ABCMdb

PMID: 25386751

Noveski P, Madjunkova S, Mircevska M, Plaseski T, Filipovski V, Plaseska-Karanfilska D
SNaPshot assay for the detection of the most common CFTR mutations in infertile men.
PLoS One. 2014 Nov 11;9(11):e112498. doi: 10.1371/journal.pone.0112498. eCollection 2014., [PubMed]

Sentences

No. Mutations Sentence Comment

2 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Arg1162* Here, we describe single base extension (SNaPshot) assay for detection of 11 common CFTR mutations: F508del, G542X, N1303K, 621+1G-.T, G551D, R553X, R1162X, W1282X, R117H, 2184insA and 1717-1G-.A and IVS8polyT variants. Login to comment 29 ABCC7 p.Arg117His The three CFTR mutations most commonly associated with CBAVD are: c.1521_1523delCTT (F508del), c.1210-12T(5) (5T variant allele in intron 8) and c.350G.A (R117H) [10,11,12]. Login to comment 30 ABCC7 p.Arg117His Most of the cases with CBAVD are usually compound heterozygous for two different alleles and the most frequent mutations involved are F508del with 5T or R117H [6,13,14]. Login to comment 31 ABCC7 p.Arg117His The 5T allele is known to modify the expression of the R117H mutation when it is present on the same chromosome (in cis). Login to comment 32 ABCC7 p.Arg117His R117H mutation can be found in cis with IVS8-5T or -7T underlying a mild CF-causing complex allele when in cis with IVS8-5T, or as a CFTR-RD mutation when in cis with IVS8-7T [15]. Login to comment 37 ABCC7 p.Gly551Asp ABCC7 p.Asn1303Lys ABCC7 p.Gly542* Here, we present a rapid, reliable, cost-effective and simple assay for testing of 11 CFTR (NM_000492.3) mutations: F508del (c.1521_1523delCTT), G542X (c.1624G.T), N1303K (c.3909C.G), 621+1G-.T (c.489+1G.T), G551D (c.1652G. Login to comment 38 ABCC7 p.Arg117His ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Arg1162* A), R553X (c.1657C.T), R1162X (c.3484C.T), W1282X (c.3846G.A), R117H (c.350G.A), 2184insA (c.2052_2053insA) and 1717-1G.A (c.1585-1G.A). Login to comment 69 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Arg1162* Mutation analyzeda Name Sequence 59-.39 Exon/intron amplified (bp)b Length of PCR fragment amplified in bp 621+1G-.T, R117H CFTR ex4/F TCTTGTGTTGAAATTCTCAGGGTA exon4 (216) 374 CFTR ex4/R CCAGCTCACTACCTAATTTATGACA delF508 CFTR ex10/F TGAATCCTGAGCGTGATTTG exon10 (192) 302 CFTR ex10/R TGGGTAGTGTGAAGGGTTCAT G542X, G551D, R553X CFTR ex11/F GCCTTTCAAATTCAGATTGAGC exon11 (95) 288 CFTR ex11/R CTAGCCATAAAACCCCAGGA 2184insA CFTR ex13/F TGCAATAAAACATTAACAAAATGC exon13 (724) 480 CFTR ex13/R GGGAGTCTTTTGCACAATGG R1162X CFTR ex19/F TGTGAAATTGTCTGCCATTCTT exon19 (249) 369 CFTR ex19/R TGCTTCAGGCTACTGGGATT W1282X CFTR ex20/F CTGAATTATGTTTATGGCATGG exon20 (156) 249 CFTR ex20/R TTTTTCTGGCTAAGTCCTTTTG N1303K CFTR ex21/F TGATGGTAAGTACATGGGTGTTTC exon21 (90) 257 CFTR ex21/R CCCCTTTCA AAATCATTTCAG IVS8-5T/7T/9T CFTR intron 8/F GGCCATGTGCTTTTCAAACT intron8 (194) 194 CFTR intron 8/R AAGAAGAGGCTGTCATCACCA a Legacy name. Login to comment 73 ABCC7 p.Gly551Asp ABCC7 p.Arg117His ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Arg1162* CFTR mutation cDNA name according to HGVS (ref. seq. NM_000492.3) Sequence (59-.39) Orientation SNaPshot Result (normal/mutant allele) Size of extended fragment in base pairs (normal allele/mutant allele)a Concentration in mix (mM)b G542X c.1624G.T CAGTGTGATTCCACCTTCTC Reverse C/A (24.9/25.9) 3 N1303K c.3909C.G CCCACTGTTCATAGGGATCCAA Reverse G/C (26.3/26.9) 5 F508del c.1521_1523delCTT CCCCTGGCACCATTAAAG- AAAATATCAT Forward C/T (29.6/31.0) 1 R117H c.350G.A 15(C)GGATAACAAGGAGGAAC Forward G/A (33.6/35.3) 7 IVS8-5T/7T/9T c.1210-12T[5_9] TGTGTGTGTGTGTGTGTGTTTTT Forward A/T 5T - 32.3 7T,9T - 33.4 1 621+1G-.T c.489+1G.T CCCTAGCTATGTTTAGTTTG- ATTTATAAGAAG Forward G/T (37.2/38.2) 5 IVS8-7T/9T c.1210-12T[7_9] 14(C)GTGTGTGTGTGTGT- GTGTTTTTTT Forward A/T 7T - 44.0 9T - 44.9 2 2184insA c.2052_2053insA 13(C)GTCTCCTGGACAGAAAC- AAAAAAA Forward C/A (38.7/39.7) 8 1717-1 G-.A c.1585-1G.A 9(C)GACTCTCTAATTTTC- TATTTTTGGTAATA Forward G/A (41.3/41.7) 2 G551D c.1652G.A 21(C)TGGAATCACACTGAG- TGGAG Forward G/A (43.4/43.9) 4 R553X c.1657C.T 24(C)AATCACACTGAGT- GGAGGTCAA Forward C/T (46.2/47.2) 2 W1282X c.3846G.A 28(C)GGATTCAATA- ACTTTGCAACAGTG Forward G/A (51.6/52.6) 1 R1162X c.3484C.T 29(C)ATTTCAGATG- CGATCTGTGAGC Forward C/T (51.0/52.0) 4 a Data generated on ABI PRISM 3130 Genetic Analyzer with POP-4 polymer, 36-cm capillary array and sized against GeneScan-120 LIZ size standard. Login to comment 98 ABCC7 p.Gly542* [1521_1523delCTT];[ = ] 3 100% G542X/[2] c. Login to comment 100 ABCC7 p.Gly542* [489+1G.T];[ = ] 2 100% G542X/F508del c. Login to comment 101 ABCC7 p.Arg117His [1624G.T];[1521_1523delCTT] 1 100% R117H/F508del c. Login to comment 103 ABCC7 p.Trp1282* [2052_2053insA];[1521 _1523delCTT] 1 100% W1282X/[2] c. Login to comment 104 ABCC7 p.Arg1162* [3846G.A];[ = ] 1 100% R1162X/[2] c. Login to comment 105 ABCC7 p.Arg553* ABCC7 p.Arg553* [3484C.T];[ = ] 1 100% R553X/R553X c. Login to comment 106 ABCC7 p.Asn1303Lys [1657C.T];[1657C.T] 1 100% N1303K/[2] c. Login to comment 108 ABCC7 p.Gly551Asp [1585-1G.A];[ = ] 1 100% G551D c. Login to comment 115 ABCC7 p.Gly542* Among the oligozoospermic men five patients carried CF mutation (3 with F508del and 2 with G542X) but one of them also carried the CFTR-RD mutation, i.e. 5T allele. Login to comment 120 ABCC7 p.Gly542* Compound heterozygosity for CF mutation (F508del or G542X) and CFTR-RD mutation (IVS8-5T) was present in higher frequency among patients with obstructive azoospermia (22.7%), when compared to the fertile controls (0%) p = 3.4261025 and all other groups of infertile men: non-obstructive azoospermia/severe oligozoospermia (1.14%, p = 1.1661023 ), azoospermia (0%, p = 3.3261024 ), oligozoospermia (0.92%, p = 4.8961024 ) and normoasthenoteratozoospermia (0%, p = 4.5461024 ). Login to comment 139 ABCC7 p.Gly542* ABCC7 p.Gly542* Patients CFTR genotype Intron8 polyT genotype N % Azoospermia [2]/[2] 5T/7T 8 10.1% [2]/[2] 5T/9T 1 1.3% [2]/[2] 7T/7T 56 70.9% [2]/[2] 7T/9T 14 17.7% Total 79 100.0% Oligozoospermia delF508/[2] 7T/9T 2 1.9% delF508/[2] 9T/9T 1 0.9% G542X/[2] 5T/9T 1 0.9% G542X/[2] 7T/9T 1 0.9% [2]/[2] 5T/7T 4 3.7% [2]/[2] 7T/7T 79 73.1% [2]/[2] 7T/9T 20 18.5% Total 108 100.0% Normoasthenoteratozoospermia delF508/[2] 7T/9T 1 1.4% delF508/[2] 9T/9T 2 2.7% [2]/[2] 5T/7T 6 8.2% [2]/[2] 7T/7T 49 67.1% [2]/[2] 7T/9T 14 19.2% [2]/[2] 9T/9T 1 1.4% Total 73 100.0% Fertile Controls delF508/[2] 7T/9T 2 1.5% [2]/[2] 5T/7T 8 5.9% [2]/[2] 5T/9T 1 0.7% [2]/[2] 7T/7T 96 70.6% [2]/[2] 7T/9T 27 19.9% [2]/[2] 9T/9T 2 1.5% Total 136 100.0% Note: [2] means no CF mutation detected on single chromosome. Login to comment 145 ABCC7 p.Arg117His CBAVD is the most common CFTR-RD, which is usually associated with the presence of one severe mutation (most commonly F508del) and one mild mutation (most commonly R117H or IVS8-5T) or two mild mutations. Login to comment 160 ABCC7 p.Gly542* We have genotyped one patient to have F508del/ IVS8-5T genotype, with histopathological diagnosis of testicular atrophy and one oligozoospermic patient with G542X/IVS8-5T genotype. Login to comment 162 ABCC7 p.Gly542* These results imply that F508del/IVS8-11TG-5T genotype might not be a cause of the infertility in the first patient, while G542X/IVS8-12TG-5T genotype is most probably a cause of infertility in the second patient. Login to comment 163 ABCC7 p.Gly542* Similar to F508del, G542X has never been found in linkage disequilibrium with IVS8-5T [39]. Login to comment