ABCMdb

ABCC7 p.Gly126Asp

ClinVar:	c.376G>A , p.Gly126Ser ? , not provided
CF databases:	c.377G>A , p.Gly126Asp (CFTR1) D ,
Predicted by SNAP2:	A: N (61%), C: D (75%), D: D (71%), E: D (91%), F: D (91%), H: D (91%), I: D (85%), K: D (91%), L: D (71%), M: D (85%), N: D (75%), P: D (75%), Q: D (85%), R: D (91%), S: N (53%), T: D (59%), V: D (66%), W: D (91%), Y: D (91%),
Predicted by PROVEAN:	A: N, C: D, D: D, E: D, F: N, H: D, I: N, K: D, L: N, M: N, N: D, P: D, Q: D, R: D, S: N, T: N, V: N, W: D, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Two buffer PAGE system-based SSCP/HD analysis: a g... Eur J Hum Genet. 1999 Jul;7(5):590-8. Liechti-Gallati S, Schneider V, Neeser D, Kraemer R
Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease.
Eur J Hum Genet. 1999 Jul;7(5):590-8., [PMID:10439967]

Abstract [show]
The large size of many disease genes and the multiplicity of mutations complicate the design of an adequate assay for the identification of disease-causing variants. One of the most successful methods for mutation detection is the single strand conformation polymorphism (SSCP) technique. By varying temperature, gel composition, ionic strength and additives, we optimised the sensitivity of SSCP for all 27 exons of the CFTR gene. Using simultaneously SSCP and heteroduplex (HD) analysis, a total of 80 known CF mutations (28 missense, 22 frameshift, 17 nonsense, 13 splicesite) and 20 polymorphisms was analysed resulting in a detection rate of 97.5% including the 24 most common mutations worldwide. The ability of this technique to detect mutations independent of their nature, frequency, and population specificity was confirmed by the identification of five novel mutations (420del9, 1199delG, R560S, A613T, T1299I) in Swiss CF patients, as well as by the detection of 41 different mutations in 198 patients experimentally analysed. We present a three-stage screening strategy allowing analysis of seven exons within 5 hours and analysis of the entire coding region within 1 week, including sequence analysis of the variants. Additionally, our protocol represents a general model for point mutation analysis in other genetic disorders and has already been successfully established for OTC deficiency, collagene deficiency, X-linked myotubular myopathy (XLMTM), Duchenne and Becker muscular dystrophy (DMD, BMD), Wilson disease (WD), Neurofibromatosis I and II, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, and defects in mitochondrial DNA. No other protocol published so far presents standard SSCP/HD conditions for mutation screening in different disease genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 The technique developed demonstrates excellent single-strand separation and non-radioactive visualisation on polyacrylamide gels, and is time-saving and directly Table 2 Known mutations identified in 198 CF patients analysed investigatively Exon (E) Number of CFTR mutations intron (I) chromosomes Patient`s nationality Highest prevalence ∆F508 E10 212 miscellaneous 3905insT E20 025 Swiss Swiss, Amish, Arcadian R553X E11 020 Swiss, German German 1717-1G->A I10 017 Swiss, Italian Italian N1303K E21 011 Swiss, French, Italian Italian W1282X E20 014 Swiss, Italian, Israelit Jewish-Askhenazi G542X E11 009 Swiss, Spanish, Italian Spanish 2347delG E13 008 Swiss R1162X E19 006 Swiss, Italian, Russian Italian 3849+10kbC->T I19 005 German, French R347P E07 004 Swiss T5 I08 004 Swiss R334W E07 003 Swiss Q525X E10 003 Swiss 3732delA E19 003 Swiss S1235R E19 003 Italian, Turkish G85E E03 002 Italian, Greek I148T E04 002 Austrian, Turkish French-Canadian 621+1G->T I04 002 French French-Canadian 1078delT E07 002 Swiss E585X E12 002 Italian 2176insC E13 002 Swiss, Italian 2789+5G->A I14b 002 Italian Spanish D1152H E18 002 Swiss, French 4016insT E21 002 Turkish Q39X E02 001 Swiss 394delTT E03 001 Swiss Nordic, Finnish R117H E04 001 Swiss A120T E04 001 Swiss G126D E04 001 Swiss 711+5G->A I05 001 Russian M348K E07 001 Italian L568F E12 001 Italian 2183AA->G E13 001 Italian Italian K710X E13 001 Swiss S945L E15 001 French 3272-26A.->G I17a 001 Swiss M1101K E17b 001 Swiss Huttite 3601-17C->T I18 001 Swiss R1158X E19 001 Swiss 4005+1G-A I20 001 Italian applicable to early diagnostic testing, carrier detection and prenatal diagnosis. Login to comment

[hide] Ligation dependent allele specific quantification ... Clin Chim Acta. 2009 Apr;402(1-2):47-53. Epub 2008 Dec 24. Schneider M, von Kanel T, Sanz J, Gallati S
Ligation dependent allele specific quantification (LASQ) of CFTR cDNA on the LightCycler using MLPA hybridization probes.
Clin Chim Acta. 2009 Apr;402(1-2):47-53. Epub 2008 Dec 24., [PMID:19146842]

Abstract [show]
BACKGROUND: As for Cystic Fibrosis (CF) and many other hereditary diseases there is still a lack in understanding the relationship between genetic (e.g. allelic) and phenotypic diversity. Therefore methods which allow fine quantification of allelic proportions of mRNA transcripts are of high importance. METHODS: We used either genomic DNA (gDNA) or total RNA extracted from nasal cells as starting nucleic acid template for our assay. The subjects included in this study were 9 CF patients compound heterozygous for the F508del mutation and each one F508del homozygous and one wild type homozygous respectively. We established a novel ligation based quantification method which allows fine quantification of the allelic proportions of ss and ds CFTR cDNA. To verify reliability and accuracy of this novel assay we compared it with semiquantitative fluorescent PCR (SQF-PCR). RESULTS: We established a novel assay for allele specific quantification of gene expression which combines the benefits of the specificity of the ligation reaction and the accuracy of quantitative real-time PCR. The comparison with SQF-PCR clearly demonstrates that LASQ allows fine quantification of allelic proportions. CONCLUSION: This assay represents an alternative to other fine quantitative methods such as ARMS PCR and Pyrosequencing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 doi:10.1016/j.cca.2008.12.017 Contents lists available at ScienceDirect Clinica Chimica Acta journal homepage: www.elsevier.com/locate/clinchim missense mutation (P2: F508del/R5347H and P1: F508del/G126D, respectively). Login to comment

[hide] High frequency of the R75Q CFTR variation in patie... J Cyst Fibros. 2004 Aug;3(3):189-91. Divac A, Nikolic A, Mitic-Milikic M, Nagorni-Obradovic L, Petrovic-Stanojevic N, Dopudja-Pantic V, Nadaskic R, Savic A, Radojkovic D
High frequency of the R75Q CFTR variation in patients with chronic obstructive pulmonary disease.
J Cyst Fibros. 2004 Aug;3(3):189-91., [PMID:15463907]

Abstract [show]
We performed the complete screening of the CFTR gene in a group of 31 patients with COPD in order to investigate the impact of mutations and polymorphisms in the CFTR gene. The cumulative frequency of CFTR mutations (17.74%) was significantly higher than in our general population (P < 0.0001). The R75Q was significantly overrepresented in COPD patients (8.06%; P = 0.002). In all patients carrying the R75Q chronic bronchitis was a dominant symptom of COPD, and all were homozygous for the V470 allele. These findings suggest that R75Q mutation could be characteristic CFTR variant for COPD patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Six different mutations (R75Q, F508del, G126D, L997F, F1052V, R74W) were identified on 11 (17.74%) of the 62 chromosomes, giving a significantly higher frequency than in our general population ( P < 0.0001, 95%CI: 2.60-36.21). Login to comment
59 Table 1 CFTR genotypes in COPD patients No. of cases CFTR gene mutation IVS8 Tn M470V genotype 1 R75Q/R75Q 7/7 V470/V470 1 L997F/R75Q 7/9 V470/V470 2 R75Q/- 7/7 V470/V470 1 F508del/- 7/9 M470/V470 1 F508del/- 5/9 M470/M470 1 G126D/- 7/9 M470/M470 1 F1052V/- 7/7 M470/V470 1 R74W/- 7/7 M470/M470 2 -/- 5/7 V470/V470 3 -/- 5/7 M470/V470 1 -/- 5/7 M470/M470 1 -/- 5/9 M470/V470 3 -/- 7/9 M470/V470 6 -/- 7/7 V470/V470 4 -/- 7/7 M470/V470 -/- 7/7 M470/M470 A. Divac et al. / Journal of Cystic Fibrosis 3 (2004) 189-191190 Acknowledgements This work was supported by grant 1417 from Ministry for Science, Technologies and Development of Serbia. Login to comment

[hide] Co- and posttranslational translocation mechanisms... J Biol Chem. 1998 Jan 2;273(1):568-76. Lu Y, Xiong X, Helm A, Kimani K, Bragin A, Skach WR
Co- and posttranslational translocation mechanisms direct cystic fibrosis transmembrane conductance regulator N terminus transmembrane assembly.
J Biol Chem. 1998 Jan 2;273(1):568-76., [PMID:9417117]

Abstract [show]
Transmembrane topology of most eukaryotic polytopic proteins is established cotranslationally at the endoplasmic reticulum membrane through the action of alternating signal and stop transfer sequences. Here we demonstrate that the cystic fibrosis transmembrane conductance regulator (CFTR) achieves its N terminus topology through a variation of this mechanism that involves both co- and posttranslational translocation events. Using a series of defined chimeric and truncated proteins expressed in a reticulocyte lysate system, we have identified two topogenic determinants encoded within the first (TM1) and second (TM2) membrane-spanning segments of CFTR. Each sequence independently (i) directed endoplasmic reticulum targeting, (ii) translocated appropriate flanking residues, and (iii) achieved its proper membrane-spanning orientation. Signal sequence activity of TM1, however, was inefficient due to the presence of two charged residues, Glu92 and Lys95, located within its hydrophobic core. As a result, TM1 was able to direct correct topology for less than half of nascent CFTR chains. In contrast to TM1, TM2 signal sequence activity was both efficient and specific. Even in the absence of a functional TM1 signal sequence, TM2 was able to direct CFTR N terminus topology through a ribosome-dependent posttranslational mechanism. Mutating charged residues Glu92 and Lys95 to alanine improved TM1 signal sequence activity as well as the ability of TM1 to independently direct CFTR N terminus topology. Thus, a single functional signal sequence in either the first or second TM segment was sufficient for directing proper CFTR topology. These results identify two distinct and redundant translocation pathways for CFTR N terminus transmembrane assembly and support a model in which TM2 functions to ensure correct topology of CFTR chains that fail to translocate via TM1. This novel arrangement of topogenic information provides an alternative to conventional cotranslational pathways of polytopic protein biogenesis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 CFTR mutations ⌬E115, E116K, E115K/E116K, and G126D were engineered by PCR overlap extension (35) using sense primers: 1) CCGGATAA- CAAGGAACGCTCTATC, 2) GATAACAAGGAGAAACGCTCTATCGCG, 3) AACAAGAAAAAACGGTCCATCGCGATTTATCTAGGC, 4) GATTTATC- TAGGCATAGACTTATGCCTTCTC, respectively, and complimentary antisense primers (not shown) to generate overlapping 5Ј and 3Ј PCR fragments. Login to comment
52 Plasmids TM1-2.P encoding mutations E116K/G126D and E115K/E116K/G126D were constructed by PCR overlap extension using primers 2 and 3 and pSPCFTR(G126D) template. Login to comment
53 Similarly, plasmids TM1-2.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (5Ј template pSPCFTR(E92A/K95A) and 3Ј template pSPCFTR(G126D); (c) primer 3 (5Ј template pSPCFTR(E92A/ K95A) 3Ј template pSPCFTR(G126D)). Login to comment
55 Plasmids encoding G85E together with E115K/E116K, E116K/G126D or E115K/E116K/G126D mutations were made in the identical manner except that pSPCFTR(G85E) was used as the template for the initial 5Ј PCR reactions. Login to comment
120 To better define the role of TM2 in directing CFTR topology, we attempted to decrease TM2 signal sequence activity by introducing three mutations previously identified in cystic fibrosis patients (G126D, ⌬E115, and E116K) (39). Login to comment
123 However, the double mutations E115K/E116K, E116K/G126D and the triple mutation E115K/E116K/G126D all reduced N-linked glycosylation to approximately 20% of chains, a 65-70% reduction from WT levels (Fig. 3A, lanes 7-15). Login to comment
139 For the remaining two mutants, E116K/G126D and E115K/E116K/G126D, little or no translocation of the P reporter was observed (lanes 10-15). Login to comment
143 CFTR cDNA encoding mutations, ⌬E115, E116K, E115K/E116K, E116K/G126D or E115K/E116K/G126D was therefore truncated at codon Asn186 , and the topology of chains was determined in RRL (Fig. 4). Login to comment
154 However, TM2 mutations E116K/G126D and E115K/E116K/G126D had a relatively minor but reproducible effect on CFTR N terminus topology, 82 and 79% of WT translocation activity, respectively (Fig. 4B, lanes 16-24 and Fig. 5, A and B). Login to comment
155 When the TM1 mutation G85E was introduced into chains containing E116K/G126D or E115K/E116K/G126D mutations, translocation efficiency was further reduced to 45% and 48% of WT levels, respectively (Fig. 5, A and B). Login to comment
54 Similarly, plasmids TM12.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (59 template pSPCFTR(E92A/K95A) and 39 template pSPCFTR(G126D); (c) primer 3 (59 template pSPCFTR(E92A/ K95A) 39 template pSPCFTR(G126D)). Login to comment
56 Plasmids encoding G85E together with E115K/E116K, E116K/G126D or E115K/E116K/G126D mutations were made in the identical manner except that pSPCFTR(G85E) was used as the template for the initial 59 PCR reactions. Login to comment
121 To better define the role of TM2 in directing CFTR topology, we attempted to decrease TM2 signal sequence activity by introducing three mutations previously identified in cystic fibrosis patients (G126D, DE115, and E116K) (39). Login to comment
124 However, the double mutations E115K/E116K, E116K/G126D and the triple mutation E115K/E116K/G126D all reduced N-linked glycosylation to approximately 20% of chains, a 65-70% reduction from WT levels (Fig. 3A, lanes 7-15). Login to comment
140 For the remaining two mutants, E116K/G126D and E115K/E116K/G126D, little or no translocation of the P reporter was observed (lanes 10-15). Login to comment

[hide] Bithiazole correctors rescue CFTR mutants by two d... Biochemistry. 2013 Aug 6;52(31):5161-3. doi: 10.1021/bi4008758. Epub 2013 Jul 22. Loo TW, Bartlett MC, Clarke DM
Bithiazole correctors rescue CFTR mutants by two different mechanisms.
Biochemistry. 2013 Aug 6;52(31):5161-3. doi: 10.1021/bi4008758. Epub 2013 Jul 22., [PMID:23865422]

Abstract [show]
Better correctors are needed to repair cystic fibrosis transmembrane conductance regulator (CFTR) processing mutants that cause cystic fibrosis. Determining where the correctors bind to CFTR would aid in the development of new correctors. A recent study reported that the second nucleotide-binding domain (NBD2) was involved in binding of bithiazole correctors. Here, we show that bithiazole correctors could also rescue CFTR mutants that lacked NBD2. These results suggest that bithiazoles rescue CFTR mutants by two different mechanisms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
17 VX-809 appears to rescue CFTR processing mutants through direct interactions with TMD1.12,18 Bithiazoles, however, appear to rescue CFTR processing mutants by a different mechanism because bithiazoles have an additive effect on maturation when used in combination with VX-809.15 Identification of the bithiazole rescue site in CFTR is controversial as there is evidence that these compounds bind to NBD218 or to the TMDs.9 Evidence that bithiazoles interact with the TMDs was that 4a inhibited cross-linking between cysteines introduced into TMD1 and TMD219 and that 4a appears to stabilize TMD2.20 In addition, it was found that bithiazoles enhanced core glycosylation of a truncation mutant that contained only the TMDs.19 By contrast, it was recently reported that bithiazoles must interact with NBD2 because ƊF508 CFTR missing NBD2 was not rescued with bithiazoles and in silico docking predicted the presence of a bithiazole-binding site in NBD2.18 To test whether rescue of other CFTR processing mutants with bithiazoles (see Figure 1 for structures) was mediated by the TMDs or NBD2, we tested if bithiazoles could rescue full-length or ƊNBD2 CFTR mutants that had processing mutations in the TMDs such as G126D in TM2,21 V232D in Received: July 3, 2013 Revised: July 17, 2013 Published: July 18, 2013 Rapid Report pubs.acs.org/biochemistry (c) 2013 American Chemical Society dx.doi.org/10.1021/bi4008758 | Biochemistry 2013, 52, 5161-5163 Terms of Use TM4,20 F337R in TM6,12 and S1141R in TM12 (see Figure 2A). Login to comment
18 Mutants G126D and V232D are naturally occurring CF mutants, whereas F337R and S1141R mutants were constructed to map the orientation of the TM segments.12 The mutants were expressed for 18 h with or without VX-809 or the 4a, 4d, or 15Jf bithiazole correctors. Login to comment
20 Figure 2B shows that full-length and ƊNBD2 forms of G126D, V232D, and S1141R could be efficiently rescued with all the correctors such that the mature protein was the major product (Figure 2C,D). Login to comment
25 The second bithiazole rescue mechanism appears to involve the TMDs because removal of NBD2 had little effect on bithiazole rescue of mutants G126D, V232D, and S1141R and mutation F337R in TM6 inhibited rescue of full-length CFTR with bithiazoles. Login to comment

[hide] A Genotypic-Oriented View of CFTR Genetics Highlig... Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229. Lucarelli M, Bruno SM, Pierandrei S, Ferraguti G, Stamato A, Narzi F, Amato A, Cimino G, Bertasi S, Quattrucci S, Strom R
A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis.
Mol Med. 2015 Apr 21;21:257-75. doi: 10.2119/molmed.2014.00229., [PMID:25910067]

Abstract [show]
Cystic fibrosis (CF) is a monogenic disease caused by mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The genotype-phenotype relationship in this disease is still unclear, and diagnostic, prognostic and therapeutic challenges persist. We enrolled 610 patients with different forms of CF and studied them from a clinical, biochemical, microbiological and genetic point of view. Overall, there were 125 different mutated alleles (11 with novel mutations and 10 with complex mutations) and 225 genotypes. A strong correlation between mutational patterns at the genotypic level and phenotypic macrocategories emerged. This specificity appears to largely depend on rare and individual mutations, as well as on the varying prevalence of common alleles in different clinical macrocategories. However, 19 genotypes appeared to underlie different clinical forms of the disease. The dissection of the pathway from the CFTR mutated genotype to the clinical phenotype allowed to identify at least two components of the variability usually found in the genotype-phenotype relationship. One component seems to depend on the genetic variation of CFTR, the other component on the cumulative effect of variations in other genes and cellular pathways independent from CFTR. The experimental dissection of the overall biological CFTR pathway appears to be a powerful approach for a better comprehension of the genotype-phenotype relationship. However, a change from an allele-oriented to a genotypic-oriented view of CFTR genetics is mandatory, as well as a better assessment of sources of variability within the CFTR pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
368 [Arg117Leu;Leu997Phe] G126D c.377G>A uncertain: CF-PI and/or CF-PS nd p.Gly126Asp H139R c.416A>G CF-PI,CF-PS nd p.His139Arg 574delA c.442delA CF-PI CF-causing p.Ile148LeufsX5 621+1G>T c.489+1G>T CF-PI CF-causing 621+3A>G c.489+3A>G CFTR-RD nd G178R c.532G>A CF-PI CF-causing p.Gly178Arg D192G c.575A>G CF-PS nd p.Asp192Gly E193K c.577G>A CBAVD nd p.Glu193Lys 711+1G>T c.579+1G>T CF-PI CF-causing 711+3A>G c.579+3A>G CF-PS CF-causing 711+5G>A c.579+5G>A uncertain: CF-PI and/or CF-PS and/or CFTR-RD CF-causing and/or CBAVD H199R c.596A>G CF-PI nd p.His199Arg L206W c.617T>G CFTR-RD CF-causing p.Leu206Trp Q220X c.658C>T CF-PI CF-causing p.Gln220* 852del22 c.720_741delAGGGAGAATGATGATGAAGTAC CF-PI CF-causing p.Gly241GlufsX13 907delCins29 c.775delCinsTCTTCCTCAGATTCATTGTGATTACCTCA uncertain: CF-PI and/or CF-PS nd C276X c.828C>A CF-PI CF-causing p.Cys276* Continued on next page R E S E A R C H A R T I C L E M O L M E D 2 1 : 2 5 7 - 2 7 5 , 2 0 1 5 | L U C A R E L L I E T A L . Login to comment