ABCMdb

PMID: 9216449

Heinonen P, Iitia A, Torresani T, Lovgren T
Simple triple-label detection of seven cystic fibrosis mutations by time-resolved fluorometry.
Clin Chem. 1997 Jul;43(7):1142-50., [PubMed]

Sentences

No. Mutations Sentence Comment

20 ABCC7 p.Arg553* ABCC7 p.Gly542* We utilized triple-label time-resolved fluorometry and short, allele-specific oligonucleotide probes to detect ⌬F508, G1717 3A, G542X, R553X, 3905 insertion T 1 Department of Biotechnology, University of Turku, FIN-20520 Turku, Finland. Login to comment 27 ABCC7 p.Trp1282* ABCC7 p.Asn1303Lys Clinical Chemistry 43:7 1142-1150 (1997) Molecular Pathology 1142 (3905insT), W1282X, and N1303K mutations after PCR amplification of the CFTR gene exons 10, 11, 20, and 21. Login to comment 55 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* of hybridization wells Detection probe 5؅-3؅ sequence and label5؅-Primer 3؅-Primer ⌬F508 w 1 AAGCACAGTGGAAGAATTTC BioCTCTTCTAGTTGGCATGCT 2 Tb-(modC)20ATCATCTTTGGT m 3 Sm-(modC)20TATCAT∧TGGTGT w 1 BioGAGCATACTAAAAGTGACTC BioCATGAATGACATTTACAGCAA 1 Eu-(modC)20ATGTCCTATTAC G1717 3A m 3 Tb-(modC)20TAATAAGACATCT G542X w 1 BioGAGCATACTAAAAGTGACTC BioCATGAATGACATTTACAGCAA 2 Eu-(modC)20GGTCTTGGAGAA m 1 Tb-(modC)20GGTCTTTGAGAA R553X w 1 BioGAGCATACTAAAAGTGACTC BioCATGAATGACATTTACAGCAA 2 Sm-(modC)20GTCAACGAGCAA m 3 Eu-(modC)20TTGCTCATTGAC 3905insT w 2 BioCCTTATAGGTGGGCCTCT BioGCTAAGTCCTTTTGCTCAC 4 Tb-(modC)20AGCTTTTTT*GAG m 5 Sm-(modC)20CTCAAAAAAAGC W1282X w 2 BioCCTTATAGGTGGGCCTCT BioGCTAAGTCCTTTTGCTCAC 4 Eu-(modC)20TTCCTCCACTGT m 5 Eu-(modC)20CAGTGAAGGAAA N1303K w 2 AAGTATTTATTTTTTCTGGAACA BioTTCTTGATCACTCCACTGTT 4 Sm-(modC)20AAAACTTGGATC m 5 Tb-(modC)20AAAAAGTTGGAT Sequences, labels, and design of hybridization wells for wild-type specific (w) and mutant specific (m) detection probes for seven CFTR mutations. Login to comment 85 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* and type of label Optimal hybridization temperature,b,d °C Optimal probe conc.,b ng/well Hybridization sensitivity (target molecules/well)c,d Cross-reactivity,b,d % Maximal hybridization efficiency,b % ⌬F508 w 19Tb 31 2 4.1 ϫ 107 0.0 6.5 m 19Sm 24 5 1.2 ϫ 108 1.0 13.5 G1717 3A w 18Eu 17 5 5.9 ϫ 107 0.2 10.5 m 19Tb Ͻ10 5 5.6 ϫ 107 0.1 8.0 G542X w 18Eu 18-27 5 6.7 ϫ 107 0.4 5.5 m 19Tb 20 10 8.1 ϫ 107 0.5 2.5 R553X w 9Sm 32 2 3.2 ϫ 108 1.0 8.5 m 16Eu 22 1 2.2 ϫ 107 0.2 14.5 3905insT w 18Tb 25 5 1.8 ϫ 107 2.9 10.5 m 19Sm 22 2 1.8 ϫ 107 6.5 38.0 W1282X w 19Eu 22 1 3.2 ϫ 107 0.4 14.0 m 19Eu 20 2 1.7 ϫ 107 0.5 21.0 N1303K w 9Sm 31 10 6.4 ϫ 107 0.6 8.0 m 13Tb 27 2 3.1 ϫ 107 0.0 11.0 a For sequences, see Table 1. b Determined using 1 ϫ 1011 target molecules/well. Login to comment 88 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* probes specific for ⌬F508, G1717 3A, G542X, and R553X in wells 1-3, and the fragments amplified in PCR2 with probes specific for 3905insT, W1282X, and N1303K in wells 4 and 5 (Fig. 1). Login to comment 97 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* The mutations of interest were ⌬F508 in exon 10, G1717 3A, G542X, and R553X in exon 11, 3905insT and W1282X in exon 20, and N1303K in exon 21. Login to comment 110 ABCC7 p.Arg553* ABCC7 p.Arg553* ABCC7 p.Gly542* ABCC7 p.Gly542* The hybridization reactions were distributed as follows: wild-type G1717 3A probe and mutant G542X probe were hybridized in well 1, wild-type probes for ⌬F508, G542X, and R553X in well 2, and mutant probes for ⌬F508, G1717 3A, and R553X in well 3. Login to comment 132 ABCC7 p.Gly542* The maximal efficiency varied from probe to probe between 2.5% (the mutant G542X probe) and 38% (the mutant 3905insT probe) (Table 2). Login to comment 134 ABCC7 p.Arg553* The lowest optimal hybridization temperature was Ͻ10 °C (the mutant G1717 3A probe), and the highest optimum was 32 °C (the mutant R553X probe) (Table 2). Login to comment 146 ABCC7 p.Arg553* Relative hybridization signals of mutant R553X (F), G1717 3A (f), and ⌬F508 (ࡗ) probes hybridized at optimal probe concentrations at different temperatures with 1 ϫ 1011 synthetic target molecules/well. Login to comment 148 ABCC7 p.Gly542* A typical calibration curve for the wild-type G542X probe is shown in Fig. 4. Login to comment 155 ABCC7 p.Gly542* Fig. 4 illustrates the cross-reactivity of the wild-type G542X probe with different target concentrations. Login to comment 162 ABCC7 p.Gly542* Calibration curve and cross-reaction of wild-type G542X probe. Login to comment 163 ABCC7 p.Gly542* Hybridization signals of wild-type G542X probe hybridized with different concentrations of wild-type specific synthetic target (F) and cross-reaction signals with mutant specific synthetic target (ࡗ) (background subtracted). Login to comment 167 ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Arg553* ABCC7 p.Arg553* ABCC7 p.Arg553* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Asn1303Lys ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Gly542* ABCC7 p.Gly542* Signal-to-noise ratio for wild/mutant ⌬F508 G1717 3A G542X R553X 3905insT W1282X N1303K w m w m w m w m w m w m w m Diagnosis Purified DNA samples 293 1.2 255 1.1 65 1.4 64 2.3 82 1.2 20 1.0 23 1.2 Normal 120 77 218 1.2 57 1.5 57 2.2 76 1.3 24 1.4 18 1.4 ⌬F508/unknown 2.2 166 236 1.1 73 2.7 62 3.0 78 1.4 25 1.6 15 2.0 ⌬F508/⌬F508 141 91 132 17 79 1.5 69 3.0 79 1.4 22 1.7 19 1.6 ⌬F508/G1717 3A 286 1.4 2.5 31 61 2.4 59 2.5 81 1.3 23 1.4 25 1.7 G1717 3A/G1717 3A 280 1.4 61 14 18 13 29 2.8 82 1.2 25 1.0 16 1.5 G1717 3A/G542X 220 1.8 265 1.5 73 1.6 40 36 78 1.3 19 1.4 13 2.0 ⌬F508/R553X 284 2.0 176 1.7 75 4.0 3.0 60 87 1.4 21 1.7 20 1.8 R553X/R553X 264 1.8 226 1.7 76 3.5 37 32 44 17 23 1.1 20 1.5 R553X/3905insT 104 67 214 2.3 46 2.3 48 3.5 44 16 22 1.6 15 1.9 ⌬F508/3905insT 154 97 268 1.5 68 1.5 62 3.2 74 1.8 11 33 21 0.9 ⌬F508/W1282X 310 1.2 294 1.1 83 2.5 73 2.4 78 1.3 18 1.5 6.4 40 N1303K/N1303K Blood spot samples 250 1.2 265 0.9 75 0.9 73 1.3 69 1.3 31 2.2 12 2.7 Normal 69 40 213 1.1 63 1.1 54 1.9 58 1.2 17 55 18 2.4 ⌬F508/W1282X 1.5 138 256 1.2 62 1.1 74 3.7 76 1.5 32 2.1 11 2.7 ⌬F508/⌬F508 96 48 304 1.0 96 12 76 2.2 82 1.5 31 2.9 13 3.2 ⌬F508/G542X Boldface numbers indicate signal-to-noise ratios considered positive. Login to comment 201 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* Results of DNA samples analyzed for seven CFTR mutations: 16 amplified samples, each plotted for seven mutations, ⌬F508 (ࡗ), G1717 3A (छ), G542X (f), R553X (Ⅺ), 3905insT (F), W1282X (E), and N1303K (‫. Login to comment