ABCMdb

PMID: 10388469

Castaldo G, Fuccio A, Cazeneuve C, Picci L, Salvatore D, Raia V, Scarpa M, Goossens M, Salvatore F
Detection of five rare cystic fibrosis mutations peculiar to Southern Italy: implications in screening for the disease and phenotype characterization for patients with homozygote mutations.
Clin Chem. 1999 Jul;45(7):957-62., [PubMed]

Sentences

No. Mutations Sentence Comment

13 ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* A few mutations (i.e., ⌬F508, N1303K, G542X, and R553X) are frequent worldwide; the other mutations are regional or "private" mutations. Login to comment 14 ABCC7 p.Trp1282* Several mutations are peculiar to specific ethnic groups, i.e., W1282X is frequent among Ashkenazi (4), 1 Centro di Ingegneria Genetica scarl and Dipartimento di Biochimica e Biotecnologie Mediche, Universita` di Napoli "Federico II", 80131 Naples, Italy. Login to comment 24 ABCC7 p.Arg1162* ABCC7 p.Thr338Ile Clinical Chemistry 45:7 957-962 (1999) Molecular Diagnostics and Genetics T338I is typical among Sardinians (5), and 2183AA3G and R1162X are frequent in Northeastern Italy (5). Login to comment 36 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Ile148Thr All patients were first analyzed for eight CF mutations, i.e., ⌬F508, N1303K, G542X, W1282X, 1717-1G3A, R553X, 2183AA3G, and I148T (9). Login to comment 39 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Asn1303Lys ABCC7 p.Gly542* ABCC7 p.Ile148Thr methods The eight CF mutations (i.e., ⌬F508, N1303K, G542X, W1282X, 1717-1G3A, R553X, 2183AA3G, and I148T) were identified with a semi-automated procedure based on a single multiplex PCR amplification followed by the allele-specific oligonucleotide (ASO) identification we described previously (9). Login to comment 46 ABCC7 p.Gly1244Glu ABCC7 p.Leu1065Pro ABCC7 p.Arg1158* aso dot-blot procedure for the analysis of the five "rare" cf mutations To analyze routinely the five mutations (i.e., L1065P, 711ϩ1G3T, R1158X, 4016insT, and G1244E) we set up a procedure based on a single multiplex PCR amplification followed by ASO dot-blot hybridization. Login to comment 49 ABCC7 p.Gly1244Glu ABCC7 p.Leu1065Pro ABCC7 p.Arg1158* Mutation Forward primer (5؅) Reverse primer (3؅) Wild-type oligo for ASO dot blota Mutated oligo for ASO dot blota L1065P (exon 17b) 5ЈTTCAAAGAATGGCACCAGTGT 3ЈATAACCTATAGAATGCAGCA 5ЈATGGACACTTCGTGCCT (52 °C) 5ЈTGGACACCTCGTGCCT (52 °C) 4016insT (exon 21) 5ЈAATGTTCACAAGGGACTCCA 3ЈCAAAAGTACCTGTTGCTCCA 5ЈAGTATTTATTTTTTCTGGAAC (52 °C) 5ЈGTATTTATTTTTTTCTGGAAC (52 °C) 711ϩ1G3T (intron 5) 5ЈATTTCTGCCTAGATGCTGGG 3ЈAACTCCGCCTTTCCAGTTGT 5ЈTTGATGAAGTATGTACCTAT (52 °C) 5ЈTTTGATGAATTATGTACCTAT (52 °C) R1158X (exon 19) 5ЈGCCCGACAAATAACCAAGTGA 3ЈGCTAACATTGCTTCAGGCT 5ЈTTCAGATGCGATCTGTGA (52 °C) 5ЈTTTCAGATGTGATCTGTGA (52 °C) G1244E (exon 20) 5ЈGGTCAGGATTGAAAGTGTGCA 3ЈCTATGAGAAAACTGCACTGGA 5ЈCCTCTTGGGAAGAACTGGA (53 °C) 5ЈCCTCTTGGAAAGAACTGGA (51 °C) a For each oligonucleotide, the optimal washing temperature of the filter is reported. Login to comment 53 ABCC7 p.Gly1244Glu ABCC7 p.Leu1065Pro ABCC7 p.Arg1158* Results The DGGE screening allowed us to identify 20 different mutations; five of these, i.e., R1158X, G1244E, 4016insT, 711ϩ1G3T, and L1065P, were observed with a frequency Ͼ1.0% among 396 CF alleles from Southern Italy. Login to comment 55 ABCC7 p.Leu1065Pro The homozygote (Fig. 1A) and heterozygote (Fig. 1B) patterns of exon 17b are clearly altered; sequence analysis revealed the L1065P mutation. Login to comment 57 ABCC7 p.Leu1065Pro The incidence of the L1065P mutation in our series of 396 CF chromosomes was 1.3%. Login to comment 58 ABCC7 p.Leu1065Pro One patient homozygous for L1065P showed a mild pulmonary and gastrointestinal form of CF, with a moderate pancreatic insufficiency and mild liver involvement. Login to comment 66 ABCC7 p.Arg1158* The R1158X mutation was identified through the altered DGGE pattern of exon 19, followed by sequence Fig. 1. Login to comment 70 ABCC7 p.Leu1065Pro The sequence analysis revealed the L1065P mutation. Login to comment 76 ABCC7 p.Arg1158* The incidence of R1158X among CF chromosomes from our regions was 1.3%. Login to comment 87 ABCC7 p.Leu1065Pro ABCC7 p.Arg1158* An example of the improved ASO dot-blot procedure used to analyze the five mutations is shown in Fig. 3 for R1158X (Fig. 3A), L1065P (Fig. 3B), 4016insT (Fig. 3C), 711ϩ1G3T (Fig. 3D), and G1244EG3A (Fig. 3E). Login to comment 93 ABCC7 p.Arg1158* Mutation R1158X has a frequency of 0.8% in Greece (20); only one allele bearing the mutation has been described in Spain (21), and two alleles have been described in France (22). Login to comment 95 ABCC7 p.Arg1162* ABCC7 p.Thr338Ile Several mutations highly frequent in Northern Italy (R1162X and 711ϩ5G3A) have not been detected in Southern Italy, neither has T338I, which is peculiar to Sardinia (5). Login to comment 97 ABCC7 p.Leu1065Pro Mutation L1065P has been reported in ϳ3% of CF chromosomes (24) from Sicily (Southern Italy). Login to comment 99 ABCC7 p.Arg1158* Different haplotypes have been described only for R1158X, which suggests a recurrent origin (19) or rather, several recombinant events. Login to comment 100 ABCC7 p.Arg1158* Mutation R1158X, which has a frequency of 0.8% in the Greek population (18, 20), could have been introduced into Southern Italy by the ancient Greeks who colonized this geographic area. Login to comment 103 ABCC7 p.Arg1158* We observed the same haplotype in all five alleles bearing the R1158X mutation, i.e., 1, 2, 6, 7, 17 (XV2c, KM19, IVS8CA, IVS17bTA, and IVS17bCA). Login to comment 105 ABCC7 p.Arg1158* Of the two chromosomes bearing the R1158X mutation described in France, one showed haplotype 2, 2, 16, 7, 17, and the other Table 2. Login to comment 107 ABCC7 p.Leu1065Pro ABCC7 p.Leu1065Pro ABCC7 p.Arg1158* ABCC7 p.Arg1158* Genotype 4016insT/4016insT R1158X/R1158X L1065P/L1065P Ethnic origin Southern Italy Southern Italy Southern Italy Present age 23 years Death at 20 years 18 years Age at diagnosis 2 years 3 months 1 year Meconium ileus No No No Nasal polyposis No No No Lung involvement Severe Very severe Mild FEV 1, % of predicted 38 18 62 Liver involvement Cholestasis Moderate Mild Pancreatic insufficiency Moderate Moderate Moderate Sweat chloride 70 mEq/L 98 mEq/L 93 mEq/L Table 3. Login to comment 109 ABCC7 p.Leu1065Pro ABCC7 p.Arg1158* CF mutation XV2c KM19 IVS18CA IVS17bTA IVS17bCA M470V R1158X 1 2 16 7 17 M L1065P 1 1 16 30 13 V 711ϩ1G3T 1 1 16 25 13 V 4016insT 2 1 16 30 13 V G1244EG3T 1 1 16 34 13 V showed haplotype 2, 2, 16, 45, 13, suggesting the recurrent origin of the mutation or a recombinant event (18, 22). Login to comment 129 ABCC7 p.Leu1065Pro ABCC7 p.Arg1158* The patient homozygous for R1158X (a nonsense mutation) and the patient homozygous for 4016insT (a frameshift mutation) showed very severe expression of CF (because the synthesis of the wild-type protein was suppressed) compared with the patient homozygous for L1065P, a missense mutation associated with the synthesis of a protein with a single amino acid substitution. Login to comment 135 ABCC7 p.Leu1065Pro ABCC7 p.Arg1158* For R1158X (A) and L1065P (B), 1 and 2 are heterozygotes for the mutation, 3 is a homozygote for the mutation, and 4 is a healthy control. Login to comment 137 ABCC7 p.Gly1244Glu For 711ϩ1G3T (D) and G1244E (E), 1 and 2 are healthy controls, and 3 and 4 are heterozygotes for the mutation. Login to comment