ABCMdb

PMID: 7532152

Artlich A, Boysen A, Bunge S, Entzian P, Schlaak M, Schwinger E
Common CFTR mutations are not likely to predispose to chronic bronchitis in northern Germany.
Hum Genet. 1995 Feb;95(2):226-8., [PubMed]

Sentences

No. Mutations Sentence Comment

2 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* R553X, G542X, G551D, N1303K and 621 + 1G--->T were not detected. Login to comment 10 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Gly542Asp We have analyzed CF carrier frequency and the frequency of the more common CFTR mutations AF508, R553X, G551D, G542D, G542X, N1303K and 621 + 1G--+T by examination of 100 patients with chronic bronchitis. Login to comment 20 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* Sequences from exons 4, 10, l l and 21 were amplified by the polymerase chain reaction (PCR) according to the published protocols in order to search for mutations AF508, G542X, R553X, G551D, N1303K and 621 +IG---~T (Rommens et al. 1990; Cutting et al. 1990; Kerem et al. 1990;Osborne et al. 1991; Zielenski et al. 1991). Login to comment 22 ABCC7 p.Gly542* Primers F: TTGCAGAGAAAGA- CAATATAGTTCCT and R: GCACAGATTCTGAGTAACCAT- AATC generate a 296 bp product with a BstI site destroyed by G542X. Login to comment 23 ABCC7 p.Gly551Asp ABCC7 p.Arg553* The same product has a HinclI site destroyed by G551D and R553X, differentiated by subsequent Mbol digestion. Login to comment 24 ABCC7 p.Asn1303Lys The product generated by primers F: AATGTTCACAAGGGACT- CCA and R: CACTCCACTGTTCATAGGGATCCAG reveals N1303K by BstNI cleavage. Login to comment