ABCMdb

PMID: 15084222

D'Apice MR, Gambardella S, Bengala M, Russo S, Nardone AM, Lucidi V, Sangiuolo F, Novelli G
Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy.
BMC Med Genet. 2004 Apr 14;5:8., 2004-04-14 [PubMed]

Sentences

No. Mutations Sentence Comment

7 ABCC7 p.His199Arg Among these are two novel CFTR mutations, including one missense (H199R) and one microdeletion (4167delCTAAGCC). Login to comment 55 ABCC7 p.Ser549Arg ABCC7 p.Arg117Leu ABCC7 p.Leu1065Pro ABCC7 p.Arg1066Cys ABCC7 p.Leu1077Pro ABCC7 p.Ala1006Glu ABCC7 p.Ser42Phe These mutations included S4X (143 C to A), exon 1; S42F (257 C to T), exon 2; R117L (482 G to T), exon 4; S549R (1779 T to G), exon 11; 3667ins4, exon 19; A1006E (3149 C to A), exon17a; L1065P (3326 T to C), R1066C (3328 C to T), L1077P (3362 T to C), exon 17b. Login to comment 65 ABCC7 p.His199Arg Among these mutations, we have identified and characterised in the Italian population two novel mutations in two affected children: H199R and 4167delCTAAGCC. Login to comment 66 ABCC7 p.His199Arg An abnormal DHPLC pattern in exon 6a due to the nucleotide change A to G at position 728 of CFTR determines the missense mutation H199R that falls into the transmembrane domain, TM1. Login to comment 67 ABCC7 p.Asn1303Lys This CF mutation was identified in a patient who carries the N1303K (4041 C to G) mutation on the maternal CF chromosome. Login to comment 68 ABCC7 p.His199Arg H199R mutation, to our knowledge, has been detected in a single CF chromosome in a population in Brittany [7]. Login to comment 69 ABCC7 p.His199Tyr ABCC7 p.His199Gln The other two mutations that affect the same codon are described: H199Y (727 C to T), found in a German CF patient heterozygous for delF508 and who exhibits only mild pancreatic symptoms and borderline sweat chloride values, and H199Q (729 T to G). Login to comment 70 ABCC7 p.Leu1065Pro The microdeletion 4167delCTAAGCC in exon 22 was identified by DHPLC analysis in a CF patient who presents the L1065P (3326 T to C) mutation on the maternal chromosome. Login to comment 77 ABCC7 p.Gly542* ABCC7 p.Ser549Arg Finally, in a single CF patient, we detected two different mutations [G542X (1756 G to T) and S549R (1779 T to G)] in the same exon 11-derived DNA amplicon, which showed a peculiar DHPLC pattern, different from that observed when only one of these mutations was present (data not show). Login to comment 82 ABCC7 p.His199Arg H199R has a substitution of a conserved amino acid crucial in the TM1 domain, while the other, a 7bp-deletion, introduces a premature STOP codon, resulting in a truncated protein. Login to comment 89 ABCC7 p.Gly551Asp ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Arg334Trp ABCC7 p.Arg347Pro ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Ser549Arg ABCC7 p.Gly85Glu ABCC7 p.Ser549Asn ABCC7 p.Arg117Leu ABCC7 p.Thr338Ile ABCC7 p.Leu1065Pro ABCC7 p.Arg1066Cys ABCC7 p.Gln552* ABCC7 p.Met348Lys ABCC7 p.Arg334Leu ABCC7 p.Leu558Ser ABCC7 p.Leu1077Pro ABCC7 p.Ala1006Glu ABCC7 p.Asp110His ABCC7 p.Asp614Gly ABCC7 p.Ser42Phe ABCC7 p.His199Arg ABCC7 p.His139Arg Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment 90 ABCC7 p.Arg75Gln Table 3: Polymorphisms (*) identified in our cohort of CF patients by DHPLC Polymorphism Nucleotide change Exon/intron 125G/C 125 G to C 5' UTR R75Q 356 G to A 3 875+40A/G 875+40A/G Intron 6a M470V 1540 A to G 10 T854T 2694 T to G 14a T966T 3030 G to A 15 4006-199G/A 4006-199G/A Intron 20 P1306P 4050 C to T 21 (*) According to [7]. Login to comment