ABCMdb

PMID: 10627945

Gundry CN, Bernard PS, Herrmann MG, Reed GH, Wittwer CT
Rapid F508del and F508C assay using fluorescent hybridization probes.
Genet Test. 1999;3(4):365-70., [PubMed]

Sentences

No. Mutations Sentence Comment

51 ABCC7 p.Phe508Cys Ittttcctggattatgcctggcaccattaai |gaaaatatcatct/\tggtgtttccI A F508C _Sf2_ FIG 1 Schematic of the adjacent hybridization probe design. Login to comment 55 ABCC7 p.Phe508Cys The raised T in the 24-mer probe designates the position of the nucleotide creating a single base-pair mismatch when hybridized to the F508C alíele. Login to comment 59 ABCC7 p.Phe508Cys Either probe set can be used to genotype the wild type, F508del, and F508C alíeles, although the shorter probe set results in the best discrimination (see text). Login to comment 98 ABCC7 p.Phe508Cys This is a known and single nucleotide base change resulting in a phenylalanine to cysteine amino acid substitution (F508C) that has been indicated as a factor in male sterility (Meschede et al, 1993; Dörk et al, 1997). Login to comment 99 ABCC7 p.Phe508Cys The F508C variant created a T:C mismatch which was positioned exactly in the center of the 35-mer probe and 11 bp in from the 5'-end of the 24-mer probe (Fig. 1). Login to comment 101 ABCC7 p.Phe508Cys Figure 4 compares derivative melting peaks for the wild-type, F508del, and F508C alíeles. Login to comment 105 ABCC7 p.Phe508Cys Genotyping the F508del and F508C variants by derivative fluorescent heating curves using a 24-mer Cy5-labeled probe. Login to comment 106 ABCC7 p.Phe508Cys The samples shown are as follows: heterozygous F508del (-), heterozygous F508C (- • -), and no template control ( • ••). Login to comment 113 ABCC7 p.Phe508Cys The method is specific for different variants as shown by the ability to discriminate between the F508del mutation and the F508C base change. Login to comment 115 ABCC7 p.Phe508Cys Apparent Melting Temperature of Probe/Allele Duplexes Apparent Tm (°Cf Allele 35-mer 24-mer F508del F508C Wild type 61.6 64.6 68.6 53.8 59.0 64.0 "Apparent melting temperature at a heating rate of 0.1 °C/sec. Login to comment 148 ABCC7 p.Ile506Val Several sequence variants near codon 508 should be discriminated by this method, including the benign I506V (Kobayashi et al, 1990), and the disease-causing I507del and 1506del (Nelson et al, 1991). Login to comment 149 ABCC7 p.Gly551Asp ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Arg1162* Other clinically significant mutations (e.g., G542X, R553X, R1162X, N1303K, W1282X, G551D, G5151X, etc.) Login to comment