ABCMdb

PMID: 7544319

Brancolini V, Cremonesi L, Belloni E, Pappalardo E, Bordoni R, Seia M, Russo S, Padoan R, Giunta A, Ferrari M
Search for mutations in pancreatic sufficient cystic fibrosis Italian patients: detection of 90% of molecular defects and identification of three novel mutations.
Hum Genet. 1995 Sep;96(3):312-8., [PubMed]

Sentences

No. Mutations Sentence Comment

21 ABCC7 p.Trp1282* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* We have studied a cohort of 31 Italian patients with PS using firstly traditional methods to screen for mutations which predominate in the Italian population [AF508, G542X (Kerem et al. 1990b), N1303K (Osborne et al. 1991), 1717-1G--~A (Guillermit et al. 1990) and W1282X (Vidaud et al. 1990)], secondly denaturing gradient gel electrophoresis (DGGE) analysis of the entire coding part of the CFTR gene, thirdly testing for the presence of the two mutations [1811+ 1.2kbA--+G (Chillon et al., personal communication to the CF Genetic Analysis Consortium) and 3849+10kbC-+T (Highsmith et al. 1994)] located in non-coding portions of the gene, which were not detectable by DGGE, and finally intragenic microsatellites [IVS8/GT (Morral et al. 1991), IVS17b/TA and IVS17b/CA (Zielenski et al. 1991b)] mapping. Login to comment 33 ABCC7 p.Trp1282* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* Mutation detection Screening for mutations which predominate in our population: AF508, G542X, N1303K, 1717-1G---~A,W1282X, and of the two intronic mutations 3849+10kbC--+T and 1811+l.2kbA---~G was carried out as previously described (Ballabio et al. 1990;Friedman et al. 1991; Cremonesi et al. 1991; Vidaud et al. 1990; Highsmith et al. 1994; Chillon et al., personal communication to the CF Genetic Analysis Consortium). Login to comment 38 ABCC7 p.Gly542* Table 1 PCR primers and conditions for denaturing gradient gel electrophoresis analysis of exons 1 and 9 (for exon 9 two different PCR products were analyzed under different conditions in order to detect all possible base changes) Exon PCR primers 5"---~3" Annealing Denaturing Electrophoresis temperature (~C) range time (h) 1 TAGGTCTTTGGCATTAGGAG 54 40%-90% 6 (55GC)CCAAACCCAACCCATA CACAC (35GC)TGAAAATATCTGACAA 45 10%-60% 6 ACTC CCTTCCAGCACTACAAACTA (37GC)AACAGGGATTTGGGG 50 10%-60% 6 AATTA AACTAGAAAAAAAAAGAGA Results Screening for predominant mutations A preliminary screening for mutations being predominant in our population was carried out in our series of patients showing PS, revealing the presence of AF508 on 19 (30.6%) chromosomes, 1717-1G---~A and G542X on 2 (3.22%). Login to comment 39 ABCC7 p.Asn1303Lys ABCC7 p.Gly542* In a previous study the overall frequencies of mutations in the whole sample population referring to our Center had been evaluated on a sample of 1018 CF chromosomes having the following frequencies: AF508:516 (50.7%) chromosomes, G542X: 52 (5.1%), 1717-1G--->A: 41 (4.0%), N1303K: 35 (3.4%), WI282X: 14 (1.4%) (our unpublished results). Login to comment 41 ABCC7 p.Glu193Lys ABCC7 p.Asp579Gly ABCC7 p.Trp57Gly Amongst these, three were previously unreported (W57G, D579G and E193K) (Fig. 1). Login to comment 42 ABCC7 p.Gly1349Asp ABCC7 p.Arg334Trp ABCC7 p.Arg347Pro ABCC7 p.Ser1251Asn ABCC7 p.Arg352Gln ABCC7 p.Gly85Glu ABCC7 p.Thr338Ile ABCC7 p.Arg1158* ABCC7 p.Arg1066Cys ABCC7 p.Phe1052Val ABCC7 p.Arg1066His ABCC7 p.Glu193Lys ABCC7 p.Asp579Gly ABCC7 p.Trp57Gly The remaining 19 included R352Q (Cremonesi et al. 1992) (three chromosomes), G85E (Zielenski et al. 1991a), Dl152H (High- Fig. 1 A-C Direct sequencing of PCR products from three cystic fibrosis patients (CF) carrying the W57G (A), E193K (B) and D579G (C) mutations, in parallel with control samples (C) displaying normal sequences (N/N) smith et al., personal communication to the CF Genetic Analysis Consortium), R1066H (Ferec et al. 1992), T338I (Saba et al. 1993), 711 +5G--+A (Gasparini et al., personal communication to the CF Genetic Analysis Consortium), M1V (Cheadle et al. 1993), R334W (Gasparini et al. 1991) (two chromosomes each), 4382delA (Claustres et al. 1993), R1158X (Ronchetto et al. 1992), F1052V (Mercier et al. 1993), G1349D (Beaudet et al. 1991), 1898+3A-+G (Cremonesi et al. 1992), $549N (Cutting et al. 1990), 711+ 3A-->G (Petreska et al. 1994), R347P (Dean et al. 1990), 2789+5G--+A (Highsmith et al. 1990), R1066C (Fanen et al. 1992) and S1251N (K~ilin et al. 1992) (one chromosome each). Login to comment 44 ABCC7 p.Arg352Gln ABCC7 p.Trp57Gly ABCC7 p.Trp57Gly The W57G mutation was a T301 to G transversion in exon 3 substituting tryptophan at position 57 with glycine, and was detected in a patient from Northern Italy (Lombardia) bearing the R352Q mutation on the other chromosome. Login to comment 48 ABCC7 p.Asp579Gly ABCC7 p.Asp579Gly The D579G mutation was a A1868G transition in exon 12, substituting aspartic acid 579 with glycine and creating an AvrII restriction site. Login to comment 54 ABCC7 p.Asp579Gly For the second patient carrying the D579G 7 mutation, it was not possible to define the grandparental 8 transmission [grandparents originated from southern 9 (Puglia) and northern Italy (Lombardia-Emilia)]. Login to comment 61 ABCC7 p.Glu193Lys ABCC7 p.Glu193Lys 20 The third mutation, E193K, was a G709---~A transition 21 in exon 5 substituting the glutamic acid 193 with a lysine. Login to comment 65 ABCC7 p.Glu193Lys ABCC7 p.Asp579Gly ABCC7 p.Trp57Gly 31 The W57G mutation was not detected on an additional 132 CF and 50 normal chromosomes, D579G on an additional 115 CF and 50 normal chromosomes and E193K on an additional 108 CF and 54 normal chromosomes. Login to comment 70 ABCC7 p.Gly1349Asp ABCC7 p.Arg334Trp ABCC7 p.Arg334Trp ABCC7 p.Arg347Pro ABCC7 p.Gly542* ABCC7 p.Gly542* ABCC7 p.Gly542* ABCC7 p.Gly542* ABCC7 p.Ser1251Asn ABCC7 p.Arg352Gln ABCC7 p.Arg352Gln ABCC7 p.Arg352Gln ABCC7 p.Gly85Glu ABCC7 p.Gly85Glu ABCC7 p.Ser549Asn ABCC7 p.Thr338Ile ABCC7 p.Thr338Ile ABCC7 p.Arg1158* ABCC7 p.Arg1066Cys ABCC7 p.Asp1152His ABCC7 p.Phe1052Val ABCC7 p.Arg1066His ABCC7 p.Arg1066His ABCC7 p.Glu193Lys ABCC7 p.Asp579Gly ABCC7 p.Asp579Gly ABCC7 p.Trp57Gly (UN yet unidentified mutation) Patient Genotype after Genotype at the end number preliminary screening of the analysis UN/UN M1V/4382delA 1717-1G---~A/UN 1717-1G---~A/R1066H AF508/UN AF508/D579G UN/UN M1V/UN AF508/UN AF508/UN UN/UN T338I/R1158X UN/UN G85E/71 I+5G---~A UN/UN D1152H/UN AF508/UN AF508/UN AF508/UN AF508/3849+ 10kbC---~T UN/UN 711+3A---~G/UN AF508/UN AF508/F1052V UN/UN R352Q/W57G UN/UN 1898+3A----~G/UN AF508/UN AF508/711+5G--~A G542X/UN G542X/DI 152H AF508/UN AF508/E193K 1717-1G---~A/UN 1717-1G---~A/2789+5A---)G AF508/UN AF508/G1349D AF508/UN AF508/G85E AF508/UN AF508/R347P AF508/UN AF508/R352Q AF508/UN AF508/R352Q AF508/UN AF508/S549N G542X/UN G542X/R1066H AF508/UN AF508/T338I AF508/UN AF508/R334W AF508/UN AF508/R334W AF508/UN AF508/S1251N AF508/UN AF508/R1066C AF508/UN AF508/D579G results) while the remaining three haplotypes had been found in association with other rare mutations, which were excluded by DGGE analysis in these patients (Table 3). Login to comment 75 ABCC7 p.Arg334Trp ABCC7 p.Arg352Gln These, in combination with three mutations identified through a preliminary screening for predominant mutations and one intronic mutation, identified molecular de- Table 3 Microsatellite haplotypes detected in association with yet uncharacterized chromosomes and their distribution among CF and normal chromosomes Patient Microsatellite haplotype CF chromosomes Normal number chromosomes IVS8 IVS 17b IVS 17b AF508 Other Unknown GT TA CA mutations mutations 14 16 30 14 0 0 1 0 4 16 31 13 0 2~ 7 36 II 16 28 12 0 0 l 0 5,8 16 30 13 0 5b 11 25 9 16 7 17 0 21~ 8 33 Total chromosomes analyzed 97 77 46 220 ~Both chromosomes carry the D 1152H mutation bG 1349D, R352Q, 1898+3A---~G, 4382delA, R334W (one chromosome each) 1717-1G---~A (15 chromosomes). Login to comment 77 ABCC7 p.Glu193Lys ABCC7 p.Asp579Gly Among the new mutations detected in this study, both D579G and E193K were found in patients compound heterozygous for AF508 and presumably cause the mild pancreatic status, being dominant over AF508. Login to comment 78 ABCC7 p.Arg352Gln ABCC7 p.Trp57Gly ABCC7 p.Trp57Gly W57G was found in a patient carrying R352Q on the other chromosome, and we cannot exclude a contribution to the PS phenotype by the W57G mutation. Login to comment 85 ABCC7 p.Gly1349Asp ABCC7 p.Arg334Trp ABCC7 p.Gly542* ABCC7 p.Ser1251Asn ABCC7 p.Arg352Gln ABCC7 p.Gly85Glu ABCC7 p.Thr338Ile ABCC7 p.Arg1066Cys ABCC7 p.Asp1152His ABCC7 p.Phe1052Val ABCC7 p.Arg1066His ABCC7 p.Glu193Lys ABCC7 p.Asp579Gly In total, among the mutations detected in our PS patients, 17 (D579G, E193K, F1052V, 711+5G---~A, G1349D, G85E, R347R R352Q, $549N, 2789+5A---~G, D1152H, R1066H, R334W, T338I, 3849+10kbC---~T, S1251N, R1066C) have been detected in compound heterozygosity with a mutation already classified as severe (AF508, 1717-1G--~A, G542X) and thus can be considered as presumably mild. Login to comment 86 ABCC7 p.Arg334Trp ABCC7 p.Arg334Trp ABCC7 p.Arg347Pro ABCC7 p.Arg347Pro ABCC7 p.Arg352Gln ABCC7 p.Arg352Gln ABCC7 p.Gly85Glu ABCC7 p.Gly85Glu ABCC7 p.Thr338Ile ABCC7 p.Arg1066Cys ABCC7 p.Asp1152His ABCC7 p.Phe1052Val ABCC7 p.Glu193Lys ABCC7 p.Asp579Gly Of these mutations, seven (G85E, EI93K, 711+5G--qA, R347P, R334W, R352Q, T338|) are located in the first transmembrane (I TM) domain, five (2789+ 5A---~G, RI066H, F1052V, D1152H, R1066C) in the second transmembrane (II TM) domain, four in the nucleo- R334W R347P R352Q T338I E193K 711+.E G85E 1 2 3 4 D579G G->A I S 549N 5 6a 6b 7 8 9 10 11 12 13 3849+11 !11 ! Login to comment 87 ABCC7 p.Gly1349Asp ABCC7 p.Ser1251Asn ABCC7 p.Arg1066Cys ABCC7 p.Asp1152His ABCC7 p.Phe1052Val ABCC7 p.Arg1066His R1066C R1066H F1052V 2789+5A->G D1152H 14a14b 15 1617a 17b 18 19 S1251N ItKbC->T G1349D m III! Login to comment 88 ABCC7 p.Gly1349Asp ABCC7 p.Ser1251Asn ABCC7 p.Asp579Gly 20 21 22 23 24 MEMBRANE SPANNING ATP R DOMAIN MEMBRANE SPANNING ATP BINDING BINDING tide binding folds ($549N and D579G in the NBF I, G1349D and S1251N in the NBF II) and one in intron 19 (3849+10kbC--~T), further confirming that the milder defects mostly affect the membrane spanning domains with a greater incidence on the I TM (Fig. 2). Login to comment 89 ABCC7 p.Trp1282* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* The results of this search showed, as expected, a different distribution of classical severe mutations (AF508, G542X, 1717-1G-+A, N1303K, W1282X) in patients with PS as compared to the overall CF population (37.1% against 67.4%). Login to comment 90 ABCC7 p.Arg117His ABCC7 p.Arg347Pro Moreover, some classical mild mutations, which have been frequently detected in other PS sample populations, are absent (R117H) (Dean et al. 1990) or infrequent (R347P) in our patients. Login to comment 91 ABCC7 p.Arg334Trp ABCC7 p.Arg352Gln ABCC7 p.Gly85Glu ABCC7 p.Thr338Ile ABCC7 p.Arg1066His ABCC7 p.Asp579Gly Conversely, other presumably mild mutations such as R352Q (three chromosomes), and G85E, Dl152H, 711+5G--~A, R1066H, T338I, R334W, D579G (two chromosomes each), are more frequently detected in the PS cohort, accounting in total for 27.4% of chromosomes. Login to comment 93 ABCC7 p.Arg334Trp ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Arg352Gln ABCC7 p.Gly85Glu ABCC7 p.Thr338Ile ABCC7 p.Arg1066His ABCC7 p.Asp579Gly Screening for only eight presumed mild mutations (R352Q, R1066H, G85E, Dl152H, 711+5G---~A, T338I, R334W and D579G) in addition to the predominant four severe mutations (AF508, G542X, 1717-1G-+A and N1303K), would have allowed the identification of 64.5% of the molecular defects in our patients having PS. Login to comment