes.
Hum Mutat. 1996;8(4):340-7., [PMID:8956039]

Abstract [show]
A variety of mutation detection techniques, including restriction endonuclease digestion, allele specific oligonucleotides, and automated fluorescent sequencing, were used in the identification of 15 CFTR mutations representing 86.7% of CF chromosomes in 206 Northern Irish cystic fibrosis (CF) families. A systematic analysis of the 27 exons and intron/exon boundaries of the CFTR gene was performed using denaturing gradient gel electrophoresis (DGGE) in an attempt to characterise the 55 unknown CF mutations in 51 patients. Twenty different mutations were detected by DGGE on 30 chromosomes accounting for a further 7.3% of CF alleles. Fifteen of these mutations had not previously been found in Northern Ireland, and two are novel, M1I(G > T) and V562L. In total, 30 CFTR mutations account for 93.9% of the 412 Northern Irish CF chromosomes tested. The three major CF mutations in Northern Ireland are delta F508, G551D, and R117H with respective frequencies of 68.0%, 5.1%, and 4.1%. The efficacy of the DGGE technique was proven by the detection of 77 out of 77 control variants from all the CFTR exons. DGGE is a highly efficient and sensitive method for mutation screening especially in large genes where the mutation spectrum is known to be heterogeneous.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 3120G>A 11027T,3130de115 L1059X G1123R D1152H 3659delC, 3849G>A, 3849+4A>G, R1158X, R1162X. Login to comment

[hide] CFTR gene variant for patients with congenital abs... Am J Hum Genet. 1995 Oct;57(4):958-60. Zielenski J, Patrizio P, Corey M, Handelin B, Markiewicz D, Asch R, Tsui LC
CFTR gene variant for patients with congenital absence of vas deferens.
Am J Hum Genet. 1995 Oct;57(4):958-60., [PMID:7573058]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 More recently, CFTR alleles Letters to the Editor Table I CFTR Mutations Detected in the CBAVD Patients Number of Percentage Genotype Patients of Total AF508 IVS8/ST 16 W1282X IVS8/5T 9 AF508 R117H(7T) 4 N1303K IVS8/5T 2 IVS8/ST IVS8/5T 2 AF508 R117C 1 AF508 D1152H 1............ 1 58.6 AF508 S50Y 1 R553X R117H(7T) 1 R117H(7T) R117H(7T) 1 G542X IVS8/5T 1 1717-1G-+A IVS8/ST 1 1525-1G-A IVS8/5T 1 IVS8/5T Unknown 4 AF508 Unknown 4. Login to comment

[hide] Search for mutations in pancreatic sufficient cyst... Hum Genet. 1995 Sep;96(3):312-8. Brancolini V, Cremonesi L, Belloni E, Pappalardo E, Bordoni R, Seia M, Russo S, Padoan R, Giunta A, Ferrari M
Search for mutations in pancreatic sufficient cystic fibrosis Italian patients: detection of 90% of molecular defects and identification of three novel mutations.
Hum Genet. 1995 Sep;96(3):312-8., [PMID:7544319]

Abstract [show]
A cohort of 31 cystic fibrosis patients showing pancreatic sufficiency and bearing an unidentified mutation on at least one chromosome was analyzed through denaturing gradient gel electrophoresis of the whole coding region of the cystic fibrosis transmembrane conductance regulator gene, including intron-exon boundaries. Three new and 19 previously described mutations were detected. The combination of these with known mutations detected by other methods, allowed the characterization of mutations on 56/62 (90.3%) chromosomes. Among those identified, 17 can be considered responsible for pancreatic sufficiency, since they were found in patients carrying a severe mutation on the other chromosome. Among these presumed mild mutations, eight were detected more than once, R352Q being the most frequent in this sample (4.83%). Intragenic microsatellite analysis revealed that the six chromosomes still bearing unidentified mutations are associated with five different haplotypes. This may indicate that these chromosomes bear different mutations, rarely occurring among cystic fibrosis patients, further underlying the molecular heterogeneity of the genetic defects present in patients having pancreatic sufficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 (UN yet unidentified mutation) Patient Genotype after Genotype at the end number preliminary screening of the analysis UN/UN M1V/4382delA 1717-1G---~A/UN 1717-1G---~A/R1066H AF508/UN AF508/D579G UN/UN M1V/UN AF508/UN AF508/UN UN/UN T338I/R1158X UN/UN G85E/71 I+5G---~A UN/UN D1152H/UN AF508/UN AF508/UN AF508/UN AF508/3849+ 10kbC---~T UN/UN 711+3A---~G/UN AF508/UN AF508/F1052V UN/UN R352Q/W57G UN/UN 1898+3A----~G/UN AF508/UN AF508/711+5G--~A G542X/UN G542X/DI 152H AF508/UN AF508/E193K 1717-1G---~A/UN 1717-1G---~A/2789+5A---)G AF508/UN AF508/G1349D AF508/UN AF508/G85E AF508/UN AF508/R347P AF508/UN AF508/R352Q AF508/UN AF508/R352Q AF508/UN AF508/S549N G542X/UN G542X/R1066H AF508/UN AF508/T338I AF508/UN AF508/R334W AF508/UN AF508/R334W AF508/UN AF508/S1251N AF508/UN AF508/R1066C AF508/UN AF508/D579G results) while the remaining three haplotypes had been found in association with other rare mutations, which were excluded by DGGE analysis in these patients (Table 3). Login to comment
85 In total, among the mutations detected in our PS patients, 17 (D579G, E193K, F1052V, 711+5G---~A, G1349D, G85E, R347R R352Q, $549N, 2789+5A---~G, D1152H, R1066H, R334W, T338I, 3849+10kbC---~T, S1251N, R1066C) have been detected in compound heterozygosity with a mutation already classified as severe (AF508, 1717-1G--~A, G542X) and thus can be considered as presumably mild. Login to comment
86 Of these mutations, seven (G85E, EI93K, 711+5G--qA, R347P, R334W, R352Q, T338|) are located in the first transmembrane (I TM) domain, five (2789+ 5A---~G, RI066H, F1052V, D1152H, R1066C) in the second transmembrane (II TM) domain, four in the nucleo- R334W R347P R352Q T338I E193K 711+.E G85E 1 2 3 4 D579G G->A I S 549N 5 6a 6b 7 8 9 10 11 12 13 3849+11 !11 ! Login to comment
87 R1066C R1066H F1052V 2789+5A->G D1152H 14a14b 15 1617a 17b 18 19 S1251N ItKbC->T G1349D m III! Login to comment

[hide] CFTR haplotype analysis reveals genetic heterogene... Am J Hum Genet. 1995 Jun;56(6):1359-66. Rave-Harel N, Madgar I, Goshen R, Nissim-Rafinia M, Ziadni A, Rahat A, Chiba O, Kalman YM, Brautbar C, Levinson D, et al.
CFTR haplotype analysis reveals genetic heterogeneity in the etiology of congenital bilateral aplasia of the vas deferens.
Am J Hum Genet. 1995 Jun;56(6):1359-66., [PMID:7539210]

Abstract [show]
Congenital bilateral aplasia of the vas deferens (CBAVD) was suggested to be a mild form of cystic fibrosis (CF). Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in males with CBAVD revealed that in some males CBAVD is caused by two defective CFTR alleles. The genetic basis of CBAVD in the other males and its association with CF remained unclear. We undertook this study to test the hypothesis of commonality of CBAVD and CF by haplotype analysis, in the CFTR locus, of males suffering from CBAVD and of their families. According to the hypothesis of commonality of CBAVD and CF, two brothers with CBAVD are expected to carry the same two CFTR alleles, while their fertile brothers are expected to carry at least one different allele. Eleven families were studied, of which two families, with unidentified CFTR mutations, did not support this hypothesis. In these families two brothers with CBAVD inherited different CFTR alleles. Their fertile brothers inherited the same CFTR alleles as their brothers with CBAVD. These results provide evidence for genetic heterogeneity in CBAVD. Though in some families CBAVD is associated with two CFTR mutations, we suggest that in others it is caused by other mechanisms, such as mutations at other loci or homozygosity or heterozygosity for partially penetrant CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 1991a); D1152H (W. E. Highsmith, personal communication); 405+1G>A (Dork et al. 1993); Q359K/ T360K (Shoshani et al. Login to comment
58 Mutation Analysis Fourteen CF-R mutations that were elsewhere identified among the Israeli CF patient population (Kerem et al. 1994) were analyzed: W1282X, AF508, N1303K, G542X, 3849+10Kb C--T, S549R, S549I, W1089X, 4010delTATT, G85E, 1717-1G--A, D1152H, 405+1G--A, and Q359K1T360K. Login to comment
65 Each family had at least one male with CBAVD and one brother Table I CFTR Mutations and Haplotypes in Israeli Patients with CBAVD CFTR HAPLOTYPESb CFTR ETHNIC ORIGIN AND PATIENT MUTATIONSa XV2C/KM19C GATT TUB18 24M XV2C/KM19c GATT TUB18 24M Ashkenazi Jews: 104-1, 104-10, 610 ................. N1303K/N B 2 1 2 A 1 1 2 613, 645,635 ......................... AF508/N B 2 1 2 C 1 12 643 ......... ............... W1282X/R117H B 1 2 1 C 1 1 2 609,611,615,620,642 ......... W1282X/N B 1 2 1 C 1 1 2 631 ......... ............... W1282X/N B 1 2 1 A 1 1 2 630 ......... ............... D1152H/D1152H C 1 1 2 C 1 1 2 633 ......... ............... D1152H/D1152H D 1 1 2 D 1 1 2 612 ......... ............... N/N B 1 2 1 D 1 2 1 632 ......... ............... N/N B (2) 1 2 A (1) 1 2 640 ......... ............... N/N A/B 2 1 2 D/C 2 1 2 614,624 ........................ N/N A 1 1 2 C 1 12 616 ......... ............... N/N A 1 (2) 2 C 1 (1) 2 644 ........................ N/N A 1 1 (1)C 1 1 (2) 605,636 ........................ N/N C 1 1 2 C 1 12 Non-Ashkenazi Jews: 602 ......... ............... AF508/R117H B 2 1 2 B 1 1 2 604 ........................ AFS08/N B 2 1 2 C 2 2 1 629 ........................A AF508/N B 2 1 2 C 1 1 2 608 ......... ............... N/N B (2) 1 1 D (1) 1 2 628-1, 628-4 ........................ N/N B 2 1 2 C 1 1 2 625,637 ........................ N/N C 1 1 2 C 1 12 603-1, 603-4 ........................ N/N A 2 2 1 A 2 2 1 Arabs: 627 ......... ............... D1152H/D1152H C 1 1 2 C 1 1 2 626, 607-1 ........................ N/N C 1 1 2 C 1 1 2 607-4, 638 ........................ N/N A 1 1 2 C 1 1 2 639 ......... ............... N/N B/A 1 (2) (1) C/D 1 (1) (2) a The data in the column "CFTR mutations" are in the same order (left to right) as in the column "CFRT haplotypes." Login to comment
83 The infertile brother and one of his fertile brothers (626-10) inherited the same two CFTR alleles determined by the Table 2 Haplotype Analysis of Families with CBAVD BROTHERS WITH CBAVD FERTILE BROTHERS CFTR HAPLOTYPES CFTR CFTR CFTrR FAMILY MUTATIONS Father Mother No. Haplotypes No. Haplotypes 104 ......... N1303K/N B 21-1--12 5 =a A 12-1--12 3 = c 2 aa/c 2 aa/d C 12-1--12 4 = b A 12-1--21 5 = d b/d 610 ......... N1303K/N B 2111-212 4 = a A 2221- 212 4 = c 2 aa/c 2 aa/d A 1221-511 10 = b B 1221-212 3 = d b/c 645 ......... AF508/N - 1------- - a B 2-----12 3 = c 1 b/ca 1 b/d C 1-----12 5=b - 1------- 10=d 627 ......... D1152H/D1152H C 1-21--12 3 = a C 1-21--12 4 = c 1 aa/ca 2 b/d C 1-21--12 7= b A 1-21--12 4 =d 630 ......... D1152H/D1152H C 1----- 12 1 =a C 1----- 12 - =c 1 aa/ca 1 aa or ca/d - -------- - b - -- 2=d 628 ......... N/N B 2--15-12 4 = a C 1--15-12 3 =c 2 a/c 1 a/d B 1--22-22 1 = b B 2--25-12 4= d 603 ......... N/N A 21123121 4 = a A 21123121 4=c 2 a or b/dor c 1 a or b/dor c A 21123521 4 = b A 21123521 4 = d 644 ......... N/N A 1----- 11 4 = a C 1----- 12 6=c 1 a/c 1 a/d C 1------- 9=b B -------- 6=d 636 ......... N/N C 1------2 4=a C 1------2 3=c 1 a/c 1 c/d A 2------2 4 =b A 1------2 11 = d NOTE.-The polymorphic sites are as in figs. Login to comment
103 Five mutations-AF508, W1282X, N1303K, D1152H, and R117H-were identified. Login to comment
104 The AF508, W1282X, and N1303K mutations were found on chromosomes carrying the same haplotype as previously found in chromosomes of CF patients carrying these mutations (Sereth et al. 1993). Login to comment
107 The D1152H mutation was found on two different haplotypes, C,1,1,2 and D,1,1,2. Login to comment
59 Mutation Analysis Fourteen CF-R mutations that were elsewhere identified among the Israeli CF patient population (Kerem et al. 1994) were analyzed: W1282X, AF508, N1303K, G542X, 3849+10Kb C--T, S549R, S549I, W1089X, 4010delTATT, G85E, 1717-1G--A, D1152H, 405+1G--A, and Q359K1T360K. Login to comment
66 Each family had at least one male with CBAVD and one brother Table I CFTR Mutations and Haplotypes in Israeli Patients with CBAVD CFTR HAPLOTYPESb CFTR ETHNIC ORIGIN AND PATIENT MUTATIONSa XV2C/KM19C GATT TUB18 24M XV2C/KM19c GATT TUB18 24M Ashkenazi Jews: 104-1, 104-10, 610 ................. N1303K/N B 2 1 2 A 1 1 2 613, 645,635 ......................... AF508/N B 2 1 2 C 1 1 2 643 ......... ............... W1282X/R117H B 1 2 1 C 1 1 2 609,611,615,620,642 ......... W1282X/N B 1 2 1 C 1 1 2 631 ......... ............... W1282X/N B 1 2 1 A 1 1 2 630 ......... ............... D1152H/D1152H C 1 1 2 C 1 1 2 633 ......... ............... D1152H/D1152H D 1 1 2 D 1 1 2 612 ......... ............... N/N B 1 2 1 D 1 2 1 632 ......... ............... N/N B (2) 1 2 A (1) 1 2 640 ......... ............... N/N A/B 2 1 2 D/C 2 1 2 614,624 ........................ N/N A 1 1 2 C 1 1 2 616 ......... ............... N/N A 1 (2) 2 C 1 (1) 2 644 ........................ N/N A 1 1 (1) C 1 1 (2) 605,636 ........................ N/N C 1 1 2 C 1 1 2 Non-Ashkenazi Jews: 602 ......... ............... AF508/R117H B 2 1 2 B 1 1 2 604 ........................ AFS08/N B 2 1 2 C 2 2 1 629 ........................A AF508/N B 2 1 2 C 1 1 2 608 ......... ............... N/N B (2) 1 1 D (1) 1 2 628-1, 628-4 ........................ N/N B 2 1 2 C 1 1 2 625,637 ........................ N/N C 1 1 2 C 1 1 2 603-1, 603-4 ........................ N/N A 2 2 1 A 2 2 1 Arabs: 627 ......... ............... D1152H/D1152H C 1 1 2 C 1 1 2 626, 607-1 ........................ N/N C 1 1 2 C 1 1 2 607-4, 638 ........................ N/N A 1 1 2 C 1 1 2 639 ......... ............... N/N B/A 1 (2) (1) C/D 1 (1) (2) a The data in the column "CFTR mutations" are in the same order (left to right) as in the column "CFRT haplotypes." Login to comment
84 The infertile brother and one of his fertile brothers (626-10) inherited the same two CFTR alleles determined by the Table 2 Haplotype Analysis of Families with CBAVD BROTHERS WITH CBAVD FERTILE BROTHERS CFTR HAPLOTYPES CFTR CFTR CFTrR FAMILY MUTATIONS Father Mother No. Haplotypes No. Haplotypes 104 ......... N1303K/N B 21-1--12 5 =a A 12-1--12 3 = c 2 aa/c 2 aa/d C 12-1--12 4 = b A 12-1--21 5 = d b/d 610 ......... N1303K/N B 2111-212 4 = a A 2221- 212 4 = c 2 aa/c 2 aa/d A 1221-511 10 = b B 1221-212 3 = d b/c 645 ......... AF508/N - 1------- - a B 2-----12 3 = c 1 b/ca 1 b/d C 1-----12 5=b - 1------- 10=d 627 ......... D1152H/D1152H C 1-21--12 3 = a C 1-21--12 4 = c 1 aa/ca 2 b/d C 1-21--12 7= b A 1-21--12 4 =d 630 ......... D1152H/D1152H C 1----- 12 1 =a C 1----- 12 - =c 1 aa/ca 1 aa or ca/d - -------- - b - -- 2=d 628 ......... N/N B 2--15-12 4 = a C 1--15-12 3 =c 2 a/c 1 a/d B 1--22-22 1 = b B 2--25-12 4= d 603 ......... N/N A 21123121 4 = a A 21123121 4=c 2 a or b/dor c 1 a or b/dor c A 21123521 4 = b A 21123521 4 = d 644 ......... N/N A 1----- 11 4 = a C 1----- 12 6=c 1 a/c 1 a/d C 1------- 9=b B -------- 6=d 636 ......... N/N C 1------2 4=a C 1------2 3=c 1 a/c 1 c/d A 2------2 4 =b A 1------2 11 = d NOTE.-The polymorphic sites are as in figs. Login to comment
109 The D1152H mutation was found on two different haplotypes, C,1,1,2 and D,1,1,2. Login to comment

[hide] Mutations in the cystic fibrosis gene in patients ... N Engl J Med. 1995 Jun 1;332(22):1475-80. Chillon M, Casals T, Mercier B, Bassas L, Lissens W, Silber S, Romey MC, Ruiz-Romero J, Verlingue C, Claustres M, et al.
Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens.
N Engl J Med. 1995 Jun 1;332(22):1475-80., [PMID:7739684]

Abstract [show]
BACKGROUND: Congenital bilateral absence of the vas deferens (CBAVD) is a form of male infertility in which mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene have been identified. The molecular basis of CBAVD is not completely understood. Although patients with cystic fibrosis have mutations in both copies of the CFTR gene, most patients with CBAVD have mutations in only one copy of the gene. METHODS: To investigate CBAVD at the molecular level, we have characterized the mutations in the CFTR gene in 102 patients with this condition. None had clinical manifestations of cystic fibrosis. We also analyzed a DNA variant (the 5T allele) in a noncoding region of CFTR that causes reduced levels of the normal CFTR protein. Parents of patients with cystic fibrosis, patients with types of infertility other than CBAVD, and normal subjects were studied as controls. RESULTS: Nineteen of the 102 patients with CBAVD had mutations in both copies of the CFTR gene, and none of them had the 5T allele. Fifty-four patients had a mutation in one copy of CFTR, and 34 of them (63 percent) had the 5T allele in the other CFTR gene. In 29 patients no CFTR mutations were found, but 7 of them (24 percent) had the 5T allele. In contrast, the frequency of this allele in the general population was about 5 percent. CONCLUSIONS: Most patients with CBAVD have mutations in the CFTR gene. The combination of the 5T allele in one copy of the CFTR gene with a cystic fibrosis mutation in the other copy is the most common cause of CBAVD: The 5T allele mutation has a wide range of clinical presentations, occurring in patients with CBAVD or moderate forms of cystic fibrosis and in fertile men.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 OF PATIENTS POLYT GENOTYPE† ⌬F508/R668C 32c;F508/D1152H ⌬F508/D1270N ⌬F508/R75L ⌬F508/R117H ⌬F508/L206W ⌬F508/R258G ⌬F508/S1235R ⌬F508/R347H ⌬F508/R347H R117H/G1349D R117H/712-1G→T G149R/R668C R347H/R1066H R553X/R668C R1070W/2869insG ⌬F508/- G542X/- W1282X/- R334W/- K1060T/- R1162X/- N1303K/- A800G/- ⌬F508/- ⌬F508/- ⌬F508/- ⌬E115/- R117H/- R347H/- G542X/- R553X/- 1677delTA/- 2184delA/- 2789ϩ5G→Α/- S1235R/- W1282X/- -/- -/- -/- -/- 2 2 2 1 1 1 1 1 1 1 1 1 1 1 1 1 22 4 3 1 1 1 1 1 7 1 1 1 1 2 1 1 1 1 1 1 1 3 3 1 19 9T/7T 9T/7T 9T/7T 9T/7T 9T/7T 9T/9T 9T/7T 9T/7T 9T/7T 9T/9T 7T/7T 7T/9T 9T/7T 9T/7T 7T/7T 7T/7T 9T/5T 9T/5T 7T/5T 7T/5T 7T/5T 7T/5T 9T/5T 5T/5T 9T/7T 9T/9T 7T/7T 7T/7T 7T/7T 9T/7T 9T/7T 7T/7T 7T/7T 7T/7T 7T/7T 7T/9T 7T/7T 9T/5T 7T/5T 5T/5T 7T/7T -/- 3 7T/9T *Data were obtained from the Spanish population analyzed in this study. Login to comment

[hide] Increased incidence of cystic fibrosis gene mutati... Hum Mol Genet. 1995 Apr;4(4):635-9. Pignatti PF, Bombieri C, Marigo C, Benetazzo M, Luisetti M
Increased incidence of cystic fibrosis gene mutations in adults with disseminated bronchiectasis.
Hum Mol Genet. 1995 Apr;4(4):635-9., [PMID:7543317]

Abstract [show]
In order to identify a possible hereditary predisposition to the development of obstructive pulmonary disease of unknown origin, we have looked for the presence of Cystic Fibrosis Transmembrane Regulator (CFTR) gene mutations in unrelated patients with no signs of Cystic Fibrosis (CF). We screened for 70 common mutations, and also for rare mutations by denaturing gradient gel electrophoresis analysis. In this search, different CFTR gene mutations (R75Q, delta F508, R1066C, M1137V and 3667ins4) were found in five out of 16 adult Italian patients with disseminated bronchiectasis, a significant increase over the expected frequency of carriers. Moreover, three rare CFTR gene DNA polymorphisms (G576A, R668C, and 2736 A-->G), not deemed to be the cause of CF, were found in two patients, one of which was a compound heterozygote with R1066C. These results indicate that CFTR gene mutations, and perhaps also DNA polymorphisms, may be involved in the etiopathogenesis of at least some cases of bronchiectasis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 List of CFTR gene mutations and DNA polymorphisms screened Mutations R75Q/X/L, G85E, 394deITT 457TAT->G, R117H 621 + 1G->T 711 + 5G->A L206W 875 + 40 A->G 936 del TA 1001 + 11C->T R334W, R347 P/H/L, 1154insTC A455E, V456F DF5O8 1717-IG->A, 1717-8G->A G542X, G551D, Q552X, R553X P574H 1898 + 3A->G 2183 AA->G, 2184delA, R709X D836Y, 2694 T/G 2752-22 A/G 2789 + 5 G->A, 2790-2 A-»G Q890X 3041-71 G/C 3132delTG 3271 + 18 C-»T, 3272-26 A->G H1054D, G1061R, R1066C/H, A1067T, H1085R, Y1092X, 3320 ins5 D1152H R1162X, 3667ins4, 3737delA, 11234V 3849 + 10 kb C-»T, 3850-1 G-»A SI25IN, S1255P, 3905insT, 3898insC, D127ON, W1282X, R1283M, 4002 A/G 4005 + 1 G-»A N1303 K/H, 4029 A/G D1377H Q1411 X 4404 C/T, 4521 G/A Location e 3 e 4 i 4 i 5 e 6a i 6a e 6b i 6b e 7 e 9 e 10 i 10 e 11 e 12 i 12 e 13 e 14a i 14a i 14b e 15 i 15 e 17a i 17a e 17b e 18 e 19 i 19 e 20 i 20 e2l e 22 e 23 e24 Listing is in order of location along the CFTR gene, e = exon; i = intron. Login to comment

[hide] Identification of seven rather infrequent and one ... Hum Mol Genet. 1994 Dec;3(12):2249-50. Teng H, Cuppens H, De Boeck C, Cassiman JJ
Identification of seven rather infrequent and one novel CFTR mutation in the Belgian population.
Hum Mol Genet. 1994 Dec;3(12):2249-50., [PMID:7881429]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Seven of these were described previously: R117H (2), G551D (3), R553X (3), 394delTT (4), L206W (4), G85E (5) and D1152H (6). Login to comment

[hide] Association of pancreatic adenocarcinoma, mild lun... Clin Chem. 1994 Oct;40(10):1972-4. Tsongalis GJ, Faber G, Dalldorf FG, Friedman KJ, Silverman LM, Yankaskas JR
Association of pancreatic adenocarcinoma, mild lung disease, and delta F508 mutation in a cystic fibrosis patient.
Clin Chem. 1994 Oct;40(10):1972-4., [PMID:7522998]

Abstract [show]
A case of adenocarcinoma of the pancreas and mild lung disease in a 39-year-old man homozygous for the delta F508 cystic fibrosis mutation is presented. Cystic fibrosis is the most common lethal genetic disease in Caucasians, and is most commonly associated with severe obstructive lung disease. To our knowledge, this is only the fifth case of adenocarcinoma of the pancreas in a CF patient to be reported and the first case for which molecular data are available. The rare incidence of this type of malignancy in the general population suggests a possible association of CF with this malignant disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 CorrelatIon of phenotype and genotype of CFTR mutations Key phenotypic Lung disease SweatC1 Exocnne pancreas function Vasdeferens Associated CFTR mutations Pancreatic InsuffIcIent Pancreatic sufficient Normalsweat C1 Severe Less severe Relatively mild Elevated Elevated Normal Insufficient Sufficient Sufficient Absent Absent Absent SF508, G542X, R553X, G5510, Ni 303K, Wi 282X, RI 17H, and others 2789 + 5G>A, R117H, R334W, R347P, A455E, P574H, S945L, G85E, and others G551S, R117H, 3849 + 10kb C>T, and others Congenitalabsence of the vas deferens None Normal or elevated Sufficient Absent F508C, Ri 17H, Di D1152H, and others FIg. 2. Login to comment

[hide] Sensitivity of single-strand conformation polymorp... Hum Mol Genet. 1994 May;3(5):801-7. Ravnik-Glavac M, Glavac D, Dean M
Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene.
Hum Mol Genet. 1994 May;3(5):801-7., [PMID:7521710]

Abstract [show]
The gene responsible for cystic fibrosis (CF) contains 27 coding exons and more than 300 independent mutations have been identified. An efficient and optimized strategy is required to identify additional mutations and/or to screen patient samples for the presence of known mutations. We have tested several different conditions for performing single-stranded conformation polymorphism (SSCP) analysis in order to determine the efficiency of the method and to identify the optimum conditions for mutation detection. Each exon and corresponding exon boundaries were amplified. A panel of 134 known CF mutations were used to test the efficiency of detection of mutations. The SSCP conditions were varied by altering the percentage and cross-linking of the acrylamide, employing MDE (an acrylamide substitute), and by adding sucrose and glycerol. The presence of heteroduplexes could be detected on most gels and in some cases contributed to the ability to distinguish certain mutations. Each analysis condition detected 75-98% of the mutations, and all of the mutations could be detected by at least one condition. Therefore, an optimized SSCP analysis can be used to efficiently screen for mutations in a large gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.). Login to comment

[hide] H2O2 stimulates cystic fibrosis transmembrane cond... Am J Respir Cell Mol Biol. 2013 Oct;49(4):672-9. doi: 10.1165/rcmb.2013-0156OC. Conner GE, Ivonnet P, Gelin M, Whitney P, Salathe M
H2O2 stimulates cystic fibrosis transmembrane conductance regulator through an autocrine prostaglandin pathway, using multidrug-resistant protein-4.
Am J Respir Cell Mol Biol. 2013 Oct;49(4):672-9. doi: 10.1165/rcmb.2013-0156OC., [PMID:23742099]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) activity is essential for the maintenance of airway surface liquid depth, and therefore mucociliary clearance. Reactive oxygen species, increased during inflammatory airway diseases, alter CFTR activity. Here, H2O2 levels in the surface liquid of normal human bronchial epithelial cultures differentiated at the air-liquid interface were estimated, and H2O2-mediated changes in CFTR activity were examined. In Ussing chambers, H2O2-induced anion currents were sensitive to the CFTR inhibitors CFTRinh172 and GlyH-101. These currents were absent in cells from patients with cystic fibrosis. Responses to greater than 500 muM H2O2 were transient. Cyclooxygenase inhibitors blocked the H2O2 response, as did EP1 and EP4 receptor antagonists. A multidrug-resistant protein (MRP) inhibitor and short hairpin RNA directed against MRP4 blocked H2O2 responses. EP1 and EP4 agonists mimicked H2O2 in both control and MRP4 knockdown cells. Thus, H2O2 activates the synthesis, export, and binding of prostanoids via EP4 and, interestingly, EP1 receptors in normal, differentiated human airway epithelial cells to activate cyclic adenosine monophosphate pathways that in turn activate CFTR channels in the apical membrane.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 The genotypes of these lungs were ƊF508/R347P and ƊF508/D1152H. Login to comment

[hide] Cystic fibrosis in a boy with meconium ileus and m... Turk J Pediatr. 2008 Jul-Aug;50(4):383-5. Yalcin E, Ozcelik U, Yilmaz E, Dogru D, Kiper N, Ferec C
Cystic fibrosis in a boy with meconium ileus and mild clinical phenotype associated with 2183AA-G/D1152H genotype.
Turk J Pediatr. 2008 Jul-Aug;50(4):383-5., [PMID:19014055]

Abstract [show]
We report a 16-year-old boy with cystic fibrosis presenting with meconium ileus in the neonatal period who showed mild clinical phenotype later. He had sufficient pancreatic function, mild lung involvement and borderline sweat chloride levels. Analysis of the cystic fibrosis transmembrane regulator protein gene revealed the rare mutation: 2183AA-G/D1152H. To our knowledge, this is the first report concerning such a mutation combination in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
10 We report a 16-year-old boy with CF presenting with MI in the neonatal period, but who then showed nonclassic CF phenotype with PS, mild lung involvement and borderline sweat chloride levels. Analysis of the CFTR gene revealed the rare mutation 2183AA-G/D1152H. Login to comment
20 Analysis of the CFTR gene revealed 2183AA-G/ D1152H mutations in our patient. Login to comment
27 In our patient, analysis of the CFTR gene revealed 2183AA-G/D1152H mutations; this mutation combination was found for the first time. Login to comment
28 D1152H mutation is an exon 18 mutation that causes nonclassic CF phenotype even if severe mutation (e.g. delF508) is on the other allele4,5. Login to comment
35 To our knowledge, our patient is the first reported case concerning mild phenotype with 2183AA-G/D1152H mutations. Login to comment
46 In conclusion, we present our CF patient having 2183AA-G/D1152H mutations with a history of MI and nonclassic CF phenotype. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Drugs. 2010 Feb 12;70(3):241-59. doi: 10.2165/11316160-000000000-00000. Becq F
Cystic fibrosis transmembrane conductance regulator modulators for personalized drug treatment of cystic fibrosis: progress to date.
Drugs. 2010 Feb 12;70(3):241-59. doi: 10.2165/11316160-000000000-00000., [PMID:20166764]

Abstract [show]
This article considers the issue of personalized drug discovery for the orphan disease cystic fibrosis (CF) to deliver a candidate for therapeutic development. CF is a very complicated disease due to numerous anomalies of the gene leading to progressive severity and morbidity. Despite extensive research efforts, 20 years after the cloning of the CF gene, CF patients are still waiting for a curative treatment as prescribed medications still target the secondary manifestations of the disease rather than the gene or the CF transmembrane conductance regulator (CFTR) protein. New therapeutics aimed at improving mutant CFTR functions, also known as 'protein repair therapy' are nevertheless hoped and predicted to replace some of the currently used therapy, while improving the quality of life as well as life expectancy of CF patients. Although there is substantial variability in the cost of treating CF between countries, a protein repair therapy should also alleviate the financial burden of medical costs for CF patients and their families. Finding new drugs or rediscovering old ones for CF is critically dependent on the delivery of molecular and structural information on the CFTR protein, on its mutated version and on the network of CFTR-interacting proteins. The expertise needed to turn compounds into marketable drugs for CF will depend on our ability to provide biological information obtained from pertinent models of the disease and on our success in transferring safe molecules to clinical trials. Predicting a drug-induced response is also an attractive challenge that could be rapidly applied to patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
209 [76] Similar effects were observed for G551D, G1349D and D1152H mutants. Login to comment

[hide] Distribution of CFTR mutations in the Czech popula... J Cyst Fibros. 2013 Sep;12(5):532-7. doi: 10.1016/j.jcf.2012.12.002. Epub 2012 Dec 29. Krenkova P, Piskackova T, Holubova A, Balascakova M, Krulisova V, Camajova J, Turnovec M, Libik M, Norambuena P, Stambergova A, Dvorakova L, Skalicka V, Bartosova J, Kucerova T, Fila L, Zemkova D, Vavrova V, Koudova M, Macek M, Krebsova A, Macek M Jr
Distribution of CFTR mutations in the Czech population: positive impact of integrated clinical and laboratory expertise, detection of novel/de novo alleles and relevance for related/derived populations.
J Cyst Fibros. 2013 Sep;12(5):532-7. doi: 10.1016/j.jcf.2012.12.002. Epub 2012 Dec 29., [PMID:23276700]

Abstract [show]
BACKGROUND: This two decade long study presents a comprehensive overview of the CFTR mutation distribution in a representative cohort of 600 Czech CF patients derived from all regions of the Czech Republic. METHODS: We examined the most common CF-causing mutations using the Elucigene CF-EU2v1 assay, followed by MLPA, mutation scanning and/or sequencing of the entire CFTR coding region and splice site junctions. RESULTS: We identified 99.5% of all mutations (1194/1200 CFTR alleles) in the Czech CF population. Altogether 91 different CFTR mutations, of which 20 were novel, were detected. One case of de novo mutation and a novel polymorphism was revealed. CONCLUSION: The commercial assay achieved 90.7%, the MLPA added 1.0% and sequencing increased the detection rate by 7.8%. These comprehensive data provide a basis for the improvement of CF DNA diagnostics and/or newborn screening in our country. In addition, they are relevant to related Central European populations with lower mutation detection rates, as well as to the sizeable North American "Bohemian diaspora".

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Unknown 6 0.50 Total 1200 100.00 Legend: Within the traditional nomenclature column: "*" mutations included in the Elucigene CF-EU2v1ࡊ assay; "# " genotype-phenotype correlations of detected mutations are described in the CFTR2 database [21] with e.g. D1152H, L997F having "varying consequences"&#a8;; "?" Login to comment

[hide] PGD for cystic fibrosis patients and couples at ri... Reprod Biomed Online. 2013 May;26(5):420-30. doi: 10.1016/j.rbmo.2013.01.006. Epub 2013 Jan 29. Rechitsky S, Verlinsky O, Kuliev A
PGD for cystic fibrosis patients and couples at risk of an additional genetic disorder combined with 24-chromosome aneuploidy testing.
Reprod Biomed Online. 2013 May;26(5):420-30. doi: 10.1016/j.rbmo.2013.01.006. Epub 2013 Jan 29., [PMID:23523379]

Abstract [show]
Preimplantation genetic diagnosis (PGD) for inherited disorders is presently applied for more than 300 different conditions. The most frequent PGD indication is cystic fibrosis (CF), the largest series of which is reviewed here, totalling 404 PGD cycles. This involved testing for 52 different CFTR mutations with almost half of the cases (195/404 cycles) performed for DeltaF508 mutation, one-quarter (103/404 cycles) for six other frequent mutations and only a few for the remaining 45 CFTR mutations. There were 44 PGD cycles performed for 25 CF-affected homozygous or double-heterozygous CF patients (18 male and seven female partners), which involved testing simultaneously for three mutations, resulting in birth of 13 healthy CF-free children and no misdiagnosis. PGD was also performed for six couples at a combined risk of producing offspring with CF and another genetic disorder. Concomitant testing for CFTR and other mutations resulted in birth of six healthy children, free of both CF and another genetic disorder in all but one cycle. A total of 96 PGD cycles for CF were performed with simultaneous aneuploidy testing, including microarray-based 24-chromosome analysis, as a comprehensive PGD for two or more conditions in the same biopsy material.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 [1075C>A; 1079C>A] p.[Gln359Lys; Thr360Lys] Exon 8 1 1 1 4 1 1 R297Q c.890G>A p.Arg297Gln Exon 8 1 1 1 2 0 0 R347P c.1040G>C p.Arg347Pro Exon 8 3 5 2 4 1 1 T338I c.1013C>T p.Thr338Ile Exon 8 1 1 1 2 1 1 DF508 c.1521_1523delCTT p.Phe508del Exon 11 130 195 172 345 88 (4) 92 DI507 c.1519_1521delATC p.Ile507del Exon 11 1 5 5 11 2 1 Q493R c.1478A>G p.Gln493Arg Exon 11 5 5 2 2 2 2 1717-1G-A c.1585-1G>A - Intron 11 6 10 9 18 6 8 G542X c.1624G>T p.Gly542X Exon 12 14 17 15 34 10 10 G551S c.1651G>A p.Gly551Ser Exon 12 1 1 1 2 1 1 G551D c.1652G>A p.Gly551Asp Exon 12 12 22 19 33 7 8 I556V c.1666A>G p.Ile556Val Exon 12 1 2 2 4 1 1 R553X c.1657C>T p.Arg553X Exon 12 3 4 2 4 0 0 R560T c.1679G>C p.Arg560Thr Exon 12 1 1 1 2 1 2 1898+1G-A c.1766 &#b1; 1G>A - Intron 13 1 1 1 2 1 1 2184delA c.2052delA p.Lys684AsnfsX38 Exon 14 1 1 0 0 0 0 G622D c.1865G>A p.Gly622Asp Exon 14 1 1 1 3 0 0 N703S c.2108A>G p.Asn703Ser Exon 14 1 2 2 3 2 2 S737F c.2210C>T p.Ser737Phe Exon 14 1 1 0 0 0 0 2622+1G-A c.2490 &#b1; 1G>A - Intron 14 1 5 5 13 1 1 2752-26A-G c.2620-26A>G - Intron 15 1 2 2 4 0 0 2789+5G-A c.2657 &#b1; 5G>A - Intron 16 3 5 4 8 0 0 3120G-A c.2988G>A - Exon 18 2 2 1 2 1 0 3067-72del c.3067_3072del p.Ile1023_Val1024del Exon 19 1 1 1 1 0 0 I1027T c.3080T>C p.Ile1027Thr Exon 19 1 1 1 1 0 0 L997F c.2991G>C p.Leu997Phe Exon 19 1 2 2 4 1 (1) 0 M1028R c.3083T>G p.Met1028Arg Exon 19 1 1 1 2 1 2 F1052V c.3154T>G p.Phe1052Val Exon 20 1 1 0 0 0 0 Y1092X c.3276C>A p.Tyr1092X Exon 20 1 2 1 2 1 1 A1136T c.3406G>A p.Ala1136Thr Exon 21 1 2 1 2 1 0 D1152H c.3454G>C p.Asp1152His Exon 21 3 7 7 15 1 1 3659 del C c.3528delC p.Lys1177SerfsX15 Exon 22 2 4 3 7 3 3 R1162X c.3484C>T p.Arg1162X Exon 22 1 3 2 5 2 2 S1235R c.3705T>G p.Ser1235Arg Exon 22 2 3 3 5 2 1 3849+10kbC>T c.3717 &#b1; 12191C>T - Intron 22 2 4 4 5 0 0 W1282X c.3846G>A p.Trp1282X Exon 23 15 20 20 42 11 11 N1303K c.3909C>G p.Asn1303Lys Exon 24 9 12 11 24 4 5 Q1352H c.4056G>C p.Gln1352His Exon 25 1 1 1 1 1 1 Total 265 404 345 685 172 (6a ) 175 Values are n unless otherwise stated. Login to comment
75 (Upper panel) Pedigree showing that both of the parents are carriers of different CFTR mutations: the mother is a carrier of D1152H and the father is a carrier or V1282X. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... PLoS One. 2013 Apr 17;8(4):e61176. doi: 10.1371/journal.pone.0061176. Print 2013. Schippa S, Iebba V, Santangelo F, Gagliardi A, De Biase RV, Stamato A, Bertasi S, Lucarelli M, Conte MP, Quattrucci S
Cystic fibrosis transmembrane conductance regulator (CFTR) allelic variants relate to shifts in faecal microbiota of cystic fibrosis patients.
PLoS One. 2013 Apr 17;8(4):e61176. doi: 10.1371/journal.pone.0061176. Print 2013., [PMID:23613805]

Abstract [show]
INTRODUCTION: In this study we investigated the effects of the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene variants on the composition of faecal microbiota, in patients affected by Cystic Fibrosis (CF). CFTR mutations (F508del is the most common) lead to a decreased secretion of chloride/water, and to mucus sticky secretions, in pancreas, respiratory and gastrointestinal tracts. Intestinal manifestations are underestimated in CF, leading to ileum meconium at birth, or small bowel bacterial overgrowth in adult age. METHODS: Thirty-six CF patients, fasting and under no-antibiotic treatment, were CFTR genotyped on both alleles. Faecal samples were subjected to molecular microbial profiling through Temporal Temperature Gradient Electrophoresis and species-specific PCR. Ecological parameters and multivariate algorithms were employed to find out if CFTR variants could be related to the microbiota structure. RESULTS: Patients were classified by two different criteria: 1) presence/absence of F508del mutation; 2) disease severity in heterozygous and homozygous F508del patients. We found that homozygous-F508del and severe CF patients exhibited an enhanced dysbiotic faecal microbiota composition, even within the CF cohort itself, with higher biodiversity and evenness. We also found, by species-specific PCR, that potentially harmful species (Escherichia coli and Eubacterium biforme) were abundant in homozygous-F508del and severe CF patients, while beneficial species (Faecalibacterium prausnitzii, Bifidobacterium spp., and Eubacterium limosum) were reduced. CONCLUSIONS: This is the first report that establishes a link among CFTR variants and shifts in faecal microbiota, opening the way to studies that perceive CF as a 'systemic disease', linking the lung and the gut in a joined axis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 Patient Sex Age (years) CFTR allele, = CFTR allele, R Criterion I(a) Criterion II (1 = severe, 0 = mild)(b) Pancreatic status(d) FEV1% BMI 1 M 17 F508del M1V 2 (1) 1 65 17.91 2 F 23 F508del Y569D 2 (1) 0 97 18.66 3 (s1)(c) F 20 P1013L F508del 2 (0) 0 87 18.67 4 M 11 F508del L997F (without R117L) 2 0 0 110 21.33 5 (s1)(c) M 11 P1013L F508del 2 (0) 0 100 23.14 6 M 8 R553X F508del 2 1 0 80 15.87 7 M 3 F508del unknown 2 (0) 0 nd nd 8 F 33 F508del F508del 1 1 1 73 18.61 9 M 10 F508del L1077P 2 1 0 94 19.79 10 M 9 F508del G542X 2 1 1 100 16.00 11 F 9 4167delCTAAGCC L1065P 3 nd 1 76 14.57 12 F 14 R117C (without (TG)12T5) F508del 2 0 0 94 18.44 13 F 11 F508del 991del5 2 1 1 109 17.80 14 M 42 (TG)12T5 F508del 2 0 0 106 23.78 15 (s2)(c) M 9 F508del F508del 1 1 1 82 15.45 16 M 10 F508del R347P 2 (0) 0 89 15.91 17 (s2)(c) F 6 F508del F508del 1 1 1 110 15.20 18 (s3)(c) M 39 2789+5G.A N1303K 3 nd 0 105 19.33 19 (s3)(c) F 41 2789+5G.A N1303K 3 nd 0 80 19.47 20 F 26 N1303K W1282X 3 nd 1 90 19.57 21 M 7 CFTRdele2,3 (21 kb) N1303K 3 nd 1 107 12.85 22 F 9 F508del L997F (without R117L) 2 0 0 113 25.21 23 M 7 P5L W1282X 3 nd 0 89 22.31 24 M 9 2789+5G.A F508del 2 (1) 1 97 15.60 25 F 2 F508del F508del 1 1 1 nd nd 26 F 32 N1303K N1303K 3 nd 1 107 21.22 27 M 14 L1065R T338I 3 nd 0 116 21.50 28 M 12 711+3A.G S549R(A.C) 3 nd 0 97 20.00 29 M 13 unknown R117H (without (TG)12T5) 3 nd 0 104 19.36 30 M 14 F508del G542X 2 1 1 84 21.87 31 F 13 F508del F508del 1 1 1 85 18.00 32 F 41 2789+5G.A N1303K 3 nd 1 84 21.08 33 F 21 L1065P F508del 2 (0) 0 62 18.29 34 F 50 D1152H F508del 2 (0) 0 63 23.74 35 M 29 F508del 2790-2A.G 2 (1) 0 92 24.46 36 F 45 unknown W1282X 3 nd 0 69 23.42 a (Hm = 1; Ht = 2; N = 3). Login to comment
63 Class IV or V: R117H, 2789+5G.A, TG12T5, R347P, D1152H, R117C. Login to comment

[hide] Clinical and genetic features in patients with cys... Iran J Pediatr. 2013 Apr;23(2):212-5. Farjadian S, Moghtaderi M, Kashef S, Alyasin S, Najib K, Saki F
Clinical and genetic features in patients with cystic fibrosis in southwestern iran.
Iran J Pediatr. 2013 Apr;23(2):212-5., [PMID:23724185]

Abstract [show]
OBJECTIVE: Cystic fibrosis (CF) is a common autosomal recessive genetic disease caused by a mutation in the CF transmembrane conductance regulatory (CFTR) gene. This study attempted to identify the most common CFTR mutations and any correlations between certain mutations and the clinical presentation of the disease in CF patients in southwestern Iran. METHODS: Twenty nine common CFTR gene mutations were examined in 45 CF patients. FINDINGS: Chronic cough, intestinal obstruction, dehydration, heat exhaustion and steatorrhea were the most common early clinical symptoms among our patients. The most common mutation was DeltaF508, with an allele frequency of 21%. The homozygous DeltaF508 mutation was observed in eight patients (18%), and three patients (7%) were DeltaF508 carriers. The 2183AA > G mutation was observed in four patients, one of whom was also a DeltaF508 carrier. The R1162X mutation was detected in two patients. The G542X, R334W and N1303K mutations were detected each in one patient, the first of whom was also a DeltaF508 carrier. CONCLUSION: Out of 45 patients, 27 (60%) had none of the CFTR gene mutations we tested for. The most frequent mutations in southwestern Iranian patients with CF should be identified by sequencing the entire CFTR gene in order to optimize the design of a diagnostic kit for common regional mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Genomic DNA was extracted from 200 &#b5;L of whole blood with the QiaAmp DNA Mini Kit (Qiagen, Valencia, CA, USA) and 29 common CFTR gene mutations (D1152H, 1717-1G>A, G542X, W1282X, N1303K, ࢞F508, 3849+10kbC>T, 394delTT, 621+1G>T, S1251N, G551D, R117H, R1162X, R334W, A455E, 2183AA>G, 3659delC, 1078delT, ࢞I507, R347P, R553X, E60X, 3120+1G>A, 2789+5G>A, 1898+1G>A, 711+1G>T, G85E, 2184delA and R560T) were analyzed with the ELUCIGENE CF29 v. 2 kit using four multiplex PCR. Login to comment

[hide] Managing the underlying cause of cystic fibrosis: ... Paediatr Drugs. 2013 Oct;15(5):393-402. doi: 10.1007/s40272-013-0035-3. Galietta LJ
Managing the underlying cause of cystic fibrosis: a future role for potentiators and correctors.
Paediatr Drugs. 2013 Oct;15(5):393-402. doi: 10.1007/s40272-013-0035-3., [PMID:23757197]

Abstract [show]
Cystic fibrosis (CF), a severe genetic disease, is caused by mutations that alter the structure and function of CFTR, a plasma membrane channel permeable to chloride and bicarbonate. Defective anion transport in CF irreversibly damages the lungs, pancreas, liver, and other organs. CF mutations cause loss of CFTR function in multiple ways. In particular, class 3 mutations such as p.Gly551Asp strongly decrease the time spent by CFTR in the open state (gating defect). Instead, class 2 mutations impair the maturation of CFTR protein and its transport from the endoplasmic reticulum to the plasma membrane (trafficking defect). The deletion of phenylalanine 508 (p.Phe508del), the most frequent mutation among CF patients (70-90 %), destabilizes the CFTR protein, thus causing both a trafficking and a gating defect. These two defects can be overcome with drug-like molecules generically called correctors and potentiators, respectively. The potentiator Kalydeco (also known as Ivacaftor or VX-770), developed by Vertex Pharmaceuticals, has been recently approved by the US FDA and the European Medicines Agency (EMA) for the treatment of CF patients carrying at least one CFTR allele with the p.Gly551Asp mutation (2-5 % of all patients). In contrast, the corrector VX-809, which significantly improves p.Phe508del-CFTR trafficking in vitro, is still under study in clinical trials. Because of multiple defects caused by the p.Phe508del mutation, it is probable that rescue of the mutant protein will require combined treatment with correctors having different mechanisms of action. This review evaluates the status of experimental and clinical research in pharmacotherapy for the CF basic defect.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 There are several studies describing the discovery of very effective potentiators, in many cases with nanomolar potency, that can rescue channel activity not only of p.Phe508del, but also of p.Gly551Asp, p.Gly1349Asp, p.Glu193Lys, p.Gly970Arg, p.Asp1152His, and other mutations [51, 52]. Login to comment

[hide] A comprehensive assay for CFTR mutational analysis... Clin Chem. 2013 Oct;59(10):1481-8. doi: 10.1373/clinchem.2013.206466. Epub 2013 Jun 17. Abou Tayoun AN, Tunkey CD, Pugh TJ, Ross T, Shah M, Lee CC, Harkins TT, Wells WA, Tafe LJ, Amos CI, Tsongalis GJ
A comprehensive assay for CFTR mutational analysis using next-generation sequencing.
Clin Chem. 2013 Oct;59(10):1481-8. doi: 10.1373/clinchem.2013.206466. Epub 2013 Jun 17., [PMID:23775370]

Abstract [show]
BACKGROUND: Cystic fibrosis is a life-threatening genetic disorder that has been associated with mutations in the CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] gene. Hundreds of CFTR mutations have been detected to date. Current CFTR genotyping assays target a subset of these mutations, particularly a mutation panel recommended by the American College of Medical Genetics for carrier screening of the general population. Fast sequencing of the entire coding sequence in a scalable manner could expand the detection of CFTR mutations and facilitate management of costs and turnaround times in the clinical laboratory. METHODS: We describe a proof-of-concept CFTR assay that uses PCR target enrichment and next-generation sequencing on the Ion Torrent Personal Genome Machine (PGM) platform. RESULTS: The scalability of the assay was demonstrated, with an average mean depth of coverage ranging from 500x to 3500x, depending on the number of multiplexed patient samples and the Ion Torrent chip used. In a blinded study of 79 previously genotyped patient DNA samples and cell lines, our assay detected most of the mutations, including single-nucleotide variants, small insertions and deletions, and large copy-number variants. The reproducibility was 100% for detecting mutations in independent runs. Our assay demonstrated high specificity, with only 2 false-positive calls (at 2184delA) found in 2 samples caused by a sequencing error in a homopolymer stretch of sequence. The detection rate for variants of unknown significance was very low in the targeted region. CONCLUSIONS: With continued optimization and system refinements, PGM sequencing promises to be a powerful, rapid, and scalable means of clinical diagnostic sequencing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 of cases af9;/af9; c.1521_1523delCTT; c.1521_1523delCTT èc;F508; èc;F508 CF Yes 97 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.350Gb0e;A èc;F508; R117H CF Yes 53; 50 Dartmouth 1 af9;/af9; c.350Gb0e;A; c.1477Cb0e;T R117H; Q493*b CF Yes 52; 49 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.1000Cb0e;T èc;F508; R334W CF Yes 49; 54 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.489af9;1Gb0e;T èc;F508; 621af9;1Gb0e;T CF Yes 48; 47 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.1364Cb0e;A èc;F508; A455E CF Yes 51; 46 Dartmouth 1 af9;/af9; c.489af9;1Gb0e;T; c.2988af9;1Gb0e;A 621af9;1Gb0e;T; 3120af9;1Gb0e;A CF Yes 48; 49 Coriell 1 af9;/af9; c.1521_1523delCTT; c.1657Cb0e;T èc;F508; R553* CF Yes 44; 49c Coriell 2 af9;/af9; c.1521_1523delCTT; c.3528delC èc;F508; 3659delC CF Yes 46; 46 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.579af9;1Gb0e;T 621af9;1Gb0e;T; 711af9;1Gb0e;T CF Yes 50; 51 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.254Gb0e;A 621af9;1Gb0e;T; G85E CF Yes 50; 45 Coriell 1 af9;/af9; c.1521_1523delCTT; c.1679Gb0e;C èc;F508; R560T CF Yes 44; 52 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.1364Cb0e;A 621af9;1Gb0e;T; A455E CF Yes 50; 49 Coriell 1 af9;/af9; c.3909Cb0e;G; c.4046Gb0e;A N1303K; G1349D CF Yes 47; 52 Coriell 1 af9;/af9; c.2657af9;5Gb0e;A; c.2657af9;5Gb0e;A 2789af9;5Gb0e;A; 2789af9;5Gb0e;A CF Yes 100 Coriell 1 af9;/af9; c.1040Gb0e;C; c.1652Gb0e;A R347P; G551D CF Yes 51; 49 Coriell 1 af9;/af9; c.1000Cb0e;T; c.3368-2Ab0e;T R334W; 3500-2Ab0e;G CF Yes 53; 45 Coriell 1 af9;/af9; c.254Gb0e;A; c.3454Gb0e;C G85E; D1152H CF Yes 44; 47 Coriell 1 af9;/af9; c.1521_1523delCTT; c.350Gb0e;A èc;F508; R117H CF Yes 49; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.54-5940_273af9;10250del21kb èc;F508; CFTRdel2,3 CF Yes 47; N/Ad Coriell 1 af9;/af9; c.1521_1523delCTT; c.1766af9;1Gb0e;A èc;F508; 1898af9;1Gb0e;A CF Yes 47; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.2051_2052delAAinsG èc;F508; K684Sfs CF Yes 47; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.2052del èc;F508; K684Nfs*38 CF Yes 51; 55 Coriell 1 af9;/afa; c.1521_1523delCTT èc;F508 Carrier Yes 50c Dartmouth 16 af9;/afa; c.1652Gb0e;A G551D Carrier Yes 50c Dartmouth 5 af9;/afa; c.1519_1521delATC èc;I507 Carrier Yes 46 Dartmouth 1 af9;/afa; c.3454Gb0e;C D1152H Carrier Yes 50 Dartmouth 1 af9;/afa; c.1657Cb0e;T R553* Carrier Yes 51 Dartmouth 1 af9;/afa; c.178Gb0e;T E60* Carrier Yes 51 Dartmouth 1 af9;/afa; c.3846Gb0e;A W1282* Carrier Yes 45c Dartmouth 3 af9;/afa; c.1000Cb0e;T R334W Carrier Yes 51 Dartmouth 1 af9;/afa; c.1624Gb0e;T G542* Carrier Yes 47c Dartmouth 4 af9;/afa; c.3484Cb0e;T R1162* Carrier Yes 43 Dartmouth 1 af9;/afa; c.1766af9;1Gb0e;A 1898af9;1Gb0e;A Carrier Yes 57 Dartmouth 1 af9;/afa; c.3773_3774insT 3905insT (L1258Ffs*7) Carrier Yes 37 Dartmouth 1 af9;/afa; c.350Gb0e;A R117H Carrier Yes 50c Dartmouth 3 af9;/afa; c.1645Ab0e;C S549R Ab0e;C Carrier No N/A Dartmouth 1 af9;/afa; c.1040Gb0e;A R347H Carrier Yes 47 Dartmouth 1 af9;/afa; c.3909Cb0e;G N1303K Carrier Yes 46 Dartmouth 1 af9;/afa; c.3718-2477Cb0e;T 3849af9;10kbCb0e;T Carrier Yes 51 Coriell 1 af9;/afa; c.2988af9;1Gb0e;A 3120af9;1Gb0e;A Carrier Yes 49 Coriell 1 af9;/afa; c.489af9;1Gb0e;T 621af9;1Gb0e;T Carrier Yes 50 Coriell 1 af9;/afa; c.1585-1Gb0e;A 1717-1Gb0e;A Carrier Yes 51 Coriell 1 afa;/afa;e N/Af N/A Normal N/A N/A Dartmouth 9 a af9;/af9;, 2 pathogenic mutations; af9;/afa;, carrier of a single pathogenic mutation; afa;/afa;, absence of any pathogenic mutations. Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
54 In contrast, the estimated total protein levels for E193K-CFTR (177 &#b1; 12% normal CFTR; n = 6), R352Q-CFTR (178 &#b1; 4% normal CFTR; n = 6), and D1152H-CFTR (256 &#b1; 16% normal CFTR; n = 9) were higher (P b 0.05; ANOVA followed by Tukey's least significant difference test) compared with normal CFTR, suggesting that the baseline chloride transport may be overestimated by ~1.8 to 2.6 fold for these three mutant CFTR forms. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
71 This was expected, as the CFTR mutations tested include known or putative CF-causing mutations, as well as CFTR mutations associated with varying clinical consequences (e.g., R668C, F1052V, D1152H) or complex CFTR alleles that may modify disease severity (e.g., S1235R) (www.CFTR2.org) [8,16]. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3. Login to comment

[hide] Defining the disease liability of variants in the ... Nat Genet. 2013 Oct;45(10):1160-7. doi: 10.1038/ng.2745. Epub 2013 Aug 25. Sosnay PR, Siklosi KR, Van Goor F, Kaniecki K, Yu H, Sharma N, Ramalho AS, Amaral MD, Dorfman R, Zielenski J, Masica DL, Karchin R, Millen L, Thomas PJ, Patrinos GP, Corey M, Lewis MH, Rommens JM, Castellani C, Penland CM, Cutting GR
Defining the disease liability of variants in the cystic fibrosis transmembrane conductance regulator gene.
Nat Genet. 2013 Oct;45(10):1160-7. doi: 10.1038/ng.2745. Epub 2013 Aug 25., [PMID:23974870]

Abstract [show]
Allelic heterogeneity in disease-causing genes presents a substantial challenge to the translation of genomic variation into clinical practice. Few of the almost 2,000 variants in the cystic fibrosis transmembrane conductance regulator gene CFTR have empirical evidence that they cause cystic fibrosis. To address this gap, we collected both genotype and phenotype data for 39,696 individuals with cystic fibrosis in registries and clinics in North America and Europe. In these individuals, 159 CFTR variants had an allele frequency of l0.01%. These variants were evaluated for both clinical severity and functional consequence, with 127 (80%) meeting both clinical and functional criteria consistent with disease. Assessment of disease penetrance in 2,188 fathers of individuals with cystic fibrosis enabled assignment of 12 of the remaining 32 variants as neutral, whereas the other 20 variants remained of indeterminate effect. This study illustrates that sourcing data directly from well-phenotyped subjects can address the gap in our ability to interpret clinically relevant genomic variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
137 In addition to these ten variants, c.1210-12(7) (legacy name 7T) had already been reported to be non-penetrant48 and was identified as a second variant in numerous fathers, and a twelfth variant, p.Ile1027Thr, was deemed 159 variants ࣙ0.01% frequency in CFTR2 127 variants meet clinical and functional criteria Clinical and functional analysis 13 variants meet neither criteria 14 variants 5 variants 7 variants 6 variants Evidence of non-penetrance No evidence of non-penetrance 19 variants meet clinical or functional criteria 127 variants are CF causing 12 variants are non CF causing 20 variants are indeterminate p.Arg117HisߤC p.Arg75Gln p.Gly576Alaߤ p.Arg668Cys ߤ p.Met470Val C p.IIe1027Thr ߤC p.Val754Met ߤC p.IIe148Thr ߤC p.Arg31Cys C p.Ser1235Arg ߤ p.Leu997Phe ߤ p.Arg1162Leu p.Leu227Arg F p.Gln525* F p.Leu558SerC p.Asp614Gly C c.2657+2_2657+3insA C c.1418delG F c.1210-12(7) ߤ p.Arg1070Gln C p.Asp1270Asn ߤC p.[Gln359Lys; Thr360Lys] p.Gly1069Argߤ p.Asp1152His p.Phe1052Val c.1210-12(5) p.Arg74Trpߤ p.IIe1234Val ߤC p.Arg1070Trp ߤF p.Ser977Phe F p.Asp579Gly C p.Tyr569Asp F Penetrance analysis Figure 4ߒ Assignment of disease liability to the 159 most frequent CFTR variants using three criteria. Login to comment
147 Included among the variants meeting neither clinical nor functional criteria are those that have previously been associated with variable penetrance (such as p.Asp1152His), variants that have been reported as part of complex alleles in which the disease liability of each variant individually could not be determined (such as the pair p.Arg74Trp and p.Asp1270Asn) and variants with incomplete clinical or functional analysis. Login to comment

[hide] Does extensive genotyping and nasal potential diff... Thorax. 2014 Mar;69(3):254-60. doi: 10.1136/thoraxjnl-2013-203832. Epub 2013 Oct 21. Ooi CY, Dupuis A, Ellis L, Jarvi K, Martin S, Ray PN, Steele L, Kortan P, Gonska T, Dorfman R, Solomon M, Zielenski J, Corey M, Tullis E, Durie P
Does extensive genotyping and nasal potential difference testing clarify the diagnosis of cystic fibrosis among patients with single-organ manifestations of cystic fibrosis?
Thorax. 2014 Mar;69(3):254-60. doi: 10.1136/thoraxjnl-2013-203832. Epub 2013 Oct 21., [PMID:24149827]

Abstract [show]
BACKGROUND: The phenotypic spectrum of cystic fibrosis (CF) has expanded to include patients affected by single-organ diseases. Extensive genotyping and nasal potential difference (NPD) testing have been proposed to assist in the diagnosis of CF when sweat testing is inconclusive. However, the diagnostic yield of extensive genotyping and NPD and the concordance between NPD and the sweat test have not been carefully evaluated. METHODS: We evaluated the diagnostic outcomes of genotyping (with 122 mutations included as disease causing), sweat testing and NPD in a prospectively ascertained cohort of undiagnosed patients who presented with chronic sino-pulmonary disease (RESP), chronic/recurrent pancreatitis (PANC) or obstructive azoospermia (AZOOSP). RESULTS: 202 patients (68 RESP, 42 PANC and 92 AZOOSP) were evaluated; 17.3%, 22.8% and 59.9% had abnormal, borderline and normal sweat chloride results, respectively. Only 17 (8.4%) patients were diagnosable as having CF by genotyping. Compared to sweat testing, NPD identified more patients as having CF (33.2%) with fewer borderline results (18.8%). The level of agreement according to kappa statistics (and the observed percentage of agreement) between sweat chloride and NPD in RESP, PANC and AZOOSP subjects was 'moderate' (65% observed agreement), 'poor' (33% observed agreement) and 'fair' (28% observed agreement), respectively. The degree of agreement only improved marginally when subjects with borderline sweat chloride results were excluded from the analysis. CONCLUSIONS: The diagnosis of CF or its exclusion is not always straightforward and may remain elusive even with comprehensive evaluation, particularly among individuals who present at an older age with single-organ manifestations suggestive of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 ߤ14/24 (58%) were not identified with two CF-causing mutations: 12 carried one CF-causing mutation (DF508/-(x5); DF508/5 T (x3); DF508/D1152H; R75X/V456A; 1717-1G>A/Q1291H; 1717-1G>A/5 T) and two had no CF-causing mutation (D579G/D579G; -/-). Login to comment

[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]

Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 The variants D1152H (4.0%) and L206W (2.4%), each associated with a variable CF phenotype, were the most common variants not present on the ACMG/ACOG 23-mutation panel. Login to comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment
86 Two variants, L206W and D1152H, accounted for 19.1% of the mutant alleles detected in this ethnic group. Login to comment
99 Several alleles not found on the ACMG/ACOG panel were found at relatively high frequency (Table 2), including D1152H (4.0%), L206W (2.4%), c.3744delA (0.9%), F311del (0.8%), R117C (0.7%), and S549N (0.6%). Login to comment
118 Two variants, D1152H and L206W, account for 19.1% of all mutations identified in the Hispanic group and deserve special attention. Login to comment
121 Strom et al.7 advocate against adding these variants to CF panels, stating that detection of D1152H and L206W during carrier screening may increase the rate of pregnancy termination among parents who fear having a child with classic CF, not to mention inflating the mutation detection rate among Hispanic Americans.7 It is acknowledged now in the literature that the D1152H variant belongs to both the CF-causing and CFTR-related disorder groups,19-21 and, in conjunction with an established CF-causing mutation, it could still manifest as typical CF.19,22 Burgel et al.23 studied 42 patients with D1152H mutations and reported that the variant, in conjunction with a CF-causing mutation, can cause significant pulmonary disease, albeit with longer survival. Login to comment
122 One of the authors of this article observedsimilarresults(K.J.F.,unpublisheddata).Sosnayetal.24 did not find enough evidence for the D1152H variant to meet clinical and functional criteria consistent with disease and hence categorized the variant as indeterminate. Login to comment
124 Even without the D1152H variant, the use of the 69-mutation panel will improve the detection rate for the Hispanic population by 22.2% (P < 0.04). Login to comment

[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]

Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

[hide] CFTR mutations spectrum and the efficiency of mole... PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014. Zietkiewicz E, Rutkiewicz E, Pogorzelski A, Klimek B, Voelkel K, Witt M
CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.
PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014., [PMID:24586523]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Three of them (R352Q, Q359R and D1152H) were in a compound heterozygosity with F508del, six (E217G, I506, V562L, G723V, D924N and L967S) had no accompanying mutation in trans. Login to comment
101 The more recent estimates provide much lower values, ranging from 1:5000 [14], 1:6000 cited in WHO 2002 report [15] to 1:7500 for Southeastern Poland estimated for a 1-year period of Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 15 17 L967S 0.27 c.2900T.C 3032T.C 1 CFMDB; rs1800110 unknown 18 21 D1152H 0.50 c.3454G.C 3586G.C 1 CFMDB; rs75541969 F508del Sequence changes considered as lacking pathogenic effect 4 4 I148T 2.04 c.443T.U 575T.U 4 IL19e unknown 13 14 I752V 0.35 c.2254A.G 2386A.G 1 Novelf F508 15 17 S912L 2.12 c.2735C.T 2867C.T 1 CFMDBg ; rs121909034 F508 Legend: a IL19 i 17 - mutations included in the INNOLiPA tests (see below); CFMDB - non-INNOLiPA mutations present in the CTFR mutation database; novel - mutations first reported in this study; b in three chromosomes R668C with G576A in trans; c F508del, c.1585-1G.A, G542X, N1303K or c.579+3A.G; d F508del, G542X, R553X or N1303K; e not pathogenic if not in cis with c.3067-72del6 (l.n.3199del6); f not pathogenic - see explanation the text; g not pathogenic if not in cis with G1244V. Login to comment

[hide] Challenging the diagnosis of cystic fibrosis in a ... BMC Pulm Med. 2014 Mar 13;14:44. doi: 10.1186/1471-2466-14-44. Caldrer S, Verze G, Johansson J, Sorio C, Angiari C, Buffelli M, Assael BM, Melotti P
Challenging the diagnosis of cystic fibrosis in a patient carrying the 186-8T/C allelic variant in the CF transmembrane conductance regulator gene.
BMC Pulm Med. 2014 Mar 13;14:44. doi: 10.1186/1471-2466-14-44., [PMID:24621136]

Abstract [show]
BACKGROUND: This report describe for the first time a clinical case with a CFTR allelic variant 186-8T/C (c.54-8 T/C) in intron 1 of CFTR and underline the importance of applying a combination of genetic and functional tests to establish or exclude a diagnosis of Cystic Fibrosis. In this case the diagnostic algorithm proposed for CF has been successfully applied at our Center and previous CF diagnosis assigned in a different Center was not confirmed. CASE PRESENTATION: A 38 year-old Italian woman had been treated as affected by CF since 2010, following diagnosis based on sweat tests (reported values of 73 and 57 mEq/L) and a clinical history consistent with CF. No mutations were identified by first level of genetic analysis. Afterwards the patient referred to our center for assessing the relevance of these findings. The genetic variant 186-8T/C (c.54-8 T/C) in intron 1 of the CFTR gene was detected by sequencing. Low-level interstitial-alveolar infiltration was recorded by high-resolution computerized tomography. Lung function was normal and sputum and Broncho Alveolar Lavage cultures resulted bacteriologically negative. Sweat chloride levels was re-assessed and resulted with values of 57 and 35 mEq/L, with a borderline range between 40 and 60 mEq/L. Nasal Potential Difference measurements resulted in three reliable measurements consistent with a non-CF phenotype. Differential diagnosis with ciliary dyskinesia was excluded, as was exon 2 skipping of CFTR gene that might have caused a CFTR functional defect. Furthermore, single cell fluorescence analysis in response to cAMP agonists performed in patient's monocytes overlapped those obtained in healthy donors. CONCLUSION: We concluded that this patient was not affected by CF. This case highlights the need for referrals to highly specialized centers and the importance of combined functional and genetic tests in making a correct diagnosis. Moreover, we confirmed a correlation between NPD tracings and cell depolarization in monocytes providing a rationale for proposing the use of leukocytes as a potential support for CF diagnosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 It is known that Normal and borderline sweat tests were obtained in CF patients in the presence of specific CFTR genotypes: the most representative includes mutations 3849 + 10 kb C > T, D1152H and R117H [12,13]. Login to comment

[hide] Genetics of cystic fibrosis: CFTR mutation classif... Int J Biochem Cell Biol. 2014 Jul;52:94-102. doi: 10.1016/j.biocel.2014.02.023. Epub 2014 Mar 12. Fanen P, Wohlhuter-Haddad A, Hinzpeter A
Genetics of cystic fibrosis: CFTR mutation classifications toward genotype-based CF therapies.
Int J Biochem Cell Biol. 2014 Jul;52:94-102. doi: 10.1016/j.biocel.2014.02.023. Epub 2014 Mar 12., [PMID:24631642]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes an epithelial anion channel. Since the identification of the disease in 1938 and up until 2012, CF patients have been treated exclusively with medications aimed at bettering their respiratory, digestive, inflammatory and infectious symptoms. The identification of the CFTR gene in 1989 gave hopes of rapidly finding a cure for the disease, for which over 1950 mutations have been identified. Since 2012, recent approaches have enabled the identification of small molecules targeting either the CFTR protein directly or its key processing steps, giving rise to novel promising therapeutic tools. This review presents the current CFTR mutation classifications according to their clinical consequences and to their effect on the structure and function of the CFTR channel. How these classifications are essential in the establishment of mutation-targeted therapeutic strategies is then discussed. The future of CFTR-targeted treatment lies in combinatory therapies that will enable CF patients to receive a customized treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 For example, the p.Asp1152His mutation may result in isolated congenital bilateral absence of the vas deferens (CBAVD), or in a fully expressed CF lung disease with pancreatic sufficiency. Login to comment

[hide] CFTR functional measurements in human models for d... J Cyst Fibros. 2014 Jul;13(4):363-72. doi: 10.1016/j.jcf.2014.05.007. Epub 2014 Jun 2. Beekman JM, Sermet-Gaudelus I, de Boeck K, Gonska T, Derichs N, Mall MA, Mehta A, Martin U, Drumm M, Amaral MD
CFTR functional measurements in human models for diagnosis, prognosis and personalized therapy: Report on the pre-conference meeting to the 11th ECFS Basic Science Conference, Malta, 26-29 March 2014.
J Cyst Fibros. 2014 Jul;13(4):363-72. doi: 10.1016/j.jcf.2014.05.007. Epub 2014 Jun 2., [PMID:24882694]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 Further, based solely on QPIT, patients carrying certain CFTR mutations such as 3849+10kbCNT or D1152H may not be identified as CF [15,16]. Login to comment
73 As shown earlier, the b2;-adrenergic sweat secretion was half-maximal in heterozygotes when compared to healthy controls and completely absent in all CF patients including those with 3849+10kbCNT or D1152H and normal sweat Cl- results. Login to comment

[hide] Increasing nontuberculous mycobacteria infection i... J Cyst Fibros. 2015 Jan;14(1):53-62. doi: 10.1016/j.jcf.2014.05.008. Epub 2014 Jun 7. Bar-On O, Mussaffi H, Mei-Zahav M, Prais D, Steuer G, Stafler P, Hananya S, Blau H
Increasing nontuberculous mycobacteria infection in cystic fibrosis.
J Cyst Fibros. 2015 Jan;14(1):53-62. doi: 10.1016/j.jcf.2014.05.008. Epub 2014 Jun 7., [PMID:24917112]

Abstract [show]
BACKGROUND: Nontuberculous mycobacteria (NTM) are emerging infections in the CF population. AIMS: To assess NTM infection prevalence and associated features in our CF clinic population. METHODS: Patient records, 2002-2011, were reviewed for NTM infection. FEV1, pancreatic function, sputum microbiology, and serum cytokines were compared in patients with and without NTM infection. RESULTS: Incidence rate of NTM infection increased from 0 in 2002 to 8.7% in 2011 (p<0.001). NTM infection prevalence increased 3-fold from 5% (4/79) in 2003 to 14.5% (16/110) in 2011 (p=0.05). Prevalence of chronic NTM lung disease has decreased somewhat since a peak in 2009, with institution of aggressive triple therapy. Of NTM-infected compared to uninfected patients, 88.2% vs. 60.3% had a known 'severe' CFTR genotype (p=0.04), 88.2% vs. 58.9% were pancreatic insufficient (p=0.02); 70.6% vs. 43.8% had chronic Pseudomonas aeruginosa (p=0.06); 75% vs. 32% had Aspergillus infection (p=0.007) and 23.5% vs 2.7% had allergic bronchopulmonary aspergillosis (p=0.01). Patients infected with Mycobacterium abscessus had increased TGF-beta, TNF-alpha, IL-1beta, IL-2, IL-4 and IL-5 levels (p<0.05). There was no difference in cytokine levels for all NTM infected compared to uninfected patients. M. abscessus comprised 46% of all NTM infections. Comparing M. abscessus versus other NTM, duration was 10.5 (1-118) months versus 1 (1-70) month, median (range) (p=0.004); lung disease occurred in 69% versus 17% (p=0.0004), with sputum conversion in 4/11 versus 5/6, respectively (NS). CONCLUSIONS: NTM incidence and prevalence have increased dramatically in our CF clinic, associated with a severe CF genotype and phenotype. M. abscessus, the most prevalent NTM, caused prolonged infection despite therapy. There has been some decrease in the prevalence of NTM lung disease since 2009.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 The most frequent CFTR mutations in our cohort were W1282X, ƊF508, G542X, D1152H, 3849 + 10kbC࢐T. Login to comment

[hide] Genetics and treatment options for recurrent acute... Curr Treat Options Gastroenterol. 2014 Sep;12(3):359-71. doi: 10.1007/s11938-014-0022-y. Shelton CA, Whitcomb DC
Genetics and treatment options for recurrent acute and chronic pancreatitis.
Curr Treat Options Gastroenterol. 2014 Sep;12(3):359-71. doi: 10.1007/s11938-014-0022-y., [PMID:24954874]

Abstract [show]
OPINION STATEMENT: Worldwide research efforts demonstrate a major role of gene-environment interactions for the risk, development, and progression of most pancreatic diseases, including recurrent acute and chronic pancreatitis. New findings of pancreas disease-associated risk variants have been reported in the CPA1, GGT1, CLDN2, MMP1, MTHFR, and other genes. These risk genes and their regulatory regions must be added to the known pathogenic variants in the PRSS1, SPINK1, CFTR, CTRC, CASR, UBR1, SBDS, CEL, and CTSB genes. This new knowledge promises to improve disease management and prevention through personalized medicine. At the same time, however, knowledge of an increasing number of pathogenic variants, and their complicated effects when present in combination, results in increasing difficulty in interpretation and development of recommendations. Direct-to-consumer marketing of genetic testing results also adds complexity to disease management paradigms, especially without interpretation and, in many cases, proven accuracy. While improvements in the ability to rapidly and accurately interpret complex genetic tests are clearly needed, some results, such as pathogenic CFTR variants, including a new class of bicarbonate-defective mutations, and PRSS1 variants have immediate implications that direct management. In addition, discovery of pancreatitis-associated genetic variants in patients with glucose intolerance may suggest underlying type 3c diabetes, which also has implications for treatment and disease management.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 Members of the CFTR bicarbonate-defective genetic variants (CFTRBD ) include R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N [23ߦߦ, 25]. Login to comment

[hide] Mechanisms of CFTR functional variants that impair... PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul. LaRusch J, Jung J, General IJ, Lewis MD, Park HW, Brand RE, Gelrud A, Anderson MA, Banks PA, Conwell D, Lawrence C, Romagnuolo J, Baillie J, Alkaade S, Cote G, Gardner TB, Amann ST, Slivka A, Sandhu B, Aloe A, Kienholz ML, Yadav D, Barmada MM, Bahar I, Lee MG, Whitcomb DC
Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.
PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul., [PMID:25033378]

Abstract [show]
CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Login to comment
62 Of 43 CFTR variants identified in the NAPS2 cohort (Table 1), nine not associated with typical CF but reported in patients with pancreatitis[25-29] were of particular interest: R74Q, R75Q, R117H (CFTRm-v only when in cis with IVS8-T5[30]; R117H*T5), R170H, L967S, L997F, D1152H, S1235R, and D1270N. Login to comment
95 CFTR variant %Cases %Uctrls OR p-value %Cases w/N34S OR w/N34S p-value w/N34S CF/BD or BD/BD 2.5 0.1 31.9 ,0.0001 5.5 7.46 0.12 All CF 8.7 3.3 2.76 ,0.0001 16.4 5.65 ,0.0001 F508del CF 6.9 3.1 2.32 ,0.0001 14.5 5.13 ,0.0001 IVS8T5** CF 9.9 8.2 1.24 0.079 10.9 1.37 0.47 2789+5G.A CF 0.3 0.0 0.028 0.0 3849+10kbC.T CF 0.3 0.0 0.028 0.0 N1303K CF 0.3 0.0 0.027 0.0 621+1G.T CF 0.1 0.0 0.13 1.8 ,0.0001 2184delA CF 0.1 0.0 0.13 0.0 3120+1G.A CF 0.1 0.0 0.13 0.0 G551D CF 0.2 0.1 2.50 0.20 0.0 0.00 0.83 W1282X CF 0.2 0.1 2.50 0.20 0.0 0.00 0.83 G542X CF 0.2 0.0 0.059 0.0 R1162X CF 0.1 0.0 0.13 0.0 2183AA.G CF 0.0 0.1 0.17 0.0 0.00 0.83 All BD 14.2 9.8 1.50 0.002 25.5 4.63 ,0.0001 R75Q BD 6.3 6.2 1.02 0.30 16.4 2.97 0.003 S1235R BD 2.4 1.4 1.69 0.052 1.8 1.30 0.80 R117H CF/BD 2.3 0.7 3.49 0.0007 5.5 8.74 0.0002 L967S BD 1.1 0.2 6.87 0.002 1.8 11.17 0.014 L997F BD 0.8 1.0 0.82 0.26 1.8 1.84 0.55 D1152H BD 0.4 0.0 0.014 0.0 D1270N BD 0.3 0.2 1.25 0.29 0.0 0.00 0.71 R170H BD 0.3 0.0 0.028 0.0 R74Q BD 0.3 0.1 3.02 0.17 1.8 21.15 0.002 Other M470V 76.1 74.2 1.11 0.14 70.9 0.85 0.59 T854T 57.3 57.8 0.98 0.29 45.5 0.61 0.071 Q1463Q 39.6 39.5 1.01 0.30 40.0 1.02 0.94 1001+11C.T* 13.4 10.9 1.27 0.016 14.5 1.40 0.42 125G.C 10.3 9.7 1.07 0.26 12.7 1.36 0.45 P1290P 7.6 7.9 0.95 0.28 7.3 0.91 0.86 1716G.A 4.5 4.1 1.10 0.26 1.8 0.43 0.39 R668C 1.0 1.4 0.72 0.19 0.0 0.00 0.38 G576A 0.7 1.2 0.58 0.11 0.0 0.00 0.41 computationally modeled the molecular structure, and studied the dynamics, of wild type (WT) and mutated CFTR channels. Login to comment
102 MD simulations comparing the channel diameters of the WT and mutants L997F and D1152H (Figure 2c-f) demonstrate that the channel diameter is observed to narrow down from an average value of 10.3 A da; to 7.5 A da; (standard deviation, s = 0.5 A da; ) at the pore region, near the L997F amino acid substitution (Figure 2e), and from an average of 9.9 A da; to 4.3 A da; (s = 1.1 A da; ) for the CFTRBD mutant D1152H (Figure 2f). Login to comment
103 Note that in contrast to the WT CFTR and L997F mutant where the structure maintains its stability, the D1152H mutation induces significant fluctuations in local conformation, which are reflected on the changes in the pore diameter at this location within the channel. Login to comment
124 We identified the R75Q, R117H, L967S, L997F, D1152H, and S1235R CFTRBD variants as well as CFTRCF -associated variants (e.g., F508del, G542X) in cases with rhinosinusitis. Login to comment
188 Panel c shows the charge distribution around D1152H: this negatively charged residue (left; shown in red space-filling representation) is surrounded by several positively charged residues (green), especially on its side of the cavity, creating an attractive force that keeps the residue from extending into the cavity. Login to comment
190 Panel d shows the corresponding scene for the variant residue, D1152H (cyan), which can move toward the center of the cavity, thus leading to a constriction in the channel diameter. Login to comment
192 On panel f, the same information for the WT and variant D1152H is shown. Login to comment
199 Although located in a critical portion of the CFTR molecule, the association and functional threshold for inclusion as a CFTRBD variant were not fully met. Two variants (L997F and D1152H) appeared to reduce channel diameter. Login to comment
202 D1152H is a mutation of varying clinical consequence for CF and is associated with low rates of pancreatic insufficiency and retention of chloride conductance [53]. Login to comment
203 CFTR D1152H was identified in four cases and no controls (p = 0.014). Login to comment
237 In particular, the L997F and D1152H mutants showed channel pore size reductions in their neighborhoods that would directly affect conductance properties. Login to comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment
309 Using this model for WT CFTR, we generated in silico models for the mutants L997F and D1152H. Login to comment

[hide] Comprehensive CFTR gene analysis of the French cys... Genet Med. 2015 Feb;17(2):108-16. doi: 10.1038/gim.2014.113. Epub 2014 Aug 14. Audrezet MP, Munck A, Scotet V, Claustres M, Roussey M, Delmas D, Ferec C, Desgeorges M
Comprehensive CFTR gene analysis of the French cystic fibrosis screened newborn cohort: implications for diagnosis, genetic counseling, and mutation-specific therapy.
Genet Med. 2015 Feb;17(2):108-16. doi: 10.1038/gim.2014.113. Epub 2014 Aug 14., [PMID:25122143]

Abstract [show]
PURPOSE: Newborn screening (NBS) for cystic fibrosis (CF) was implemented throughout France in 2002. It involves a four-tiered procedure: immunoreactive trypsin (IRT)/DNA/IRT/sweat test [corrected] was implemented throughout France in 2002. The aim of this study was to assess the performance of molecular CFTR gene analysis from the French NBS cohort, to evaluate CF incidence, mutation detection rate, and allelic heterogeneity. METHODS: During the 8-year period, 5,947,148 newborns were screened for cystic fibrosis. The data were collected by the Association Francaise pour le Depistage et la Prevention des Handicaps de l'Enfant. The mutations identified were classified into four groups based on their potential for causing disease, and a diagnostic algorithm was proposed. RESULTS: Combining the genetic and sweat test results, 1,160 neonates were diagnosed as having cystic fibrosis. The corresponding incidence, including both the meconium ileus (MI) and false-negative cases, was calculated at 1 in 4,726 live births. The CF30 kit, completed with a comprehensive CFTR gene analysis, provides an excellent detection rate of 99.77% for the mutated alleles, enabling the identification of a complete genotype in 99.55% of affected neonates. With more than 200 different mutations characterized, we confirmed the French allelic heterogeneity. CONCLUSION: The very good sensitivity, specificity, and positive predictive value obtained suggest that the four-tiered IRT/DNA/IRT/sweat test procedure may provide an effective strategy for newborn screening for cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Some molecular defects that could belong to either the CF-causing group or the CFTR-related disorders group (group A/B) were reported in patients presenting a broad spectrum of phenotypes from classic CF to mild monosymptomatic presentations.16 These are four missense mutations (p.Leu206Trp (L206W), p.Arg347His (R347H), p.Asp1152His (D1152H), and p.Ser945Leu (S945L)) and three splice mutations (c.2657+5G>A (2789+5G>A), c.3718-2477C>T (3849+10kbC>T), and c.1210-34TG(13);1210-12T(5) (TG13T5)). Login to comment

[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]

Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 The molecular analysis of the CFTR gene revealed that the two Table 1 Number of subjects tested who were carriers of the cystic fibrosis transmembrane regulator gene Mutation Men Women Total G551D 1 2 3 R553X 0 1 1 F508del 35 32 67 N1303K 7 8 15 I148T 4 9 13 G542X 3 6 9 DI507 2 0 2 L1077P 0 2 2 D1152H 1 6 7 W1282X 2 0 2 2183 AA>G 3 0 3 1259insA 0 1 1 4016insT 1 0 1 I507del 1 0 1 2789+5G>A 1 0 1 4382delA 0 2 2 G1244E 1 0 1 621+3A>G 1 0 1 Total 63 69 132 Figure 1 76 patients with cystic fibrosis and positive sweat test, all have two genes mutated. Login to comment
59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17]. Login to comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

[hide] The p.Gly622Asp (G622D) mutation, frequently found... J Cyst Fibros. 2015 May;14(3):305-9. doi: 10.1016/j.jcf.2014.11.001. Epub 2014 Nov 28. Marion H, Natacha G, Brigitte M, Francois C, Michel R, Corinne T, Emmanuelle G, Thierry B
The p.Gly622Asp (G622D) mutation, frequently found in Reunion Island and in black populations, is associated with a wide spectrum of CF and CFTR-RD phenotypes.
J Cyst Fibros. 2015 May;14(3):305-9. doi: 10.1016/j.jcf.2014.11.001. Epub 2014 Nov 28., [PMID:25443471]

Abstract [show]
Examination of genotype-phenotype correlations along with functional evaluation of CFTR mutations may not be straightforward. The c.1865G>A, p.Gly622Asp (G622D), located at the NBD1 C terminus of the CFTR protein, was initially reported in patients with male infertility. However, the substitution of Gly622 by an aspartic acid in vitro would perturb the local structure or even affect the CFTR folding itself. In order to determine whether p.Gly622Asp affects the risk of developing a CFTR-Related disorder (CFTR-RD) or cystic fibrosis (CF), we analyzed the phenotype of subjects bearing the p.Gly622Asp mutation. We report molecular and clinical analyses in eleven unrelated patients with CF or CFTR-RD with compound heterozygosity for the p.Gly622Asp mutation. On the basis of the clinical features presented by the eleven patients, we postulate that the p.Gly622Asp might be associated with a wide spectrum of phenotypes including classical cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 Other CFTR mutations have been associated with a large spectrum of phenotypes, such as c.3454G N C, p.Asp1152His (D1152H), c.617T N G, p.Leu206Trp (L206W), c.579 + 3A N G (621 + 3A N G). Login to comment

[hide] Clinical expression of patients with the D1152H CF... J Cyst Fibros. 2015 Jul;14(4):447-52. doi: 10.1016/j.jcf.2014.12.012. Epub 2015 Jan 10. Terlizzi V, Carnovale V, Castaldo G, Castellani C, Cirilli N, Colombo C, Corti F, Cresta F, D'Adda A, Lucarelli M, Lucidi V, Macchiaroli A, Madarena E, Padoan R, Quattrucci S, Salvatore D, Zarrilli F, Raia V
Clinical expression of patients with the D1152H CFTR mutation.
J Cyst Fibros. 2015 Jul;14(4):447-52. doi: 10.1016/j.jcf.2014.12.012. Epub 2015 Jan 10., [PMID:25583415]

Abstract [show]
BACKGROUND: Discordant results were reported on the clinical expression of subjects bearing the D1152H CFTR mutation, and also for the small number of cases reported so far. METHODS: A retrospective review of clinical, genetic and biochemical data was performed from individuals homozygous or compound heterozygous for the D1152H mutation followed in 12 Italian cystic fibrosis (CF) centers. RESULTS: 89 subjects carrying at least D1152H on one allele were identified. 7 homozygous patients had very mild clinical expression. Over half of the 74 subjects compound heterozygous for D1152H and a I-II-III class mutation had borderline or pathological sweat test and respiratory or gastrointestinal symptoms; one third had pulmonary bacteria colonization and 10/74 cases had complications (i.e. diabetes, allergic bronchopulmonary aspergillosis, and hemoptysis). However, their clinical expression was less severe as compared to a group of CF patients homozygous for the F508del mutation. Finally, 8 subjects compound heterozygous for D1152H and a IV-V class mutation showed very mild disease. CONCLUSIONS: The natural history of subjects bearing the D1152H mutation is widely heterogeneous and is influenced by the mutation in trans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Original Article Clinical expression of patients with the D1152H CFTR mutation Vito Terlizzi a , Vincenzo Carnovale b , Giuseppe Castaldo c,d , Carlo Castellani e , Natalia Cirilli f , Carla Colombo g , Fabiola Corti g , Federico Cresta h , Alice D'Adda g , Marco Lucarelli i , Vincenzina Lucidi j , Annamaria Macchiaroli k , Elisa Madarena l , Rita Padoan m , Serena Quattrucci n , Donatello Salvatore o , Federica Zarrilli p , Valeria Raia a,Ìe; a Dipartimento di Scienze Mediche Traslazionali, Sezione di Pediatria, Universit&#e0; di Napoli Federico II, Naples, Italy b Centro Fibrosi Cistica Adulti, Dipartimento di Scienze Traslazionali, Universit&#e0; di Napoli Federico II, Naples, Italy c CEINGE-Biotecnologie avanzate, Naples, Italy d Dipartimento di Medicina Molecolare e Biotecnologie Mediche, Universit&#e0; di Napoli Federico II, Naples, Italy e Centro Fibrosi Cistica, Azienda Ospedaliera Universitaria Integrata, Verona, Italy f Centro Regionale Fibrosi Cistica, Dipartimento Materno-Infantile, Ospedali Riuniti Ancona, Ancona, Italy g Centro Fibrosi Cistica, Fondazione IRCCS Ca' Granda, Ospedale Maggiore Policlinico, Milano, Italy h Centro Fibrosi Cistica, Dipartimento di Pediatria, IRCCS G. Gaslini, Genova, Italy i Dipartimento di Biotecnologie Cellulari ed Ematologia, Istituto Pasteur Fondazione Cenci Bolognetti, Sapienza Universit&#e0; e Policlinico Umberto I, Rome, Italy j Unit&#e0; di Fibrosi Cistica, IRCCS Ospedale Pediatrico Bambin Ges&#f9;, Rome, Italy k Centro Regionale Fibrosi Cistica, Ospedale Cardarelli, Campobasso, Italy l Centro Fibrosi Cistica, Ospedale Giovanni Paolo II, Lamezia, Italy m Centro di supporto Fibrosi Cistica, Dipartimento di Pediatria, Universit&#e0; di Brescia, Brescia, Italy n Dipartimento di Pediatria, Centro Fibrosi Cistica, Sapienza Universit&#e0; e Policlinico Umberto I, Rome, Italy o Centro Fibrosi Cistica, Centro Pediatrico Bambino Ges&#f9; Basilicata, AOR San Carlo, Potenza, Italy p Dipartimento di Bioscienze e Territorio, Universit&#e0; del Molise, Isernia, Italy Received 4 September 2014; revised 17 December 2014; accepted 18 December 2014 Available online 10 January 2015 Abstract Background: Discordant results were reported on the clinical expression of subjects bearing the D1152H CFTR mutation, and also for the small number of cases reported so far. Login to comment
1 Methods: A retrospective review of clinical, genetic and biochemical data was performed from individuals homozygous or compound heterozygous for the D1152H mutation followed in 12 Italian cystic fibrosis (CF) centers. Login to comment
2 Results: 89 subjects carrying at least D1152H on one allele were identified. Login to comment
4 Over half of the 74 subjects compound heterozygous for D1152H and a I-II-III class mutation had borderline or pathological sweat test and respiratory or gastrointestinal symptoms; one third had pulmonary bacteria colonization and 10/74 cases had complications (i.e. diabetes, allergic bronchopulmonary Abbreviations: CF, cystic fibrosis; CFTR, cystic fibrosis transmembrane conductance regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency; CFTR-RD, CFTR related disorders; CBAVD, congenital bilateral absence of vas deferens; SC, sweat chloride; W, weight; pc, percentile; H, height; BMI, body mass index; FEV1, forced expiratory volume in 1 s; PA, Pseudomonas aeruginosa; BC, Burkholderia cepacia; SM, Stenotrophomonas malthophilia; SA, Staphylococcus aureus; MRSA, methicillin resistant Staphylococcus aureus; CFRD, cystic fibrosis related diabetes; CFLD, CF-associated liver disease; ABPA, allergic bronchopulmonary aspergillosis; MI, meconium ileus; DIOS, distal intestine obstruction syndrome; NBS, newborn screening. Login to comment
12 Finally, 8 subjects compound heterozygous for D1152H and a IV-V class mutation showed very mild disease. Login to comment
13 Conclusions: The natural history of subjects bearing the D1152H mutation is widely heterogeneous and is influenced by the mutation in trans. Login to comment
15 Keywords: Cystic fibrosis; D1152H; Neonatal screening; Genotype/phenotype 1. Login to comment
23 The D1152H mutation (p.Asp1152His) is a class IV mutation causing the production of an abnormal CFTR protein that is only partially activated by cAMP, consequently it is associated to some CFTR protein residual activity [11]. Login to comment
24 Initially, D1152H was associated to a congenital bilateral absence of vas deferens (CBAVD) or to CF with late onset pulmonary disease and borderline or normal sweat chloride values [12,13]. Login to comment
27 In 2011 a higher frequency of the D1152H mutation was detected in individuals referred for symptoms suggestive of CF compared with healthy individuals included in a CF carrier screening program [15]. Login to comment
28 Recently, the D1152H mutation was included in a list of nine CFTR mutations associated to a higher risk of pancreatitis but not of CF [16]. Login to comment
29 Finally, the CFTR2 database considered D1152H as a mutation with variable penetrance, i.e., the D1152H in trans with a CF-causing mutation may or may not cause CF (http://www.http. com//www.cftr2). Login to comment
30 Thus, the data so far available about phenotypes associated to D1152H were obtained in small numbers of subjects. Login to comment
31 So the primary aim of our study is to describe the clinical course of a large cohort of patients bearing the D1152H mutation in trans with different class mutations. Login to comment
34 A descriptive study was designed to include patients either homozygous or compound-heterozygous for the D1152H CFTR mutation (89 cases). Login to comment
53 Results 89 subjects carrying at least one D1152H mutation were identified (Table 1): 7 were homozygous (median age: 20 years, range: 4-47 years) and 82 were compound heterozygous for other mutations (median age: 15 years, range: 1-68 years). Login to comment
54 Among the latter, 74/82 (median age 13 years, range: 1-68 years) patients were compound heterozygous for D1152H and a class I-II-III mutation, while 8/82 (median age 10 years, range: 2-47 years) patients were compound heterozygous for D1152H and a class IV-V mutation. Login to comment
55 Linkage analysis using 7 intragenic short tandem repeats [30] performed on 49/89 patients excluded the recurrent origin of the D1152H mutation. Login to comment
57 Homozygous patients for D1152H b10 years 2/7 patients homozygous for the D1152H mutation were 10 years old or less (4 and 5 years old, respectively). Login to comment
61 Homozygous patients for D1152H N10 years 5/7 patients homozygous for the D1152H mutation were N10 years old (median age: 36 years; range: 13 to 47 years old). Login to comment
67 Compound heterozygous patients with a class I-II-III mutation b10 years 25/74 patients compound heterozygous for D1152H and a class I-II-III mutation were 10 years old or less (median age: 5 years; range: 1-9 years). Login to comment
75 Compound heterozygous patients with a class I-II-III mutation N10 years 49/74 patients compound heterozygous for D1152H and a class I-II-III mutation were N10 years old (median age: 35 years; range: 12-68 years). Login to comment
82 Compound heterozygous patients with a class IV-V mutation b10 years 4/8 patients compound heterozygous for D1152H and a class IV-V mutation had 10 years or less (median age: 4.5 years; range: 2-8 years). Login to comment
84 Only 1 patient had SC in the Table 1 Genetic analysis of 91 patients with D1152H mutation. Login to comment
85 Legacy name Protein name CDNA name Patients Homozygous for the D1152Ha D1152H p.Asp1152His c.3454GNC 7 Compound heterozygous for class I-II-III mutationsa : 74 F508del p.Phe508del c.1521_1523delCTT 43 G542X p.Gly542X c.1624GNT 7 N1303K p.Asn1303Lys c.3909CNG 4 1717-1GNA No protein name c.1585-1GNA 4 R1158X p.Arg1158X c.3472CNT 4 2183AANG p.Lys684SerfsX38 c.2051_2052delAAinsG 2 W1282X p.Trp1282X c.3846GNA 2 711 + 1GNT No protein name c.579 + 1GNT 1 Y849X p.Tyr849X c.2547CNA 1 L1065P p.Leu1065Pro c.3194 TNC 1 4016insT p.Ser1297PhefsX5 c.3884_3885insT 1 R1066H p.Arg1066His c.3197GNA 2 R1066C p.Arg1066Cys c.3196CNT 1 4382delA p.Glu1418ArgfsX14 c.4251delA 1 Compound heterozygous for class IV-V mutationsa : 8 (TG)12T5 No protein name Not available 2 2789 + 5GNA No protein name c.2657 + 5GNA 1 D579G p.Asp579Gly c.1736ANG 1 [R74W;V201M; D1270N] No protein name Not available 1 3849 + 10KbCNT No protein name c.3717 + 12191CNT 1 R347H p.Arg347His c.1040GNA 1 R347P p.Arg347Pro c.1040GNC 1 a Protein name and cDNA name from the CFTR2 database (http://www.http. com//www.cftr2) and http://www.genet.sickkids.on.ca/Home.html. Login to comment
88 Compound heterozygous patients with a class IV-V mutation N10 years 4 patients compound heterozygous for D1152H and a class IV-V mutation were N10 years old (median age: 15.5 years; range: 12-47 years). Login to comment
94 Homozygous patients for F508del N10 years As shown in Table 2, 48 CF patients homozygous for the F508del mutation and N10 years old (median age: 24 years; range: 11-58 years) were evaluated to compare their clinical expression with the 49 patients N10 years compound heterozygous for D1152H and a class I-II-III mutation. Login to comment
96 As shown in Table 2, the occurrence of several symptoms or complications i.e., pathological sweat test (p b 0.001), meconium ileus (p b 0.01), pancreatic insufficiency (p b 0.0001), diabetes (p b 0.001), nasal polyposis (p b 0.01), respiratory insufficiency as evaluated by the number of cases with an altered FEV1 (p b 0.05), bacterial colonization by P. aeruginosa (p b 0.001), S. aureus (p b 0.05) and S. maltophilia (p b 0.01), bronchiectasis (p b 0.05) and atelectasis (p b 0.05) was significantly more frequent in the 48 patients homozygous for the F508del mutation as compared to the 49 patients compound heterozygous for D1152H and a class I-IIIII mutation. Login to comment
98 Discussion Our data indicate that the clinical expression of CF in patients with the D1152H mutation is heterogeneous, and may in part depend on the mutation in trans. Login to comment
99 As a matter of fact, homozygous patients for the D1152H mutation show a very mild clinical course, with normal SC in all but one case, PS, lung function test in the normal range for age and gender, good nutritional status and no airway bacteria colonization or other complications. Login to comment
101 In particular Peleg et al. [15] reported a series of 4 homozygous patients for D1152H: all had PS, but two cases had recurrent pneumonia since infancy or bronchiectasis with recurrent lung infections. Login to comment
103 Furthermore, the only patient homozygous for the D1152H mutation described by Burgel had recurrent bronchitis and a multiple pulmonary colonization [11]. Login to comment
105 Among individuals carrying D1152H and a class I-II-III mutation, 19/71 (26.7%) cases showed SC over 60 mmol/L and suggestive clinical symptoms: these patients were diagnosed as having CF. Login to comment
106 In the same group 20/71 (28%) cases had a borderline SC and suggestive symptoms of CF: these patients were classified Table 2 Clinical characteristics of patients in the different groups: A) homozygous patients for the D1152H mutation b10 years; B) homozygous patients for the D1152H mutation N10 years; C) compound heterozygous for D1152H and a class I-II-III mutation b10 years; D) compound heterozygous for D1152H and a class I-II-III mutation N10 years; E) compound heterozygous for D1152H and a class IV-V mutation b10 years; F) compound heterozygous for D1152H and a class IV-V mutation N10 years; G) homozygous patients for the F508del mutation N10 years. Login to comment
110 These results agree with the data reported previously by Burgel [11] but are in disagreement with the study by LaRusch et al. [16] that reported the D1152H was carried in patients with pancreatitis but not with CF. Login to comment
116 When we analyzed data in the group of patients b10 years old (23/71 patients) we found that these patients also had a more severe phenotype than D1152H homozygous patients (i.e., 2 cases with borderline SC, 1 with MI, 2 cases with PI). Login to comment
117 It must be noted that the age at diagnosis for patients diagnosed for symptoms from this subgroup is higher than that of patients homozygous for the D1152H mutation and that of patients compound heterozygous for D1152H and a class IV-V mutation. Login to comment
119 In any case, even if a number of patients compound heterozygous for D1152H and a mutation of class I-II-III show symptoms and complications typically found in CF patients, clinical expression of CF is milder and the occurrence of complications more rare as compared to CF patients homozygous for the F508del mutation, despite that the 48 patients of the latter group examined in our study are meanly younger. Login to comment
122 On the contrary, even if there is a significant difference in the frequency, pulmonary colonizations and bronchiectasis are observed in both groups, and this suggests that patients compound heterozygous for D1152H and a class I-III mutation must be carefully monitored at the pulmonary level. Login to comment
123 Individuals compound heterozygous for D1152H and a class IV-V mutation show a very mild clinical course. Login to comment
128 Most of them carry a rare mutation in trans with the D1152H mutation and the question on how deep should be the molecular analysis in patients with normal SC is still unanswered [31]. Login to comment
129 In conclusion, clinical outcomes in individuals carrying D1152H and a class I-II-III mutation seem to be more severe than in those with D1152H and a class IV-V mutation and in D1152H homozygotes (most of this group do not meet CF diagnostic criteria). Login to comment
130 The former group could possibly benefit from early diagnosis, suggesting that the D1152H mutation should be included in panels for molecular analysis. Login to comment
131 Actually the extent to which D1152H has variable penetrance to cause disease is unknown. Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Both methods used 5 &#b5;l of isolated DNA for the NGS assay. NGS assay for detection of CFTR mutations/variants CFTR mutations are described using both the international nomenclature of the Human Genome Variation Society Mutations that have varying consequences c.3454G>C (D1152H) c.3154T>G (F1052V) c.3208C>T (R1070W) c.2930C>T (S977F) - c.3808G>A (D1270N) c.3205G>A (G1069R) c.350G>A (R117H) PolyTG/ polyT - c.1736A>G (D579G) c.3209G>A (R1070Q) c.220C>T (R74W) - - Mutations still under evaluation c.2657ߙ+ߙ2_2657ߙ+ߙ3insA (2789ߙ+ߙ2insA) c.680T>G (L227R) c.1705T>G (Y569D) - - c.1841A>G (D614G) c.1673T>C (L558S) - - - c.3700A>G (I1234V) c. Login to comment
66 Of the four CFTR mutations with varying consequences, two cases with an F508del/D1152H genotype were labeled "carrier" based on the sweat test results and the initial clinical assessment, whereas another F508del/D1152H genotype was labeled as CRMS. Login to comment
67 Note that the D1152H mutation is associated with variable clinical consequences. Login to comment

[hide] [Phenotypic variability of cystic fibrosis: case r... Rev Chil Pediatr. 2014 Jul;85(4):470-5. doi: 10.4067/S0370-41062014000400010. Hernandez-Amaris MF, Gomez-Vasquez AM, Pachajua H H
[Phenotypic variability of cystic fibrosis: case report of twins with F508/F508 mutation].
Rev Chil Pediatr. 2014 Jul;85(4):470-5. doi: 10.4067/S0370-41062014000400010., [PMID:25697321]

Abstract [show]
INTRODUCTION: Cystic fibrosis (CF) is an autosomal recessive disease caused by a mutation in the CFTR gene, resulting in an alteration of a protein involved in sodium and chloride transport in the apical plasma membrane of epithelial cells in respiratory and intestinal tracts. It primarily presents respiratory compromise, affecting other systems in different ways. Meconium ileus is a gastrointestinal manifestation that occurs in 10-20% of patients, which is not entirely attributable to a specific CFTR mutation. OBJECTIVE: To report a case of monozygotic twins diagnosed with CF (F508) in whom phenotypic variation is evident based on the expression of meconium ileus, showing that there are external modifiers in the development of this complication. CASE REPORT: monoamniotic monochorionic twin pregnancy which resulted in preterm births. One of the patient presented meconium ileus at birth leading to CF suspicion and establishing the diagnosis by (F508/F508) molecular analysis in both twins. CONCLUSION: Phenotypic variability in these twins supports the hypothesis proposed by different authors that there are other gene expression-modulation factors of the disease as well as environmental modifiers that must be taken into account when dealing with this disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 Referencias 1.- Diana A, Tesse R, Polizzi AM, et al: A large deletion causes apparent homozygosity for the D1152H mutation in the cystic fibrosis transmembrane regulator (CFTR) gene. Login to comment

[hide] Mutation analysis of PRSS1, SPINK1 and CFTR gene i... Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287. Sisman G, Tugcu M, Ayla K, Sebati O, Senturk H
Mutation analysis of PRSS1, SPINK1 and CFTR gene in patients with alcoholic and idiopathic chronic pancreatitis: A single center study.
Turk J Gastroenterol. 2015 Mar;26(2):176-80. doi: 10.5152/tjg.2015.4287., [PMID:25835118]

Abstract [show]
BACKGROUND/AIMS: A relation between some genetic mutations and chronic pancreatitis (CP) has been reported. However, the relation of genetic mutation to alcoholic CP (ACP) and idiopathic CP (ICP) still remains controversial. In this study, we investigated the prevalence of protease serine 1 (PRSS1), serine protease inhibitor, Kazal type 1 (SPINK1) SPINK1 and cystic fibrosis transmembrane conductance regulator (CFTR) mutations in ACP and ICP patients in Turkey. MATERIALS AND METHODS: Forty-one patients with ACP and 38 patients with ICP were enrolled, and 35 healthy individuals served as controls. The PRSS1 and SPINK1 mutations were investigated by the polymerase chain reaction (PCR)-restriction fragment-length polymorphism (RFLP) technique. The CFTR mutation was examined with PCR direct sequencing. RESULTS: The mean ages of the ACP, ICP and healthy control groups were 53.2, 40.4 and 46.3 years, respectively. A CFTR F508 mutation was detected as a heterozygote in one (2.4%) patient with ACP. In the ICP and control populations, PRSS1, SPINK1 and CFTR mutations were not detected. CONCLUSION: This study shows that PRSS1, SPINK1 and CFTR mutations do not play a role in ACP and ICP patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 DNA samples were multiplied by multiplex PCR with a CF 22Mut and CF 14Mut+Tn strip assay kit which has 36 common mutations of the CFTR gene (DF508, DI507, F508C, I502T, 1706del17, 1677del TA, G542X, 1717-1G>A, R553X, Q552X, G551D, S549R(A>C), N1303K, 4016insT, R1162X, R1158X, W1282X, G1244E, 2789+5G>A, 2183AA>G, 711+5G>A, 711+1G>T, G85E, 3849+10kbC>T, 621+1G>T, R117H, D1152H, L1065P, R1066H, L1077P, 4382delA, 1259insA, 852del22, R347P, T338I, S912X and Allele5T-7T-9T). Login to comment

[hide] Strain rate echocardiography uncovers subclinical ... J Cyst Fibros. 2015 Sep;14(5):654-60. doi: 10.1016/j.jcf.2015.03.010. Epub 2015 Apr 9. Sellers ZM, McGlocklin L, Brasch A
Strain rate echocardiography uncovers subclinical left ventricular dysfunction in cystic fibrosis.
J Cyst Fibros. 2015 Sep;14(5):654-60. doi: 10.1016/j.jcf.2015.03.010. Epub 2015 Apr 9., [PMID:25866147]

Abstract [show]
BACKGROUND: CFTR is expressed in cardiac myocytes. In mice, lack of CFTR alters cardiomyocyte contraction and Ca2+ signaling, and decreases cardiac reserve. We undertook a pilot study evaluating left ventricular (LV) function in CF patients using strain and strain rate echocardiography. METHODS: Echocardiography with tissue Doppler and strain and strain rate imaging were performed in 8 CF adults following pulmonary function tests. Results were compared to literature values obtained in healthy subjects. RESULTS: All CF individuals had normal LV ejection fractions. In contrast, 50% of men and 100% of women with CF had decreased LV systolic strain. Strain rates were significantly decreased in 100% of CF individuals. RV function was normal and LV function did not correlate with lung function. CONCLUSIONS: Strain and strain rate echocardiography identified LV systolic abnormalities in CF individuals not detected by conventional echocardiography. We propose that this echocardiography modality may identify subclinical cardiac dysfunction in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 Characteristics CF Cohort (n = 8) Age (years) 35 &#b1; 13 (35) Gender (M:F) 6:2 BMI (kg/m2 ) 26.6 &#b1; 10.2 (24) CF genotypes ƊF508/ƊF508 5 ƊF508/R117H 1 ƊF508/D1152H 1 ƊF508/1898 + 1G- N A 1 FEV1 (%) 68 &#b1; 27 (61) Last CF exacerbation requiring hospitalization/ER visit (years) 6.2 &#b1; 5.1 (5.8) Subjects with CF-related diabetes 1 HR (beats/min) 75 &#b1; 17 (76) Systolic BP (mm Hg) 129 &#b1; 11 (128) Diastolic BP (mm Hg) 76 &#b1; 9 (74) BNP (pg/mL) 20 &#b1; 11 (20) Data are presented as means &#b1; SD. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
280 These patients had the following mutations on the other allele: S1206X (p.Ser1206*) (1 CF-PS), D1152H (p.Asp1152His) (1 CBAVD). Login to comment
390 L1077P c.3230T>C CF-PI CF-causing p.Leu1077Pro Y1092X(C>A) c.3276C>A CF-PI CF-causing p.Tyr1092* M1137V c.3409A>G CFTR-RD nd p.Met1137Val D1152H c.3454G>C CF-PI,CF-PS,CFTR-RD varying clinical consequence p.Asp1152His R1162X c.3484C>T CF-PI CF-causing p.Arg1162* D1168G c.3503A>G CFTR-RD nd p.Asp1168Gly 3667ins4 c.3535_3536insTCAA CF-PI CF-causing p.Thr1179IlefsX17 S1206X c.3617C>A uncertain: CF-PI and/or CF-PS nd p.Ser1206* I1234V c.3700A>G CF-PI,CF-PS CF-causing p.Ile1234Val S1235R c.3705T>G CFTR-RD non CF-causing p.Ser1235Arg 3849+10kbC>T c.3717+12191C>T CF-PI,CF-PS CF-causing V1240G c.3719T>G CFTR-RD nd p.Val1240Gly G1244R c.3730G>A uncertain: CF-PI and/or CF-PS nd p.Gly1244Arg G1244E c.3731G>A CF-PI,CF-PS CF-causing p.Gly1244Glu G1247R(G>C) c.3739G>C CF-PS nd p.Gly1247Arg W1282X c.3846G>A CF-PI CF-causing p.Trp1282* Q1291R c.3872A>G CF-PI,CF-PS,CFTR-RD nd p.Gln1291Arg 4016insT c.3884_3885insT CF-PI CF-causing p.Ser1297PhefsX5 4040delA c.3908delA CF-PI nd p.Asn1303ThrfsX25 N1303K c.3909C>G CF-PI CF-causing p.Asn1303Lys ex22-24del c.3964-3890_4443+3143del9454ins5 CF-PI nd ex22,23del c.3964-78_4242+577del1532 CF-PI CF-causing 4168delCTAAGCC c.4036_4042del CF-PI nd p.Leu1346MetfsX6 G1349D c.4046G>A CF-PI CF-causing p.Gly1349Asp H1375P c.4124A>C uncertain: CF-PI and/or CF-PS nd p.His1375Pro S1455X c.4364C>G CF-PS,CFTR-RD nd p.Ser1455* Q1476X c.4426C>T CFTR-RD nd p.Gln1476* nd,Not determined.According to the three rules described (see Materials and Methods),each mutated allele was classified according to its clinical outcome.It was impossible to univocally assign 16 of the 125 different mutated alleles to one or more macrocategories.A comparison with the CFTR2 project (11) (http://www.cftr2.org) is shown.The alleles are ordered according to their nucleotidic position. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 [Gln359Lys; Thr360Lys] L558S c.1673 T4C p.Leu558Ser Y569D c.1705 T4G p.Tyr569Asp D579G c.1736 A4G p.Asp579Gly D614G c.1841 A4G p.Asp614Gly S977F c.2930C4T p.Ser977Phe F1052V c.3154 T4G p.Phe1052Val G1069R c.3205G4A p.Gly1069Arg R1070Q c.3209G4A p.Arg1070Gln D1152H c.3454G4C p.Asp1152His I1234V c.3700 A4G p.Ile1234Val 5T c.1210 - 12[5] Examples of common not CF-causing variantsc R31C c.91C4T p.Arg31Cys R74W c.220C4T p.Arg74Trp R75Q c.224G4A p.Arg75Gln I148T c.443 T4C p.Ile148Thr M470V c.1408 A4G p.Met470Val G576A c.1727G4C p.Gly576Ala R668C c.2002C4T p.Arg668Cys V754M c.2260G4A p.Val754Met L997F c.2991G4C p.Leu997Phe I1027T c.3080 T4C p.Ile1027Thr R1070W c.3208C4T p.Arg1070Trp R1162L c.3485G4T p.Arg1162Leu Table 1 (Continued) HGVS nomenclature Legacy name cDNA nucleotide name Protein name S1235R c.3705 T4G p.Ser1235Arg D1270N c.3808G4A p.Asp1270Asn 7T c.1210-12[7] Abbreviation: HGVS, Human Genome Variation Society. Login to comment
104 I1027T is usually found in cis with F508del: Notes: (i) Some missense variants classified as either indeterminate or non CF-causing (R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R and D1270N) can selectively alter the bicarbonate permeation of the CFTR channel (but not the chloride channel), thus affecting primarily the organs that utilize CFTR for bicarbonate secretion (pancreas, nasal sinus, or vas deferens) and, consequently, they could be involved in the pathogenic mechanisms of CFTR-RDs.14 (ii) In Table 1, the traditional name of common CFTR variants is referenced alongside the HGVS version in order to ensure compatibility with clinical reports and understanding by clinicians and couples. Login to comment

[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]

Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented. Login to comment

[hide] The impact of a national population carrier screen... J Cyst Fibros. 2015 Sep 16. pii: S1569-1993(15)00203-9. doi: 10.1016/j.jcf.2015.08.007. Stafler P, Mei-Zahav M, Wilschanski M, Mussaffi H, Efrati O, Lavie M, Shoseyov D, Cohen-Cymberknoh M, Gur M, Bentur L, Livnat G, Aviram M, Alkrinawi S, Picard E, Prais D, Steuer G, Inbar O, Kerem E, Blau H
The impact of a national population carrier screening program on cystic fibrosis birth rate and age at diagnosis: Implications for newborn screening.
J Cyst Fibros. 2015 Sep 16. pii: S1569-1993(15)00203-9. doi: 10.1016/j.jcf.2015.08.007., [PMID:26386752]

Abstract [show]
BACKGROUND: Population carrier screening (PCS) has been available in Israel since 1999 and universally subsidized since 2008. We sought to evaluate its impact. METHODS: A retrospective review of governmental databanks, the national CF registry and CF centers. RESULTS: CF rate per 100,000 live births has decreased from 14.5 in 1990 to 6 in 2011. From 2004-2011 there were 95 CF births: 22 utilized PCS; 68 (72%) had 2 known CFTR mutations; 37% were pancreatic sufficient. At diagnosis, age was 6 (0-98) months; 53/95 had respiratory symptoms, 41/95 failure to thrive and 19/95 pseudomonas. Thirty-four (36%) were Arabs and 19 (20%) orthodox Jews, compared to 20% and 8% respectively, in the general population. CONCLUSIONS: PCS markedly reduced CF birth rates with a shift towards milder mutations, but was often avoided for cultural reasons. As children regularly have significant disease at diagnosis, we suggest a balanced approach, utilizing both PCS and newborn screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 Mutation DF508 G542X W1282X N1303K 3849 + 10kbC- N T D1152H 405 + 1G࢐A G85E S549R W1089X 1717 + 1G࢐A I1234Va Y1092Xb 3121-1G N Ab 3120 + 1kbdel8.6 kbc 2183AA N Gc 4010delTATTc The first 14 mutations served as the panel used for Jewish population carrier screening program during the study period. Login to comment
92 Nine of these carried one or more D1152H mutation and 2 had a 5T intron splicing mutation, both associated with a milder phenotype. Login to comment
97 3 carried one or more D1152H mutation. Login to comment
134 As our understanding of genotype-phenotype relationships with regards to D1152H [18] and other mutations improves, parents can be supplied with a more robust body of knowledge when making decisions about the continuation of pregnancy. Login to comment
155 D1152H was removed from the PCS panel in 2013 as it is associated with a milder phenotype, although without NBS, those with significant lung disease will now likely be diagnosed late [26]. Login to comment

[hide] Single-cell high resolution melting analysis: A no... J Cyst Fibros. 2015 Oct 19. pii: S1569-1993(15)00217-9. doi: 10.1016/j.jcf.2015.09.009. Destouni A, Poulou M, Kakourou G, Vrettou C, Tzetis M, Traeger-Synodinos J, Kitsiou-Tzeli S
Single-cell high resolution melting analysis: A novel, generic, pre-implantation genetic diagnosis (PGD) method applied to cystic fibrosis (HRMA CF-PGD).
J Cyst Fibros. 2015 Oct 19. pii: S1569-1993(15)00217-9. doi: 10.1016/j.jcf.2015.09.009., [PMID:26493493]

Abstract [show]
BACKGROUND: Institutions offering CF-PGD face the challenge of developing and optimizing single cell genotyping protocols that should cover for the extremely heterogeneous CF mutation spectrum. Here we report the development and successful clinical application of a generic CF-PGD protocol to facilitate direct detection of any CFTR nucleotide variation(s) by HRMA and simultaneous confirmation of diagnosis through haplotype analysis. METHODS: A multiplex PCR was optimized supporting co-amplification of any CFTR exon-region, along with 6 closely linked STRs. Single cell genotypes were established through HRM analysis following melting of the 2nd round PCR products and were confirmed by STR haplotype analysis of the 1st PCR products. The protocol was validated pre-clinically, by testing 208 single lymphocytes, isolated from whole blood samples from 4 validation family trios. Fifteen PGD cycles were performed and 103 embryos were biopsied. RESULTS: In 15 clinical PGD cycles, genotypes were achieved in 88/93 (94.6%) embryo biopsy samples, of which 57/88 (64.8%) were deemed genetically suitable for embryo transfer. Amplification failed at all loci for 10/103 blastomeres biopsied from poor quality embryos. Six clinical pregnancies were achieved (2 twin, 4 singletons). PGD genotypes were confirmed following conventional amniocentesis or chorionic villus sampling in all achieved pregnancies. CONCLUSIONS: The single cell HRMA CF-PGD protocol described herein is a flexible, generic, low cost and robust genotyping method, which facilitates the analysis of any CFTR genotype combination. Single-cell HRMA can be beneficial to other clinical settings, for example the detection of single nucleotide variants in single cells derived from clinical tumor samples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 PGD case no. Genotype combination (HGVS CFTR reference sequences NM000492.3 and NG016465.1) LSC exons (legacy nomenclature) (Montgomery et al., 2007) No. of blastomeres received for diagnosis No. of blastomeres amplified No. of blastomeres genotyped No. of unaffected blastomeres Pregnancy Confirmation of PGD result by PNDa 1 p.Arg334Gln and c.489+3ANG 7.2 and 4.2 5 4 4 2 No N/A 2 p.Phe508del and p.Phe508del 10 11 10 10 6 Yes Yes 3 p.Phe508del and c.489+1GNT 10 and 4.2 8 7 7 4 Yes Yes 4 p.Phe508del and p.Leu732X 10 and 13.3 10 8 8 5 Yes Yes 5 p.Phe508del and p.Asp1152His 10 and 18 4 3 3 3 Yes Yes 6 p.Phe508del and c.2051_2052delAAinsG 10 and 13.2 5 4 4 3 Yes Yes 7 p.Phe508del and p.Gly1069Arg 10 and 17bA1 9 9 9 4 Yes No (BP) 8 p.Phe508del and p.Gly542X 10 and 11 3 3 3 2 Yes Yes 9 p.Phe508del and c.3140-26ANG 10 and 17bA1 8 8 7 3 No N/A 10 p.Gly542X and p.Gly542X 11 2 2 2 1 No transfer 11 p.Glu826Lys and p.Phe508del 13.4 and 10 6 6 4 3 Yes Miscarried 12 p.D1312G and c.489+1GNT 21 and 4.2 11 9 9 8 Yes Miscarried 13 p.Glu279Asp and p.Phe508del 6b and 10 7 7 5 3 No N/A 14 p.Phe508del and p.Gly1069Arg 10 and 17bA1 9 8 8 5 Yes No (BP) 15 p.Glu822X and p.Gly1069Arg 13.4 and 17bA1 5 5 5 5 Yesb Miscarried Total 103 93 88 57 N/A: non-applicable, BP: biochemical pregnancy. Login to comment

[hide] Non-allergic asthma as a CFTR-related disorder. J Cyst Fibros. 2015 Oct 30. pii: S1569-1993(15)00253-2. doi: 10.1016/j.jcf.2015.10.011. Schulz A, Tummler B
Non-allergic asthma as a CFTR-related disorder.
J Cyst Fibros. 2015 Oct 30. pii: S1569-1993(15)00253-2. doi: 10.1016/j.jcf.2015.10.011., [PMID:26526220]

Abstract [show]
BACKGROUND: CFTR dysfunction can be involved in CBAVD, pancreatitis or bronchiectasis. METHODS: Subjects with cystic fibrosis-like disease, equivocal sweat chloride concentrations and no or one disease-causing CFTR mutation were investigated by intestinal current and/or nasal potential difference measurements. RESULTS: A subgroup of female patients who had been diagnosed to suffer from non-allergic asthma showed intermediary chloride concentrations in sweat test, normal chloride secretory responses in the intestine and an abnormal nasal potential difference with Sermet scores in the cystic fibrosis range. CONCLUSION: Non-allergic asthma is a clinical entity that may be associated with CFTR dysfunction of the respiratory epithelium.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 2 A. Schulz, B. T&#fc;mmler / Journal of Cystic Fibrosis xx (2015) xxx-xxx Please cite this article as: Schulz A, T&#fc;mmler B, Non-allergic asthma as a CFTR-related disorder, J Cyst Fibros (2015), http://dx.doi.org/10.1016/j.jcf.2015.10.011 The missense mutation p.Asp1152His that has been classified as a mutation with variable penetrance [4,] was identified in a 9-years old child. Login to comment
65 Patient A B C D E F G Healthy controlsa CFTR mutation genotypeb F508del/WT WT/WT F508del/WT WT/WT D1152H/WT WT/WT WT/WT Sweat test: chloride [mmol/L] 52, 55 34, 60, 49, 43 60, 65 43, 60 9, 28, 31 45, 55, 58 32, 33, 14 ICM: cumulative response to segretagogues [bc;A/cm2 ]c 82, 76 66, 36, 35 188, 100, 51, 114 NPD:e Basic potential [mV] -30, -18 -32, -35 -19, -14 -24,-36 -30, -44 -20, -36 -16, -9 -18 (-10 to -33) Hyperpolarization potential [mV]f 25, 10 25, 28 11, 10 7, 21 6, 22 12, 19 8, 4 8 (3 to 15) Depolarization potential [mV]g -4, 0 0, -1 -5, -6 -4, -3 0, -3 -7, -1 -2, -3 -15 (-7 to -47) ATP response [mV]h -7, -10 -8,-9 -5, -4 -1, -4 -6, -10 -7, -11 -3, -9 -3 (-1 to -15) Sermet score [10]d -0.81; -0.50 -1.25;-1.29 0.05;0.16 0.09;-0.72 -0.3;-0.77 0.17;-0.84 -0.18;0.13 1.32 (0.37 to 4.5) Wilschanski score [11]d 0.85;1.00 1.00;0.96 0.63;0.55 0.57;0.87 1.00;0.87 0.56;0.95 0.78;0.47 0.18 (0.00 to 0.41) a NPD control measurements were performed according to SOP in 38 healthy individuals. Login to comment

[hide] Newborn Screening for Cystic Fibrosis in Californi... Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16. Kharrazi M, Yang J, Bishop T, Lessing S, Young S, Graham S, Pearl M, Chow H, Ho T, Currier R, Gaffney L, Feuchtbaum L
Newborn Screening for Cystic Fibrosis in California.
Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16., [PMID:26574590]

Abstract [show]
OBJECTIVES: This article describes the methods used and the program performance results for the first 5 years of newborn screening for cystic fibrosis (CF) in California. METHODS: From July 16, 2007, to June 30, 2012, a total of 2 573 293 newborns were screened for CF by using a 3-step model: (1) measuring immunoreactive trypsinogen in all dried blood spot specimens; (2) testing 28 to 40 selected cystic fibrosis transmembrane conductance regulator (CFTR) mutations in specimens with immunoreactive trypsinogen values >/=62 ng/mL (top 1.6%); and (3) performing DNA sequencing on specimens found to have only 1 mutation in step 2. Infants with >/=2 mutations/variants were referred to CF care centers for diagnostic evaluation and follow-up. Infants with 1 mutation were considered carriers and their parents offered telephone genetic counseling. RESULTS: Overall, 345 CF cases, 533 CFTR-related metabolic syndrome cases, and 1617 carriers were detected; 28 cases of CF were missed. Of the 345 CF cases, 20 (5.8%) infants were initially assessed as having CFTR-related metabolic syndrome, and their CF diagnosis occurred after age 6 months (median follow-up: 4.5 years). Program sensitivity was 92%, and the positive predictive value was 34%. CF prevalence was 1 in 6899 births. A total of 303 CFTR mutations were identified, including 78 novel variants. The median age at referral to a CF care center was 34 days (18 and 37 days for step 2 and 3 screening test-positive infants, respectively). CONCLUSIONS: The 3-step model had high detection and low false-positive levels in this diverse population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 [1210-12[5]];[1210-34TG[13]] (IVS8 (TG)13-5T)c 5 1 (n = 2) 3 (n = 1) 4 (n = 2) c.1521_1523delCTT (F508del) / c.3454G.C (D1152H)c 2 0.5d (n = 1) 2 (n = 1) c.1521_1523delCTT (F508del) / c.350G.A (R117H)c 2 1 (n = 1) 2 d (n = 1) c.223C.T (R753) / c. Login to comment
109 [1210-12[5]];[1210-34TG[12]] (IVS8 (TG)12-5T)c 1 4 c.1624G.T (G5423) / c.3454G.C (D1152H)c 1 5 c.2988+1G.A (3120+1G.A) / c. Login to comment

[hide] Pulmonary function and clinical observations in me... Chest. 1996 Aug;110(2):440-5. Colin AA, Sawyer SM, Mickle JE, Oates RD, Milunsky A, Amos JA
Pulmonary function and clinical observations in men with congenital bilateral absence of the vas deferens.
Chest. 1996 Aug;110(2):440-5., [PMID:8697849]

Abstract [show]
Congenital bilateral absence of the vas deferens (CBAVD) was once thought to be a distinct clinical entity, but genetic similarities in men with cystic fibrosis (CF) and CBAVD are described increasingly. We evaluated the clinical status, growth and nutritional state, and respiratory function of 18 men with CBAVD to determine whether these men with different CF transmembrane regulator (CFTR) genotypes may have clinical evidence of mild CF. Following a thorough history and examination, pulmonary function tests, sweat test, and renal ultrasound were performed. Genetic evaluation for 50 known CF mutations, screening for private mutations (single-strand conformational polymorphism and direct sequencing), and assay of the length of the polypyrimidine tract in the splice site acceptor of intron 8 was performed. A history of pulmonary disease was present in three, and an additional man had some features suggestive of malabsorption. Results of general physical examination and anthropomorphic measurements were unremarkable in all patients, with a mean (SD) body mass index of 26 (3). Pulmonary function tests of large and small airway function as well as lung volumes were normal in all except one whose results were consistent with moderate asthma. Five men were compound heterozygotes for CFTR mutations, four of whom had positive sweat tests (sweat chloride > 60 mEq/L). Twelve men were heterozygotes for CFTR mutations while no mutations were identified in one man. Although putative etiologic factors may suggest that men with CBAVD and CFTR mutations could be considered within the spectrum of clinical CF, the authors suggest that in men with CBAVD without any other clinical features of CF, the diagnosis of CF may not be made.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 His stool description Table 1.Age, Sweat Sodium and Chloride Concentration and Ratio, and Genotype Subject/Age, yr Symptoms Sweat Na+: mEq/L Sweat Cl mEq/L Na:Cl Ratio CFTR Genotype Polythymidine Splice Variant l*/32 2*/27 3f/30 4/23 5*/22 6*/31 7*/37 8/30 9/41 10/31 11/31 12/38 13/40 14/32 15/31 16/43 17/40 18/27 Asthma Malabsorption Bronchitis Asthma 100 39 53 37 36 36 26 46 42 35 83 74 44 44 44 28 21 106 80 37 51 35 34 34 24 45 43 32 79 75 46 44 40 32 22 0.94 1.05 1.03 1.06 1.05 1.05 1.08 1.00 0.98 1.09 1.05 0.99 0.96 1.00 1.10 0.90 0.95 AF508/R117H AF508/R117H AF508/- AF508/- AF508/- AF508/- AF508/- R117H/- Q493X/- AF508/- AF508/- AF508/R117H G551D/R117H G551D/D1152H AF508/- G542X/- R117H/- -/- 7/9 7/9 5/9 5/9 7/7 7/9 7/9 NT$ 7/7 NT NT 7/9 7/7 7/7 5/9 5/9 7/7 5/9 * Subject 1 and 2 are brothers. Login to comment