PMID: 16540752

de Vries TW, Ajubi N, Slomp J, Storm H
Analyzing DNA from buccal cells is a reliable method for the exclusion of cystic fibrosis. Results of a pilot study.
Genet Med. 2006 Mar;8(3):175-7., [PubMed]
Sentences
No. Mutations Sentence Comment
36 ABCC7 p.Gly551Asp
X
ABCC7 p.Gly551Asp 16540752:36:187
status: NEW
view ABCC7 p.Gly551Asp details
ABCC7 p.Arg553*
X
ABCC7 p.Arg553* 16540752:36:194
status: NEW
view ABCC7 p.Arg553* details
ABCC7 p.Asn1303Lys
X
ABCC7 p.Asn1303Lys 16540752:36:201
status: NEW
view ABCC7 p.Asn1303Lys details
ABCC7 p.Gly542*
X
ABCC7 p.Gly542* 16540752:36:180
status: NEW
view ABCC7 p.Gly542* details
3 b r i e f r e p o r t Genetics IN Medicine Polymerase Chain Reaction (PCR) PCR followed by restriction-fragment length polymorphism (RFLP) was performed to analyze delta F508, G542X, G551D, R553X, N1303K, and A455E according to previously described methods on a Perkin Elmer PE 2400 thermocycler.5 As an alternative, the delta F508 mutation was also analyzed by means of amplification refraction mutation system (ARMS) using the following primer combination: common reverse primer 5=GGGTAGTGTGAAGGGTTCATATGCATAATC3=, Wildtype Forward primer 5=GCCTGGCACCATTAAAGAA- AATATCATCTT3=, and Mutant Forward primer 5=GCCTG- GCACCATTAAAGAAAATATCATTGG3=.6 After PCR was performed, amplicons were digested (in the case of RFLP) using appropriate restriction enzymes as previously described. Login to comment