ABCMdb

PMID: 1379210

Fanen P, Ghanem N, Vidaud M, Besmond C, Martin J, Costes B, Plassa F, Goossens M
Molecular characterization of cystic fibrosis: 16 novel mutations identified by analysis of the whole cystic fibrosis conductance transmembrane regulator (CFTR) coding regions and splice site junctions.
Genomics. 1992 Jul;13(3):770-6., [PubMed]

Sentences

No. Mutations Sentence Comment

55 ABCC7 p.Gly551Asp ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Arg1162* Six of these mutations, G542X, G551D, 1717-1 G-A (Fig. l), 3659delC, R1162X, and N1303K, have been reported previously (Cutting et al., 1990; Gasparini et al., 1991b; Guillermit et al., 1990; Kerem et al., 1990; Osborne et al., 1991). Login to comment 58 ABCC7 p.Trp1282* We have previously reported the mutation W1282X (Vidaud et al., 1990a). Login to comment 59 ABCC7 p.Lys1200Glu The two others, 3732delA and K1200E, which have not been described before, were found to be contained in the same CFTR allele in exon 19, the other CF chromosome bearing the 1717-1 G-A defect. Login to comment 61 ABCC7 p.Lys1200Glu Although the residue involved switches from basic to acid, we cannot be certain that the K1200E substitution is disease-causing, even though it has not been found among a large number of normal chromosomes. Login to comment 63 ABCC7 p.Lys710* In addition to K710X nonsense and 2034delG frameshift (disease-causing) defects, two missense mutations were detected. Login to comment 64 ABCC7 p.Gly628Arg One was in a patient heterozygous for a G-to-A transition at nucleotide position 2014 (G628R in the numbering system of Riordan) (Riordan et al., 1989). Login to comment 66 ABCC7 p.Asp44Gly In TABLE 1 Oligonucleotides Used for Amplification and DGGE Analysis of CFTR Gene Exons Annealing Amplified Denaturant Exon PCR primers, 5` + 3 temperature ("C) product (bp) 1 2 3 4 5 6a 6b 7 8 9 10 11 12 13 14a 14b 15 16 17a 17b 18 19 20 21 22 23 24 CGTAGTGGGTGGAGAAAGC (CFl) [55 GC] CCAAAGCCAACCCATACACA (GCCFl) CCAAATCAAGTGAATATCTG (CF2) [40 GC] TAATAATATGAATTTCTCTCTT (GCCFB) TTGGATATACTTGTGTGAAT (CF3) [40 GC] TTCGTAGTCTTTTCATAATC (GCCF3) TGTGTTGAAATTCTCAGGGT (CF4) [40 GC] CAGAATATATGTGCCATGGG (GCCF4) [35GC] TATTTGTATTTTGTTTGTTGA (GCCF5) CTTTCCAGTTGTATAATTTA (CF5) [50 GC] TGGAAGATACAATGACACCTG (GCCFGa) GCATAGAGCAGTCCTGGTTT (CF6a) TATGACTTAAAACCTTGAGC (CFGb) [40 GCIAAGGACAGAATTACTAACAA (GCCFGb) CATCCTGAATTTTATTGTTA (CF7) [50 GC] ATCATAGTATATAATGCAGC (GCCF7) [50 GC] TAAAGTAGATGTAATAATGC (GCCFS) ATTTTATTCGCCATTAGGAT (CFS) TGAAAATATCTGACAAACTC (CF9) GGGGAATTATTTGAGAAAGC (CF9i) [40 GC] CCTTCCAGCACTACAAACTA (GCCFS) TCCTGAGCGTGATTTGATAA (CFlO) [35 GCIATTTGGGTAGTGTGAAGGG (GCCFlO) [35 GC] CAGATTGAGCATACTAAAAGTG (GCCFll) CATTTACAGCAAATGCTTGCTAG (CFll) ATGACCAGGAAATAGAGAGG (CF12) [30 GC] GCTACATTCTGCCATACCAA (GCCF12) [35 GC] TATATCTTAAAGCTGTGTCTGT (GCCF1311) TCCCTGCTCAGAATCTGGTA (CF1312) [50 GC] CCCTTACAAATGAATGGCAT (GCCF1321) TATCCAGTTCAGTCAAGTTT (CF1322) [50 CC] CCCTTACAAATGAATGGCAT (GCCF1321) TACATATTGCATTCTACTCA (CF1323) CAAAATGCTAAAATACGAGACA (CF13-3) TCCCTGCTCAGAATCTGGTA (CF1312) [35 GC] GGTGGCATGAAACTGTACTG (GCCF14a) TGTATACATCCCCAAACTATCT (CF14a) AATAGGTGAAGATGTTAGAA (CF14b) [40 GC] ATAAAACACAATCTACACAA (GCCF14b) TCAGTAAGTAACTTTGGCTGC (CF15) [40 GC] CCTATTGATGGTGGATCAGC (GCCF15) [25 GC] TCTGAATGCGTCTACTGTGA (GCCF16) GCAATAGACAGGACTTCAAC (CF16) [35 GC] TGCAATGTGAAAATGTTTAC (GCCF17a) CTCTTATAGCTTTTTTACAA (CF17a) [40 GC] TTTGTGTTTATGTTATTTGC (GCCFl7b) TGCAGCATTTTATTCATTGA (CF17b) ATCATTTCTATTCTCATTTG (CFl7bi) TAGGAGAAGTGTGAATAAAG (CF18) [40 GC] ATACTTTGTTACTTGTCTGA (GCCF18) GTGAAATTGTCTGCCATTCT (CF19) [45 GC] AGGCTACTGGGATTCACTTA (GCCF19) [35 CC] TATGTCACAGAAGTGATCCC (GCCFZO) TGAGTACAAGTATCAAATAGC (CF20) TGAAATATTTTACAATACAATAAGGG (CF21) [40 CC] GCCATTTGTGTTGGTATGAG (GCCF21) TTTTAGAATGTCAACTGCTT (CF22) [50 GC] ATGATTCTGTTCCCACTGTG (GCCF22) [40 GC] CTGTTCTGTGATATTATGTG (GCCF23) GTTATCAAGAATTACAAGGG (CF23) TTTCTGTCCCTGCTCTGGTC (CF24) [40 GC] TCCCACGAGCTCCAATTCCA (GCCF24) 55 451 range (%) 40-80 50 240 lo-60 50 323 lo-60 55 369 30-80 45 235 lo-60 55 345 50 301 40-90 and lo-60 lo-60 50 365 lo-60 45 302 lo-60 55 375 lo-60 55 298 lo-60 55 336 lo-60 50 224 lo-60 55 296 lo-60 55 516 25-75 50 318 40-90 50 454 lo-60 55 545 O-60 55 276 50 168 lo-60 lo-60 55 390 lo-60 55 323 lo-60 45 283 lo-60 50 382 lo-60 50 266 30-80 48 277 lo-60 55 55 407 302 30-80 lo-60 55 272 55 340 lo-60 and 30-80 30-80 50 242 lo-60 60 362 30-80 Running time (h) 7 3 3 5 3 5 5 4 6 3 5 5 4 3 3 2 4 4 2 6 5 3 5 3 4 4 3 3 5 5 5 5 5 3 4 TABLE 2 Mutations Identified in this Study 773 Name Amino acid change Nucleotide change Exon - D44G 241delAT 574delA G1`78R 711 + 1 G -. Login to comment 67 ABCC7 p.Gly551Asp ABCC7 p.Trp1282* ABCC7 p.Arg334Trp ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Arg1162* ABCC7 p.Arg1066Cys ABCC7 p.Tyr1092* ABCC7 p.Lys710* ABCC7 p.Cys225Arg ABCC7 p.Trp846* ABCC7 p.Lys1200Glu ABCC7 p.Gly628Arg ABCC7 p.Trp1063* ABCC7 p.Tyr913Cys T C225R R334W G542X G551D 1717-l G -+ A K710X Lys -b Stop at 710 A-+Tat2260 G628R Gly + Arg at 628 G+Aat2014 2043 delG Frameshift 1 -bp deletion W846X Trp --, Stop at 846 G-+Aat2670 2789 + 5 G - A Splice mutation G + A at 2789 + 5 Y913C Tyr --) Cys at 913 A-,Gat2870 3272-26 A -+ G Splice mutation A + G at 3272-26 W1063X Trp -+ Stop at 1063 G+Aat3321 R1066C Arg + Cys at 1066 C+Tat3328 Y1092X Tyr + Stop at 1092 C + A at 3408 3659delC Frameshift l-bp deletion 19 3732deIA Frameshift 1-bp deletion 19 K1200E Lys --, Glu at 1200 A+Gat3730 19 R1162X Arg - Stop at 1162 C + T at 3616 19 W1282X Trp + Stop at 1282 G+Aat3978 20 N1303K Asn -+ Lys at 1303 C -+ G at 4041 21 4374 + 1 G + A Splice mutation G+Aat4374+ 1 Intron 23 Asp + Gly at 44 Frameshift Frameshift Gly + Arg at 178 Splice mutation Cys + Arg at 225 Arg + Trp at 334 Gly + Stop at 542 Gly + Asp at 551 Splice mutation A+Gat263 2 2bp deletion 2 1-bp deletion 4 G --, A at 664 5 G + Tat 711 + 1 Intron 5 T+Cat805 6a C + Tat 1132 7 G + T at 1756 11 G+Aat1784 11 G + A at 1717-l Intron 10 Haplotype Restriction (XV-2c, KM-19) site change Reference A B A A or C A D A B, D B B Hinfl(-) - - - - SecI (+) MspI (6) - Mb01 (+) - 13 13 13 14a Intron 14 b 15 Intron 17a 17b 17b 17b C A B A D A A C B C XmnI (-) - - - MnlI (-) - - This study This study This study Zielenski et al. (1991) Zielenski et al. (1991) This study Gasparini et al. (1991b) Kerem et al. (1990) Cutting et al. (1990) Kerem et al. (1990); Guillermit et al. (1990) This study This study This study Vidaud et al. (1990a) Highsmith et al. (1990) Vidaud et al. (1990a) This study This study This study Bozon (personal communication) Kerem et al. (1990) This study Together with 3732delA Gasparini et al. (1991b) Vidaud et al. (1990a) Osborne et al. (1991) This study Note. Previously undescribed mutations are shown in bold type. Login to comment 73 ABCC7 p.Trp846* (574delA), one introduced a stop codon (W846X), and the other three were missense defects. Login to comment 74 ABCC7 p.Cys225Arg The C225R mutation was detected in exon 6a in a CF patient with pancreatic disease requiring pancreatic enzyme supplementation and who also bore the AF508 deletion. Login to comment 76 ABCC7 p.Tyr913Cys The Y913C mutation, which we havepre- viously reported (Vidaud et al., 1990a), probably has a similar effect. Login to comment 78 ABCC7 p.Arg334Trp The R334W mutation (exon 7) was found in two patients heterozygous for the AF508 deletion. Login to comment 82 ABCC7 p.Trp846* The patient with this defect bears the W846X mutation on the other CF allele, has mild pulmonary disease, and is pancreatic sufficient. Login to comment 83 ABCC7 p.Leu997Phe In a further case, two substitutions-L997F and 11027T (exon 17a)-were shown in familial studies to be located within the AF508 CF allele. Login to comment 89 ABCC7 p.Arg1066Cys ABCC7 p.Tyr1092* ABCC7 p.Gly178Arg ABCC7 p.Trp1063* ABCC7 p.Asp44Gly Analysis of the Remaining Exons Other mutations or candidate mutations were detected outside the regions cited above and included D44G, 241delAT (exon 2) (Fig. l), G178R, 711 + 1 G-T (exon 5), W1063X, R1066C, Y1092X (exon 17b) (Fig. 2), and 4374 + 1 G-A (intron 23). Login to comment 100 ABCC7 p.Asn1303Lys A good example is the N1303K mutation (due to a C-to-G substitution) detected here, yet considered to be difficult to distinguish by DGGE (Traystman et al., 1990). Login to comment 101 ABCC7 p.Lys710* ABCC7 p.Gly576Ala ABCC7 p.Asp44Val Similarly, other substitutions of the G-C (or A-T) type were detected, e.g., the D44V (Fig. l), K710X, and G576A substitutions (Tables 2 and 3). Login to comment 108 ABCC7 p.Gly551Asp ABCC7 p.Gly551Asp ABCC7 p.Gly542* ABCC7 p.Gly542* Two mutations in exon 11-G551D and G542X-are more frequent than the other non-AF508 mutations: G542X represents 4-6% in all parts of the country except Brittany, while G551D is present at a rate of 4% in the population of Celtic origin (Ferec, personal communication). Login to comment 116 ABCC7 p.Leu997Phe (1990) This study This study This study This study Zielenski et al. (1991) This study Together with L997F This study Ferec (personal communication) This study Shoshani (personal communication) Note. Previously undescribed polymorphisms are shown in bold type. Login to comment