ABCMdb

PMID: 21374513

Schwarz M, Malone G
Methods for screening in cystic fibrosis.
Methods Mol Med. 1996;5:99-119., [PubMed]

Sentences

No. Mutations Sentence Comment

10 ABCC7 p.Gly551Asp ABCC7 p.Trp1282* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Val520Phe ABCC7 p.Gly85Glu ABCC7 p.Arg560Thr ABCC7 p.Glu60* Molecular D/agnoss of GenetIc Diseases Edlted by R Elles Humana Press Inc , Totowa, NJ 99 Table1 RelativeFrequenciesoftheCommonCFMutationsintheUnitedKingdom(S),NorthAmerica, andNorthernandSouthernEurope(7)" NorthNorthernSouthern UKAmericaEuropeEurope MutationExonNo.%No.%No.%No%References AF508 G551D G542X 621+l(G>T) 1717-l(G>A) sR117H =R553x 1898+l(G>A) N1303K R560T AI507 G85E 1154insTC V520F W1282X E60X 3659delC 1078delT 10738775.32690066.114,86670.28400755.033 113023.082061.973561.68370.518 111651.682342.244392.082593.569 intron4910.931541.48970.46370.51IO intron10560.57440.421600.76650.899 4450.46610.586202930.04II 11450.46960.921650.7844068 intron12450.4620.02410.191001412 21450.461301.252090.991792.4613 11410.42240.2340019009 10300.31200.19570.2750.079,14 3210.211601530014140.19II 7190.19n/an/an/an/an/an/a15 10170.17n/an/an/an/an/an/a16 20170.172452.351200.57430.5917 3160.16n/an/an/an/an/an/aMaloneb 19140.14140.133901810.019 790.0910.015302520.318 S549N1180.0850.051800920038 Q493X1070.07n/an/adan/adan/a9 R347P760.06260.25550.26240.3311 3849+10kb(C>T)intron1950.05570.55230.1180.1119 A455E930.03270.26350.17009 %/a,Datanotavadable. Login to comment 34 ABCC7 p.Arg117His ABCC7 p.Arg560Thr As an extreme example, asample may betested for R560T and R117H by ARMS duplex (primers aredetailed in Table 3,p. Login to comment 35 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys 106), for exons5,8, and 18by denaturing gradient gel electrophoresis (DGGE), for exons 3 and 7 by single-stranded conformational polymorphism (SSCP), for W1282X and N1303K by AS0 hybridization to dot-blots (Table 4, p. 106), and for R553X by restriction endonuclease digestion of PCR products. Login to comment 36 ABCC7 p.Arg553* ABCC7 p.Arg560Thr Becauseof the simplicity of detection of changeswhich alter restriction endonucleaserecognition sequences(Table 5, p. 107), anumber of diagnostic laboratories chooseto testfor thesemutations (e.g., R553X, R560T) at an early stage.This may be followed by further SSCPand DGGE analysis, and ultimately DNA sequencing exon by exon. Login to comment 38 ABCC7 p.Arg117His ABCC7 p.Arg560Thr ABCC7 p.Arg560Thr Table2 Sequences,ProductSizes,andAnnealingTemperaturesofPCRPrimersUsedinCFAnalysis(seeNote1O)8 ExonPrimersequence5`to3`Name ProductAnnealing size,bptemperature,"C 3 4 7 9 10@al-Q G A10 11 12 13 14a 17b 19 CTTGGGTTAATCTCCTTGGA3i5 ATTCACCAGATTTCGTAGTC313 TCACATATGGTATGACCCTC4i5 TTGTACCAGCTCACTACCTA4i3 AGACCATGCTCAGATCTTCCAT7i5 GCAAAGTTCATTAGAACTGATC7i3 TAATGGATCATGGGCCATGT9i5 ACAGTGTTGAATGTGGTGCA9i3 GTTTTCCTGGATTATGCCTGGGCACC16B GTTGGCATGCTTTGATGACGCTTCC16D GCAGAGTACCTGAAACAGGAlOi CATTCACAGTAGCTTACCCAlOi CAACTGTGGTTAAAGCAATAGTGTlli5 GCACAGATTCTGAGTAACCATAATlli3 GTGAATCGATGTGGTGACCA1215 CTGGTTTAGCATGAGGCGGT1213 TGCTAAAATACGAGACATATTGCA13i5 ATCTGGTACTAAGGACAGCl-1M AAAAGGTATGCCACTGTTAAG14ai5 GTATACATCCCCAAACTATCT14ai3 TTCAAAGAATGGCACCAGTGT17bl5 ATAACCTATAGAATGCAGCA17bi3 GCCCGACAAATAACCAAGTGA1915 GCTAACACATTGCTTCAGGCT19i3 309 438 410 561 98 491 425 426 528 511 463 454 54 54 54 54 54 54 54 57 58 57 56 54 20 21 intron6a iniron8 intron17b intron17b mtron19 GGTCAGGATTGAAAGTGTGCA CTATGAGAAAACTGCACTGGA AATGTTCACAAGGACTCCA CAAAGTACCTGTTGCTCCA CAAGTCTTTCACTGATCTTC TGAGCAGTTGTTAATAGATAA TCTATCTCATGTTAATGCTG GTTTCTAGAGGACATGATC GACAATCTGTGTGCATCG GCTGCATTCTATAGGTTATC AAACTTACCGACAAGAGGA TGTCACCTCTTCATACTCAT AGGCTTCTCAGTGATCTGTTG GAATCATTCAGTGGGTATAAGCAG 20x547359 2Oi3 211547654 210 FC09106/l1057 6iRPT NURI22050 AT17R1.2201-30150 AT17D1.2 ACl7R214050 AC17D2 i19F43750 i19R "SequencesareprovidedcourtesyoftheCysticFibrosisGeneticAnalysisConsortium 106 Schwarz and Malone Table 3 Sequences and Product Sizes for ARMS Primers (23) Used to Detect the CF Mutations R560T and R117H in a Duplex Reactiona Mutatron Prnner Sequence 5` to 3` Product size, bp R560T RI 17H Common AAAATTTCAGCAATGTTGTTTTTGACCAAC Normal GCTTGCTAGACCAATAATTAGTTATTCAAC Mutant GCTTGCTAGACCAATAATTAGTTATTCAAG Common CACATATGGTATGACCCTCTATATAAACTC Normal CCTATGCCTAGATAAATCGCGATAGAACC Mutant CCTATGCCTAGATAAATCGCGATAGAAT 316 237 aAs for the CF(4)m test, a pan of tubes (A and B) is required for eachDNA sample. Login to comment 39 ABCC7 p.Arg117His ABCC7 p.Arg117His ABCC7 p.Arg117His ABCC7 p.Arg117His ABCC7 p.Arg560Thr ABCC7 p.Arg560Thr ABCC7 p.Arg560Thr ABCC7 p.Arg560Thr Tube A contams R560T and R117H common, R560T normal, and R117H mutant primers; tube B contams R560T and R117H common, R560T mutant and R117H normal, pnmers. Login to comment 41 ABCC7 p.Trp1282* ABCC7 p.Asn1303Lys AF508 N CACCAAAGATGATATTTTC M AACACCAATGATATTTTCTT 1717-l(G>A) N TGGTAATAGGACATCTC M TGGTAATAAGACATCTC 1898+ l(G>A) N CAAAGAACATACCTTTCAA M TGAAAGATATGTTCTTTG W1282X N CAACAGTGGAGGAAAGCCTT M CAACAGTGAAGGAAAGCCTT N1303K N TAGAAAAAACTTGGATCC M TAGAAAAAAGTTGGATCC PolyT(intron8) 5T TGTGTGTGTTTTTAACAG 7T TGTGTGTTTTTTTAACAG 9T GTGTGTTTTTTTTTAACAG 42-44 42-44 42-44 424 42,44,46 36,40,42 36 36,40,42 aPosthybndlzatlon washes are camed out m 2X SSC, 0 1% SDS solution at incremental temperatures as shown (see Notes 9 and 10). Login to comment 42 ABCC7 p.Gly551Asp ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Arg334Trp ABCC7 p.Arg347Pro ABCC7 p.Gly85Glu ABCC7 p.Ser549Asn ABCC7 p.Arg560Thr Screening in Cystic Fibrosis 107 Table 5 CF Mutations Detectable by Restriction Endonuclease (RE) Digestion of PCR Products Mutation PCR primers0 RE RE digestion product sizes, bpbJ Normal Mutant G85E 621+ 1 (G`V 1154insTC R334W R347P G551D R553X R560T S549N 3849+ IOkb CC ` T) W1282X 3i5 and 313 4i5 and 4i3 Hinff MseI 105 + 204 33,35,71, 118, 181 7i5 and 7i3 MspI, RsaI 50,68,74 + 21V 715 and 7i3 MspI 192 + 218 7i5 and 7i3 CfoI 151+ 259 1li5 and 1113 Mb01 425 1115 and lli3 HzncII 186 + 239 lli5 and lli3 Mae11 425 lli5 and lli3 DdeI 13, 174 + 238 i19F and i19R HphI 88 + 349 2Oi5 and 2Oi3 Mnfl 185 + 288 309 33,35,54,71, 118, 127 50,68,76 + 21gc 410 410 182+243 425 215 + 210 13 + 412 88,127 + 222 473 'See Table 2 bThe expected digestion product sizes for both normal and mutant sequences are shown CTheseproducts may be d1stmgmshedby PAGE 1.2.3. Login to comment 82 ABCC7 p.Gly542* ABCC7 p.Lys1060Thr For example the mutations AEl15 and K1060T, aswell asAF508, G542X, and RI 17H have been seenm CBAVD (29). Login to comment 193 ABCC7 p.Gly542* Odd-numbered tracks contain the ARMS products for the normal alleles of 621 + l(G > T) and AF508, plus the mutant alleles of G55 1D and G542X. Login to comment 194 ABCC7 p.Gly542* Even-numbered tracks contain products for the normal alleles of G55 1D and G542X and the mutant alleles of 62 1 + 1(G > T) and AF508. Tracks 1 and 2 are from an individual who is negative for all four mutations, as are tracks 3 and 4. Login to comment 198 ABCC7 p.Gly542* Tracks 13 and 14 are from a compound heterozygote of G542X and AF508. Tracks 15 and 16 are a negative (no DNA) control and track 17 is DNA molecular weight marker VI (Boehringer Mannheim). Login to comment