ABCMdb

PMID: 7520798

Shoshani T, Augarten A, Yahav J, Gazit E, Kerem B
Two novel mutations in the CFTR gene: W1089X in exon 17B and 4010delTATT in exon 21.
Hum Mol Genet. 1994 Apr;3(4):657-8., [PubMed]

Sentences

No. Mutations Sentence Comment

1 ABCC7 p.Trp1089* 4 -658 Two novel mutations in the CFTR gene: W1089X in exon 17B and 4010delTATT in exon 21 Tzipora Shoshanl, Arie Augarten1 . Login to comment 6 ABCC7 p.Trp1282* Among Ashkenazi Jewish CF patients one major mutation, W1282X, was found in 60% of the CF chromosomes (3). Login to comment 7 ABCC7 p.Asn1303Lys ABCC7 p.Gly542* Together with the AF5O8 mutation and three other less common mutations (G542X, N1303K and 3849 + 10 Kb C-T) CFFM Figure 1. Login to comment 8 ABCC7 p.Trp1089* Analysis of BstNI digestion of the gertomic region surrounding the W1089X mutation. Login to comment 12 ABCC7 p.Trp1089* Digestion of DNA from individuals heterozygous for the W1089X mutation generates three bands, 208, 184 and 24 bp, again the 24 bp has migrated out of the gel (The patient and his mother, CF and M). Login to comment 19 ABCC7 p.Trp1089* This mutation, designated W1089X, is predicted to produce a truncated protein, which lacks part of the second transmembrane domain and the second nucleotide binding fold. Login to comment 22 ABCC7 p.Trp1089* Therefore, it is most likely that the W1089X termination mutation is a disease causing mutation. Login to comment 23 ABCC7 p.Trp1089* The W1089X mutation does not alter a restriction enzyme site, thus, to facilitate testing for this mutation, a restriction site generating PCR test (RG-PCR) was generated. Login to comment 24 ABCC7 p.Trp1089* The PCR was performed using the oligonucleotide primers 17bi-3 (8) and a mismatch primer, 5' GCTCTGAATTTACATACTGCCAC 3' artificially designed to create a BstNI site (CCTGG) with the normal sequence but not with the mutant W1089X sequence (CC- TAG). Login to comment 36 ABCC7 p.Trp1089* Testing 138 chromosomes carrying unidentified CF mutations revealed one more chromosome with the W1089X mutation. Login to comment 37 ABCC7 p.Trp1089* Both CF chromosome carrying the W1089X mutation carry the same extra- and intragenic haplotype, A112 (9). Login to comment