ABCMdb

PMID: 1379414

Ferrie RM, Schwarz MJ, Robertson NH, Vaudin S, Super M, Malone G, Little S
Development, multiplexing, and application of ARMS tests for common mutations in the CFTR gene.
Am J Hum Genet. 1992 Aug;51(2):251-62., [PubMed]

Sentences

No. Mutations Sentence Comment

6 ABCC7 p.Gly551Asp ABCC7 p.Gly542* ARMS reactions for the most common mutations have been multiplexed to give a test which will detect the presence of the AF508, G551D, G542X, and 621 + 1G--T mutations in a DNA sample. Login to comment 57 ABCC7 p.Trp1282* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* The mutations detected, their frequencies, and the methods used to Table I CF Mutations in 1,030 Chromosomes from the Northwest of England Observed Frequency Detection Mutation (%) Methoda Reference R117H ......... .4 A Dean et al. 1990 621 + 1G>T ... 1.0 R Zielenski et al. 1991 AI507 ......... .5 S Schwartz et al. 1991 AF508 ......... 80.7 S and A Kerem et al. 1989 1717-1G>A ... .3 A Guillermit et al. 1990 G542X ......... 1.1 A Kerem et al. 1990 GSS1D ......... 3.4 R Cutting et al. 1990 RS53X ......... .8 R Cutting et al. 1990 RS60T ......... .6 R Kerem et al. 1990 W1282X ....... .2 A Vidaud et al. 1990 N1303K ........ .6 A Osborne et al. 1991 a A = ASO hybridization; R = RFLP; and S = size difference. Login to comment 58 ABCC7 p.Trp1282* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* The mutations detected, their frequencies, and the methods used to Table I CF Mutations in 1,030 Chromosomes from the Northwest of England Observed Frequency Detection Mutation (%) Methoda Reference R117H ......... .4 A Dean et al. 1990 621 + 1G>T ... 1.0 R Zielenski et al. 1991 AI507 ......... .5 S Schwartz et al. 1991 AF508 ......... 80.7 S and A Kerem et al. 1989 1717-1G>A ... .3 A Guillermit et al. 1990 G542X ......... 1.1 A Kerem et al. 1990 GSS1D ......... 3.4 R Cutting et al. 1990 RS53X ......... .8 R Cutting et al. 1990 RS60T ......... .6 R Kerem et al. 1990 W1282X ....... .2 A Vidaud et al. 1990 N1303K ........ .6 A Osborne et al. 1991 a A = ASO hybridization; R = RFLP; and S = size difference. Login to comment 65 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Arg560Thr ARMS tests were developed for the following mutations: AF508 (Riordan et al. 1989), A1507 (Schwarz et al. 1991), R117H (Dean et al. 1990), 621 + 1G-T (Zielenski et al. 1991), 1717G--oA (Guillermit et al. 1990), W1282X (Vidaud et al. 1990), GSS1D and R553X (Cutting et al. 1990), G542X and R560T (Kerem et al. 1990), and N1303K (Osborne et al. 1991). Login to comment 66 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Arg560Thr ARMS tests were developed for the following mutations: AF508 (Riordan et al. 1989), A1507 (Schwarz et al. 1991), R117H (Dean et al. 1990), 621 + 1G-T (Zielenski et al. 1991), 1717G--oA (Guillermit et al. 1990), W1282X (Vidaud et al. 1990), GSS1D and R553X (Cutting et al. 1990), G542X and R560T (Kerem et al. 1990), and N1303K (Osborne et al. 1991). Login to comment 77 ABCC7 p.Arg117His In some cases primers complementary to the sense strand were used, and this is indicated by the replacement of the - symbol with a + symbol in ARMS and common primers codes; for example, RH-d-N indicates that this primer is used to analyze the R117H mutation (RH), that it has an A residue as the penultimate base which mismatches a C residue in the target sequence (code d), and that it is specific for the normal allele (N). Login to comment 78 ABCC7 p.Arg117His In some cases primers complementary to the sense strand were used, and this is indicated by the replacement of the - symbol with a + symbol in ARMS and common primers codes; for example, RH-d-N indicates that this primer is used to analyze the R117H mutation (RH), that it has an A residue as the penultimate base which mismatches a C residue in the target sequence (code d), and that it is specific for the normal allele (N). Login to comment 82 ABCC7 p.Phe508Cys The development of these ARMS tests was complicated by the existence of two additional benign mutations of the CFTR gene, namely F508C and 1506V (Kobayashi et al. 1990). Login to comment 83 ABCC7 p.Phe508Cys The development of these ARMS tests was complicated by the existence of two additional benign mutations of the CFTR gene, namely F508C and 1506V (Kobayashi et al. 1990). Login to comment 88 ABCC7 p.Phe508Cys DNA samples carrying the benign mutations were not available for analysis, but, as the 1506V mutation was proximal to the ARMS target site, and as the F508C mutation was complementary to the normal ARMS primer, it seems likely that samples containing either of these sequences would appear normal in this test. Login to comment 89 ABCC7 p.Phe508Cys DNA samples carrying the benign mutations were not available for analysis, but, as the 1506V mutation was proximal to the ARMS target site, and as the F508C mutation was complementary to the normal ARMS primer, it seems likely that samples containing either of these sequences would appear normal in this test. Login to comment 94 ABCC7 p.Arg117His R I 17H The R117H mutation of exon IV of the CF gene is a G-A substitution atposition 482 (Dean et al. 1990). Login to comment 95 ABCC7 p.Arg117His R I 17H The R117H mutation of exon IV of the CF gene is a G-A substitution atposition 482 (Dean et al. 1990). Login to comment 97 ABCC7 p.Arg117His An R117H homozygote was not available for us to confirm the specificity ofthe normal primer. Login to comment 98 ABCC7 p.Arg117His ABCC7 p.Arg117His Three approaches were used in order to design an ARMS test specific for the R117H mutation. Login to comment 99 ABCC7 p.Arg117His Three approaches were used in order to design an ARMS test specific for the R117H mutation. Login to comment 105 ABCC7 p.Arg117His ABCC7 p.Arg117His When control primers AAT3 and AAT4 (product size 360 bp) were included in both R117H ARMS reactions at a concentration of 0.86 pM, it was noted that the faint mutant R117H band previously detected in normal individuals was no longer visible (fig. 2c). Login to comment 106 ABCC7 p.Arg117His ABCC7 p.Arg117His ABCC7 p.Arg117His ABCC7 p.Arg117His In ARMS tests of individuals heterozygous for the R117H mutation, the intensity of normal and mutant R117H ARMS product bands was equal. Login to comment 107 ABCC7 p.Arg117His ABCC7 p.Arg117His In ARMS tests of individuals heterozygous for the R117H mutation, the intensity of normal and mutant R117H ARMS product bands was equal. Login to comment 113 ABCC7 p.Arg117His The use of the primers incorporating the C/C mismatch resulted in a specific R117H test (fig. 2d). Login to comment 114 ABCC7 p.Arg117His The use of the primers incorporating the C/C mismatch resulted in a specific R117H test (fig. 2d). Login to comment 115 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Arg560Thr The mutations for which ARMS tests were developed were R560T, R553X, GS5iD, G542X, 1717-1G--A, 621 + 1G--T, N1303K, and W1282X. Login to comment 116 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Arg560Thr The mutations for which ARMS tests were developed were R560T, R553X, GS5iD, G542X, 1717-1G--A, 621 + 1G--T, N1303K, and W1282X. Login to comment 118 ABCC7 p.Gly542* ABCC7 p.Gly542* The Development of a Multiplex ARMS Test for the Four Most Common CF Mutations in the Northwest of England In order to obtain a multiplex ARMS test for these four mutations (AF508, GSSiD, G542X, and 621 + 1G-T; table 1), it was necessary to develop a method for the simultaneous detection of the two closely linked exon XI mutations, GSSiD and G542X, which are separated by only 28 bp. Login to comment 119 ABCC7 p.Gly542* ABCC7 p.Gly542* The Development of a Multiplex ARMS Test for the Four Most Common CF Mutations in the Northwest of England In order to obtain a multiplex ARMS test for these four mutations (AF508, GSSiD, G542X, and 621 + 1G-T; table 1), it was necessary to develop a method for the simultaneous detection of the two closely linked exon XI mutations, GSSiD and G542X, which are separated by only 28 bp. Login to comment 136 ABCC7 p.Arg560Thr Exon 11: TAAAATTTCAGCAATGTTGTTTTTGACC ............ R560T GCTTGCTAGACCAATAATTAGTTATTCATC. Login to comment 138 ABCC7 p.Arg117His ABCC7 p.Arg553* ABCC7 p.Gly542* R553X: CACCTTGCTAAAGAAATTCTTGCTAG ................. CACCTTGCTAAAGAAATTCTTGCTAA ................. GS51D: GCTAAAGAAATTCTTGCTCGTTGCC ................. AGCTAAAGAAATTCTTGCTCGTTGCT ................. G542X: ACTCAGTGTGATTCCACCTTCTAC ...................... CACTCAGTGTGATTCCACCTTCTCA .................... 1717-1G>A: GTCTTTCTCTGCAAACTTGGAGATGTGC ............ GTCTTTCTCTGCAAACTTGGAGATGTGT ............ R117H: CACATATGGTATGACCCTCTATATAAACTC. Login to comment 139 ABCC7 p.Asn1303Lys ABCC7 p.Arg560Thr CCTATGCCTAGATAAATCGCGATAGAAC ............. CCTATGCCTAGATAAATCGCGATAGAAT ............ N1303K:b CTCAATTTCTTTATTCTAAAGACATTGG ............ GATCACTCCACTGTTCATAGGGATCCAAG .......... GATCACTCCACTGTTCATAGGGATCCAAC ........... 621 + 1G>T: TCACATATGGTATGACCCTCTATATAAACT. Login to comment 141 ABCC7 p.Arg117His ABCC7 p.Arg553* ABCC7 p.Gly542* R553X: CACCTTGCTAAAGAAATTCTTGCTAG ................. CACCTTGCTAAAGAAATTCTTGCTAA ................. GS51D: GCTAAAGAAATTCTTGCTCGTTGCC ................. AGCTAAAGAAATTCTTGCTCGTTGCT ................. G542X: ACTCAGTGTGATTCCACCTTCTAC ...................... CACTCAGTGTGATTCCACCTTCTCA .................... 1717-1G>A: GTCTTTCTCTGCAAACTTGGAGATGTGC ............ GTCTTTCTCTGCAAACTTGGAGATGTGT ............ R117H: CACATATGGTATGACCCTCTATATAAACTC. Login to comment 142 ABCC7 p.Trp1282* ABCC7 p.Asn1303Lys W1282X: CCCATCACTTTTACCTTATAGGTGGGCCTC. Login to comment 145 ABCC7 p.Trp1282* W1282X: CCCATCACTTTTACCTTATAGGTGGGCCTC. Login to comment 152 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Gly542* In the multiplex, the normal ARMS reactions for AF508 and 621 + 1G--T are combined with the mutant overARMS reactions for G551D and G542X in the "A" Figure 2 Development of a single ARMS test for R117H. Login to comment 154 ABCC7 p.Arg117His The second pair of tracks in each panel are the products when DNA from an R117H heterozygote is used. Login to comment 155 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Gly542* ABCC7 p.Arg560Thr Shown are the results a n m n m R560T 317bp c n m n m 0551 D 286bp obtained using primers RH-d-N and RH-d-M at 0.86 pM (a), at reduced primer concentration 0.10 ItM (b), at 0.86 FM with the inclusion of AAT1 /2 control primers (c), and using primers RHh-N and RH-h-M (which are identical to RH-d-N/M, except for C/C mismatch at position - 2). Login to comment 156 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Gly542* b n m n m R553X 291bp * control - 220bp d n m n m G542X 256bp4- control 220bp e n m n m 621 +1G>T 380bp gn m n m f n m n m 360bp 4----- control 220bp h n m n m 1717G>A 220bp -- control - * 360bp W1282X I 178bp Figure 3 Single ARMS tests. Login to comment 157 ABCC7 p.Arg117His The second pair of tracks in each panel are the products when DNA from an R117H heterozygote is used. Login to comment 158 ABCC7 p.Arg560Thr Shown are the results a n m n m R560T 317bp c n m n m 0551 D 286bp obtained using primers RH-d-N and RH-d-M at 0.86 pM (a), at reduced primer concentration 0.10 ItM (b), at 0.86 FM with the inclusion of AAT1 /2 control primers (c), and using primers RHh-N and RH-h-M (which are identical to RH-d-N/M, except for C/C mismatch at position - 2). Login to comment 159 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Gly542* b n m n m R553X 291bp * control - 220bp d n m n m G542X 256bp 4- control 220bp e n m n m 621 +1G>T 380bp gn m n m f n m n m 360bp 4----- control 220bp h n m n m 1717G>A 220bp -- control - * 360bp W1282X I 178bp Figure 3 Single ARMS tests. Login to comment 161 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* The ARMS tests are as follows: a, R56OT; b, R553X; c, GSS1D; d, G542X; e, 621 + 1G T; f, N1303K; g, 1717G-A; and h, W1282X. Login to comment 162 ABCC7 p.Asn1303Lys N1303K 4---- 328bp tube, and the corresponding mutant and normal reactions are combined in the "B" tube. Login to comment 164 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* The ARMS tests are as follows: a, R56OT; b, R553X; c, GSS1D; d, G542X; e, 621 + 1G T; f, N1303K; g, 1717G-A; and h, W1282X. Login to comment 165 ABCC7 p.Asn1303Lys N1303K 4---- 328bp tube, and the corresponding mutant and normal reactions are combined in the "B" tube. Login to comment 191 ABCC7 p.Gly542* In addition to the validation and application data reported here, theARMS multiplex is also being tested Table 4 Sequences and Concentration of ARMS Primers Used in the Multiplex ARMS Test Size Concentration Mutation and Sequence (5' to 3') Code (bp) Tube (x standard) AFS08: GACTTCACTTCTAATGATGATTATGGGAGA ...... DF-C A/B 1.0 GTATCTATATTCATCATAGGAAACACCACA ....... DF-j-N 160 A 1.0 GTATCTATATTCATCATAGGAAACACCATT ....... DF-w-M 157 B 2.0 Exon 11: TAAAATTTCAGCAATGTTGTTTTTGACC ......... 11-C A/B 2.0 GS51D: GCTAAAGAAATTCTTGCTCGTTACC .................. GD-j2d3-N 285 B 2.0 AGCTAAAGAAATTCTTGCTCGTTGCT ................ GD-j-M 286 A 1.0 G542X: ACTCAGTGTGATTCCACCTTCTAC..................... GX-e-N 256 B 1.0 CACTCAGTGTGATTCCACCTTCTCA ................... GX-M 257 A 1.0 621 + 1G>T: TCACATATGGTATGACCCTCTATATAAACT ....... 621-C A/B .5 TGCCATGGGGCCTGTGCAAGGAAGTATTCC ..... 621-j-N 380 A .5 TGCCATGGGGCCTGTGCAAGGAAGTATTGA .... 621-r-M 380 B .5 4 5 6 7 8 9 10 11 Figure 4 Results obtained using the standard ARMS multiplex test. Login to comment 193 ABCC7 p.Gly542* The first contains the products of the normal 621 + 1G-T and AF508 primers and ofthe mutant GSS1D and G542X primers. Login to comment 194 ABCC7 p.Gly542* ABCC7 p.Gly542* The corresponding products for the 621 + 1G-T and AFS08 mutant primers and for the GSS1D and G542X normal primers are in the second track of the pair. Login to comment 196 ABCC7 p.Gly551Asp ABCC7 p.Gly542* ABCC7 p.Gly542* ABCC7 p.Gly542* The genotypes of the 11 samples are as follows: 1, normal; 2, normal; 3, normal; 4, 621 + 1G-T heterozygote; 5, G551D heterozygote; 6, G542X heterozygote; 7, AFS08 heterozygote; 8, 621 + 1G-T, AFS08; 9, GSS1D,AFS08; 10, G542X,AFS08; and 11, AFS08 homozygote. as part ofa large multicenter study. Login to comment 197 ABCC7 p.Gly542* The corresponding products for the 621 + 1G-T and AFS08 mutant primers and for the GSS1D and G542X normal primers are in the second track of the pair. Login to comment 199 ABCC7 p.Gly551Asp ABCC7 p.Gly542* ABCC7 p.Gly542* The genotypes of the 11 samples are as follows: 1, normal; 2, normal; 3, normal; 4, 621 + 1G-T heterozygote; 5, G551D heterozygote; 6, G542X heterozygote; 7, AFS08 heterozygote; 8, 621 + 1G-T, AFS08; 9, GSS1D,AFS08; 10, G542X,AFS08; and 11, AFS08 homozygote. Login to comment 207 ABCC7 p.Asn1303Lys Furthermore, the Tm can be increased without altering ARMS primer specificity (e.g., a 40 mer version ofthe N1303K ARMS primers retained the same specificity; data not shown). Login to comment 211 ABCC7 p.Asn1303Lys Furthermore, the Tm can be increased without altering ARMS primer specificity (e.g., a 40 mer version ofthe N1303K ARMS primers retained the same specificity; data not shown). Login to comment 213 ABCC7 p.Arg117His ABCC7 p.Arg117His During the development of single ARMS tests, two other approaches were found to be useful in obtaining specificity; these were reducing the primer concentration (e.g., R117H; fig. 2b) and inclusion of a control PCR reaction (e.g., R117H; fig. 2c). Login to comment 216 ABCC7 p.Gly551Asp ABCC7 p.Gly551Asp ABCC7 p.Gly542* ABCC7 p.Gly542* ABCC7 p.Gly542* 1 2 3 blank 621 +lG>T G551D - ~ G542X F508 621 + 1 G>T G551 D G542X F508 621 +lG>T G551D \_-_ G542X F508 The use of long primers (typically 30 mers) ensured that false priming events were minimized and that primer template interactions were stabilized. Login to comment 217 ABCC7 p.Arg117His ABCC7 p.Arg117His During the development of single ARMS tests, two other approaches were found to be useful in obtaining specificity; these were reducing the primer concentration (e.g., R117H; fig. 2b) and inclusion of a control PCR reaction (e.g., R117H; fig. 2c). Login to comment 220 ABCC7 p.Gly551Asp ABCC7 p.Gly551Asp ABCC7 p.Gly542* ABCC7 p.Gly542* ABCC7 p.Gly542* 1 2 3 blank 621 +lG>T G551D - ~ G542X F508 621 + 1 G>T G551 D G542X F508 621 +lG>T G551D \_-_ G542X F508 The use of long primers (typically 30 mers) ensured that false priming events were minimized and that primer template interactions were stabilized. Login to comment 229 ABCC7 p.Gly542* This approach did not work, because the yields of several of the reactions were too low (GSSlD-normal, G542X-mutant, and AFS08 mutant) or too high (621 + 1G-T-normal and mutant) when compared with the yield of the other reactions (data not shown). Login to comment 233 ABCC7 p.Gly542* This approach did not work, because the yields of several of the reactions were too low (GSSlD-normal, G542X-mutant, and AFS08 mutant) or too high (621 + 1G-T-normal and mutant) when compared with the yield of the other reactions (data not shown). Login to comment 238 ABCC7 p.Gly542* An additional problem in the development ofa multiplex for the four most common CF mutations is the close proximity of GSS1D and G542X; these mutations are within 28 bp of each other in exon XI of the CFTR gene. Login to comment 241 ABCC7 p.Gly542* A potential problem with this method is the priming ofthe GSS1D product with the G542X primers or product. Login to comment 242 ABCC7 p.Gly542* An additional problem in the development ofa multiplex for the four most common CF mutations is the close proximity of GSS1D and G542X; these mutations are within 28 bp of each other in exon XI of the CFTR gene. Login to comment 243 ABCC7 p.Gly542* In our hands the approach worked well and allowed simultaneous detection of GS51D and G542X, although the relative yield ofthese two products was sensitive to changes in mismatch strength and primer concentration. Login to comment 245 ABCC7 p.Gly542* A potential problem with this method is the priming ofthe GSS1D product with the G542X primers or product. Login to comment 247 ABCC7 p.Gly542* In our hands the approach worked well and allowed simultaneous detection of GS51D and G542X, although the relative yield ofthese two products was sensitive to changes in mismatch strength and primer concentration. Login to comment