ABCMdb

ABCA1 p.Arg219Lys

ClinVar:	c.656G>A , p.Arg219Lys ? , protective
Predicted by SNAP2:	A: N (93%), C: N (78%), D: N (87%), E: D (53%), F: D (80%), G: N (87%), H: N (93%), I: N (82%), K: N (78%), L: N (87%), M: N (93%), N: N (97%), P: N (93%), Q: N (97%), S: N (97%), T: N (93%), V: N (87%), W: D (71%), Y: D (59%),
Predicted by PROVEAN:	A: N, C: N, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, S: N, T: N, V: N, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Meta-analysis on association between the ATP-bindi... Gene. 2012 Dec 1;510(2):147-53. doi: 10.1016/j.gene.2012.09.009. Epub 2012 Sep 13. Jiang M, Lv L, Wang H, Yang X, Ji H, Zhou F, Zhu W, Cai L, Gu X, Sun J, Dong Q
Meta-analysis on association between the ATP-binding cassette transporter A1 gene (ABCA1) and Alzheimer's disease.
Gene. 2012 Dec 1;510(2):147-53. doi: 10.1016/j.gene.2012.09.009. Epub 2012 Sep 13., [PMID:22982414]

Abstract [show]
PURPOSE: In the past decade, a number of case-control studies have been carried out to investigate the relationship between ABCA1 polymorphisms and Alzheimer's disease (AD). However, these studies have yielded contradictory results. To investigate this inconsistency, a meta-analysis was performed. METHODS: Databases including PubMed, Web of Science, EMBASE and CNKI were searched to find relevant studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association. RESULTS: A total of 13 case-control studies, involving 6214 patients and 6034 controls for ABCA1 polymorphisms were included. In a combined analysis, the summary per-allele odds ratio for AD of the 219K was 1.03 (95% CI: 0.93-1.14, p=0.56). A meta-analysis of studies on the 883M and 1587K variant showed no significant overall association with AD, yielding a per-allele odds ratio of 1.10 (95% CI: 0.96-1.26, p=0.16), and 1.09 (95% CI: 0.97-1.24, p=0.16) respectively. Similar results were also found for heterozygous and homozygous. In the subgroup analysis by ethnicity, sample size, APOE status and onset type, no significant associations were found in almost all genetic models. CONCLUSIONS: In summary, there was no significant association detected between ABCA1 R219K, I883M and R1587K polymorphisms and risk for AD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
9 34 Conclusions: In summary, there was no significant association detected between ABCA1 R219K, I883M and 35 R1587K polymorphisms and risk for AD. Login to comment
28 In consideration of the extensive role of ABCA1 in the develop- 77 ment of AD, we carried out a comprehensive meta-analysis on all eligible 78 case-control studies to estimate the overall AD risk of ABCA1 R219K 79 (rs2230806), I883M (rs4149313) and R1587K (rs2230808) polymor- 80 phisms as well as to quantify the between-study heterogeneity and po- 81 tential bias. Login to comment
63 For the R219K 155 polymorphism, 12 studies were available, including a total of 5372 156 cases and 5180 controls. For the I883M polymorphism, 5 studies in- 157 volved a total of 2118 cases and 1852 controls. For the R1587K poly- 158 morphism, 6 studies involved a total of 2942 cases and 2720 controls. Login to comment
68 Association of R219K variant with AD 165 For AD risk and the R219K polymorphism of ABCA1, our meta- 166 analysis gave an overall OR of 1.03 (95% CI: 0.93-1.14; p=0.56) without 167 statistically significant between-study heterogeneity (Fig. 2). Login to comment
78 t1:3 Study Year Ethnicity Genotyping method No. of case/control Diagnostic criterion Outcome Mean age of onset Mean age of case/control Gender of case/control (% male) Polymorphism t1:4 Wollmer 2003 Swedish Pyrosequencing 169/166 NINCDS-ADRDA LOAD; EOAD 70.1 73.5/69.0 42.0/51.0 R219K t1:5 Li 2004 American RT-PCR 418/376 NINCDS-ADRDA LOAD 75.5 77.5/NA 43.0/44.0 R219K, I883M, R1587K t1:6 Katzov 2004 Swedish; English DASH 974/751 NINCDS-ADRDA LOAD; EOAD 70.8 76.6/75.4 40.2/44.1 R219K, I883M, R1587K t1:7 Shibata 2006 North American SNAPshot 218/195 NINCDS-ADRDA LOAD 75.0 NA/73.1 47.0/48.0 R219K, I883M, R1587K t1:8 Kölsch 2006 German RFLP 241/294 DSM IV LOAD; EOAD NA 73.2/71.8 28.5/45.6 R219K t1:9 Wahrle 2007 American MassArray 1225/1431 AD patients LOAD NA NA/NA NA/NA R219K t1:10 Chu 2007 Chinese MassArray 272/278 NINCDS-ADRDA LOAD NA 78.0/72.0 51.0/70.1 R219K, I883M, R1587K t1:11 Wang 2007 Chinese RFLP 168/215 NINCDS-ADRDA LOAD; EOAD 69.3 73.5/72.3 46.0/41.4 R219K t1:12 Sundar 2007 American Pyrosequencing 992/699 NINCDS-ADRDA LOAD 72.3 NA/75.3 34.0/38.0 R219K t1:13 Rodríguez-Rodríguez 2007 Spainish TaqMan 371/436 NINCDS-ADRDA LOAD 72.3 75.8/80.8 34.0/31.0 R219K, I883M, R1587K t1:14 Li 2008 Canadian Affymetrix genechip 691/682 DSM IV LOAD 80.2 NA/NA 100/100 R1587K t1:15 Khorshid 2010 Iranian RFLP 154/162 DSM IV LOAD NA 78.5/77.1 40.9/38.9 R219K t1:16 Sun 2012 Chinese RFLP 321/349 DSM IV LOAD; EOAD NA 70.0/68.5 38.0/35.8 R219K t1:17 NA: Not available, DASH: Dynamic Allele Specific Hybridization, LOAD: Late-onset Alzheimer disease, EOAD: Early-onset Alzheimer disease, DSM-IV: Diagnostic and Statistical Manual of t1:18 Mental Disorders IV. Login to comment
79 Fig. 2. Forest plot from the meta-analysis of Alzheimer's disease risk and ABCA1 R219K polymorphism (K versus R). Login to comment
80 3 182 The data on genotypes of the R219K polymorphism among cases 183 and controls stratified by APOE ε4-allele status were available in 5 184 (including 2131 cases and 2343 controls) studies. Login to comment
81 Using the dominant 185 genetic model, the APOE ε4-allele carrier with the risk allele of R219K 186 variant had no significantly increased AD risk compared to APOE 187 ε4-allele non-carrier with an OR of 1.04 [95% CI: 0.83-1.31; P(Z)= 188 0.73; P(Q)=0.26]. Login to comment
83 Association of I883M variant with AD 190 Overall, the per-allele OR of the 883M variant for AD was 1.10 191 (95% CI: 0.96-1.26; p=0.16; Fig. 3), with corresponding results for 192 heterozygous and homozygous of 1.12 (95% CI: 0.94-1.33; p=0.22) 193 and 1.21 (95% CI: 0.80-1.82; p=0.89), respectively. In the stratified 194 analysis by ethnicity and sample size, no significant associations be- 195 tween the I883M polymorphism and AD risk were detected in all ge- 196 netic models (Table 3). Login to comment
86 Table 2 t2:1 t2:2 Main results of pooled ORs with CI for association of the R219K polymorphism and Alzheimer's disease risk in the meta-analysis. Login to comment
92 The statistical results still did not show publi- 210 cation bias in these studies for R219K (Begg test, P=0.67; Egger test, 211 P=0.83; Supplementary Fig. 4), I883M (Begg test, P=0.42; Egger 212 test, P=0.62; Supplementary Fig. 5) and R1587K (Begg test, P= 213 0.13; Egger test, P=0.49; Supplementary Fig. 6). Login to comment
114 This may indicate that the R219K genotype has 254 a minor effect on AD than that of the APOE ε4ε4 genotype. Login to comment
127 282 To conclude, this meta-analysis suggests that the R219K, I883M 283 and R1587K polymorphisms of ABCA1 are not associated with AD 284 susceptibility. Login to comment
30 In consideration of the extensive role of ABCA1 in the development of AD, we carried out a comprehensive meta-analysis on all eligible case-control studies to estimate the overall AD risk of ABCA1 R219K (rs2230806), I883M (rs4149313) and R1587K (rs2230808) polymorphisms as well as to quantify the between-study heterogeneity and potential bias. Login to comment
65 For the R219K polymorphism, 12 studies were available, including a total of 5372 cases and 5180 controls. For the I883M polymorphism, 5 studies involved a total of 2118 cases and 1852 controls. For the R1587K polymorphism, 6 studies involved a total of 2942 cases and 2720 controls. Login to comment
70 Association of R219K variant with AD For AD risk and the R219K polymorphism of ABCA1, our meta-analysis gave an overall OR of 1.03 (95% CI: 0.93-1.14; p=0.56) without statistically significant between-study heterogeneity (Fig. 2). Login to comment
82 The data on genotypes of the R219K polymorphism among cases and controls stratified by APOE b5;4-allele status were available in 5 (including 2131 cases and 2343 controls) studies. Login to comment
88 Table 2 Main results of pooled ORs with CI for association of the R219K polymorphism and Alzheimer's disease risk in the meta-analysis. Sub-group analysis No. of data sets No. of case/control K allele Heterozygous Homozygous OR (95% CI) P (Z) P (Q) I2 (%) OR (95% CI) P (Z) P (Q) I2 (%) OR (95% CI) P (Z) P (Q) I2 (%) Total 15 5372/5180 1.03 (0.93-1.14) 0.56 0.01 23 1.07 (0.98-1.17) 0.12 0.43 10 0.95 (0.77-1.17) 0.62 0.06 21 Ethnicity Caucasian 11 4897/4669 1.04 (0.96-1.14) 0.32 0.18 14 1.09 (1.00-1.19) 0.06 0.64 0 1.02 (0.83-1.25) 0.87 0.18 19 Asian 4 475/511 0.91 (0.72-1.16) 0.76 0.05 21 0.91 (0.61-1.36) 0.66 0.15 8 0.71 (0.38-1.30) 0.26 0.09 26 Onset type EOAD 2 244/293 1.06 (0.82-1.36) 0.68 0.55 5 1.16 (0.81-1.67) 0.42 0.93 0 1.02 (0.56-1.85) 0.95 0.53 0 LOAD 10 3340/2785 1.06 (0.96-1.17) 0.27 0.19 16 1.14 (1.00-1.31) 0.06 0.51 12 0.99 (0.78-1.27) 0.94 0.15 17 Mixed 4 1788/2102 0.92 (0.76-1.10) 0.35 0.06 33 0.92 (0.74-1.14) 0.44 0.17 19 0.85 (0.57-1.27) 0.43 0.07 22 APOE status b5;4 carriers 5 1099/552 1.09 (0.93-1.28) 0.30 0.59 0 1.37 (0.96-1.96) 0.08 0.90 0 0.96 (0.66-1.40) 0.84 0.66 0 b5;4 non-carriers 5 1032/1791 0.97 (0.79-1.20) 0.80 0.07 24 1.07 (0.77-1.50) 0.67 0.04 57 0.88 (0.61-1.27) 0.49 0.13 18 Sample size b300 8 1334/1608 0.98 (0.85-1.14) 0.82 0.10 13 1.00 (0.85-1.18) 0.97 0.37 2 0.93 (0.67-1.29) 0.66 0.16 6 ࣙ300 7 4038/3572 1.03 (0.91-1.17) 0.61 0.05 42 1.10 (1.00-1.22) 0.06 0.45 0 0.96 (0.71-1.30) 0.80 0.05 39 Fig. 3. Forest plot from the meta-analysis of Alzheimer's disease risk and ABCA1 I883M polymorphism (M versus I). Login to comment
113 This may indicate that the R219K genotype has a minor effect on AD than that of the APOE b5;4b5;4 genotype. Login to comment
126 To conclude, this meta-analysis suggests that the R219K, I883M and R1587K polymorphisms of ABCA1 are not associated with AD susceptibility. Login to comment

[hide] Association of gender, ABCA1 gene polymorphisms an... Lipids Health Dis. 2012 Jul 9;11:62. Kolovou V, Marvaki A, Karakosta A, Vasilopoulos G, Kalogiani A, Mavrogeni S, Degiannis D, Marvaki C, Kolovou G
Association of gender, ABCA1 gene polymorphisms and lipid profile in Greek young nurses.
Lipids Health Dis. 2012 Jul 9;11:62., [PMID:22668585]

Abstract [show]
OBJECTIVE: One of the important proteins involved in lipid metabolism is the ATP-binding cassette transporter A1 (ABCA1) encoding by ABCA1 gene. In this study we evaluated the single nucleotide polymorphisms (SNPs) of ABCA1 gene. We analyzed SNPs in chromosome 9 such as rs2230806 (R219K) in the position 107620867, rs2230808 (R1587K) in the position 106602625 and rs4149313 (I883M) in the position 106626574 according to gender and lipid profile of Greek nurses. METHODS: The study population consisted of 447 (87 men) unrelated nurses who were genotyped for ABCA1 gene polymorphisms. Additionally, lipid profile [total cholesterol, triglycerides, high density lipoprotein cholesterol, low density lipoprotein cholesterol (LDL-C) and apolipoprotein A1] was evaluated. RESULTS: The distribution of all three studied ABCA1 gene polymorphisms did not differ according to gender. However, only R219K genotype distribution bared borderline statistical significance (p = 0.08) between the two studied groups. Moreover, allele frequencies of R219K, R1587K and I88M polymorphisms did not differ according to gender. In general, blood lipid levels did not seem to vary according to ABCA1 gene polymorphisms, when testing all subjects or when testing only men or only women. However, a significant difference of LDL-C distribution was detected in all subjects according to R1587K genotype, indicating lower LDL-C levels with KK polymorphism (p = 0.0025). The above difference was solely detected on female population (p = 0.0053). CONCLUSIONS: The ABCA1 gene polymorphisms frequency, distribution and lipid profile did not differ according to gender. However, in the female population the KK genotype of R1587K gene indicated lower LDL-C levels. Further studies, involving a higher number of individuals, are required to clarify genes and gender contribution.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 We analyzed SNPs in chromosome 9 such as rs2230806 (R219K) in the position 107620867, rs2230808 (R1587K) in the position 106602625 and rs4149313 (I883M) in the position 106626574 according to gender and lipid profile of Greek nurses. Login to comment
6 However, only R219K genotype distribution bared borderline statistical significance (p = 0.08) between the two studied groups. Login to comment
7 Moreover, allele frequencies of R219K, R1587K and I88M polymorphisms did not differ according to gender. Login to comment
19 Several ABCA1 gene polymorphisms were identified such as rs2230806 (R219K) in the chromosomal position 107620867, rs2230808 (R1587K) in the chromosomal position 106602625 and rs4149313 (I883M) in the chromosomal position 106626574]. Login to comment
34 DNA analysis and determination of blood lipids The ABCA1 gene polymorphisms (R219K, R1587K and I883M) were detected using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP`s). Login to comment
36 The oligonucleotide primers used for R219K and R1587K polymorphisms were described by Saleheen D et al. [7] and Tupitsina TV et al. [8] respectively. The oligonucleotide primers used for I883M polymorphism were 5`-GAGAAGAGCCACCCTGGTT- CCAACCAGAAGAGGAT-3` and 5`- AGAAAGGCAG- GAGACATCGCTT -3 as described by Clee SM et al. [9]. Login to comment
42 The Kruskal - Wallis H statistic was employed in order to detect differences in lipid levels according to three different polymorphisms of ABCA1 gene (R219K, R1587K and I883M). Login to comment
54 However, only R219K distribution bared borderline significance between the two groups studied (Table 2). Login to comment
55 A post hoc power calculation was conducted employing the calculated differences in the distribution of R219K polymorphism between men and women. Login to comment
58 Moreover, allele frequencies of R219K, R1587K and I88M polymorphisms did not differ according to gender (Table 2). Login to comment
65 R219K polymorphism One of the first study which evaluated the R219K polymorphism and lipid profile in man was published by Clee SM et al. [9]. Login to comment
70 Since then, many other studies correlated the R219K variant with the lipid profile and risk for CAD in various populations and ethnicities [6,9-16]. Login to comment
76 Table 2 Distribution of R219K, R1587K and I883M polymorphisms and allele frequencies according to sex Men(n = 87) Women(n = 360) P R219K RR 39 (17.3%) 186 (82.7%) 0.08* RK 45 (23.8%) 144 (76.2%) KK 3(9.4%) 29 (90.6%) R1587K RR 37 (17.5%) 174 (82.5%) 0.12* RK 45 (23.5%) 146 (76.5%) KK 5 (11.4%) 39 (88.6%) I883M II 64 (20.7%) 245 (79.3%) 0.66* IM 22 (17.2%) 106 (82.8%) MM 1 (12.5%) 7 (87.5 %) Allele frequencies for R219K polymorphism R allele frequency 0.71 0.72 0.85** K allele frequency 0.29 0.28 Allele frequencies for R1587K polymorphism R allele frequency 0.68 0.69 0.85** K allele frequency 0.32 0.31 Allele frequencies for I883M polymorphism I allele frequency 0.86 0.83 0.4** M allele frequency 0.17 0.14 Fisher`s exact test - **Test for equality of proportions. Login to comment
82 In our study, we do not find any association of the R219K variant with any parameter of the lipid profile. Login to comment
84 Noteworthy to mention is that the R219K distribution bared borderline statistical significance (p = 0.08) between two studied groups. Login to comment
92 In this study we found according to gender that blood lipid levels did not Table 3 Blood lipid levels according to ABCA1 polymorphisms in all subjects ALL SUBJECTS (n = 447) Genotype Median IQR P† R219K Total cholesterol (mg/dl) RR 199 [160 - 239] 0.74 RK 194 [158 - 241] KK 205 [160-244] Triglycerides (mg/dl) RR 98 [65 - 162] 0.66 RK 98 [63 - 170] KK 95 [69 - 140] HDL cholesterol (mg/dl) RR 66 [51 - 80] 0.94 RK 64 [52.5 - 84] KK 63 [50.5 - 85] LDL cholesterol (mg/dl) RR 106 [78 - 131] 0.18 RK 104 [71.5 - 131] KK 118 [92-147] Apo A1 (mg/dl) RR 139 [108 - 180] 0.09 RK 152 [106-187] KK 164 [115-202] R1587K Total cholesterol (mg/dl) RR 190 [145 - 238] 0.08 RK 203 [170 - 241] KK 199 [158 - 222] Triglycerides (mg/dl) RR 95 [60 - 167] 0.35 RK 103 [68 - 168] KK 85 [69-150] HDL cholesterol (mg/dl) RR 65 [51 - 81] 0.73 RK 65 [53 - 83] KK 62 [47 - 85] LDL cholesterol (mg/dl) RR 100 [66 - 122] 0.0025 RK 114 [84 -139] KK 88 [87 - 89] Apo A1 (mg/dl) RR 145 [104 - 185] 0.78 RK 148 [109 - 180] KK 147 [107 - 194] I883M Total cholesterol (mg/dl) II 198 [155 - 240] 0.74 IM 198 [164 - 238] MM 197 [175 - 253] Triglycerides (mg/dl) II 99 [65 - 163] 0.49 IM 91 [62 - 171] MM 170 [78 - 233] HDL cholesterol (mg/dl) II 65 [51 - 82] 0.83 IM 64 [52 - 82] MM 68 [55 - 95] LDL cholesterol (mg/dl) II 105 [74 - 130] 0.52 IM 108 [81 - 133] MM 117 [64 - 132] Table 3 Blood lipid levels according to ABCA1 polymorphisms in all subjects (Continued) Apo A1 (mg/dl) II 143 [104 - 182] 0.62 IM 148 [109 - 184] MM 153 [111 - 200] HDL: high density lipoprotein, LDL: low density lipoprotein, Apo A1: apolipoprotein A1. Login to comment
104 Hodoğlugil et al. [20] correlated the I883M variant with higher HDL-C concentration in both sexes. Login to comment
108 Although, this variant was common in Thai Table 4 Blood lipid levels according to ABCA1 polymorphisms in men MEN (n = 87) Genotype Median IQR P† R219K Total cholesterol (mg/dl) RR 199 [149 - 250] 0.86 RK 205 [164 - 258] KK 222 [122 - 240] Triglycerides (mg/dl) RR 125 [100 - 177] 0.58 RK 142 [97 - 196] KK 134 [50 - 163] HDL cholesterol (mg/dl) RR 61 [49 - 74] 0.28 RK 57 [46 - 81] KK 46 [45 - 48] LDL cholesterol (mg/dl) RR 109 [66 - 146] 0.84 RK 106 [76 - 150] KK 149 [67 - 159] Apo A1 (mg/dl) RR 112 [100 - 135] 0.58 RK 117 [95 - 168] KK 116 [81 - 180] R1587K Total cholesterol (mg/dl) RR 192 [146 - 273] 0.28 RK 206 [166 - 241] KK 122 [110 - 205] Triglycerides (mg/dl) RR 131 [79 - 199] 0.92 RK 131 [100 - 176] KK 153 [108 - 170] HDL cholesterol (mg/dl) RR 60 [51 - 74] 0.41 RK 58 [48 - 76] KK 45 [42 - 48] LDL cholesterol (mg/dl) RR 99 [70 - 150] 0.16 RK 119 [81 - 149] KK 67 [58-106] Apo A1 (mg/dl) RR 114 [94 - 156] 0.79 RK 116 [100 - 149] KK 100 [96 - 116] I883M Total cholesterol (mg/dl) II 201 [148 - 255] 0.27 IM 214 [180 - 241] MM 120 - Triglycerides (mg/dl) II 126 [84-177] 0.18 IM 169 [118 - 250] MM 152 - HDL cholesterol (mg/dl) II 59 [47 - 75] 0.44 IM 57 [48 - 78] MM 41 - LDL cholesterol (mg/dl) II 111 [70-148] 0.39 IM 105 [80 - 149] MM 49 - Table 4 Blood lipid levels according to ABCA1 polymorphisms in men (Continued) Apo A1 (mg/dl) II 110 [94 - 148] 0.14 IM 148 [107 - 169] MM 112 - HDL: high density lipoprotein, LDL: low density lipoprotein, Apo A1: apolipoprotein A1. Login to comment
114 However, there are some data from Delgado-Lista et al. [24] suggesting that the major allele homozygotes for ABCA1 gene polymorphisms i27943 (rs2575875) and R219K (rs2230806) have a lower postprandial response as compared to minor allele carriers. Login to comment
124 Authors` contributions VK participated in the development of hypothesis, drafting of the manuscript and carried out the genetic analysis, AM participated in the molecular Table 5 Blood lipid levels according to ABCA1 polymorphisms in women WOMEN (n = 360) Genotype Median IQR P† R219K Total cholesterol (mg/dl) RR 200 [160 - 238] 0.64 RK 193 [155 - 238] KK 204 [163 - 249] Triglycerides (mg/dl) RR 89 [57 - 152] 0.88 RK 87 [61 - 159] KK 94 [70 - 134] HDL cholesterol (mg/dl) RR 66 [52 - 82] 0.84 RK 65 [55 - 85] KK 66 [55 - 85] LDL cholesterol (mg/dl) RR 105 [79 - 127] 0.18 RK 104 [70 - 126] KK 117 [93 - 141] Apo A1 (mg/dl) RR 145 [111 - 187] 0.16 RK 155 [110 - 194] KK 164 [122 - 204] R1587K Total cholesterol (mg/dl) RR 189 [145 - 231] 0.09 RK 203 [172 - 240] KK 203 [163 - 224] Triglycerides (mg/dl) RR 87 [57 - 146] 0.61 RK 96 [61 - 160] KK 81 [69 - 136] HDL cholesterol (mg/dl) RR 66 [51 - 82] 0.82 RK 67 [55 - 84] KK 64 [52 - 86] LDL cholesterol (mg/dl) RR 100 [66 - 121] 0.0053 RK 112 [85 - 132] KK 106 [83 - 133] Apo A1 (mg/dl) RR 152 [109 - 189] 0.59 RK 155 [114 - 188] KK 153 [116 - 194] I883M Total cholesterol (mg/dl) II 198 [156 - 237] 0.54 IM 196 [160 - 238] MM 214 [181 - 273] Triglycerides (mg/dl) II 90 [61-155] 0.45 IM 86 [58 - 148] MM 188 [73 - 274] HDL cholesterol (mg/dl) II 66 [52-82.5] 0.61 IM 66 [53 - 83] MM 73 [60 - 111] LDL cholesterol (mg/dl) II 104 [74 - 125] 0.34 IM 109 [83 - 132] MM 124 [66 - 134] Table 5 Blood lipid levels according to ABCA1 polymorphisms in women (Continued) Apo A1 (mg/dl) II 154 [111-189] 0.86 IM 149 [110 - 188] MM 166 [110 - 226] HDL: high density lipoprotein, LDL: low density lipoprotein, Apo A1: apolipoprotein A1. Login to comment
157 Srinivasan SR, Li S, Chen W, Boerwinkle E, Berenson GS: R219K polymorphism of the ABCA1 gene and its modulation of the variations in serum high-density lipoprotein cholesterol and triglycerides related to age and adiposity in white versus black young adults. Login to comment
164 Zhao SP, Xiao ZJ, Li QZ, Nie S, Tan LM, Jiang B, Wu J: Relationship between ATP-binding cassette transporter 1 R219K genetic variation and blood lipids. Login to comment
170 Kitjaroentham A, Hananantachai H, Tungtrongchitr A, Pooudong S, Tungtrongchitr R: R219K polymorphism of ATP binding cassette transporter A1 related with low HDL in overweight/obese Thai males. Login to comment
18 ABCA1 protein is expressed in liver, macrophages, intestines, lungs etc. Several ABCA1 gene polymorphisms were identified such as rs2230806 (R219K) in the chromosomal position 107620867, rs2230808 (R1587K) in the chromosomal position 106602625 and rs4149313 (I883M) in the chromosomal position 106626574]. Login to comment
31 DNA analysis and determination of blood lipids The ABCA1 gene polymorphisms (R219K, R1587K and I883M) were detected using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP`s). Login to comment
33 The oligonucleotide primers used for R219K and R1587K polymorphisms were described by Saleheen D et al. [7] and Tupitsina TV et al. [8] respectively. The oligonucleotide primers used for I883M polymorphism were 5`-GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT-3` and 5`- AGAAAGGCAG- GAGACATCGCTT -3 as described by Clee SM et al. [9]. Login to comment
39 The Kruskal - Wallis H statistic was employed in order to detect differences in lipid levels according to three different polymorphisms of ABCA1 gene (R219K, R1587K and I883M). Login to comment
51 However, only R219K distribution bared borderline significance between the two groups studied (Table 2). Login to comment
52 A post hoc power calculation was conducted employing the calculated differences in the distribution of R219K polymorphism between men and women. Login to comment
62 R219K polymorphism One of the first study which evaluated the R219K polymorphism and lipid profile in man was published by Clee SM et al. [9]. Login to comment
67 Since then, many other studies correlated the R219K variant with the lipid profile and risk for CAD in various populations and ethnicities [6,9-16]. Login to comment
73 Table 2 Distribution of R219K, R1587K and I883M polymorphisms and allele frequencies according to sex Men(n = 87) Women(n = 360) P R219K RR 39 (17.3%) 186 (82.7%) 0.08* RK 45 (23.8%) 144 (76.2%) KK 3(9.4%) 29 (90.6%) R1587K RR 37 (17.5%) 174 (82.5%) 0.12* RK 45 (23.5%) 146 (76.5%) KK 5 (11.4%) 39 (88.6%) I883M II 64 (20.7%) 245 (79.3%) 0.66* IM 22 (17.2%) 106 (82.8%) MM 1 (12.5%) 7 (87.5 %) Allele frequencies for R219K polymorphism R allele frequency 0.71 0.72 0.85** K allele frequency 0.29 0.28 Allele frequencies for R1587K polymorphism R allele frequency 0.68 0.69 0.85** K allele frequency 0.32 0.31 Allele frequencies for I883M polymorphism I allele frequency 0.86 0.83 0.4** M allele frequency 0.17 0.14 Fisher`s exact test - **Test for equality of proportions. Login to comment
79 In our study, we do not find any association of the R219K variant with any parameter of the lipid profile. Login to comment
81 Noteworthy to mention is that the R219K distribution bared borderline statistical significance (p = 0.08) between two studied groups. Login to comment
89 In this study we found according to gender that blood lipid levels did not Table 3 Blood lipid levels according to ABCA1 polymorphisms in all subjects ALL SUBJECTS (n = 447) Genotype Median IQR Pߤ R219K Total cholesterol (mg/dl) RR 199 [160 - 239] 0.74 RK 194 [158 - 241] KK 205 [160-244] Triglycerides (mg/dl) RR 98 [65 - 162] 0.66 RK 98 [63 - 170] KK 95 [69 - 140] HDL cholesterol (mg/dl) RR 66 [51 - 80] 0.94 RK 64 [52.5 - 84] KK 63 [50.5 - 85] LDL cholesterol (mg/dl) RR 106 [78 - 131] 0.18 RK 104 [71.5 - 131] KK 118 [92-147] Apo A1 (mg/dl) RR 139 [108 - 180] 0.09 RK 152 [106-187] KK 164 [115-202] R1587K Total cholesterol (mg/dl) RR 190 [145 - 238] 0.08 RK 203 [170 - 241] KK 199 [158 - 222] Triglycerides (mg/dl) RR 95 [60 - 167] 0.35 RK 103 [68 - 168] KK 85 [69-150] HDL cholesterol (mg/dl) RR 65 [51 - 81] 0.73 RK 65 [53 - 83] KK 62 [47 - 85] LDL cholesterol (mg/dl) RR 100 [66 - 122] 0.0025 RK 114 [84 -139] KK 88 [87 - 89] Apo A1 (mg/dl) RR 145 [104 - 185] 0.78 RK 148 [109 - 180] KK 147 [107 - 194] I883M Total cholesterol (mg/dl) II 198 [155 - 240] 0.74 IM 198 [164 - 238] MM 197 [175 - 253] Triglycerides (mg/dl) II 99 [65 - 163] 0.49 IM 91 [62 - 171] MM 170 [78 - 233] HDL cholesterol (mg/dl) II 65 [51 - 82] 0.83 IM 64 [52 - 82] MM 68 [55 - 95] LDL cholesterol (mg/dl) II 105 [74 - 130] 0.52 IM 108 [81 - 133] MM 117 [64 - 132] Table 3 Blood lipid levels according to ABCA1 polymorphisms in all subjects (Continued) Apo A1 (mg/dl) II 143 [104 - 182] 0.62 IM 148 [109 - 184] MM 153 [111 - 200] HDL: high density lipoprotein, LDL: low density lipoprotein, Apo A1: apolipoprotein A1. Login to comment
109 However, there are some data from Delgado-Lista et al. [24] suggesting that the major allele homozygotes for ABCA1 gene polymorphisms i27943 (rs2575875) and R219K (rs2230806) have a lower postprandial response as compared to minor allele carriers. Login to comment
119 Authors` contributions VK participated in the development of hypothesis, drafting of the manuscript and carried out the genetic analysis, AM participated in the molecular Table 5 Blood lipid levels according to ABCA1 polymorphisms in women WOMEN (n = 360) Genotype Median IQR Pߤ R219K Total cholesterol (mg/dl) RR 200 [160 - 238] 0.64 RK 193 [155 - 238] KK 204 [163 - 249] Triglycerides (mg/dl) RR 89 [57 - 152] 0.88 RK 87 [61 - 159] KK 94 [70 - 134] HDL cholesterol (mg/dl) RR 66 [52 - 82] 0.84 RK 65 [55 - 85] KK 66 [55 - 85] LDL cholesterol (mg/dl) RR 105 [79 - 127] 0.18 RK 104 [70 - 126] KK 117 [93 - 141] Apo A1 (mg/dl) RR 145 [111 - 187] 0.16 RK 155 [110 - 194] KK 164 [122 - 204] R1587K Total cholesterol (mg/dl) RR 189 [145 - 231] 0.09 RK 203 [172 - 240] KK 203 [163 - 224] Triglycerides (mg/dl) RR 87 [57 - 146] 0.61 RK 96 [61 - 160] KK 81 [69 - 136] HDL cholesterol (mg/dl) RR 66 [51 - 82] 0.82 RK 67 [55 - 84] KK 64 [52 - 86] LDL cholesterol (mg/dl) RR 100 [66 - 121] 0.0053 RK 112 [85 - 132] KK 106 [83 - 133] Apo A1 (mg/dl) RR 152 [109 - 189] 0.59 RK 155 [114 - 188] KK 153 [116 - 194] I883M Total cholesterol (mg/dl) II 198 [156 - 237] 0.54 IM 196 [160 - 238] MM 214 [181 - 273] Triglycerides (mg/dl) II 90 [61-155] 0.45 IM 86 [58 - 148] MM 188 [73 - 274] HDL cholesterol (mg/dl) II 66 [52-82.5] 0.61 IM 66 [53 - 83] MM 73 [60 - 111] LDL cholesterol (mg/dl) II 104 [74 - 125] 0.34 IM 109 [83 - 132] MM 124 [66 - 134] Table 5 Blood lipid levels according to ABCA1 polymorphisms in women (Continued) Apo A1 (mg/dl) II 154 [111-189] 0.86 IM 149 [110 - 188] MM 166 [110 - 226] HDL: high density lipoprotein, LDL: low density lipoprotein, Apo A1: apolipoprotein A1. Login to comment
151 Srinivasan SR, Li S, Chen W, Boerwinkle E, Berenson GS: R219K polymorphism of the ABCA1 gene and its modulation of the variations in serum high-density lipoprotein cholesterol and triglycerides related to age and adiposity in white versus black young adults. Login to comment
158 Zhao SP, Xiao ZJ, Li QZ, Nie S, Tan LM, Jiang B, Wu J: Relationship between ATP-binding cassette transporter 1 R219K genetic variation and blood lipids. Login to comment

[hide] The polymorphism of the ATP-binding cassette trans... Am J Geriatr Psychiatry. 2012 Jul;20(7):603-11. Sun YM, Li HL, Guo QH, Wu P, Hong Z, Lu CZ, Wu ZY
The polymorphism of the ATP-binding cassette transporter 1 gene modulates Alzheimer disease risk in Chinese Han ethnic population.
Am J Geriatr Psychiatry. 2012 Jul;20(7):603-11., [PMID:22377775]

Abstract [show]
BACKGROUND: Recent studies highlight a potential role of cholesterol metabolic disturbance in the pathophysiology of Alzheimer disease (AD). The adenosine triphosphate (ATP)-binding cassette transporter 1 (ABCA1) gene resides within proximity of linkage peaks on chromosome 9q influence AD and plays a key role in cellular cholesterol efflux in the brain. METHODS: We studied the role of R219K and V825I polymorphisms of ABCA1 in modulating the risk of AD in 321 AD patients and 349 comparisons of Chinese Han. Genotyping of R219K and V825I were performed by PCR-restriction fragment length polymorphism analysis. RESULTS: The genotype distribution of R219K was different with more RK in total AD group (chi(2) = 8.705, df = 2, p = 0.013), late-onset AD (LOAD) group (chi(2) = 10.636, df = 2, p = 0.005), APOE non-epsilon4epsilon4 group (chi(2) = 9.900, df = 2, p = 0.007), and female AD group (chi(2) = 8.369, df = 2, p = 0.015). Logistic regression manifested the risk of AD increased in RK carriers in total AD group (Wald = 6.102, df = 1, p = 0.014, odds ratio [OR]: 1.546, 95% confidence interval [95% CI]: 1.094-2.185), LOAD group (Wald = 7.746, df = 1, p = 0.005, OR: 1.921, 95% CI: 1.213-3.041), and APOE non-epsilon4epsilon4 group (Wald = 6.399, df = 1, p = 0.011, OR: 1.586, 95% CI: 1.109-2.266). K allele (RK + KK) also increased the risk of AD compared with RR allele in LOAD group (Wald = 4.750, df = 1, p = 0.029, OR: 1.619, 95% CI: 1.050-2.497). However, no discrepancy was found in V825I. In R219K, age at onset (AAO) was significantly lower by 4.9 years on average in patients of KK genotype than those of RK in APOE epsilon4 carrying group and higher by 5.5 years in patients of KK genotype than those of RR in APOE epsilon4 noncarrying group. In V825I, AAO was diseased by 4.3 years in II genotype compared with VV genotype in APOE epsilon4 noncarrying group and 3.4 years in APOE epsilon4epsilon4 noncarrying group. CONCLUSION: The results indicated that the RK genotype or K allele (RK + KK) of R219K may relate to the development of AD in the east of China.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Methods: We studied the role of R219K and V825I polymorphisms of ABCA1 in modulating the risk of AD in 321 AD patients and 349 comparisons of Chinese Han. Login to comment
4 Genotyping of R219K and V825I were performed by PCR-restriction fragment length polymorphism analysis. Login to comment
5 Results: The genotype distribution of R219K was different with more RK in total AD group (χ2 = 8.705, df = 2, p = 0.013), late-onset AD (LOAD) group (χ2 = 10.636, df = 2, p = 0.005), APOE non-ε4ε4 group (χ2 = 9.900, df = 2, p = 0.007), and female AD group (χ2 = 8.369, df = 2, p = 0.015). Login to comment
9 In R219K, age at onset (AAO) was significantly lower by 4.9 years on average in patients of KK genotype than those of RK in APOE ε4 carrying group and higher by 5.5 years in patients of KK genotype than those of RR in APOE ε4 noncarrying group. Login to comment
16 C 2012 American Association for Geriatric Psychiatry DOI: 10.1097/JGP.0b013e3182423b6a of R219K may relate to the development of AD in the east of China. Login to comment
22 But clinical investigation of its relationship to AD has commenced in these years and the results were controversial.19 Also, the investigation in Chinese ethnic Han people is rare.20 Here, we examined two single nucleotide polymorphisms (SNPs) in the coding regions of ABCA1: R219K (rs2230806) located in exon 7 with a G to A nucleotide change, which is most popular SNP in both CAD and AD examinations; V825I (rs2066715) located in exon 17 with a G to A as well, which associated with HDL-C and played an important role in CAD but was rarely reported in AD patients.21,22 We conducted a case-control study to investigate the genetic association of these two SNPs with AD in a population of Chinese Han in eastern China. Login to comment
36 Genotyping of R219K, V825I, and APOE Genomic DNA was extracted from the sodium citrate treated blood samples of both AD patients and comparisons by TIANamp blood DNA Kit (TIAN- GEN). Login to comment
37 The genotypes of R219K and V825I were the same as the previous report.23 The APOE genotypes were determined as described by Donohoe et al.24 Statistical Analysis Statistical analyses were performed using SPSS version 12.0 (SPSS Inc., Chicago, IL). Login to comment
48 Genotype and Allele Frequency Distribution R219K and V825I were under Hardy-Weinberg equilibrium in both AD and comparison groups (p > 0.20) (see Table, Supplemental Digital Content 1, http://links.lww.com/AJGP/A26, which demonstrates Hardy-Weinberg equilibrium of the two SNPs inAD patientsandcomparisongroup). Login to comment
50 The distribution of genotype in R219K was different in AD patients and comparisons (χ2 = 8.705, df = 2, p = 0.013). Login to comment
52 There was difference in genotype of R219K inLOAD group(χ2 = 10.636, df = 2, p= 0.005) but no difference in EOAD group (χ2 = 0.598, df = 2, p = 0.741). Login to comment
60 As shown in Table 3, logistic regression was used to further analyze the R219K genotype in total population, LOAD-comparison group, and APOE ε4ε4 noncarrying group. Login to comment
64 Influence of ABCA1 Polymorphisms on AAO and MMSE Score of AD As shown in Table 4, using ANOVA, we analyzed the effects of R219K and V825I genotypes on the AAO and MMSE scores of AD patients which were divided according to the onset age, gender, and APOE ε4 and ε4ε4 carrying status. Login to comment
65 When further using the post-hoc LSD multiple comparisons, in the R219K, we found that AAO was significantly lower by 4.9 years in patients of KK genotype than those of RK in APOE ε4 carrying group and higher by 5.5 years on average in patients of KK genotype than those of RR in APOE ε4 noncarrying group. Login to comment
68 R219K locates in the major extracellular loop in N-terminus of the ABCA1 protein, important for the cholesterol efflux. Login to comment
77 The R219K has been one of the most studied SNPs in both CAD and AD in recent years. Login to comment
78 In CAD, the 219K was depicted to associate with either increased HDL-C or reduced severity of atherosclerosis.30 However, the role of R219K polymorphism in AD remains controversial. Login to comment
80 Rodr´ıguez-Rodr´ıguez et al.31 found that RK + KK in R219K was significantly associated with AD and conferred a risk of 1.78 (p = 0.007) in 372 Spanish AD patients and 440 controls, the same as our results, and they also demonstrated the RK + KK genotypes increased risk in both EOAD and LOAD. Login to comment
82 Genotypes and Allele Frequencies of R219K and V825I Polymorphisms in ABCA1 Gene in AD Patients and Comparison Group Comparison Comparison R219K AD (%) Group (%) V825I AD (%) Group (%) Total, n 321 349 321 349 RR 93 (29.0) 125 (35.8) VV 92 (28.7) 109 (31.2) RK 180 (56.1) 156 (44.7) VI 158 (49.2) 170 (48.7) KK 48 (15.0) 68 (19.5) II 71 (22.1) 70 (20.1) χ2 (p) 8.705 (0.013)a 0.715 (0.699) R frequency 366 (57.0) 407 (58.2) V frequency 342 (53.3) 388 (55.6) K frequency 276 (43.0) 293 (41.8) I frequency 300 (46.7) 310 (44.4) χ2 (p) 0.183 (0.669) 0.724 (0.395) EOAD, n 124 149 124 149 RR 42 (33.9) 53 (35.6) VV 31 (25.0) 50 (33.6) RK 66 (53.2) 73 (49.0) VI 62 (50.0) 66 (44.3) KK 16 (12.9) 23 (15.4) II 31 (25.0) 33 (22.1) χ2 (p) 0.598 (0.741) 2.375 (0.305) R frequency 150 (60.5) 179 (60.1) V frequency 124 (50.0) 166 (55.7) K frequency 98 (39.5) 119 (39.9) I frequency 124 (50.0) 132 (44.3) χ2 (p) 0.1 (0.921) 1.769 (0.184) LOAD, n 197 200 197 200 RR 51 (25.9) 72 (36.0) VV 61 (31.0) 59 (29.5) RK 114 (57.9) 83 (41.5) VI 96 (48.7) 104 (52.0) KK 32 (16.2) 45 (22.5) II 40 (20.3) 37 (18.5) χ2 (p) 10.636 (0.005)b 0.448 (0.799) R frequency 216 (54.8) 227 (56.8) V frequency 218 (55.3) 222 (55.5) K frequency 178 (45.2) 173 (43.2) I frequency 176 (44.7) 178 (44.5) χ2 (p) 0.229 (0.584) 0.002 (0.962) Male, n 123 125 123 125 RR 41 (33.3) 42 (33.6) VV 31 (25.2) 41 (32.8) RK 66 (53.7) 58 (46.4) VI 64 (52.0) 60 (48.0) KK 16 (13.0) 25 (20.0) II 28 (22.8) 24 (19.2) χ2 (p) 2.488 (0.288) 1.81 (0.405) R frequency 148 (60.2) 142 (56.8) V frequency 126 (51.2) 142 (56.8) K frequency 98 (39.8) 108 (43.2) I frequency 120 (48.8) 108 (43.2) χ2 (p) 0.577 (0.447) 1.555 (0.212) Female, n 198 224 198 224 RR 52 (26.3) 83 (37.1) VV 61 (30.8) 68 (30.4) RK 114 (57.6) 98 (43.8) VI 94 (47.5) 110 (49.1) KK 32 (16.2) 43 (19.2) II 43 (21.7) 46 (20.5) χ2 (p) 8.369 (0.015)a 0.134 (0.935) R frequency 218 (55.1) 264 (58.9) V frequency 216 (54.5) 246 (54.9) K frequency 178 (44.9) 184 (41.1) I frequency 180 (45.5) 202 (45.1) χ2 (p) 1.291 (0.256) 0.11 (0.915) APOE ε4 carrying, n 150 143 150 143 RR 48 (32.0) 52 (36.4) VV 37 (24.7) 44 (30.8) RK 82 (54.7) 62 (43.4) VI 78 (52.0) 74 (51.7) KK 20 (13.3) 29 (20.3) II 35 (23.3) 25 (17.5) χ2 (p) 4.426 (0.109) 2.211 (0.331) R frequency 178 (59.3) 166 (58.0) V frequency 152 (50.7) 162 (56.6) K frequency 122 (40.7) 120 (42.0) I frequency 148 (49.3) 124 (43.4) χ2 (p) 0.101 (0.751) 2.103 (0.147) APOE ε4 noncarrying, n 171 206 171 206 RR 45 (26.3) 73 (35.4) VV 55 (32.2) 65 (31.6) RK 98 (57.3) 94 (45.6) VI 80 (46.8) 96 (46.6) KK 28 (16.4) 39 (18.9) II 36 (21.1) 45 (21.8) χ2 (p) 5.33 (0.070) 0.039 (0.981) R frequency 188 (55.0) 240 (58.3) V frequency 190 (55.6) 226 (54.9) K frequency 154 (45.0) 172 (41.7) I frequency 152 (44.4) 186 (45.1) χ2 (p) 0.82 (0.365) 0.037 (0.847) APOE ε4ε4 carrying, n 35 3 35 3 RR 11 (31.4) 1 (33.3) VV 7 (20.0) 1 (33.3) RK 17 (48.6) 2 (66.7) VI 20 (57.1) 1 (33.3) KK 7 (20.0) 0 (0.0) II 8 (22.9) 1 (33.3) (Continued ) TABLE 2. Login to comment
83 (Continued ) Comparison Comparison R219K AD (%) Group (%) V825I AD (%) Group (%) χ2 (p) 0.656 (1.000)c 1.321 (0.577)c R frequency 39 (55.7) 4 (66.7) V frequency 34 (48.6) 3 (50.0) K frequency 31 (44.3) 2 (33.3) I frequency 36 (51.4) 3 (50.0) χ2 (p) (0.692)c (1.000)c APOE ε4ε4 noncarrying, n 286 346 286 346 RR 82 (28.7) 124 (35.8) VV 85 (29.7) 108 (31.2) RK 163 (57.0) 154 (44.5) VI 138 (48.3) 169 (48.8) KK 41 (14.3) 68 (19.7) II 63 (22.0) 69 (19.9) χ2 (p) 9.9 (0.007)b 0.452 (0.798) R frequency 327 (57.2) 402 (58.1) V frequency 308 (53.8) 385 (55.6) K frequency 245 (42.8) 290 (41.9) I frequency 264 (46.2) 307 (44.4) χ2 (p) 0.11 (0.741) 0.405 (0.525) Notes: For all the χ2 of genotypes, df = 2; for all the χ2 of allele frequencies, df = 1. Login to comment
86 Logistic Regression Analysis of R219K Polymorphism of ABCA1 Gene in AD Patients and Comparison Group R219K AD Comparison Group Wald p OR (95% CI) Total, n 321 (%) 349 (%) RR 93 (29.0) 125 (35.8) Reference RK 180 (56.1) 156 (44.7) 6.102 0.014a 1.546 (1.094-2.185) KK 48 (15.0) 68 (19.5) 0.062 0.804 0.943 (0.596-1.494) RK + KK 228 (71.1) 224 (64.2) 3.430 0.064 1.363 (0.982-1.892) LOAD, n 197 (%) 200 (%) RR 51 (25.9) 72 (36.0) Reference RK 114 (57.9) 83 (41.5) 7.746 0.005b 1.921 (1.213-3.041) KK 32 (16.2) 45 (22.5) 0.021 0.884 1.044 (0.583-1.871) RK + KK 146 (74.1) 128 (64.0) 4.750 0.029a 1.619 (1.050-2.497) APOE ε4ε4 noncarrying, n 286 (%) 346 (%) RR 82 (28.7) 124 (35.8) Reference RK 163 (57.0) 154 (44.5) 6.399 0.011a 1.586 (1.109-2.266) KK 41 (14.3) 68 (19.7) 0.175 0.675 0.903 (0.559-1.458) RK + KK 204 (71.3) 222 (64.2) 3.409 0.065 1.377 (0.981-1.933) Notes: For the Wald χ2 tests, df = 1. Login to comment
92 Effects of Two Single Nucleotide Polymorphisms (R219K and V825I) of ABCA1 Gene on AAO and MMSE Score in AD Patients R219K V825I RR (%) RK (%) KK (%) F (p) VV (%)g VI (%) II (%) F (p) Total, n 93 (29.0) 180 (56.1) 48 (15.0) 92 (28.7) 158 (49.2) 71 (22.1) AAO 65.4 ± 10.42 67.8 ± 9.46 67.3 ± 9.36 1.813 (0.165) 68.4 ± 9.34 66.8 ± 9.84 65.6 ± 10.01 1.764 (0.173) MMSE 14.1 ± 6.44 14.4 ± 6.00 14.5 ± 6.25 0.113 (0.893) 14.8 ± 5.87 14.0 ± 6.31 14.4 ± 5.87 0.545 (0.580) EOAD, n 42 (33.9) 66 (53.2) 16 (12.9) 31 (25.0) 62 (50.0) 31 (25.0) AAO 55.5 ± 5.33 57.0 ± 4.97 55.7 ± 4.92 1.222 (0.298) 57.0 ± 5.20 56.3 ± 5.04 55.7 ± 5.19 0.470 (0.626) MMSE 13.6 ± 6.84 13.0 ± 6.63 14.3 ± 8.62 0.237 (0.790) 13.9 ± 7.38 12.2 ± 6.92 15.2 ± 6.21a 2.119 (0.125) LOAD, n 51 (25.9) 114 (57.9) 32 (16.2) 61 (40.0) 96 (48.7) 40 (20.3) AAO 73.5 ± 5.23 74 ± 4.57 73.1 ± 4.1 0.523 (0.594) 74.2 ± 4.11 73.6 ± 4.99 73.2 ± 4.70 0.628 (0.535) MMSE 14.4 ± 6.14 15.2 ± 5.48 14.6 ± 4.81 0.427 (0.653) 15.3 ± 5.37 15.2 ± 5.63 13.7 ± 5.58 1.179 (0.310) Male, n 41 (33.3) 66 (53.7) 16 (13.0) 31 (25.2) 64 (52.0) 28 (22.8) AAO 65.1 ± 9.65 67.2 ± 9.38 67.9 ± 9.81 0.850 (0.430) 68.0 ± 10.50 66.8 ± 9.04 64.7 ± 9.51 0.887 (0.415) MMSE 15.2 ± 6.27 16.1 ± 6.21 15.0 ± 5.72 0.404 (0.668) 16.7 ± 5.67 14.9 ± 6.49 16.4 ± 5.77 1.110 (0.333) Female, n 52 (26.3) 114 (57.6) 32 (16.1) 61 (30.8) 94 (47.5) 43 (21.7) AAO 65.7 ± 11.80 68.1 ± 9.53 67.0 ± 9.27 1.036 (0.357) 68.7 ± 8.78 66.9 ± 10.39 66.2 ± 10.38 0.960 (0.385) MMSE 13.2 ± 6.50 13.4 ± 5.67 14.2 ± 6.57 0.301 (0.740) 13.9 ± 6.03 13.4 ± 6.15 13.1 ± 5.63 0.255 (0.775) APOE ε4 carrying, n 48 (32.0) 82 (54.7) 20 (13.3) 37 (24.7) 78 (52.0) 35 (23.3) AAO 65.7 ± 9.95 67.8 ± 8.64 62.7 ± 8.85b 2.798 (0.064) 67.9 ± 8.92 65.7 ± 9.41 66.7 ± 9.14 0.742 (0.478) MMSE 13.8 ± 6.04 14.8 ± 5.69 14.5 ± 7.13 0.369 (0.692) 15.3 ± 6.15 13.7 ± 6.32 15.2 ± 4.86 1.212 (0.301) APOE ε4 noncarrying, n 45 (26.3) 98 (57.3) 28 (16.4) 55 (32.2) 80 (46.8) 36 (21.1) AAO 65.1 ± 11.01 67.8 ± 10.14 70.6 ± 8.37c 2.627 (0.075) 68.8 ± 9.68 68.0 ± 10.16 64.5 ± 10.79d 2.160 (0.119) MMSE 14.3 ± 6.90 14.1 ± 6.27 14.5 ± 5.68 0.036 (0.964) 14.6 ± 6.13 14.3 ± 6.34 13.4 ± 6.69 0.252 (0.778) APOE ε4ε4 carrying, n 11 (31.4) 17 (48.6) 7 (20.0) 7 (20.0) 20 (57.1) 8 (22.9) AAO 64.8 ± 9.67 66.5 ± 6.79 67.6 ± 7.41 0.283 (0.756) 65.0 ± 8.37 66.0 ± 7.70 67.6 ± 8.16 0.215 (0.807) MMSE 14.9 ± 6.99 14.4 ± 4.70 13.4 ± 5.29 0.162 (0.851) 13.9 ± 4.41 14.5 ± 6.43 15.0 ± 4.03 0.077 (0.926) APOE ε4ε4 noncarrying, n 82 (28.7) 163 (57.0) 41 (14.3) 85 (29.7) 138 (48.3) 63 (22.0) AAO 65.5 ± 10.57 67.9 ± 9.70 67.2 ± 9.73 1.597 (0.204) 68.7 ± 9.41 67.0 ± 10.12 65.3 ± 10.24e 2.132 (0.121) MMSE 13.9 ± 6.40 14.4 ± 6.13 14.7 ± 6.44 0.206 (0.814) 14.9 ± 6.24 13.9 ± 6.31 14.3 ± 6.08 0.667 (0.514) Notes: MMSE score and AAO were analyzed by ANOVA and post-hoc LSD multiple comparisons and were expressed in mean ± SD. Login to comment
98 If the function of R219K in ABCA1 is also related to age in the brain, the RR genotype may be assumed to become a protective factor in elder people. Login to comment
99 We found that the impact of RK and RK + KK in R219K polymorphism on LOAD but not on EOAD, which may be explained by the assumption shown earlier. Login to comment
106 Genotypes and allele frequencies of R219K showed no discrepancies in our study when stratified by APOE-ε4 allele carrying status, the same as the results of Wollmer et al.36 Other studies showed the association between R219K genotypes and the risk of AD in APOE-ε4 noncarriers,20,35 but seldom in APOE-ε4 carriers. Login to comment
107 Wahrle et al.34 investigated R219K polymorphisms in 1225 AD cases and 1431 controls, which analyzed subgroups on the basis of APOE genotype according to the large number of sample. Login to comment
108 They failed to show an effect of R219K SNP on risk of AD in either APOE ε4ε4 group or APOE non- ε4ε4 group.34 We did not find the difference in APOE ε4ε4 group and moreover the number of APOE ε4ε4 carrying subjects in our study was far smaller than theirs. Login to comment
109 But in our APOE non-ε4ε4 carrying subjects, there were significant discrepancies in R219K genotypes with more RK genotype in AD group, which was not showed in APOE ε4ε4 carriers. Login to comment
110 This may indicate the R219K RK genotype has a minor effect on AD than that of APOE ε4ε4 genotype. Login to comment
111 Wollmer et al.36 found that R219K K allele was associated with delayed AAO by 1.7 years in their late-onset, sporadic AD patients. Login to comment
113 The results indicated that R219K might affect the AD occurrence interacting with APOE ε4 allele, which needs further investigation. Login to comment
114 In summary, our data revealed that the RK heterozygosis of R219K in ABCA1 increased the risk of AD in Chinese Han ethnic population, particularly in LOAD, APOE ε4ε4 noncarriers, and females. Login to comment

[hide] Cholesteryl Ester Transfer Protein and ATP-Binding... Angiology. 2012 May 17. Kolovou G, Kolovou V, Mihas C, Giannakopoulou V, Vasiliadis I, Boussoula E, Kollia A, Boutsikou M, Katsiki N, Mavrogeni S
Cholesteryl Ester Transfer Protein and ATP-Binding Cassette Transporter A1 Genotype Alter the Atorvastatin and Simvastatin Efficacy: Time for Genotype-Guided Therapy?
Angiology. 2012 May 17., [PMID:22584245]

Abstract [show]
We compared the efficacy of atorvastatin with simvastatin according to cholesteryl ester transfer protein (CETP) and adenosine triphosphate-binding cassette transporter A1 (ABCA1) genes. Patients treated with atorvastatin (n = 254) or simvastatin (n = 332) were genotyped for CETP (TaqIB and I405V) and ABCA1 (R219K) genetic variants. For genotype B1B2, atorvastatin compared with simvastatin treatment resulted in a greater decrease in total cholesterol (35.4% vs 31.6%, P = .035) and a lower increase in high-density lipoprotein cholesterol (2% vs 8%, P = .05). For genotype B2B2, atorvastatin compared with simvastatin treatment resulted in a lower decrease in low-density lipoprotein cholesterol (31.85 vs 42%, P = .029). For genotypes RR and KK, atorvastatin compared with simvastatin treatment resulted in a greater decrease of triglycerides (27% vs 17% and 35% vs 15%, respectively; P = .02 for all comparisons). TauThe TaqIB and R219K (opposite to I405V) gene polymorphisms seem to modify the response to lipid-lowering therapy with simvastatin or atorvastatin treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 Patients treated with atorvastatin (n ¼ 254) or simvastatin (n ¼ 332) were genotyped for CETP (TaqIB and I405V) and ABCA1 (R219K) genetic variants. Login to comment
8 The TaqIB and R219K (opposite to I405V) gene polymorphisms seem to modify the response to lipid-lowering therapy with simvastatin or atorvastatin treatment. Login to comment
11 Several ABCA1 gene polymorphisms were identified, including rs2230806 (R219K) which codes RR, RK, and KK genotypes. Login to comment
28 DNA Analysis and Determination of Blood Lipids and Glucose The CETP (TaqIB, I405V) polymorphisms were detected using polymerase chain reaction (PCR) and restricted fragment length polymorphism (RFLP) analysis as described previously.10,11 The R219K of ABCA1 gene polymorphism was detected using PCR and RFLPs. Login to comment
30 For R219K polymorphism, AAA- GACTTCAAGGACCCAGCTT and cctcacattccgaaagcatta oligonucleotide primers were used.12 The PCR was subjected to 95 C for 5 minutes, 30 cycles of 95 C for 30 seconds, 55 C for 30 seconds, 72 C for 30 seconds, and final extension to 72 C for 7 minutes, producing a fragment of 309 bp. Login to comment
48 In the whole cohort, the genotype frequency of ABCA1 (R219K) polymorphism was 47% for RR, 43.8% for RK, and 9.2% for KK. Login to comment
53 ABCA1 (R219K). Login to comment
59 Discussion Gene frequencies for TaqIB, I405V, and R219K polymorphisms in our cohort were similar to those reported in other cau- casians13,14 and dyslipidemic populations.15,16 In previous studies, we evaluated the efficacy of atorvasta- tin8 and simvastatin7 according to CETP polymorphisms and found that the effectiveness in lipid lowering may be influenced by CETP polymorphism. Login to comment
80 C, HDL-C concentrations before and after statin therapy according to ABCA1 R219K genotypes in patients with baseline HDL-C <40 mg/ dL. Login to comment

[hide] Quantitative assessment of the effect of ABCA1 R21... Mol Biol Rep. 2012 Feb;39(2):1809-13. Epub 2011 Jun 4. Li Y, Tang K, Zhou K, Wei Z, Zeng Z, He L, Wan C
Quantitative assessment of the effect of ABCA1 R219K polymorphism on the risk of coronary heart disease.
Mol Biol Rep. 2012 Feb;39(2):1809-13. Epub 2011 Jun 4., [PMID:21643759]

Abstract [show]
In the past decade, a number of case-control studies have been conducted to investigate the relationship between the ATP-binding cassette transporter A1 (ABCA1) R219K polymorphism and coronary heart disease (CHD). However, the results have been inconclusive. The purpose of the present study is to investigate whether this polymorphism confers significant susceptibility to CHD using a meta-analysis. PubMed, Embase and CNKI database were searched to get the genetic association studies. Then data were extracted. Pooled odds ratio (OR) and 95% confidence interval (CI) were calculated. Moreover, subgroup and sensitive analysis were performed. In total, 9,437 cases and 16,270 controls were involved in the meta-analysis. The K219 was significantly associated with CHD (OR = 0.80, 95% CI 0.69-0.92, P(Z) = 0.001). However, significant heterogeneity was present. Further subgroup analysis suggested ethnicity explained much heterogeneity. In Asians, K219 showed a strong protective effect and the pooled OR was 0.69 (95% CI 0.55-0.86 P(Z) = 0.0009). While in Caucasians the result was not significant (OR = 0.87, 95% CI 0.73-1.04, P(Z) = 0.12). In conclusion, our results indicate that the ABCA1 R219K polymorphism is a protective factor of CHD in Asians, but not in Caucasians.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Quantitative assessment of the effect of ABCA1 R219K polymorphism on the risk of coronary heart disease Yang Li • Kefu Tang • Kejun Zhou • Zhiyun Wei • Zhen Zeng • Lin He • Chunling Wan Received: 19 November 2010 / Accepted: 21 May 2011 / Published online: 4 June 2011 Ó Springer Science+Business Media B.V. 2011 Abstract In the past decade, a number of case-control studies have been conducted to investigate the relationship between the ATP-binding cassette transporter A1 (ABCA1) R219K polymorphism and coronary heart disease (CHD). Login to comment
13 In conclusion, our results indicate that the ABCA1 R219K polymorphism is a protective factor of CHD in Asians, but not in Caucasians. Login to comment
27 To date, many case-control studies have been carried out to investigate the relationship between ABCA1 R219K polymorphism and the risk of developing CHD, but the results were conflicting or inconclusive. Login to comment
29 In an attempt to clarify this inconsistency, we combined data from relevant published population-based association studies to quantify the overall genetic effect of the ABCA1 R219K polymorphism on the risk of CHD. Login to comment
33 Inclusion criteria For inclusion, studies had to meet all of the following criteria: (1) be a case-control or cohort study published in a peer-reviewed journal; (2) examine the associations between CHD and ABCA1 R219K polymorphisms; (3) have determined the ABCA1 R219K polymorphisms in both cases and controls; (4) be independent from other studies; and (5) present original data on genotype distribution or obtain from the authors. Login to comment
52 Meta-analysis results The meta-analysis of the R219K polymorphism included 20 studies with 9,437 cases and 16,270 controls. Login to comment
53 Figure 1 shows the results of all studies of the R219K polymorphism and CHD. Login to comment
60 Pooled OR is indicated by black diamonds Table 1 Summary estimates for the OR of ABCA1 R219K polymorphism in subgroup analyses Study population Studies, n OR (95% CI) P(Z)a P(Q)b I2 (%) P(Q)c All 20 0.80 (0.69-0.92) 0.001 \0.001 76 All in HWE 17 0.78 (0.66-0.92) 0.003 \0.001 79 Ethnicity 0.010 Caucasian 10 0.87 (0.73-1.04) 0.12 \0.001 77 Asian 8 0.69 (0.55-0.86) 0.0009 0.05 50 Other 2 0.70 (0.29-1.70) 0.43 Outcome 0.922 Coronary stenosis 12 0.78 (0.67-0.92) 0.002 0.03 49 Myocardial infarction 2 0.81 (0.67-0.98) 0.03 0.34 0 Combined 6 0.80 (0.59-1.08) 0.15 \0.001 90 Gender 0.381 Males 3 0.94 (0.80-1.09) 0.4 0.59 0 Femals 2 0.82 (0.41-1.63) 0.57 0.07 69 Combined 17 0.78 (0.66-0.92) 0.003 \0.001 78 HWE Hardy-Weinberg Equilibrium The OR was calculated using random effect model a Z test used to determine the significance of the overall OR b Cochran`s chi-square Q statistic test used to assess the heterogeneity in subgroups c Cochran`s chi-square Q statistic test used to assess the heterogeneity between subgroups Caucasians and the pooled OR was 0.87(95% CI 0.73-1.04; P(Z) = 0.12). Login to comment
65 Discussion This study represents the first application of meta-analysis to assess the risk for CHD in relation to the ABCA1 R219K polymorphism. Login to comment
79 One explanation about how ABCA1 R219K polymorphism modifies the risk of CHD is that ABCA1 may influence the plasma lipid levels. Login to comment
82 Only the R219K was significantly associated with HDL-C concentration and CAD risk [29]. Login to comment
86 It is probable that the protective function of R219K polymorphism is not only explained by increased plasma HDL-C level. Login to comment
91 Another probable mechanism is that R219K polymorphism induces the activity of ABCA1 protein, which mediates cholesterol efflux from peripheral cells back to liver independent of plasma HDL-C levels. Login to comment
101 reported that R219K variant appeared to be more protective for smokers and ex-smokers than non-smokers in the premature CHD group. Login to comment
106 Our meta-analysis supports an association of ABCA1 R219K polymorphism with CHD in Asians. Login to comment
109 In subgroup analyses, evidence was obtained to suggest different risk effects of R219K between populations of Caucasians and Asians. Login to comment
51 Meta-analysis results The meta-analysis of the R219K polymorphism included 20 studies with 9,437 cases and 16,270 controls. Login to comment
59 Pooled OR is indicated by black diamonds Table 1 Summary estimates for the OR of ABCA1 R219K polymorphism in subgroup analyses Study population Studies, n OR (95% CI) P(Z)a P(Q)b I2 (%) P(Q)c All 20 0.80 (0.69-0.92) 0.001 \0.001 76 All in HWE 17 0.78 (0.66-0.92) 0.003 \0.001 79 Ethnicity 0.010 Caucasian 10 0.87 (0.73-1.04) 0.12 \0.001 77 Asian 8 0.69 (0.55-0.86) 0.0009 0.05 50 Other 2 0.70 (0.29-1.70) 0.43 Outcome 0.922 Coronary stenosis 12 0.78 (0.67-0.92) 0.002 0.03 49 Myocardial infarction 2 0.81 (0.67-0.98) 0.03 0.34 0 Combined 6 0.80 (0.59-1.08) 0.15 \0.001 90 Gender 0.381 Males 3 0.94 (0.80-1.09) 0.4 0.59 0 Femals 2 0.82 (0.41-1.63) 0.57 0.07 69 Combined 17 0.78 (0.66-0.92) 0.003 \0.001 78 HWE Hardy-Weinberg Equilibrium The OR was calculated using random effect model a Z test used to determine the significance of the overall OR b Cochran`s chi-square Q statistic test used to assess the heterogeneity in subgroups c Cochran`s chi-square Q statistic test used to assess the heterogeneity between subgroups Caucasians and the pooled OR was 0.87(95% CI 0.73-1.04; P(Z) = 0.12). Login to comment
64 Discussion This study represents the first application of meta-analysis to assess the risk for CHD in relation to the ABCA1 R219K polymorphism. Login to comment
78 One explanation about how ABCA1 R219K polymorphism modifies the risk of CHD is that ABCA1 may influence the plasma lipid levels. Login to comment
81 Only the R219K was significantly associated with HDL-C concentration and CAD risk [29]. Login to comment
85 It is probable that the protective function of R219K polymorphism is not only explained by increased plasma HDL-C level. Login to comment
90 Another probable mechanism is that R219K polymorphism induces the activity of ABCA1 protein, which mediates cholesterol efflux from peripheral cells back to liver independent of plasma HDL-C levels. Login to comment
100 reported that R219K variant appeared to be more protective for smokers and ex-smokers than non-smokers in the premature CHD group. Login to comment
105 Our meta-analysis supports an association of ABCA1 R219K polymorphism with CHD in Asians. Login to comment
108 In subgroup analyses, evidence was obtained to suggest different risk effects of R219K between populations of Caucasians and Asians. Login to comment

[hide] A dietary pattern including nopal, chia seed, soy ... J Nutr. 2012 Jan;142(1):64-9. Epub 2011 Nov 16. Guevara-Cruz M, Tovar AR, Aguilar-Salinas CA, Medina-Vera I, Gil-Zenteno L, Hernandez-Viveros I, Lopez-Romero P, Ordaz-Nava G, Canizales-Quinteros S, Guillen Pineda LE, Torres N
A dietary pattern including nopal, chia seed, soy protein, and oat reduces serum triglycerides and glucose intolerance in patients with metabolic syndrome.
J Nutr. 2012 Jan;142(1):64-9. Epub 2011 Nov 16., [PMID:22090467]

Abstract [show]
Metabolic syndrome (MetS) is a health problem throughout the world and is associated with cardiovascular disease and diabetes. Thus, the purpose of the present work was to evaluate the effects of a dietary pattern (DP; soy protein, nopal, chia seed, and oat) on the biochemical variables of MetS, the AUC for glucose and insulin, glucose intolerance (GI), the relationship of the presence of certain polymorphisms related to MetS, and the response to the DP. In this randomized trial, the participants consumed their habitual diet but reduced by 500 kcal for 2 wk. They were then assigned to the placebo (P; n = 35) or DP (n = 32) group and consumed the reduced energy diet plus the P or DP beverage (235 kcal) minus the energy provided by these for 2 mo. All participants had decreases in body weight (BW), BMI, and waist circumference during the 2-mo treatment (P < 0.0001); however, only the DP group had decreases in serum TG, C-reactive protein (CRP), and AUC for insulin and GI after a glucose tolerance test. Interestingly, participants in the DP group with MetS and the ABCA1 R230C variant had a greater decrease in BW and an increase in serum adiponectin concentration after 2 mo of dietary treatment than those with the ABCA1 R230R variant. The results from this study suggest that lifestyle interventions involving specific DP for the treatment of MetS could be more effective if local foods and genetic variations of the population are considered.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 Single nucleotide polymorphisms of the ABCA1 R230C (rs9282541), ABCA1 R219K (rs2230806), TCF7L2 (rs7903146), PPARG (rs1801282), and IRS1 (rs1801278) genes were determined using PCR-based TaqMan allele discrimination assays (ABI Prism 7900 HT Sequence Detection System, Applied Biosystems) (30). Login to comment
136 The number of participants with a specific genotype distribution (wild-type allele homozygote, variant heterozygote, variant homozygote) for each polymorphism was as follows: ABCA1 R230C (56, 11, 0,); ABCA1 R219K (37, 26, 4); TCF7L2 C/T (51,13,3); PPARG P12A (58 7,2,); and IRS1 G972R (59 7,1,). Login to comment
137 Allele frequencies (wild-type, variant) were as follows: ABCA1 R230C (91.8%, 8.2%); ABCA1 R219K (74.6%, 25.4%); TCF7L2 C/T (85.8%, 14.2%); PPARG P12A (91.8%, 8.2%); and IRS1 G972R (93.3%, 6.7%). Login to comment
138 Associations between ABCA1 R230C and anthropometric and biochemical variables. Login to comment
139 The decrease in BW in the participants in the DP group with the ABCA1 R230C variant was significantly greater (25.0 6 1.9 kg) than those with ABCA1 R230R variant (21.7 6 2 kg), and the increase in the serum adiponectin concentration in participants with the ABCA1 R230C variant (1.7 6 1.6 mg/L) was significantly greater than in those with the ABCA1 R230R variant (0.2 6 1.0 mg/L) after 2 mo. Login to comment
142 The ABCA1 R230C, ABCA1 R219K, TCF7L2 C/T, PPARG P12A, and IRS1 G972R polymorphisms were not related to the other clinical or biochemical variables or the dietary treatments (data not shown). Login to comment
171 Four additional polymorphisms, ABCA1 R219K, IRS-1 (Gly972Arg), PPARG (P12A), and TCF2L7, were examined in the current study because they are associated with decreased coronary heart disease, insulin resistance, weight loss, and diabetes; however, there was no relationship between the DP group, the presence of these polymorphisms, and the clinical and biochemical variables. Login to comment
95 Single nucleotide polymorphisms of the ABCA1 R230C (rs9282541), ABCA1 R219K (rs2230806), TCF7L2 (rs7903146), PPARG (rs1801282), and IRS1 (rs1801278) genes were determined using PCR-based TaqMan allele discrimination assays (ABI Prism 7900 HT Sequence Detection System, Applied Biosystems) (30). Login to comment
144 The ABCA1 R230C, ABCA1 R219K, TCF7L2 C/T, PPARG P12A, and IRS1 G972R polymorphisms were not related to the other clinical or biochemical variables or the dietary treatments (data not shown). Login to comment
173 Four additional polymorphisms, ABCA1 R219K, IRS-1 (Gly972Arg), PPARG (P12A), and TCF2L7, were examined in the current study because they are associated with decreased coronary heart disease, insulin resistance, weight loss, and diabetes; however, there was no relationship between the DP group, the presence of these polymorphisms, and the clinical and biochemical variables. Login to comment

[hide] A polymorphism of the ABCA1 gene confers susceptib... Prog Neuropsychopharmacol Biol Psychiatry. 2011 Dec 1;35(8):1877-83. Epub 2011 Aug 3. Ota M, Fujii T, Nemoto K, Tatsumi M, Moriguchi Y, Hashimoto R, Sato N, Iwata N, Kunugi H
A polymorphism of the ABCA1 gene confers susceptibility to schizophrenia and related brain changes.
Prog Neuropsychopharmacol Biol Psychiatry. 2011 Dec 1;35(8):1877-83. Epub 2011 Aug 3., [PMID:21839797]

Abstract [show]
OBJECTIVE: The ATP-binding cassette transporter A1 (ABCA1) mediates cellular cholesterol efflux through the transfer of cholesterol from the inner to the outer layer of the cell membrane and regulates extracellular cholesterol levels in the central nervous system. Several lines of evidence have indicated lipid and myelin abnormalities in schizophrenia. METHOD: Initially, we examined the possible association of the polymorphisms of the ABCA1 gene (ABCA1) with susceptibility to schizophrenia in 506 patients with schizophrenia (DSM-IV) and 941 controls. The observed association was then subject to a replication analysis in an independent sample of 511 patients and 539 controls. We further examined the possible effect of the risk allele on gray matter volume assessed with magnetic resonance imaging (MRI) in 86 patients with schizophrenia (49 males) and 139 healthy controls (47 males). RESULTS: In the initial association study, the 1587 K allele (rs2230808) was significantly more common in male patients with schizophrenia than in male controls. Although such a significant difference was not observed in the second sample alone, the increased frequency of the 1587 K allele in male patients remained to be significant in the combined male sample of 556 patients and 594 controls. Male schizophrenia patients carrying the 1587 K allele had a smaller amount of gray matter volume than those who did not carry the allele. CONCLUSION: Our data suggest a male-specific association of the 1587 K allele of ABCA1 with susceptibility to schizophrenia and smaller gray matter volume in schizophrenia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 Previous studies have examined the association between polymorphisms of ABCA1, particularly the non-synonymous single nucleotide polymorphisms (SNPs) of rs2230806 (R219K), rs2066718 (V771M), and rs2230808 (R1587K) and risk for Alzheimer's disease. Login to comment
65 We found only four well-validated SNPs with a heterozygosity value of N0.10 in Asian populations: rs2230806 (R219K), rs2066718 (V771M), rs2066714 (I883M), and rs2230808 (R1587K). Login to comment
123 db SNP ID and aminoacid change Position⁎ Inter-SNP distance (bp) Gender Group N Genotype distribution (frequency) χ2 P Allele count (frequency) χ2 P HWE of Controls (df=1) R/R R/K K/K R K rs2230806 107620867 (-) All Schizophrenia 497 119 (0.24) 241 (0.48) 137 (0.28) 2.77 0.250 479 (0.48) 515 (0.52) 0.01 0.897 χ²=3.73 Arg219Lys exon 7 Controls 932 204 (0.22) 495 (0.53) 233 (0.25) 903 (0.48) 961 (0.52) P=0.053 M Schizophrenia 274 63 (0.23) 137 (0.50) 74 (0.27) 0.47 0.789 263 (0.48) 285 (0.52) 0.45 0.503 χ²=0.05 Controls 330 71 (0.22) 162 (0.49) 97 (0.29) 304 (0.46) 356 (0.54) P=0.827 F Schizophrenia 223 56 (0.25) 104 (0.47) 63 (0.28) 216 (0.48) 230 (0.52) χ²=6.81 Controls 602 133 (0.22) 333 (0.55) 136 (0.23) 599 (0.50) 605 (0.50) P=0.009 V/V V/M M/M V M rs2066718 107589255 31,612 All Schizophrenia 494 438 (0.89) 54 (0.11) 2 (0.00) 1.09 0.580 930 (0.94) 58 (0.06) 0.99 0.319 χ²=0.04 Val771Met exon 16 Controls 936 812 (0.87) 120 (0.13) 4 (0.00) 1744 (0.93) 128 (0.07) P=0.847 M Schizophrenia 273 242 (0.89) 29 (0.11) 2 (0.01) 1.70 0.428 513 (0.94) 33 (0.06) 0.50 0.480 χ²=0.30 Controls 333 287 (0.86) 45 (0.14) 1 (0.00) 619 (0.93) 47 (0.07) P=0.582 F Schizophrenia 221 196 (0.89) 25 (0.11) 0 (0.00) 1.32 0.518 417 (0.94) 25 (0.06) 0.60 0.437 χ²=0.03 Controls 603 525 (0.87) 75 (0.12) 3 (0.00) 1125 (0.93) 81 (0.07) P=0.856 I/I I/M M/M I M rs2066714 107586753 34,114 All Schizophrenia 487 208 (0.43) 212 (0.44) 67 (0.14) 3.86 0.145 628 (0.64) 346 (0.36) 1.75 0.186 χ²=0.91 Ile883Met exon 18 Controls 917 345 (0.38) 446 (0.49) 126 (0.14) 1136 (0.62) 698 (0.38) P=0.339 M Schizophrenia 266 115 (0.43) 116 (0.44) 35 (0.13) 3.23 0.199 346 (0.65) 186 (0.35) 0.87 0.335 χ²=2.40 Controls 330 122 (0.37) 168 (0.51) 40 (0.12) 412 (0.62) 248 (0.38) P=0.122 F Schizophrenia 221 93 (0.42) 96 (0.43) 32 (0.14) 1.23 0.542 282 (0.64) 160 (0.36) 0.62 0.430 χ²=0.002 Controls 587 223 (0.38) 278 (0.47) 86 (0.15) 724 (0.62) 450 (0.38) P=0.966 R/R R/K K/K R K rs2230808 107562804 58,063 All Schizophrenia 491 174 (0.35) 252 (0.51) 65 (0.13) 4.05 0.132 600 (0.61) 382 (0.39) 0.63 0.427 χ²=0.50 Arg1587Lys exon 35 Controls 923 367 (0.40) 422 (0.46) 134 (0.15) 1156 (0.63) 690 (0.37) P=0.478 M Schizophrenia 273 87 (0.32) 148 (0.54) 38 (0.14) 8.51 0.014 322 (0.59) 224 (0.41) 3.68 0.055 χ²=1.17 Controls 327 140 (0.43) 141 (0.43) 46 (0.14) 421 (0.64) 233 (0.36) P=0.278 F Schizophrenia 218 87 (0.40) 104 (0.48) 27 (0.12) 0.79 0.674 278 (0.64) 158 (0.36) 0.60 0.440 χ²=0.01 Controls 596 227 (0.38) 281 (0.47) 88 (0.15) 735 (0.62) 457 (0.38) P=0.945 HWE; Hardy-Weinberg equilibrium. Login to comment
64 We found only four well-validated SNPs with a heterozygosity value of N0.10 in Asian populations: rs2230806 (R219K), rs2066718 (V771M), rs2066714 (I883M), and rs2230808 (R1587K). Login to comment
122 db SNP ID and aminoacid change PositionÌe; Inter-SNP distance (bp) Gender Group N Genotype distribution (frequency) c7;2 P Allele count (frequency) c7;2 P HWE of Controls (df=1) R/R R/K K/K R K rs2230806 107620867 (-) All Schizophrenia 497 119 (0.24) 241 (0.48) 137 (0.28) 2.77 0.250 479 (0.48) 515 (0.52) 0.01 0.897 c7;&#b2;=3.73 Arg219Lys exon 7 Controls 932 204 (0.22) 495 (0.53) 233 (0.25) 903 (0.48) 961 (0.52) P=0.053 M Schizophrenia 274 63 (0.23) 137 (0.50) 74 (0.27) 0.47 0.789 263 (0.48) 285 (0.52) 0.45 0.503 c7;&#b2;=0.05 Controls 330 71 (0.22) 162 (0.49) 97 (0.29) 304 (0.46) 356 (0.54) P=0.827 F Schizophrenia 223 56 (0.25) 104 (0.47) 63 (0.28) 216 (0.48) 230 (0.52) c7;&#b2;=6.81 Controls 602 133 (0.22) 333 (0.55) 136 (0.23) 599 (0.50) 605 (0.50) P=0.009 V/V V/M M/M V M rs2066718 107589255 31,612 All Schizophrenia 494 438 (0.89) 54 (0.11) 2 (0.00) 1.09 0.580 930 (0.94) 58 (0.06) 0.99 0.319 c7;&#b2;=0.04 Val771Met exon 16 Controls 936 812 (0.87) 120 (0.13) 4 (0.00) 1744 (0.93) 128 (0.07) P=0.847 M Schizophrenia 273 242 (0.89) 29 (0.11) 2 (0.01) 1.70 0.428 513 (0.94) 33 (0.06) 0.50 0.480 c7;&#b2;=0.30 Controls 333 287 (0.86) 45 (0.14) 1 (0.00) 619 (0.93) 47 (0.07) P=0.582 F Schizophrenia 221 196 (0.89) 25 (0.11) 0 (0.00) 1.32 0.518 417 (0.94) 25 (0.06) 0.60 0.437 c7;&#b2;=0.03 Controls 603 525 (0.87) 75 (0.12) 3 (0.00) 1125 (0.93) 81 (0.07) P=0.856 I/I I/M M/M I M rs2066714 107586753 34,114 All Schizophrenia 487 208 (0.43) 212 (0.44) 67 (0.14) 3.86 0.145 628 (0.64) 346 (0.36) 1.75 0.186 c7;&#b2;=0.91 Ile883Met exon 18 Controls 917 345 (0.38) 446 (0.49) 126 (0.14) 1136 (0.62) 698 (0.38) P=0.339 M Schizophrenia 266 115 (0.43) 116 (0.44) 35 (0.13) 3.23 0.199 346 (0.65) 186 (0.35) 0.87 0.335 c7;&#b2;=2.40 Controls 330 122 (0.37) 168 (0.51) 40 (0.12) 412 (0.62) 248 (0.38) P=0.122 F Schizophrenia 221 93 (0.42) 96 (0.43) 32 (0.14) 1.23 0.542 282 (0.64) 160 (0.36) 0.62 0.430 c7;&#b2;=0.002 Controls 587 223 (0.38) 278 (0.47) 86 (0.15) 724 (0.62) 450 (0.38) P=0.966 R/R R/K K/K R K rs2230808 107562804 58,063 All Schizophrenia 491 174 (0.35) 252 (0.51) 65 (0.13) 4.05 0.132 600 (0.61) 382 (0.39) 0.63 0.427 c7;&#b2;=0.50 Arg1587Lys exon 35 Controls 923 367 (0.40) 422 (0.46) 134 (0.15) 1156 (0.63) 690 (0.37) P=0.478 M Schizophrenia 273 87 (0.32) 148 (0.54) 38 (0.14) 8.51 0.014 322 (0.59) 224 (0.41) 3.68 0.055 c7;&#b2;=1.17 Controls 327 140 (0.43) 141 (0.43) 46 (0.14) 421 (0.64) 233 (0.36) P=0.278 F Schizophrenia 218 87 (0.40) 104 (0.48) 27 (0.12) 0.79 0.674 278 (0.64) 158 (0.36) 0.60 0.440 c7;&#b2;=0.01 Controls 596 227 (0.38) 281 (0.47) 88 (0.15) 735 (0.62) 457 (0.38) P=0.945 HWE; Hardy-Weinberg equilibrium. Login to comment

[hide] Genetic variation of the ATP-binding cassette tran... Mol Genet Metab. 2011 May;103(1):81-8. Epub 2011 Jan 22. Jiang Z, Zhou R, Xu C, Feng G, Zhou Y
Genetic variation of the ATP-binding cassette transporter A1 and susceptibility to coronary heart disease.
Mol Genet Metab. 2011 May;103(1):81-8. Epub 2011 Jan 22., [PMID:21300560]

Abstract [show]
ATP-binding cassette transporter A1 (ABCA1) is a member of a superfamily of membrane proteins that has attracted considerable attention as a candidate gene for coronary heart disease (CHD) based on its enzyme function as a key factor in regulating plasma HDL-C and apo A-I metabolism. It has been suggested that polymorphisms in the ABCA1 gene are risk factors for CHD, but a large number of studies have reported apparently conflicting results. To investigate this inconsistency and derive a more precise estimation of the relationship, a meta-analysis of 14,040 cases and 28,607 controls from 31 published case-control studies was performed. Five potential sources of heterogeneity including ethnicity, source of control, sample size, HWE status and genotyping method of study were also assessed. Overall, significantly decreased CHD risk was associated with 219K allele of R219K polymorphism when all studies were pooled into the meta-analysis. In the subgroup analysis by ethnicity, significantly decreased risks were found in Asians and other ethnic population for the polymorphism in all genetic models; while no significant associations were found among Caucasians. When stratified by source of controls, both population and hospital based studies get consistent positive results. However, no significant results were observed for I883M polymorphism of ABCA1 in all genetic models. In conclusion, this meta-analysis suggests that K allele of ABCA1 R219K polymorphism is a protective factor associated with decreased CHD susceptibility, but these associations vary in different ethnic populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 Overall, significantly decreased CHD risk was associated with 219 K allele of R219K polymorphism when all studies were pooled into the meta-analysis. Login to comment
8 In conclusion, this meta-analysis suggests that K allele of ABCA1 R219K polymorphism is a protective factor associated with decreased CHD susceptibility, but these associations vary in different ethnic populations. Login to comment
33 Among them, two common polymorphisms in the coding region, which lead to a arginine→lysine substitution at exon 7 (R219K, rs2230806) and isoleucine→methionine substitution in exon 18 (I883M, rs4149313) were studied widely for their association with CHD susceptibility [8,9]. Login to comment
35 In consideration of the extensive role of ABCA1 in the development of CHD, we carried out a comprehensive meta-analysis on all eligible case-control studies to estimate the overall CHD risk of ABCA1 R219K and I883M polymorphisms as well as to quantify the between-study heterogeneity and potential bias. Login to comment
38 Literature search and data extraction Genetic association studies published before the end of November 2010 on CHD and the R219K and I883M polymorphisms in the ABCA1 were sought through a search of PubMed, Web of Science, EMBASE, and CNKI (Chinese National Knowledge Infrastructure) database without language restrictions. Login to comment
49 The strength of association between R219K and I883M polymorphisms of ABCA1 and CHD risk was assessed by OR with the corresponding 95% confidence interval (CI). Login to comment
69 For the R219K polymorphism, 27 studies involved a total of 12,960 cases and 26,834 controls. Login to comment
75 of cases/ controls Mean age of cases/ controls Gender component in cases/controls (% male) Diagnostic criterion Outcome Definition of control Control source Genotyping method HWE for control Qi [15] 2010 R219K Chinese 173/389 60.0/61.0 70.3/57.9 ≥50% stenosis CAD CAD- HB RFLP Y Doosti [16] 2010 R219K Iranian 207/84 49.1/55.1 83.1/59.6 NA CAD CAD- HB RFLP N Shi [17] 2009 R219K Chinese 132/157 61.7/61.1 NA/NA NA CHD CAD- HB RFLP Y Wang [18] 2009 R219K Chinese 150/139 53.5/51.1 80.0/64.7 ≥50% stenosis CHD CHD- HB RFLP N Porchay-Baldérelli [8] 2009 R219K, I883M French 482/2647 68.0/65.2 79.7/71.8 NA CHD CHD- PB allele-specific PCR Y Li [19] 2009 R219K Chinese 365/246 63.0/61.0 66.4/45.9 ≥50% stenosis CHD Healthy PB RFLP Y Zhang [20] 2008 R219K Chinese 162/186 68.3/63.5 74.7/66.1 ≥50% stenosis CHD CHD- HB RFLP Y Ni [21] 2008 R219K Chinese 260/248 63.5/62.1 64.6/66.1 ≥50% stenosis CHD CHD- HB RFLP N Liu [22] 2008 R219K Chinese 71/155 58.0/57.0 52.1/55.5 NA CHD Healthy, CHD- HB, PB RFLP Y Frikke-Schmidt [9] 2008 R219K, I883M Danish 2039/15,851 NA/NA NA IHD IHD- PB TaqMan Y Wang [23] 2008 R219K Chinese 321/294 NA/NA NA/NA ≥50% stenosis CHD CHD- HB RFLP Y Balcerzyk [24] 2007 R219K Pole 178/180 43.8/35.0 65.7/71.1 ≥50% stenosis CAD CAD- PB RFLP Y Jensen [25] 2007 I883M American 259/930 62.0/54.3 0/0 WHO CHD CHD- PB Probe Y Tsai [26] 2007 I883M Chinese 205/201 62.9/51.9 78.0/51.0 ≥50% stenosis CAD CAD- PB RFLP Y Nebel [27] 2007 I883M German 1090/728 NA/NA NA/NA ≥70% stenosis CHD Healthy PB TaqMan Y Andrikovics [28] 2006 R219K, I883M German 150/193 53.4/35.3 68.4/48.2 ≥50% stenosis CHD CHD- PB Probe Y Wang [29] 2006 R219K Chinese 234/198 64.9/62.5 61.1/59.1 ≥50% stenosis CHD CHD- HB RFLP Y Martin [30] 2006 R219K, I883M Spanish 100/100 NA/NA 100/100 NA MI CHD- HB NA Y Li [31] 2005 R219K Chinese 394/417 60.1/59.4 59.8/59.5 ≥50% stenosis CHD Healthy PB RFLP Y Woll [32] 2005 R219K American 838/257 49.5/48.3 NA/NA NA CAD Healthy PB RFLP Y Sun [33] 2005 R219K, I883M Chinese 224/248 63.7/59.6 66.9/55.2 ≥50% stenosis CHD CHD- PB RFLP Y Whiting [34] 2004 R219K American 2468/834 65.0/59.0 60.0/46.0 ≥70% stenosis CAD CAD- HB RFLP Y Wang [35] 2004 R219K Chinese 222/278 62.4/62.2 54.9/50.7 NA CHD Healthy PB RFLP Y Tregouet [36] 2004 R219K, I883M British 750/722 56.3/57.3 67.0/NA NA MI CHD- PB BigDye Y Zhao [37] 2004 R219K Chinese 236/251 NA/NA NA/NA NA CHD Healthy PB RFLP Y Bertolini [38] 2004 R219K Italian 97/97 53.9/53.8 58.8/58.8 ≥50% stenosis CAD CAD- PB RFLP Y Harada [39] 2003 R219K, I883M Janpanese 273/137 NA/NA NA/NA ≥50% stenosis CAD CAD- HB Probe Y Tan [40] 2003 I883M Chinese, Malays, Indians 616/640 58.4/45.1 100/100 ≥50% stenosis CAD Healthy PB RFLP Y Cenarro [41] 2003 R219K Spanish 216/158 53.3/67.9 66.7/41.8 NA CHD CHD- HB RFLP Y Evans [42] 2003 R219K German 114/629 55.5/43.4 71.1/53.3 NA CHD CHD- HB Probe Y Brousseau [43] 2001 R219K, I883M American 1014/1013 64.0/53.0 100/100 ≥50% stenosis CHD CHD- PB Probe Y NA: not available; MI: myocardial infarction; CAD: coronary artery disease; IHD: ischemic heart disease; RFLP: restriction fragment length polymorphisms; Y: yes; N: no; PB: population based; HB: hospital based; WHO: world health organization. Login to comment
80 Association of R219K variant with CHD Significant heterogeneity was present among the 27 studies of the R219K polymorphism (Pb0.05). Login to comment
86 However, significantly decreased CHD risk was found in two studies [38,41] conducted in familial hypercholesterolaemia (FH) subjects [K allele: OR=0.66, 95% CI: 0.51-0.87; dominant model: OR=0.57, 95% CI: 0.41-0.80; recessive model: OR=0.72, 95% CI: Fig. 2. Forest plot (random-effects model) of CHD associated with ABCA1 R219K polymorphism using dominant genetic model. Login to comment
91 Table 2 Results of meta-analysis for ABCA1 R219K polymorphism and CHD risk. Sub-group analysis No. Login to comment
100 No heterogeneity was present among the 7 studies of the R219K polymorphism (PN0.05 for all comparison). Login to comment
121 Our results demonstrated that the K allele of the R219K polymorphism of ABCA1 is a protective factor for developing CHD. Login to comment
125 In the stratified analysis by ethnicity, significant associations were found in East Asians and other population for R219K polymorphism in all genetic models; while no associations were detected among Caucasians for the polymorphism. Login to comment
132 When analyses were restricted to FH subjects, the K allele of R219K polymorphism has a protective effect of CHD among Caucasian population. Login to comment
134 Our results suggest that taking other loci than LDLR such as variant R219K of ABCA1 into consideration in CHD prediction would give a more reliable result for FH patients. Login to comment
140 However, other studies failed to find an association between the R219K polymorphism and HDL [42,43,49]. Login to comment
148 Despite these limitations, this meta-analysis suggests that ABCA1 R219K polymorphism was significantly associated with decreased risk of CHD, particularly in East Asian population. Login to comment

[hide] ATP-binding cassette transporter A1 gene polymorph... Lipids Health Dis. 2011 Apr 13;10:56. Kolovou V, Kolovou G, Marvaki A, Karakosta A, Vasilopoulos G, Kalogiani A, Degiannis D, Marvaki C, Demopoulos CA
ATP-binding cassette transporter A1 gene polymorphisms and serum lipid levels in young Greek nurses.
Lipids Health Dis. 2011 Apr 13;10:56., [PMID:21489276]

Abstract [show]
OBJECTIVE: The ATP-binding cassette transporter A1 (ABCA1) is essential protein involved in lipid metabolism. The present study was undertaken to detect the possible association of polymorphisms in the ABCA1 gene [rs2230806 (R219K) and rs2230808 (R1587K)] and lipid profile in Greek young nurses. METHODS: The study population consisted of 308 unrelated nurses who were genotyped and the ABCA1 polymorphisms were detected. Additionally, lipid profile [total cholesterol (TC), triglycerides (TGs), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and apolipoprotein (apo) A] was evaluated. RESULTS: There was no difference in the genotypic and allelic frequencies of the R219K polymorphism according to lipid profile. The R1587K genotypes differed significantly according to TC, LDL-C and TGs concentration (p = 0.023, p = 0.014 and p = 0.047, respectively). Particularly, significant difference in TC, LDL-C and TGs concentration was detected between RK and RR genotypes (p = 0.006, p = 0.004, p = 0.014, respectively). Women with RK genotype compared to RR genotype had higher concentration of TGs (134.25 mg/dl vs 108.89 mg/dl, p = 0.014, respectively), total cholesterol (207.41 mg/dl vs 187.69 mg/dl, p = 0.006, respectively), and LDL-C (110.6 mg/dl vs 96.9 mg/dl, p = 0.004, respectively). CONCLUSIONS: These findings suggest that the R1587K polymorphism of ABCA1 gene was associated with lipid profile of Greek nurses. Women with RK genotype had higher TGs, total and LDL-C concentration compared to RR genotype. These observations may be significant in assessing the risk of CAD since a 1% change in LDL-C is associated with a 1% change of cardiovascular events. Also, TGs concentration were documented to play a significant role in women. However, this needs to be confirmed by larger studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 The present study was undertaken to detect the possible association of polymorphisms in the ABCA1 gene [rs2230806 (R219K) and rs2230808 (R1587K)] and lipid profile in Greek young nurses. Login to comment
4 Results: There was no difference in the genotypic and allelic frequencies of the R219K polymorphism according to lipid profile. Login to comment
16 This gene encodes a protein which is expressed in many tissues such as liver, macrophages, intestines, lungs etc. Several ABCA1 gene polymorphisms were identified, including rs2230806 (R219K) and rs2230808 (R1587K), which are mainly associated with the HDL cholesterol (HDL-C) concentration. Login to comment
17 The R219K results in a single amino acid change in codon 219 from arginine to lysine. Login to comment
18 The K allele of the R219K polymorphism has been related to low coronary artery disease (CAD) risk [4] and to lower triglycerides (TGs) concentration [5]. Login to comment
39 DNA analysis and determination of blood lipids The ABCA1 gene polymorphisms (R219K and R1587K) were detected using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP`s). Login to comment
41 For R219K polymorphism the oligonucleotide primers which were used are AAAGACTTCAAG- GACCCAGCTT and CCTCACATTCCGAAAGCATTA [9]. Login to comment
58 The frequencies of R219K genotypes were 50.97% for RR, 40.91% for RK and 8.12% for KK, whereas the frequencies of R1587K genotypes were 47.08% for RR, 41.56% for RK and 11.36% for KK. Login to comment
60 R219K and R1587K polymorphisms The distribution of R219K and R1587K polymorphisms was investigated according to Low HDL-C (n = 46) and High HDL-C concentration (n = 104). Login to comment
62 Moreover, no difference in the distribution of the R219K genotypes was detected according to lipid profile (Table 2). Login to comment
63 Also, no differences in the distribution of K and R carriers of R219K polymorphism was detected according to lipid profile (p = 0.87). Login to comment
67 Total cholesterol levels was higher in women with the RK compared to women with the RR genotype of the R1587K polymorphism (207.41 mg/dl vs 187.69 mg/dl, p Figure 2 R219K gene polymorphism. Login to comment
71 Table 2 R and K allele frequencies according to R219K and R1587K polymorphisms ABCA1 R allele frequency K allele frequency p value* R219K 0.72 0.28 0.11 R1587K 0.68 0.32 Fisher`s exact test = 0.006), whereas total cholesterol levels did not differ between women with RK and KK genotypes (207.41 mg/dl vs 193.66 mg/dl, p = 0.22). Login to comment
77 R219K gene polymorphism The frequency of R allele of R219K polymorphism in our study was 72% similar to Pasdar et al [10] who reported 73.2% in controls (68% in patients with ischemic stroke) and Porchay et al [11] [D.E.S.I.R participants (Data from an Epidemiological Study on the Insulin Resistance)] who reported 71.7%. Login to comment
79 Concerning lipid profile, the possibly influence of the R219K polymorphism is still evaluated. Login to comment
80 For example, Hodoğlugil et al in Turks individuals with low HDL-C concentration found the association of R219K polymorphism with HDL-C concentration [12]. Login to comment
81 Frikke-Schmidt et al in Danish population did not found any association between R219K polymorphism and individuals with Low or High HDL-C concentration [7]. Login to comment
85 Sandhofer et al [14] studied male population and did not find any association of R219K polymorphism and lipid profile. Login to comment
86 Also, Cenarro et al [15] evaluated the R219K polymorphism in patients with familial hypercholesterolemia with and without premature CAD and reported that K allele was more frequent in subjects without premature CAD compared to individuals with premature CAD [15]. Login to comment
87 Li et al [16] investigated the relation of R219K polymorphism with the manifestation of CAD in Chinese patients and did not report any significant correlation. Login to comment
89 Similarly, Delgado-Lista J et al [17] did not find association of R219K polymorphism and lipid profile. Login to comment
91 Also, no association between R219K polymorphism and Low or High HDL-C subgroups was found although small number involved in these groups may be a limitation. Login to comment
117 Thus the influence of diet or physical activities were unlikely, which may partially explain the lack of association of R219K or R1587K polymorphisms and HDL-C concentration. Login to comment
175 Li J, Wang LF, Li ZQ, Pan W: Effect of R219K polymorphism of the ABCA1 gene on the lipid-lowering effect of pravastatin in Chinese patients with coronary heart disease. Login to comment
38 DNA analysis and determination of blood lipids The ABCA1 gene polymorphisms (R219K and R1587K) were detected using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP`s). Login to comment
40 For R219K polymorphism the oligonucleotide primers which were used are AAAGACTTCAAGGACCCAGCTT and CCTCACATTCCGAAAGCATTA [9]. Login to comment
57 The frequencies of R219K genotypes were 50.97% for RR, 40.91% for RK and 8.12% for KK, whereas the frequencies of R1587K genotypes were 47.08% for RR, 41.56% for RK and 11.36% for KK. Login to comment
59 R219K and R1587K polymorphisms The distribution of R219K and R1587K polymorphisms was investigated according to Low HDL-C (n = 46) and High HDL-C concentration (n = 104). Login to comment
61 Moreover, no difference in the distribution of the R219K genotypes was detected according to lipid profile (Table 2). Login to comment
66 Total cholesterol levels was higher in women with the RK compared to women with the RR genotype of the R1587K polymorphism (207.41 mg/dl vs 187.69 mg/dl, p Figure 2 R219K gene polymorphism. Login to comment
70 Table 2 R and K allele frequencies according to R219K and R1587K polymorphisms ABCA1 R allele frequency K allele frequency p value* R219K 0.72 0.28 0.11 R1587K 0.68 0.32 Fisher`s exact test = 0.006), whereas total cholesterol levels did not differ between women with RK and KK genotypes (207.41 mg/dl vs 193.66 mg/dl, p = 0.22). Login to comment
76 R219K gene polymorphism The frequency of R allele of R219K polymorphism in our study was 72% similar to Pasdar et al [10] who reported 73.2% in controls (68% in patients with ischemic stroke) and Porchay et al [11] [D.E.S.I.R participants (Data from an Epidemiological Study on the Insulin Resistance)] who reported 71.7%. Login to comment
78 Concerning lipid profile, the possibly influence of the R219K polymorphism is still evaluated. Login to comment
84 Sandhofer et al [14] studied male population and did not find any association of R219K polymorphism and lipid profile. Login to comment
88 Similarly, Delgado-Lista J et al [17] did not find association of R219K polymorphism and lipid profile. Login to comment
90 Also, no association between R219K polymorphism and Low or High HDL-C subgroups was found although small number involved in these groups may be a limitation. Login to comment
116 Thus the influence of diet or physical activities were unlikely, which may partially explain the lack of association of R219K or R1587K polymorphisms and HDL-C concentration. Login to comment
174 Li J, Wang LF, Li ZQ, Pan W: Effect of R219K polymorphism of the ABCA1 gene on the lipid-lowering effect of pravastatin in Chinese patients with coronary heart disease. Login to comment

[hide] Associations of the ATP-binding cassette transport... Atherosclerosis. 2011 Apr;215(2):428-34. Epub 2011 Jan 21. Ma XY, Liu JP, Song ZY
Associations of the ATP-binding cassette transporter A1 R219K polymorphism with HDL-C level and coronary artery disease risk: a meta-analysis.
Atherosclerosis. 2011 Apr;215(2):428-34. Epub 2011 Jan 21., [PMID:21310416]

Abstract [show]
OBJECTIVE: Previous studies have evaluated the associations of the ATP-binding cassette transporter A1 (ABCA1) R219K polymorphism (rs2230806) with the level of high-density lipoprotein cholesterol (HDL-C) and the risk of developing coronary artery disease (CAD), but results from many small, underpowered studies are conflicting. The objective of this study was to overcome the limitations of individual study and provide solid epidemiologic evidence. METHODS: We conducted a systematic review and meta-analysis of available studies to clarify the associations of the ABCA1 R219K polymorphism with HDL-C level and CAD risk. RESULTS: Through retrieving PubMed, Embase, Web of Science, CBM and CNKI, we identified a total of 22 studies with 6597 cases and 15,369 controls for the association between the ABCA1 R219K polymorphism and CAD risk. The carriers of allele 219K were found to have a lower risk of CAD than the non-carriers: OR=0.76, 95% CI=0.68-0.85, P=3.78E-07, P(heterogeneity)=3.59E-08; meanwhile, 18 studies from 17 papers with 12,869 subjects were included in the association between the ABCA1 R219K polymorphism and the level of HDL-C. It was suggested that the carriers of KK genotype had higher level of HDL-C than those of RR genotype: SMD=0.19, 95% CI=0.06-0.32, P=0.005, P(heterogeneity)=3.19E-09. Subgroup analyzes by ethnicity certified that the effect on HDL level was just significant in Asians. Exclusion of the outlier studies effectively removed the heterogeneity and confirmed the total results. No publication bias was detected in this meta-analysis. CONCLUSIONS: The synthesis of available evidence demonstrates that the ABCA1 R219K polymorphism is associated with a higher HDL-C level in Asians and a protective role for CAD risk both in Asians and Caucasians.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Atherosclerosis 215 (2011) 428-434 Contents lists available at ScienceDirect Atherosclerosis journal homepage: www.elsevier.com/locate/atherosclerosis Associations of the ATP-binding cassette transporter A1 R219K polymorphism with HDL-C level and coronary artery disease risk: A meta-analysis Xiang-yu Maa,b,1 , Jian-ping Liua,1 , Zhi-yuan Songa,* a Department of Cardiology, Southwest Hospital, Third Military Medical University, Gaotanyan Street 30, Chongqing 400038, China b Department of Epidemiology, Faculty of Preventive Medicine, Third Military Medical University, Gaotanyan Street 30, Chongqing 400038, China a r t i c l e i n f o Article history: Received 2 July 2010 Received in revised form 16 December 2010 Accepted 7 January 2011 Available online 21 January 2011 Keywords: Meta-analysis Coronary artery disease ATP-binding cassette transporter A1 HDL-C a b s t r a c t Objective: Previous studies have evaluated the associations of the ATP-binding cassette transporter A1 (ABCA1) R219K polymorphism (rs2230806) with the level of high-density lipoprotein cholesterol (HDL-C) and the risk of developing coronary artery disease (CAD), but results from many small, underpowered studies are conflicting. Login to comment
2 Methods: We conducted a systematic review and meta-analysis of available studies to clarify the associations of the ABCA1 R219K polymorphism with HDL-C level and CAD risk. Login to comment
3 Results: Through retrieving PubMed, Embase, Web of Science, CBM and CNKI, we identified a total of 22 studies with 6597 cases and 15,369 controls for the association between the ABCA1 R219K polymorphism and CAD risk. Login to comment
4 The carriers of allele 219K were found to have a lower risk of CAD than the non-carriers: OR = 0.76, 95% CI = 0.68-0.85, P = 3.78E-07, Pheterogeneity = 3.59E-08; meanwhile, 18 studies from 17 papers with 12,869 subjects were included in the association between the ABCA1 R219K polymorphism and the level of HDL-C. Login to comment
9 Conclusions: The synthesis of available evidence demonstrates that the ABCA1 R219K polymorphism is associated with a higher HDL-C level in Asians and a protective role for CAD risk both in Asians and Caucasians. Login to comment
29 The results showed that only the R219K polymorphism (G1051A, rs2230806), which resulted from the substitution of a lysine for arginine at amino acid 219 of the ABCA1 protein, was associated with increased HDL-C and a reduced risk of CAD. Login to comment
31 However, there have been few studies focusing on other genetic variants in the ABCA1 gene with the exception of R219K. Login to comment
32 Considering R219K being the most focused polymorphic site and the limited number of studies about other genetic variants in the ABCA1 gene, we conducted this meta-analysis to clarify the role of the ABCA1 R219K polymorphism in the synthesis of HDL-C and CAD risk. Login to comment
40 Selection criteria We selected the studies that met the following criteria: (1) the publication examined the associations of the ABCA1 R219K polymorphism with CAD or HDL-C level; (2) all CAD cases were diagnosed as myocardial infarction (defined by World Health Organization Multinational Monitoring of Trends and Determinants in Cardiovascular Disease [MONICA] criteria [7]) or angiographic coronary stenosis (generally defined as at least 50% stenosis of one major coronary artery); (3) for CAD association, the papers must offer the total number of cases and controls, distribution of genotypes or other information that can help us infer the results; for HDL-C level association, the number of population, the mean of HDL-C level and the standard deviations (SD) by genotypes should be available; (4) when multiple publications reported on the same or overlapping data, we used the most recent or largest population as recommended by Little et al. [8]; (5) publication language was limited to English and Chinese. Login to comment
49 Summary odds ratios (ORs) with their 95% confidence intervals (CIs) for alleles and genotypes were used to assess the strength of the association between the ABCA1 R219K polymorphism and CAD risk. Login to comment
51 A pooled standardized mean difference (SMD) and its 95% CIs were used for the meta-analysis of HDL-C level and the ABCA1 R219K polymorphism. Login to comment
61 Selection and characteristics of studies Through a comprehensive retrieval and evaluation, 22 studies with 6597 cases and 15,369 controls were identified with data on the ABCA1 R219K polymorphism and CAD [5,12-32]. Login to comment
65 Table 2 describes the characteristics and data of the studies which were included in the association between the ABCA1 R219K polymorphism and HDL-C level. Login to comment
70 Association between the ABCA1 R219K polymorphism and CAD risk The result of all 22 comparisons showed that the carriers of allele 219K had a lower risk of CAD than the non-carriers: OR = 0.76, 95% CI = 0.68-0.85, P = 3.78E-07, Pheterogeneity = 3.59E-08 (Fig. 1). Login to comment
71 Additive genetic model, recessive genetic model and dominant genetic model were also included in the analysis of the association between the ABCA1 R219K polymorphism and CAD risk (Supplementary Figs. 1-3) and the results were similar with allele comparison. Login to comment
73 There was significant heterogeneity among the available studies and this Table 1 Characteristics of individual studies included in the meta-analysis of CAD and the ABCA1 R219K polymorphism. First author Year Country Ethnicity Source of controls Number (case/control) MAF Cases Controls RR RK KK RR RK KK Porchay-Balderelli et al. [14] 2009 France Caucasian Population-based 482/2647 0.28 270 175 37 1326 1109 212 Frikke-Schmidt et al. [19] 2008 Denmark Caucasian Population-based 1107/7858 0.26 603 429 75 4260 3032 566 Balcerzyk et al. [20] 2008 Poland Caucasian Population-based 178/180 0.29 90 68 20 91 78 11 Nebel et al. [21] 2007 Germany Caucasian Population-based 1090/728 0.36 b Cases: 578-1602; control: 376-1080 Andrikovics et al. [24] 2006 Germany Caucasian Population-based 150/193 0.29 84 55 11 97 73 23 Martin et al. [23] 2006 Spain Caucasian Hospital-based 100/100 0.31 48 42 10 49 40 11 Bertolini et al. [29] 2004 Italy Caucasian Hospital-based 97/97 NA c Cases: 65-32; control:47-50 Cenarro et al. [32] 2003 Spain Caucasian Hospital-based 216/158 0.28 123 78 15 72 71 15 Evans and Beil [31] 2003 Germany Caucasian Hospital-based 114/629 0.26 72 35 7 337 245 47 Clee et al. [5] 2001 Canada Caucasian Hospital-based 432/358 0.25 248 170 14 176 160 22 Li et al. [15] 2009 China Asian Population-based 365/246 0.39 140 170 55 92 116 38 Li et al. [26] 2005 China Asian Population-based 396/417 0.42 158 174 64 124 198 95 Zhao and Xiao [27] 2004 China Asian Population-based 236/251 0.40 96 111 29 80 123 48 Wang and Zhang [13]a 2009 China Asian Hospital-based 150/139 0.42 61 69 20 47 53 39 Zhang et al. [16] 2008 China Asian Hospital-based 162/186 0.43 71 65 26 49 93 44 Yu and Deng [17] 2008 China Asian Hospital-based 49/72 0.34 29 18 2 24 35 13 Liu et al. [18] 2008 China Asian Hospital-based 113/155 0.32 71 39 3 57 70 28 Wang et al. [22] 2006 China Asian Hospital-based 234/198 0.36 108 105 21 67 101 30 Sun et al. [25] 2005 China Asian Hospital-based 224/248 0.42 105 85 34 62 129 57 Wang et al. [28] 2004 China Asian Hospital-based 222/278 0.47 79 94 49 76 125 77 Harada et al. [30] 2003 Japan Asian Hospital-based 273/137 0.49 73 139 61 31 73 33 Doosti et al. [12]a 2010 Iran - Hospital-based 207/94 0.47 77 71 59 38 17 39 MAF = minor allele frequency; NA = not available. Login to comment
77 Meta-analysis of CAD and the ABCA1 R219K polymorphism (allele comparison). Login to comment
78 Table 2 Characteristics of individual studies included in the meta-analysis of HDL-C level and the ABCA1 R219K polymorphism. First author Year Country Ethnicity MAF RR RK KK n Mean SD n Mean SD n Mean SD Porchay-Balderelli et al. [14] 2009 France Caucasian 0.28 1596 1.31 0.36 1284 1.32 0.35 249 1.33 0.36 Sandhofer et al. [33] 2008 Austria Caucasian 0.29 350 1.41 0.34 274 1.38 0.33 64 1.38 0.29 Boekholdt et al. [36]a 2006 Holland Caucasian 0.24 302 0.92 0.21 223 0.92 0.22 21 0.92 0.20 Hodoglugil et al. [37] 2005 Turkey Caucasian 0.39 364 1.06 0.24 480 1.06 0.22 152 1.06 0.26 Hodoglugil et al. [37] 2005 Turkey Caucasian 0.37 574 0.91 0.19 688 0.91 0.19 204 0.91 0.20 Evans and Beil [31] 2003 Germany Caucasian 0.26 279 1.32 0.03 206 1.34 0.03 30 1.27 0.31 Clee et al. [5]a 2001 Canada Caucasian 0.25 424 0.92 0.22 330 0.93 0.23 36 0.92 0.20 Wang and Zhang [13]a 2009 China Asian 0.42 108 0.96 0.26 122 1.03 0.30 59 1.07 0.25 Li et al. [15] 2009 China Asian 0.38 140 1.06 0.15 170 1.09 0.13 55 1.12 0.17 Liu et al. [18]a 2008 China Asian 0.32 29 1.22 0.18 39 1.26 0.19 3 1.48 0.11 Wu and Bai [35] 2007 China Asian 0.47 52 1.27 0.29 107 1.41 0.54 41 1.48 0.45 Wang et al. [22] 2006 China Asian 0.36 175 1.09 0.18 206 1.11 0.23 51 1.34 0.35 Li et al. [26] 2005 China Asian 0.38 158 1.12 0.33 174 1.16 0.30 64 1.15 0.38 Wang et al. [28]a 2004 China Asian 0.43 79 0.96 0.14 94 0.95 0.14 49 1.01 0.12 Zhao and Xiao [27] 2004 China Asian 0.40 176 1.32 0.33 234 1.36 0.39 77 1.44 0.32 Zhao et al. [38] 2004 China Asian 0.40 394 1.3 0.4 470 1.4 0.4 179 1.4 0.4 Harada et al. [30] 2003 Japan Asian 0.48 68 1.25 0.41 140 1.24 0.40 57 1.24 0.35 Benton et al. [34]a 2007 USA Mixed 0.39 388 1.33 0.38 409 1.29 0.35 172 1.37 0.39 MAF = minor allele frequency; NA = not available; HDL-C = HDL cholesterol; 1 mmol/l HDL-C = 38.73 mg/dl HDL-C. Login to comment
83 However, the significant association between the ABCA1 R219K polymorphism and CAD risk was unchanged. Login to comment
85 The results suggested a significant association between the ABCA1 R219K polymorphism and CAD risk, but the existence of heterogeneity was not influenced. Login to comment
87 Association between the ABCA1 R219K polymorphism and HDL-C level Fig. 2 describes the result of the meta-analysis of HDL-C level and the ABCA1 R219K polymorphism (KK vs RR) and it strongly suggested that the carriers of KK genotype had higher level of HDL-C than those of RR genotype: SMD = 0.19, 95% CI = 0.06-0.32, P = 0.005, Pheterogeneity = 3.19E-09. Login to comment
97 For the ABCA1 R219K polymorphism and CAD risk, the shape of the funnel plot (Fig. 3 and Supplementary Fig. 9) did not reveal obvious asymmetry which means no publication bias. Login to comment
98 Then, it was confirmed by Egger`s test (P value for allele contrast: 0.200; P value for dominant model: 0.494); for the ABCA1 R219K polymorphism and HDL-C level, both of the shape of the funnel plot (Fig. 4 and Supplementary Fig. 10) and Egger`s test (P value for KK vs RR: 0.646; P value for RK vs RR: 0.714) confirmed the absence of publication bias. Login to comment
101 Additionally, a total of 18 studies from 17 papers with 12,869 subjects were included in the analysis of association between the ABCA1 R219K polymorphism and HDL-C level. Login to comment
103 After the associations of the ABCA1 polymorphisms with HDL-C level and CAD were reported by Clee et al. [5] in 2001, serial of studies evaluated the association of the ABCA1 R219K polymorphism with HDL-C level and CAD risk in different races, and the results manifested inconclusive and underpowered. Login to comment
104 We calculated the MAFs of the ABCA1 R219K polymorphism in all studies and found that MAFs of Asian were higher than those of Caucasian through t test (P < 0.01). Login to comment
106 To date, several well-designed genome-wide association studies (GWAS) of coronary heart disease have been performed [39-47], but the R219K variant was not tested by these GWAS because of the limited SNP coverage rate of the existing SNP microarray platforms on the ABCA1 gene. Login to comment
109 In this meta-analysis, we found that the ABCA1 R219K polymorphism was significantly associated with a higher level of HDL-C in Asians, not in Caucasians; we also confirmed the protective role of ABCA1 R219K polymorphism for CAD risk both in Asians and Caucasians (allele contrast: OR = 0.76, 95% CI = 0.68-0.85, P = 3.78E-07, Pheterogeneity = 3.59E-08), though the association in Caucasians was less consistent than that in Asians. Login to comment
111 Meta-analysis of HDL-C level and the ABCA1 R219K polymorphism (KK vs RR). Login to comment
115 Funnel plot for allele comparison of CAD and the ABCA1 R219K polymorphism. Login to comment
121 Funnel plot of HDL-C level and the ABCA1 R219K polymorphism (KK vs RR). Login to comment
129 By excluding these outlier studies, the heterogeneity among Asian subjects and Caucasian studies was effectively removed, but the significant association between the ABCA1 R219K polymorphism and CAD risk or HDL-C level was not changed. Login to comment
132 The results suggested a significant association between the ABCA1 R219K polymorphism and CAD risk or HDL-C level. Login to comment
134 The functional analysis of the ABCA1 R219K polymorphism was done by SIFT and Polyphen, which predicted not only damaging variants, but also gain-of-function mutations. Login to comment
140 During these studies, cases were all survivors of CAD, as we could not evaluate those that did not survive; second, the sample sizes of some included studies were rather small and they did not have adequate power to detect the possible risk for the R219K polymorphism. Login to comment
143 Conclusion The synthesis of available evidence supports the fact that the ABCA1 R219K polymorphism is associated with a higher level of HDL-C in Asians and a protective role for CAD risk both in Asians and Caucasians. Login to comment

[hide] The Association between Sporadic Alzheimer's Disea... Iran Red Crescent Med J. 2011 Apr;13(4):256-62. Epub 2011 Apr 1. Khorram Khorshid HR, Gozalpour E, Kamali K, Ohadi M, Karimloo M, Shahhosseiny MH
The Association between Sporadic Alzheimer's Disease and the Human ABCA1 and APOE Gene Polymorphisms in Iranian Population.
Iran Red Crescent Med J. 2011 Apr;13(4):256-62. Epub 2011 Apr 1., [PMID:22737475]

Abstract [show]
BACKGROUND: Apolipoprotein E (APOE), which its epsilon4 allele has been reported as a risk factor in late onset Alzheimer's disease (AD), is the main cholesterol carrier in the brain. ATP-binding cassette transporter A1 (ABCA1) gene on chromosome 9, which has been known by genome-wide AD linkage study, has an important role in cellular cholesterol efflux. This study determines the association between sporadic AD and the human ABCA1 and APOE gene polymorphisms in Iranian population. METHODS: 154 AD cases and 162 control subjects from Iranian population were genotyped for APOE genotypes and ABCA1 polymorphism (R219K). RESULTS: The frequency of epsilon2epsilon3 genotype was higher in control subjects comparing AD patients but was not significant (13% versus 5.8%) and epsilon3epsilon4 genotype frequency was significantly higher in AD cases comparing with control subjects. APOE-epsilon2 allele frequency in cases was lower than control subjects but this difference was not significant (4.5% versus 8%). Individuals carrying epsilon4 allele, developed AD 6.5 times more than non-carriers (OR=6.52, 95%CI=2.63-16.17). There was no significant association between ABCA1 polymorphism and AD. CONCLUSION: Unlike other studies, R219K polymorphism was not dependent on gender and APOE-epsilon4 allele and there was no association between APOE and ABCA1 in AD patients compared to controls.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Methods: 154 AD cases and 162 control subjects from Iranian population were genotyped for APOE genotypes and ABCA1 polymorphism (R219K). Login to comment
8 Conclusion: Unlike other studies, R219K polymorphism was not dependent on gender and APOE-ε4 allele and there was no association between APOE and ABCA1 in AD patients compared to controls. Login to comment

[hide] Mutations in APOA-I and ABCA1 in Norwegians with l... Clin Chim Acta. 2010 Dec 14;411(23-24):2019-23. Epub 2010 Aug 25. Berge KE, Leren TP
Mutations in APOA-I and ABCA1 in Norwegians with low levels of HDL cholesterol.
Clin Chim Acta. 2010 Dec 14;411(23-24):2019-23. Epub 2010 Aug 25., [PMID:20800056]

Abstract [show]
BACKGROUND: Epidemiological studies have shown that low levels of plasma high density lipoprotein (HDL) cholesterol are associated with increased risk of ischemic heart disease (IHD), but it appears that genetic forms of low HDL cholesterol levels, as opposed to lifestyle-induced low levels of HDL cholesterol, do not result in increased risk of IHD. Therefore, the etiology of reduced levels of plasma HDL cholesterol may represent a factor that should be considered in risk stratification with respect to primary prevention. Genes encoding proteins involved in HDL metabolism, such as the ATP-binding cassette transporter A1 (ABCA1) and apolipoprotein (apo) A-I genes, are candidate genes for harboring mutations that lead to low HDL cholesterol levels. METHODS: The ABCA1 and apoA-I genes in 56 Norwegian patients, with a mean HDL cholesterol level of 0.53 (+/-0.15) mmol/l, were subjected to DNA sequencing. RESULTS: Several mutations were identified in the ABCA1 gene, and two mutations were identified in the apoA-I gene. A total of 18 patients (32%) were carriers of mutations considered to be pathogenic. Their mean HDL cholesterol level was 0.45 (+/-0.15) mmol/l compared to 0.57 (+/-0.14) mmol/l in noncarriers (p<0.005). CONCLUSION: Mutations in the genes encoding ABCA1 and apoA-I are common in Norwegians, with a markedly decreased HDL cholesterol level.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 of patients (het/hom)a Mutation Nucleotide Exon/Intron (i) PolyPhen prediction (score) SNP rs ID, ref.# ABCA1 Missense 8/3 R219K c.656, GNA 7 Benign (0.489) rs2230806 0/1 R282Q c.845, GNA 9 Benign (0.592) Novel 1/0 V399A c.1196, TNC 11 Benign (0.040) rs9282543 1/0 M636V c.1906, ANG 15 Benign (0.418) Novel 3/0 V771M c.2311, GNA 16 Benign (0.931) rs2066718 2/0 V825I c.2473, GNA 17 Benign (0.440) rs2066715 3/1 I883M c.2649, ANG 18 Benign (0.147) rs2066714 1/0 C887F c.2660, GNT 19 Benign (0.888) Novel 3/0 E1172D c.3516, GNC 24 Benign (0.546) rs33918808 1/0 G1216V c.3647, GNT 25 Prob damb (2.154) Ref. [18] 1/0 L1244Q c.3731, TNA 25 Prob dam (2.269) Novel 1/0 C1477F c.4430, TNA 31 Prob dam (3.688) Ref. [17] 14/1 R1587K c.4760, ANT 35 Benign (0.284) rs2230808 1/0 V1674I c.5020, GNA 37 Benign (0.821) Novel 1/0 R1680Q c.5039, GNA 37 Poss damc (1.926) Ref. [17] 1/0 N1800H c.5398, ANC 40 Poss dam (1.845) Ref. [19] Nonsense/splice 1/0 IVS4+1, GNA c.302+1, GNA i4 - 1/0 C1429X c.4287, CNA 31 - 1/0 IVS32+1, GNA c.4559+1, GNA i32 - APOA-I 7/0 R160L c.551, GNT 4 Prob dam (2.491) Ref. [21] 1/0 del182K del c.616-618 AAG 4 - Novel a Het: heterozygote, hom: homozygote. Login to comment
78 Variants R219K, V399A, V771M, V825I, I883M, E1172D, and R1587K have been reported as single nucleotide polymorphisms (SNPs) (Table 1). Login to comment
80 In addition, R219K, V771M, V825I, I883M, E1172D, and R1587K have been found in similar frequencies in patients with low or high HDL cholesterol levels [18], indicating that these variants do not cause low HDL cholesterol levels. Login to comment

[hide] Associations between common polymorphisms of adeno... Arch Cardiovasc Dis. 2010 Oct;103(10):530-7. Epub 2010 Nov 20. Rejeb J, Omezzine A, Rebhi L, Boumaiza I, Kchock K, Belkahla R, Rejeb NB, Nabli N, Abdelaziz AB, Boughzala E, Bouslama A
Associations between common polymorphisms of adenosine triphosphate-binding cassette transporter A1 and coronary artery disease in a Tunisian population.
Arch Cardiovasc Dis. 2010 Oct;103(10):530-7. Epub 2010 Nov 20., [PMID:21130966]

Abstract [show]
BACKGROUND: The adenosine triphosphate-binding cassette transporter A1 (ABCA1) protein plays an important role in the first step of the reverse cholesterol transport system. AIMS: We studied the association of four polymorphisms in the ABCA1 gene (G1051A, G2706A, G2868A and -565C/T) with lipid profile and coronary artery disease. METHODS: Overall, 316 Tunisian patients underwent coronary angiography. Genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism analysis. Lipid and apolipoprotein concentrations were measured. RESULTS: Only carriers of the G2706A allele were associated with a decreased risk of significant stenosis (odds ratio [OR] 0.66, 95% confidence interval [CI] 0.22-0.92, p = 0.029), without pronounced effects on high-density lipoprotein (HDL) cholesterol. This protective effect was significant in smokers and diabetes. Carriers of the G1051A allele were associated only with increased concentrations of HDL cholesterol (p = 0.032). G2868A and -565C/T did not show any association with lipids or risk of significant stenosis. When ABCA1 polymorphisms were combined in haplotypes possessing G1051A, G2706A, G2868A and -565C/T, (AAGC) seemed to be most protective against significant stenosis (OR 0.5, 95% CI 0.29-0.96, p = 0.048) whereas (GGAT) was probably the most atherogenic (OR 1.26, 95% CI 1.03-1.56, p = 0.025). CONCLUSION: Only the G2706A allele seems to be associated with a reduced risk of significant stenosis without important modification of HDL-cholesterol concentration, and appears to be more protective for smokers and diabetic patients. We found that (AAGC) seems to be a protective haplotype whereas (GGAT) has an atherogenic effect in a Tunisian population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 The genotypes for each ABCA1 polymorphism (G1051A [R219K], G2706A [V771M], G2868A [V825I] and -565C/T [-477C/T]) were determined by polymerase chain reaction-restriction fragment length polymorphism analysis. Login to comment

[hide] Increase in HDL-C concentration by a dietary portf... Mol Genet Metab. 2010 Oct-Nov;101(2-3):268-72. Epub 2010 Aug 10. Guevara-Cruz M, Tovar AR, Larrieta E, Canizales-Quinteros S, Torres N
Increase in HDL-C concentration by a dietary portfolio with soy protein and soluble fiber is associated with the presence of the ABCA1R230C variant in hyperlipidemic Mexican subjects.
Mol Genet Metab. 2010 Oct-Nov;101(2-3):268-72. Epub 2010 Aug 10., [PMID:20797885]

Abstract [show]
BACKGROUND: A dietary portfolio has been used to reduce blood lipids in hyperlipidemic subjects. To increase the effectiveness of these dietary treatments in specific populations, it is important to study the genetic variability associated with the development of certain types of hyperlipidemias. Low plasma high-density lipoprotein cholesterol (HDL-C) levels are the most common dyslipidemia in Mexican adults and are coupled with the presence of the ABCA1 R230C genotype. Therefore, the aim of this study was to assess the response of HDL-C concentration to a dietary portfolio in a group of Mexican hyperlipidemic subjects with ABCA1R230C (rs9282541) and R219K (rs2230806) polymorphisms. METHODS: Forty-three hyperlipidemic subjects (20 men and 23 women) were given a low saturated fat (LSF) diet for one month, followed by a LSF diet that included 25g of soy protein and 15g of soluble fiber daily for 2months. We analyzed two ABCA1 polymorphisms and studied their association with serum lipids before and after treatment. RESULTS: Hyperlipidemic subjects with the ABCA1 R230C genotype showed lower HDL-C concentrations at the beginning of the study and were better responders to the dietary treatment than subjects with the ABCA1 R230R genotype (+4.6% vs. +14.6%) (p=.05). According to gender and the presence of the R230C genotype, women responded more significantly to the dietary treatment, reflected by an increase of 21.9% in HDL concentration (p=.022), than women with R230R genotype who only experienced an increase of 2.7% in HDL-C concentration. There was no association between the presence of the ABCA1 R219K variant (p=.544) and HDL concentration. CONCLUSION: Hyperlipidemic Mexican subjects with the ABCA1 R230C genotype showed lower HDL-concentrations and were better responders to dietary portfolio treatments for increasing HDL-C concentrations than subjects with the R230R genotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Therefore, the aim of this study was to assess the response of HDL-C concentration to a dietary portfolio in a group of Mexican hyperlipidemic subjects with ABCA1R230C (rs9282541) and R219K (rs2230806) polymorphisms. Login to comment
8 There was no association between the presence of the ABCA1 R219K variant (p=.544) and HDL concentration. Login to comment
31 The effect of ABCA1 genetic polymorphisms on HDL-C levels has been widely documented mainly in adults [9]; specifically, the K allele of the ABCA1 R219K polymorphism has been associated with increased HDL-concentrations [10-13] and a reduced incidence of coronary heart disease (CHD) events [10,11]. Login to comment
36 Therefore, the aim of this study was to assess the response of HDL-cholesterol concentration to a dietary portfolio consisting of soy protein and soluble fiber in a group of Mexican hyperlipidemic subjects with or without ABCA1(R230C, rs9282541) and R219K (rs2230806) polymorphisms and to evaluate its association with the dietary portfolio in responders and non-responders. Login to comment
62 [22] These two single-nucleotide polymorphisms (SNPs) of the gene ABCA1 (R230C variant (rs9282541) and R219K (rs2230806)) were determined using polymerase chain reaction (PCR)-based TaqMan allele discrimination assays (ABI Prism 7900HT Sequence Detection System; Applied Biosystems, Foster City, CA) [26]. Login to comment
70 Results Genotype distribution (wild type allele homozygote, variant heterozygote, variant homozygote) for each polymorphism was as follows: R230C (31, 12, 0) and R219K (19, 21, 3). Login to comment
71 Allele frequencies (wild-type, variant) were for R230C (75.5%, 24.4%) and R219K (68.6%, 31.4%). Login to comment
80 ABCA1 R219K was also studied due to its association with the fenofibrate response; however, there was no association between the presence of the ABCA1 R219K variant and the percentage of change in HDL concentration after the dietary treatment with soy protein and soluble fiber (p=.544) (Fig. 3). Login to comment

[hide] The role of ATP-binding cassette transporter A1 in... Biochim Biophys Acta. 2010 Aug;1801(8):824-30. Epub 2010 Feb 24. Koldamova R, Fitz NF, Lefterov I
The role of ATP-binding cassette transporter A1 in Alzheimer's disease and neurodegeneration.
Biochim Biophys Acta. 2010 Aug;1801(8):824-30. Epub 2010 Feb 24., [PMID:20188211]

Abstract [show]
ATP-binding cassette transporter A1 - ABCA1, is the most extensively studied transporter in human pathology. ABCA1 became a primary subject of research in many academic and pharmaceutical laboratories immediately after the discovery that mutations at the gene locus cause severe familial High Density Lipoprotein (HDL) deficiency and, in the homozygous form - Tangier disease. The protein is the major regulator of intracellular cholesterol efflux which is the initial and essential step in the biogenesis and formation of nascent HDL particles. The transcriptional regulation of ABCA1 by nuclear Liver X Receptors (LXR) provided a starting point for drug discovery and development of synthetic LXR ligands/ABCA1 activators for treatment of arteriosclerosis. A series of reports that revealed the role of ABCA1 in Abeta deposition and clearance, as well as the possibility for association of some ABCA1 genetic variants with risk for Alzheimer's disease (AD) brought a new dimension to ABCA1 research. The LXR-ABCA1-APOE regulatory axis is now considered a promising therapeutic target in AD, which includes the only proven risk factor for AD - APOE, at two distinct levels - transcriptional regulation by LXR, and ABCA1 controlled lipidation which can influence Abeta aggregation and amyloid clearance. This review will summarize the results of research on ABCA1, particularly related to AD and neurodegeneration.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 In almost all of the reports R219K (rs2230806), I883M (rs4149313), and R1587K (rs2230808) variants are the most extensively investigated since they give rise to amino acid changes, are common in the European population and are closely associated with the risk for CAD. Login to comment
56 The association of R219K is the most controversial. Login to comment
65 Importantly, the additional analysis of AD patients included in the study for association of those two markers with AD-related quantitative traits showed a significant effect of the R219K variant on CSF Aβ42 levels, whereby RK heterozygotes had the highest trait levels. Login to comment

[hide] A functional ABCA1 gene variant is associated with... Hum Mol Genet. 2010 Jul 15;19(14):2877-85. Epub 2010 Apr 23. Acuna-Alonzo V, Flores-Dorantes T, Kruit JK, Villarreal-Molina T, Arellano-Campos O, Hunemeier T, Moreno-Estrada A, Ortiz-Lopez MG, Villamil-Ramirez H, Leon-Mimila P, Villalobos-Comparan M, Jacobo-Albavera L, Ramirez-Jimenez S, Sikora M, Zhang LH, Pape TD, Granados-Silvestre Mde A, Montufar-Robles I, Tito-Alvarez AM, Zurita-Salinas C, Bustos-Arriaga J, Cedillo-Barron L, Gomez-Trejo C, Barquera-Lozano R, Vieira-Filho JP, Granados J, Romero-Hidalgo S, Huertas-Vazquez A, Gonzalez-Martin A, Gorostiza A, Bonatto
A functional ABCA1 gene variant is associated with low HDL-cholesterol levels and shows evidence of positive selection in Native Americans.
Hum Mol Genet. 2010 Jul 15;19(14):2877-85. Epub 2010 Apr 23., [PMID:20418488]

Abstract [show]
It has been suggested that the higher susceptibility of Hispanics to metabolic disease is related to their Native American heritage. A frequent cholesterol transporter ABCA1 (ATP-binding cassette transporter A1) gene variant (R230C, rs9282541) apparently exclusive to Native American individuals was associated with low high-density lipoprotein cholesterol (HDL-C) levels, obesity and type 2 diabetes in Mexican Mestizos. We performed a more extensive analysis of this variant in 4405 Native Americans and 863 individuals from other ethnic groups to investigate genetic evidence of positive selection, to assess its functional effect in vitro and to explore associations with HDL-C levels and other metabolic traits. The C230 allele was found in 29 of 36 Native American groups, but not in European, Asian or African individuals. C230 was observed on a single haplotype, and C230-bearing chromosomes showed longer relative haplotype extension compared with other haplotypes in the Americas. Additionally, single-nucleotide polymorphism data from the Human Genome Diversity Panel Native American populations were enriched in significant integrated haplotype score values in the region upstream of the ABCA1 gene. Cells expressing the C230 allele showed a 27% cholesterol efflux reduction (P< 0.001), confirming this variant has a functional effect in vitro. Moreover, the C230 allele was associated with lower HDL-C levels (P = 1.77 x 10(-11)) and with higher body mass index (P = 0.0001) in the combined analysis of Native American populations. This is the first report of a common functional variant exclusive to Native American and descent populations, which is a major determinant of HDL-C levels and may have contributed to the adaptive evolution of Native American populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 The phylogenetic reconstruction uncovered two major lineages (haplogroups A and B) defined by the non-synonymous polymorphism R219K within the ABCA1 gene. Login to comment
49 The phylogenetic reconstruction uncovered two major lineages (haplogroups A and B) defined by the non-synonymous polymorphism R219K. Login to comment
31 The phylogenetic reconstruction uncovered two major lineages (haplogroups A and B) defined by the nonsynonymous polymorphism R219K within the ABCA1 gene. Login to comment
52 The phylogenetic reconstruction uncovered two major lineages (haplogroups A and B) defined by the non-synonymous polymorphism R219K. Login to comment

[hide] Association of selected ABC gene family single nuc... Atherosclerosis. 2010 Jul;211(1):203-9. Epub 2010 Jan 29. Abellan R, Mansego ML, Martinez-Hervas S, Martin-Escudero JC, Carmena R, Real JT, Redon J, Castrodeza-Sanz JJ, Chaves FJ
Association of selected ABC gene family single nucleotide polymorphisms with postprandial lipoproteins: results from the population-based Hortega study.
Atherosclerosis. 2010 Jul;211(1):203-9. Epub 2010 Jan 29., [PMID:20170916]

Abstract [show]
The aim of the study was to determine the influence of twenty single nucleotide polymorphisms (SNPs) of the ABCA1, ABCG1, ABCG5 and ABCG8 genes on the plasmatic concentrations of total cholesterol (TC), HDL and LDL cholesterol (HDLc, LDLc) in the postprandial state with a representative Spanish Caucasian population (1473 individuals, 50.0% women, ages ranging 21-85 years). In men, subjects with the AA genotype of the ABCA1 rs2230806 (R219K) polymorphism were associated with increased plasma LDLc levels, while the ABCA1 haplotype, which included the rs2230806 A allele, was associated with higher TC and LDLc plasma concentrations. In women, significant relationships were found between rs1893590 polymorphisms (ABCG1 gene) and HDLc plasma concentrations (subjects with the AA genotype had lower HDLc levels). For the ABCG8 gene, the rs4148211 polymorphism was associated with higher plasma TC and LDLc concentrations in the total population. Moreover, an ABCG5-G8 haplotype, which included the rs6544718 T allele, was associated with higher HDLc plasma concentrations in women. In conclusion, different SNPs of the ABCA1, ABCG1 and ABCG5-ABCG8 genes were associated, some under gender-specific analysis, with variations in the plasma lipid levels under postprandial conditions in a representative Spanish population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 In men, subjects with the AA genotype of the ABCA1 rs2230806 (R219K) polymorphism were associated with increased plasma LDLc levels, while the ABCA1 haplotype, which included the rs2230806 A allele, was associated with higher TC and LDLc plasma concentrations. Login to comment
81 ABCA1 gene polymorphisms In the total population, the rs2230806 (R219K) polymorphism in gene ABCA1 was associated with plasma LDLc levels (p = 0.046) (Table 2). Login to comment
123 The R219K variant (rs2230806 polymorphism) has been recognized as putative antiatherogenic polymorphisms, and the K219 form (A allele) has been associated with increased HDLc levels [10,11,24]. Login to comment

[hide] Update on genetics of postprandial lipemia. Atheroscler Suppl. 2010 Jun;11(1):39-43. Perez-Martinez P, Delgado-Lista J, Perez-Jimenez F, Lopez-Miranda J
Update on genetics of postprandial lipemia.
Atheroscler Suppl. 2010 Jun;11(1):39-43., [PMID:20434407]

Abstract [show]
The relationship between alimentary lipemia and coronary disease is of great interest in view of the epidemiological and experimental evidence that underlies it. The modulation of such phenomena is influenced by both genetic and environmental factors, thus explaining their extraordinary individual variance. Over the last two decades there has been an explosion of research in this area, with often conflicting findings reported in the literature. In this study we have presented the current evidence linking a number of candidate genes (APOA1/C3/A4/A5 cluster, ABCA1, CETP, GCKR, HL, IL-6, LPL, PLIN, and TCF7L2) to the modulation of the postprandial lipid metabolism. Increased knowledge of how these and other genes influence postprandial response should increase the understanding of personalised nutrition.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 In this context, we have studied the influence of 3 SNPs (i27943 [rs2575875]; i48168 [rs4149272]; R219K [rs2230806]) in the postprandial lipemia of 88 normolipidemic young men who were given a fatty meal [9]. Login to comment

[hide] Interaction of common sequence variants and select... Clin Biochem. 2010 Jun;43(9):754-8. Epub 2010 Apr 13. Katerina H, Michaela S, Michal V, Helena S, Jana Z, Jaroslav H, Richard C
Interaction of common sequence variants and selected risk factors in determination of HDL cholesterol levels.
Clin Biochem. 2010 Jun;43(9):754-8. Epub 2010 Apr 13., [PMID:20394740]

Abstract [show]
OBJECTIVES: The aim of our study was to assess the association of common sequence variants, and selected interactions, with HDL-c plasma levels. DESIGN AND METHODS: We analysed 743 individuals (340 men and 403 women) with high mean triglyceride and LDL-c levels. The association of five polymorphic sites (ABCA1 g.1051G>A, APOA1 g.-75G>A, CETP g.-629C>A, HNF1A g.102A>C, and LIPG g.584C>T), apoE isoforms and selected interactions with HDL-c levels were evaluated using linear regression models. RESULTS: After adjusting for triglycerides, sex, and BMI the only genotype with a statistically significant effect on HDL-c levels (p-value=0.004) was the CETP promoter variant. Further, linear regression model with interactions included indicated possible interplay between APOA1 genotype and menopause (p-value=0.002) and ABCA1 and APOE isoforms (p-value=0.017) on HDL-c plasma concentration. CONCLUSIONS: Our study indicated that not only the CETP variant but also apoE isoforms and menopause could operate as potent modulators of HDL-c concentrations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 The g.1051GNA (p.R219K; rs2230806) variant of the adenosine triphosphate binding cassette transporter A-1 (ABCA1; GeneID: 19) gene, the g.102ANC (p.I27L; rs1169288) variant of the hepatocyte nuclear factor-1α (HNF-1α) (HNF1A; GeneID: 6927) gene, and the g.584CNT (p.T111I; rs2000813) variant of the endothelial lipase (EL) (LIPG; GeneID: 9388) gene. Login to comment

[hide] Effect of fenofibrate therapy and ABCA1 polymorphi... Mol Genet Metab. 2010 Jun;100(2):118-22. Epub 2010 Mar 6. Tsai MY, Ordovas JM, Li N, Straka RJ, Hanson NQ, Arends VL, Arnett D
Effect of fenofibrate therapy and ABCA1 polymorphisms on high-density lipoprotein subclasses in the Genetics of Lipid Lowering Drugs and Diet Network.
Mol Genet Metab. 2010 Jun;100(2):118-22. Epub 2010 Mar 6., [PMID:20346718]

Abstract [show]
BACKGROUND: Previous studies have shown that ATP-binding cassette transporter 1 (ABCA1) polymorphisms associated with increased ABCA1 expression result in increased small HDL (high-density lipoprotein) subclass particle concentration. This study examines the effect of treatment with fenofibrate, a drug known to bind peroxisome proliferator-activated receptor alpha (PPARalpha) which increases the expression of ABCA1 gene, on lipoprotein subclass profiles of individuals stratified by ABCA1 genotypes. METHODS: Participants of Genetics of Lipid Lowering Drugs and Diet Network (GOLDN) were treated with fenofibrate over a three week period. We analyzed six ABCA1 polymorphisms in 287 GOLDN participants with triglyceride concentrations >or=150mg/dL and studied their associations with HDL subclass particle concentrations, as measured by nuclear magnetic resonance spectroscopy, before and after treatment. RESULTS: Fenofibrate treatment did not result in significant changes in small HDL subclass particle concentration. When changes in HDL subclasses were stratified by ABCA1 polymorphism genotypes, there were no statistically significant associations between ABCA1 genotypes and small HDL subclasses before fenofibrate treatment. However, after fenofibrate treatment the KK genotype of R1587K (mean 4.40micromol/L; p=0.004) and the RK genotype of R219K (mean 1.60micromol/L; p=0.02) polymorphisms were associated with significantly increased small HDL. The R1587KKK genotype (mean 4.80micromol/L; p=0.0002) and the R219K KK genotype (mean 2.50micromol/L; p=0.02) were also associated with increased HDL particle concentrations. CONCLUSION: There is a synergistic effect between ABCA1 polymorphisms and fenofibrate. Thus, our study indirectly confirms the role of fenofibrate and genotype in increasing cholesterol efflux, as evidenced by increased small HDL particles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 However, after fenofibrate treatment the KK genotype of R1587K (mean 4.40 lmol/L; p = 0.004) and the RK genotype of R219K (mean 1.60 lmol/L; p = 0.02) polymorphisms were associated with significantly increased small HDL. Login to comment
7 The R1587K KK genotype (mean 4.80 lmol/L; p = 0.0002) and the R219K KK genotype (mean 2.50 lmol/L; p = 0.02) were also associated with increased HDL particle concentrations. Login to comment
22 Molecular Genetics and Metabolism 100 (2010) 118-122 Contents lists available at ScienceDirect Molecular Genetics and Metabolism journal homepage: www.elsevier.com/locate/ymgme on HDL-C concentration; specifically, the K allele of the ABCA1 R219K polymorphism has been associated with increased HDL-C concentration [8-11] and a reduced incidence of coronary artery disease (CAD) events [8,9]. Login to comment
23 In a subcohort of the Multi-Ethnic Study of Atherosclerosis (MESA) we demonstrated that the K allele of the R219K polymorphism (designated as the 1051 A allele in MESA) is associated with both a lower prevalence of coronary artery calcium even when adjusted for HDL-C [12] and increased small HDL particle concentration [13]. Login to comment
47 The ABCA1 rs2297404, rs2578575, rs4149272, and rs2230806 (R219K) polymorphisms were genotyped by Applied Biosystems TaqMan SNP system. Login to comment
68 Table 3 shows that quantitative changes in HDL subclass particle concentrations from baseline to after fenofibrate treatment are significant for the ABCA1 R1587K and R219K polymorphisms. Login to comment
70 The R219K RK (p = 0.02) genotype was associated with 1.6-fold higher small HDL, compared to the RR genotype. Login to comment
71 In addition, HDL particle concentration was 2.5-fold higher in the KK genotype of the R219K polymorphism, compared to the RR genotype (p = 0.02). Login to comment
79 Table 2 Differences in HDL subclass particle concentrations between genotypes of ABCA1 polymorphisms, as compared to reference genotypes, at baseline (pre-fenofibrate treatment) in 287 GOLDN participants. Polymorphism (reference genotype) na Comparison genotype n Small HDL (lmol/L) Medium HDL (lmol/L)c Large HDL (lmol/L) HDL particles (lmol/L) HDL size (nm) Mean (lower 95% CI, upper 95% CI)b Mean (lower 95% CI, upper 95% CI) Mean (lower 95% CI, upper 95% CI) Mean (lower 95% CI, upper 95% CI) Mean (lower 95% CI, upper 95% CI) R1587K (RR) 152 RK 84 1.00 (À0.50, 2.60) À0.04 (À0.74, 0.67) À0.29 (À1.00, 0.46) 0.32 (À1.30, 2.00) 0.03 (À0.07, 0.12) KK 14 À0.53 (À3.70, 2.70) À0.72 (À2.20, 0.74 0-0.67 (À2.20, 0.89) À2.50 (À5.80, 0.89) À0.02 (À0.22, 0.18) R219K (RR) 155 RK 113 À0.10 (À1.70, 1.50) À0.04 (À0.77, 0.68) 0.00 (À0.77, 0.78) 0.50 (À1.10, 2.10) À0.01 (À0.11, 0.09) KK 19 À0.01 (À2.90, 2.80) À0.82 (À2.10, 0.48) 0.41 (À0.98, 1.80) 0.47 (À2.50, 3.40) À0.05 (À0.23, 0.13) M883I (II) 191 IM 57 À0.28 (À1.90, 1.40) À0.06 (À0.82, 0.70) À0.05 (À0.85, 0.75) À0.32 (À2.10, 1.4) À0.03 (À0.13, 0.08) MM 1 9.50 (À1.70, 21.00) À2.50 (À7.60, 2.60) À0.09 (À5.50, 5.30) 9.30 (À2.40, 21.00) 0.02 (À0.68, 0.720 rs4149272 (GG) 128 GA 128 0.15 (À7.70, 8.00) À2.10 (À5.70, 1.50) 1.60 (À2.20, 5.50) 0.58 (À7.60, 8.80) 0.01 (À0.48, 0.50) AA 31 À7.90 (À22.00, 5.90) 2.40 (À3.90, 8.70) 3.70 (À3.00, 10.00) À1.60 (À16.00, 13.00) 0.47 (À0.39, 1.30) rs2297404 (GG) 252 GC 34 1.80 (À0.49, 4.10) À0.36 (À1.40, 0.68) À0.31 (À1.40, 0.81) 1.60 (À0.70, 3.90) À0.16 (À0.31, À0.02)d CC 1 À1.50 (À12.00, 9.50) 2.10 (À2.90, 7.10) 1.40 (À4.00, 6.70) 0.77 (À11.00, 12.00) 0.06 (À0.63, 0.75) rs2575875 (GG) 126 GA 129 0.24 (À7.70, 8.20) 1.90 (À1.70, 5.60) À2.10 (À6.00, 1.80) À1.30 (À9.60, 7.00) À0.05 (À0.55, 0.44) AA 32 8.60 (À5.10, 22.00) À2.60 (À8.90, 3.60) À5.10 (À12.00, 1.60) 0.23 (À14.00, 15.00) À0.67 (À1.50, 0.19) a Total genotypes for R1587K and M883I do not add to 287 because genotypes of 37 participants could not be determined for R1587K and 38 for M883I. Login to comment
86 In accordance with this observation, our laboratory demonstrated that the KK genotype of the R219K polymorphism of ABCA1 was associated with an increase in small HDL particles [13]; the finding suggests that the KK genotype is associated with increased ABCA1 activity, resulting in increased cholesterol efflux. Login to comment
93 While we previously demonstrated that the ABCA1 1051 A allele (aka R219K K allele) was associated with increased small HDL in the MESA population [13], in the current study there was no increase in small HDL subclass when stratified by ABCA1 R219K genotype. Login to comment
94 Rather, we show that the K alleles of R219K and R1587K are associated 1.6- and 4.4-fold increases in small HDL after fenofibrate treatment. Login to comment
98 Finally, to expand on previous work that examined the ABCA1 polymorphism R219K, five additional SNPs were examined in the current study-of these, R1587K was found to have a significant effect on small HDL concentration (p = 0.004). Login to comment

[hide] ABCA1 gene variants regulate postprandial lipid me... Arterioscler Thromb Vasc Biol. 2010 May;30(5):1051-7. Epub 2010 Feb 25. Delgado-Lista J, Perez-Martinez P, Perez-Jimenez F, Garcia-Rios A, Fuentes F, Marin C, Gomez-Luna P, Camargo A, Parnell LD, Ordovas JM, Lopez-Miranda J
ABCA1 gene variants regulate postprandial lipid metabolism in healthy men.
Arterioscler Thromb Vasc Biol. 2010 May;30(5):1051-7. Epub 2010 Feb 25., [PMID:20185793]

Abstract [show]
OBJECTIVE: Genetic variants of ABCA1, an ATP-binding cassette (ABC) transporter, have been linked to altered atherosclerosis progression and fasting lipid concentration, mainly high-density lipoproteins and apolipoprotein A1; however, results from different studies have been inconsistent. METHODS AND RESULTS: To further characterize the effects of ABCA1 variants in human postprandial lipid metabolism, we studied the influence of 3 single nucleotide polymorphisms (i27943 [rs2575875]; i48168 [rs4149272]; R219K [rs2230806]) in the postprandial lipemia of 88 normolipidemic young men who were given a fatty meal. For i27943 and i48168 single nucleotide polymorphisms, fasting and postprandial values of apolipoprotein A1 were higher and postprandial lipemia was much lower in homozygotes for the major alleles, total triglycerides in plasma, and large triglyceride-rich lipoprotein triglycerides. These persons also showed a higher apolipoprotein A1/apolipoprotein B ratio. Major allele homozygotes for i48168 and i27943 showed additionally higher high-density lipoproteins and lower postprandial apolipoprotein B. CONCLUSION: Our work shows that major allele homozygotes for ABCA1 single nucleotide polymorphisms i27943 and i48168 have a lower postprandial response as compared to minor allele carriers. This finding may further characterize the role of ABCA1 in lipid metabolism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Methods and Results-To further characterize the effects of ABCA1 variants in human postprandial lipid metabolism, we studied the influence of 3 single nucleotide polymorphisms (i27943 [rs2575875]; i48168 [rs4149272]; R219K [rs2230806]) in the postprandial lipemia of 88 normolipidemic young men who were given a fatty meal. Login to comment
17 One of the most studied ABCA1 variants is R219K (rs2230806). Login to comment
22 E-mail jlopezmir@uco.es (c) 2010 American Heart Association, Inc. Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org DOI: 10.1161/ATVBAHA.109.202580 though a typically plausible underlying mechanism of this altered atherosclerosis was the change in HDL concentration, this has not been found in the majority of studies.14,15 Looking for additional physiological pathways underlying ABCA1 effects on lipid metabolism and atherosclerosis, we investigated and report here the effects of ABCA1 variants i27943, i48168, and R219K on postprandial lipid metabolism of healthy males. Login to comment
36 Biochemical Determinations Single Nucleotide Polymorphisms Selection, DNA Amplification, and Genotyping R219K GϾA is a well-characterized single nucleotide polymorphism (SNP) that has been extensively studied and is associated with cardiovascular disease; however, its influence on postprandial lipemia has not been tested.14 We have reported previously on other effects of SNP i27943GϾA and i48168GϾA.19 Computational analysis ascribed potential functional characteristics to each variant allele of these SNP.19 Additionally, for the i48168 GϾA polymorphism, analysis by MAPPER indicated a potential allele-specific binding site for the cartilage paired-class homeoprotein 1 (CART1 or ALX1) transcription factor, with a motif that appears enriched in certain genes involved in cholesterol metabolism (Parnell and Ordovas, unpublished data). Login to comment
41 Baseline Characteristics of the Study Participants CHOL, mg/dL TG, mg/dL HDL, mg/dL LDL, mg/dL apoA1, mg/dL apoB, mg/dL ABCA1 R219K (rs2230806) GG nϭ50 153.61Ϯ3.39 86.7Ϯ4.6 45.64Ϯ1.38 90.68Ϯ3.1 103.64Ϯ2.55 67.88Ϯ2.48 GA/AA nϭ34/4 150.48Ϯ3.61 72.90Ϯ5.5 47.01Ϯ1.83 88.84Ϯ3.46 109.36Ϯ3.58 67.72Ϯ2.53 P 0.537 0.056 0.545 0.695 0.184 0.965 ABCA1 i48168 (rs4149272) CC nϭ23 152.54Ϯ4.78 73.64Ϯ7.29 50.061Ϯ2.07* 88.05Ϯ4.07 116.43Ϯ4.04* 63.50Ϯ3.13 CT nϭ51 152.82Ϯ3.06 80.76Ϯ4.67 45.36Ϯ1.32 90.72Ϯ3.2 103.59Ϯ2.59 69.16Ϯ2.00 TT nϭ14 149.33Ϯ5.85 81.56Ϯ8.93 45.389Ϯ2.53 87.4Ϯ5.38 106.75Ϯ4.95 67.30Ϯ3.83 P 0.867 0.685 0.041 0.820 0.033 0.310 ABCA1 i27943 (rs2575875) GG nϭ21 152.12Ϯ5.00 75.63Ϯ7.67 49.36Ϯ2.21 85.36Ϯ5.74 115.78Ϯ4.28† 63.88Ϯ3.29 GA nϭ52 153.347Ϯ2.99 79.88Ϯ4.59 45.89Ϯ1.32 91.39Ϯ3.02 104.00Ϯ2.56 69.06Ϯ1.97 AA nϭ15 147.86Ϯ5.83 81.17Ϯ8.93 46.12Ϯ2.57 87.46Ϯ4.44 107.89Ϯ4.98 66.38Ϯ3.82 P 0.707 0.867 0.395 0.574 0.039 0.385 CHOL indicates cholesterol; LDL, low-density lipoprotein. Login to comment
70 R219K was not in linkage disequilibrium with either of the other 2 SNP (r2 Ͻ0.012; PϾ0.05). Login to comment
72 R219K A statistical study is presented for a genotype-dominant effect based on previously published data.14 In parallel, an additive model was also performed but we did not observe any differences compared with the dominant model. Login to comment
80 AUC of Lipid Fractions in the Postprandial Study ABCA1 R219K ABCA1 i48168 ABCA1 i27943 Total TG GG 79.5Ϯ5.0 CC 56.6Ϯ7.3* GG 56.8Ϯ7.8‡ GA/AA 70.9Ϯ5.9 CT 76.5Ϯ4.7 GA 76.4Ϯ4.7 TT 89.6Ϯ9.0 AA 87.1Ϯ9.1 CHOL GG 80.9Ϯ1.7 CC 79.9Ϯ2.7 GG 78.5Ϯ2.8 GA/AA 80.8Ϯ2.1 CT 81.1Ϯ1.7 GA 81.9Ϯ1.7 TT 79.9Ϯ2.7 AA 79.0Ϯ3.3 Large TRL TG GG 33.4Ϯ2.5 CC 20.9Ϯ3.5* GG 21.6Ϯ3.7‡ GA/AA 28.7Ϯ3.0 CT 31.8Ϯ2.3 GA 31.3Ϯ2.3 TT 38.2Ϯ4.4 AA 37.3Ϯ4.5 Small TRL TG GG 23.7Ϯ2.0 CC 20.3Ϯ3.1 GG 20.1Ϯ3.2 GA/AA 23.4Ϯ2.4 CT 23.9Ϯ2.0 GA 24.1Ϯ2.0 TT 24.9Ϯ3.9 AA 24.2Ϯ3.9 Large TRL CHOL GG 4.7Ϯ0.3 CC 4.7Ϯ0.4 GG 4.8Ϯ0.4 GA/AA 4.8Ϯ0.3 CT 4.7Ϯ0.2 GA 4.7Ϯ0.3 TT 4.6Ϯ0.5 AA 4.7Ϯ0.5 Small TRL CHOL GG 6.3Ϯ0.4 CC 5.5Ϯ0.7 GG 5.7Ϯ0.7 GA/AA 6.0Ϯ0.5 CT 6.1Ϯ0.5 GA 5.9Ϯ0.4 TT 6.5Ϯ0.9 AA 6.9Ϯ0.9 apoA1 GG 54.0Ϯ1.3 CC 60.1Ϯ1.9† GG 59.1Ϯ2.1§ GA/AA 56.6Ϯ1.5 CT 53.6Ϯ1.2 GA 54.2Ϯ1.2 TT 55.9Ϯ2.4 AA 55.9Ϯ2.4 apoB GG 35.1Ϯ1.1 CC 32.6Ϯ1.7 GG 31.8Ϯ1.7§ GA/AA 35.5Ϯ1.3 CT 36.2Ϯ1.1 GA 36.5Ϯ1.0 TT 34.8Ϯ2.1 AA 34.2Ϯ2.0 HDL GG 23.7Ϯ0.8 CC 26.0Ϯ1.2 GG 25.3Ϯ1.3 GA/AA 24.2Ϯ0.9 CT 23.5Ϯ0.7 GA 23.9Ϯ0.8 TT 23.8Ϯ1.4 AA 23.8Ϯ1.5 Univariate ANOVA using body mass index and age as covariates. Login to comment
109 Furthermore, in a recent report of type 2 diabetic patients, the ABCA1 SNP associated with coronary heart disease (including R219K) were not associ- Figure 1. Login to comment
121 ated with HDL, and those associated with HDL were not associated with coronary heart disease.35 The explanation for these contradictory findings has been set on the limited effects that gene variation can have on final HDL levels, gene-environment interactions, or the influence of ABCA1 gene variants on other lipid molecules and enzymes that secondarily can mildly influence HDL concentrations.17 The minor allele of R219K has been associated with limited atherosclerosis,15 reduced risk for myocardial infarction, or progression of coronary disease in various studies.16,36-42 Here, we noticed only a trend toward lower fasting TG (Pϭ0.059), according to previous studies.14 Currently, this variant is thought to affect lipids mildly, but gene-environment interactions are strong, with greater effects on lipid concentration when oxidative stress or inflammation is elevated in subjects.14,15,39,40 Such is not the case in our study. Login to comment
122 However, marginal effects not reaching significance were found in our study for practically all lipid parameters toward a protective effect for the minor allele of R219K, which could become significant when the subject is exposed to the aforementioned stressors or even simply with increasing age. Login to comment
1 Methods and Results-To further characterize the effects of ABCA1 variants in human postprandial lipid metabolism, we studied the influence of 3 single nucleotide polymorphisms (i27943 [rs2575875]; i48168 [rs4149272]; R219K [rs2230806]) in the postprandial lipemia of 88 normolipidemic young men who were given a fatty meal. Login to comment
11 One of the most studied ABCA1 variants is R219K (rs2230806). Login to comment
16 E-mail jlopezmir@uco.es (c) 2010 American Heart Association, Inc. Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org DOI: 10.1161/ATVBAHA.109.202580 though a typically plausible underlying mechanism of this altered atherosclerosis was the change in HDL concentration, this has not been found in the majority of studies.14,15 Looking for additional physiological pathways underlying ABCA1 effects on lipid metabolism and atherosclerosis, we investigated and report here the effects of ABCA1 variants i27943, i48168, and R219K on postprandial lipid metabolism of healthy males. Login to comment
30 Biochemical Determinations Single Nucleotide Polymorphisms Selection, DNA Amplification, and Genotyping R219K Gb0e;A is a well-characterized single nucleotide polymorphism (SNP) that has been extensively studied and is associated with cardiovascular disease; however, its influence on postprandial lipemia has not been tested.14 We have reported previously on other effects of SNP i27943Gb0e;A and i48168Gb0e;A.19 Computational analysis ascribed potential functional characteristics to each variant allele of these SNP.19 Additionally, for the i48168 Gb0e;A polymorphism, analysis by MAPPER indicated a potential allele-specific binding site for the cartilage paired-class homeoprotein 1 (CART1 or ALX1) transcription factor, with a motif that appears enriched in certain genes involved in cholesterol metabolism (Parnell and Ordovas, unpublished data). Login to comment
35 Baseline Characteristics of the Study Participants CHOL, mg/dL TG, mg/dL HDL, mg/dL LDL, mg/dL apoA1, mg/dL apoB, mg/dL ABCA1 R219K (rs2230806) GG nafd;50 153.61afe;3.39 86.7afe;4.6 45.64afe;1.38 90.68afe;3.1 103.64afe;2.55 67.88afe;2.48 GA/AA nafd;34/4 150.48afe;3.61 72.90afe;5.5 47.01afe;1.83 88.84afe;3.46 109.36afe;3.58 67.72afe;2.53 P 0.537 0.056 0.545 0.695 0.184 0.965 ABCA1 i48168 (rs4149272) CC nafd;23 152.54afe;4.78 73.64afe;7.29 50.061afe;2.07* 88.05afe;4.07 116.43afe;4.04* 63.50afe;3.13 CT nafd;51 152.82afe;3.06 80.76afe;4.67 45.36afe;1.32 90.72afe;3.2 103.59afe;2.59 69.16afe;2.00 TT nafd;14 149.33afe;5.85 81.56afe;8.93 45.389afe;2.53 87.4afe;5.38 106.75afe;4.95 67.30afe;3.83 P 0.867 0.685 0.041 0.820 0.033 0.310 ABCA1 i27943 (rs2575875) GG nafd;21 152.12afe;5.00 75.63afe;7.67 49.36afe;2.21 85.36afe;5.74 115.78afe;4.28ߤ 63.88afe;3.29 GA nafd;52 153.347afe;2.99 79.88afe;4.59 45.89afe;1.32 91.39afe;3.02 104.00afe;2.56 69.06afe;1.97 AA nafd;15 147.86afe;5.83 81.17afe;8.93 46.12afe;2.57 87.46afe;4.44 107.89afe;4.98 66.38afe;3.82 P 0.707 0.867 0.395 0.574 0.039 0.385 CHOL indicates cholesterol; LDL, low-density lipoprotein. Login to comment
63 R219K was not in linkage disequilibrium with either of the other 2 SNP (r2 b0d;0.012; Pb0e;0.05). Login to comment
65 R219K A statistical study is presented for a genotype-dominant effect based on previously published data.14 In parallel, an additive model was also performed but we did not observe any differences compared with the dominant model. Login to comment
73 AUC of Lipid Fractions in the Postprandial Study ABCA1 R219K ABCA1 i48168 ABCA1 i27943 Total TG GG 79.5afe;5.0 CC 56.6afe;7.3* GG 56.8afe;7.8ߥ GA/AA 70.9afe;5.9 CT 76.5afe;4.7 GA 76.4afe;4.7 TT 89.6afe;9.0 AA 87.1afe;9.1 CHOL GG 80.9afe;1.7 CC 79.9afe;2.7 GG 78.5afe;2.8 GA/AA 80.8afe;2.1 CT 81.1afe;1.7 GA 81.9afe;1.7 TT 79.9afe;2.7 AA 79.0afe;3.3 Large TRL TG GG 33.4afe;2.5 CC 20.9afe;3.5* GG 21.6afe;3.7ߥ GA/AA 28.7afe;3.0 CT 31.8afe;2.3 GA 31.3afe;2.3 TT 38.2afe;4.4 AA 37.3afe;4.5 Small TRL TG GG 23.7afe;2.0 CC 20.3afe;3.1 GG 20.1afe;3.2 GA/AA 23.4afe;2.4 CT 23.9afe;2.0 GA 24.1afe;2.0 TT 24.9afe;3.9 AA 24.2afe;3.9 Large TRL CHOL GG 4.7afe;0.3 CC 4.7afe;0.4 GG 4.8afe;0.4 GA/AA 4.8afe;0.3 CT 4.7afe;0.2 GA 4.7afe;0.3 TT 4.6afe;0.5 AA 4.7afe;0.5 Small TRL CHOL GG 6.3afe;0.4 CC 5.5afe;0.7 GG 5.7afe;0.7 GA/AA 6.0afe;0.5 CT 6.1afe;0.5 GA 5.9afe;0.4 TT 6.5afe;0.9 AA 6.9afe;0.9 apoA1 GG 54.0afe;1.3 CC 60.1afe;1.9ߤ GG 59.1afe;2.1&#a7; GA/AA 56.6afe;1.5 CT 53.6afe;1.2 GA 54.2afe;1.2 TT 55.9afe;2.4 AA 55.9afe;2.4 apoB GG 35.1afe;1.1 CC 32.6afe;1.7 GG 31.8afe;1.7&#a7; GA/AA 35.5afe;1.3 CT 36.2afe;1.1 GA 36.5afe;1.0 TT 34.8afe;2.1 AA 34.2afe;2.0 HDL GG 23.7afe;0.8 CC 26.0afe;1.2 GG 25.3afe;1.3 GA/AA 24.2afe;0.9 CT 23.5afe;0.7 GA 23.9afe;0.8 TT 23.8afe;1.4 AA 23.8afe;1.5 Univariate ANOVA using body mass index and age as covariates. Login to comment
102 Furthermore, in a recent report of type 2 diabetic patients, the ABCA1 SNP associated with coronary heart disease (including R219K) were not associ- Figure 1. Login to comment
113 ߥPb0d;0.05 i27943 GG vs GA. Arterioscler Thromb Vasc Biol May 2010 ated with HDL, and those associated with HDL were not associated with coronary heart disease.35 The explanation for these contradictory findings has been set on the limited effects that gene variation can have on final HDL levels, gene-environment interactions, or the influence of ABCA1 gene variants on other lipid molecules and enzymes that secondarily can mildly influence HDL concentrations.17 The minor allele of R219K has been associated with limited atherosclerosis,15 reduced risk for myocardial infarction, or progression of coronary disease in various studies.16,36-42 Here, we noticed only a trend toward lower fasting TG (Pafd;0.059), according to previous studies.14 Currently, this variant is thought to affect lipids mildly, but gene-environment interactions are strong, with greater effects on lipid concentration when oxidative stress or inflammation is elevated in subjects.14,15,39,40 Such is not the case in our study. Login to comment
114 However, marginal effects not reaching significance were found in our study for practically all lipid parameters toward a protective effect for the minor allele of R219K, which could become significant when the subject is exposed to the aforementioned stressors or even simply with increasing age. Login to comment

[hide] The R219K polymorphism in the ATP-binding cassette... Neurobiol Aging. 2010 Apr;31(4):647-53. Epub 2008 Jul 14. Wang N, Xue XH, Lin Y, Fang L, Murong S, Wu ZY
The R219K polymorphism in the ATP-binding cassette transporter 1 gene has a protective effect on atherothrombotic cerebral infarction in Chinese Han ethnic population.
Neurobiol Aging. 2010 Apr;31(4):647-53. Epub 2008 Jul 14., [PMID:18621447]

Abstract [show]
The association of R219K and V825I polymorphisms of ABCA1 gene with cerebral infarction has been rarely reported. Here we wish to address this issue. A total of 476 subjects from Chinese Han ethnic population were investigated, including 152 control individuals and 324 patients with cerebral infarction. Genotyping of R219K and V825I were performed by PCR-RFLP analysis. Data were analyzed using a statistical package. The R219K genotype frequency distributions were significantly different between patients with atherothrombotic cerebral infarction (ACI) and control individuals, with fewer KK genotypes and more RR genotypes in ACI patients (chi(2)=9.89, P<0.01). The K allele is less frequent among ACI patients than in controls (chi(2)=9.16, P<0.005). A significant association of KK with decreased ACI risk was exhibited, especially in male patients, aged patients and individuals with hypertension. These results indicate that the K allele of R219K polymorphism is an independent protective factor against ACI. In addition, though there is no association of V825I with ACI, this polymorphism may have certain synergistic effect with hypertension in susceptibility to ACI.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Neurobiology of Aging 31 (2010) 647-653 The R219K polymorphism in the ATP-binding cassette transporter 1 gene has a protective effect on atherothrombotic cerebral infarction in Chinese Han ethnic population Ning Wanga, Xie-Hua Xuea, Yi Lina, Ling Fanga, Shenxing Muronga, Zhi-Ying Wua,b,* a Department of Neurology and Institute of Neurology, First Affiliated Hospital, Center of Neuroscience, Fujian Medical University, 20 Chazhong Road, Fuzhou 350005, China b Department of Neurology and Institute of Neurology, Huashan Hospital, Institutes of Brain Science and State Key Laboratory of Medical Neurobiology, Shanghai Medical College, Fudan University, 12 Wulumuqi Middle Road, Shanghai 200040, China Received 30 November 2007; received in revised form 29 April 2008; accepted 28 May 2008 Available online 14 July 2008 Abstract The association of R219K and V825I polymorphisms of ABCA1 gene with cerebral infarction has been rarely reported. Login to comment
3 Genotyping of R219K and V825I were performed by PCR-RFLP analysis. Login to comment
5 The R219K genotype frequency distributions were significantly different between patients with atherothrombotic cerebral infarction (ACI) and control individuals, with fewer KK genotypes and more RR genotypes in ACI patients (χ2 = 9.89, P < 0.01). Login to comment
8 These results indicate that the K allele of R219K polymorphism is an independent protective factor against ACI. Login to comment
11 Keywords: Cerebral infarction; ATP-binding cassette transporter 1; R219K; V825I 1. Login to comment
19 The more common SNPs are R219K in exon 7 and V825I in exon 17. Login to comment
23 Besides, there was a report that KK individuals had a higher level of LDL-C and the K allele carriers had a lower TG (Pasdar et al., 2007) and another report that R219K did not influence the plasma lipids levels (Takagi et al., 2002). Login to comment
26 Taken together, these controversial findings indicate that the function of R219K and V825I may be significant in certain environmental factors and population backgrounds. Login to comment
27 Although the association of R219K and/or V825I with CAD has been widely reported in different ethnic populations, the association of them with cerebral infarction has been reported rarely (Andrikovics et al., 2006; Pasdar et al., 2007). Login to comment
30 The aim of this study is to investigate the association of R219K and V825I with cerebral infarction and levels of plasma lipids in the Han ethnic group in Chinese population. Login to comment
111 R219K is located in the extracellular loop of the ABCA1 protein, and plays an important role for the interaction of ApoA1 and cholesterol efflux. Login to comment
115 R219K is the most common polymorphism of ABCA1 and the allele frequency of the K allele is 26-46% in Caucasian population (Koren-Morag et al., 2002; Pasdar et al., 2007; Singaraja et al., 2003). Login to comment
116 To date, several studies have reported controversial results about the possible role of R219K in arteriosclerosis. Login to comment
119 They concluded that observed effects were independent of any other SNPs found in association with R219K (Clee et al., 2001). Login to comment
123 In our present study, R219K was 47.70% in control group, similar to that of Caucasian population (Singaraja et al., 2003). Login to comment
124 In addition, the K allele of R219K was associated with increased HDL-C and apoA1 levels in the female subgroup. Login to comment
127 Although the association of R219K with CAD has been widely studied in different ethnic populations, the association of R219K with cerebral infarction has been reported rarely. Login to comment
136 This may be due to the substitution of V825I is conservative and the polymorphism may only exert minimal influence on cholesterol efflux activity (Tan et al., 2003). Login to comment
137 There was few report associated with the synergistic effects among R219K, V825I and risk factors. Login to comment
126 Although the association of R219K with CAD has been widely studied in different ethnic populations, the association of R219K with cerebral infarction has been reported rarely. Login to comment

[hide] The role of ATP-binding-cassette-transporter-A1 (A... Transl Res. 2010 Apr;155(4):185-90. Epub 2009 Dec 24. Doosti M, Najafi M, Reza JZ, Nikzamir A
The role of ATP-binding-cassette-transporter-A1 (ABCA1) gene polymorphism on coronary artery disease risk.
Transl Res. 2010 Apr;155(4):185-90. Epub 2009 Dec 24., [PMID:20303467]

Abstract [show]
ATP-binding cassette transporter A1 (ABCA1) plays a pivotal role in intracellular cholesterol removal and exerts a protective effect against atherosclerosis. The role of genetic factors in susceptibility to coronary artery disease (CAD) is not clear. The aim of this study was to evaluate for the first time the possible association between R219K gene polymorphism and coronary artery disease in an Iranian adult population. A total of 207 consecutive patients with CAD (group A) and 94 patients without CAD (group B) were studied. We determined the presence of the R219K variant in the ABCA1 gene by polymerase chain reaction (PCR) and restriction analysis in 301 patients with and without CAD. The distribution of genotypes among the 2 groups was significantly different (P=0.009). In univariate analysis (with genotype AA as reference), the GG genotype was associated with a significantly increased risk of CAD (P=0.002; odds ratio [OR]=2.761; 95% confidence interval [CI]=1.418-5.374), but the GA genotype did not show a significant association (P=0.234) (data not shown). A multivariate logistic regression analysis (using sex as clinically significant variable, and using age, diabetes mellitus, low-density lipoprotein cholesterol [LDL-C], high-density lipoprotein [HDL], smoking, body mass index [BMI], and genotype as statistically significant variables) was used to determine independent associations and adjusted ORs. The GG genotype (compared with the AA genotype) was an independent predictor of CAD (OR=2.856, 95% CI=1.307-6.241; P=0.009), followed by BMI (P=0.034; OR=1.100; 95% CI=1.007-1.200). The GG genotype in the ABCA1 gene is independently associated with CAD in Iranian patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 We determined the presence of the R219K variant in the ABCA1 gene by polymerase chain reaction (PCR) and restriction analysis in 301 patients with and without CAD. Login to comment
29 R219K polymorphism analysis. Login to comment
40 The bands were visualized by staining with ethidium bromide.22 The R219 K polymorphism is the result of a nucleotide change G to A at position 1051 of the complementary DNA sequence, and it results in the substitution of lysine for arginine at amino acid 219 of the ABCA1 protein. Login to comment
28 R219K polymorphism analysis. Login to comment
39 The bands were visualized by staining with ethidium bromide.22 The R219 K polymorphism is the result of a nucleotide change G to A at position 1051 of the complementary DNA sequence, and it results in the substitution of lysine for arginine at amino acid 219 of the ABCA1 protein. Login to comment

[hide] Genetic aspects of ischemic stroke: coagulation, h... Crit Rev Clin Lab Sci. 2010 Mar-Apr;47(2):72-123. Stankovic S, Majkic-Singh N
Genetic aspects of ischemic stroke: coagulation, homocysteine, and lipoprotein metabolism as potential risk factors.
Crit Rev Clin Lab Sci. 2010 Mar-Apr;47(2):72-123., [PMID:20590502]

Abstract [show]
Stroke is one of the most common causes of death and long term disability throughout the world. It may be the outcome of a number of monogenic disorders or, more commonly, a polygenic multifactorial disease. Numerous studies have investigated the role of genetics in the pathogenesis of ischemic stroke, with varied and often contradictory results. The candidate 'stroke risk' genes affecting haemostasis (F5, F2, FGA/FGB, F7, F13A1, vWF, F12, SERPINE1, ITGB3/ITGA2B, ITGA2, GP1BA, TPA, TAFI, THBD, PZ, ANX5), homocysteine metabolism (MTHFR, CBS, MTR), and lipid metabolism (apo E, LPL, CETP, ABCA1, apo AI, apo CIII, apo AIV, apo AV, apo B, apo H, apo(a), PON1/2/3, LDLR/LOX-1) are evaluated in this review. By examining meta-analyses and case-control studies, we made a classification of gene/gene polymorphisms according to the degree of association with ischemic stroke risk. The data assembled could be very useful for further meta-analysis and for future clinical applications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
382 (135, 434-436) Two publications assessed the distribution of different polymorphisms (L158L, R219K, G316G, R1587K) and haplotype arrangements of the ABCA I gene in IS patients. Login to comment
383 A study of 244 Hungarian patients suggested a protective role for the ABCA I -R219K and V771M polymorphisms against IS. Login to comment

[hide] Genetic variation in the ABCA1 gene, HDL cholester... Atherosclerosis. 2010 Feb;208(2):305-16. Epub 2009 Jun 11. Frikke-Schmidt R
Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population.
Atherosclerosis. 2010 Feb;208(2):305-16. Epub 2009 Jun 11., [PMID:19596329]

Abstract [show]
Epidemiological studies consistently demonstrate a strong inverse association between low levels of high-density lipoprotein (HDL) cholesterol and increased risk of ischemic heart disease (IHD). This review focuses on whether both rare and common genetic variation in ABCA1 contributes to plasma levels of HDL cholesterol and to risk of IHD in the general population, and further seeks to understand whether low levels of HDL cholesterol per se are causally related to IHD. Studies of the ABCA1 gene demonstrate a general strategy for detecting functional genetic variants, and show that both common and rare ABCA1 variants contribute to levels of HDL cholesterol and risk of IHD in the general population. The association between ABCA1 variants and risk of IHD appears, however, to be independent of plasma levels of HDL cholesterol. With the recent identification of the largest number of individuals heterozygous for loss-of-function mutations in ABCA1 worldwide, population studies suggests that genetically low HDL cholesterol per se does not predict an increased risk of IHD, and thus questions the causality of isolated low levels of HDL cholesterol for the development of IHD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2387 Common ABCA1 variants in the general population 5.1. Frequency of common variants in the extreme tails of the HDL distribution Several resequencing studies have identified a number of common non-synonymous variations in ABCA1 [57,58,81-84]: R219K, V771M, V825I, I883M, E1172D and R1587K. Login to comment
2395 Frequencies of common variants and association with variation in lipid levels in the general population Frequencies for the most common non-synonymous ABCA1 SNPs (R219K, V825I, I883M, R1587K) are largely similar across studies that partly or as a whole represent general populations [57,58,81,82,86-88], whereas the less common SNPs (V771M, and E1172D) are reported in some [57,58,81,82,86,88], but not in all studies [58,87]. Login to comment
2386 Common ABCA1 variants in the general population 5.1. Frequency of common variants in the extreme tails of the HDL distribution Several resequencing studies have identified a number of common non-synonymous variations in ABCA1 [57,58,81-84]: R219K, V771M, V825I, I883M, E1172D and R1587K. Login to comment
2394 Frequencies of common variants and association with variation in lipid levels in the general population Frequencies for the most common non-synonymous ABCA1 SNPs (R219K, V825I, I883M, R1587K) are largely similar across studies that partly or as a whole represent general populations [57,58,81,82,86-88], whereas the less common SNPs (V771M, and E1172D) are reported in some [57,58,81,82,86,88], but not in all studies [58,87]. Login to comment

[hide] Association of polymorphisms in genes involved in ... Clin Endocrinol (Oxf). 2010 Feb;72(2):169-75. Epub 2009 May 29. Lamon-Fava S, Asztalos BF, Howard TD, Reboussin DM, Horvath KV, Schaefer EJ, Herrington DM
Association of polymorphisms in genes involved in lipoprotein metabolism with plasma concentrations of remnant lipoproteins and HDL subpopulations before and after hormone therapy in postmenopausal women.
Clin Endocrinol (Oxf). 2010 Feb;72(2):169-75. Epub 2009 May 29., [PMID:19489872]

Abstract [show]
OBJECTIVE: A high degree of inter-individual variability in plasma lipid level response to hormone therapy (HT) has been reported. Variations in the oestrogen receptor alpha gene (ESR1) and in genes involved in lipid metabolism may explain some of the variability in response to HT. Subjects Postmenopausal Caucasian women (n = 208) participating in a placebo-controlled randomized trial of 3.2 years of hormone therapy (HT). METHODS: Plasma triglyceride (TG), remnant lipoprotein cholesterol (RLP-C), and high-density lipoprotein cholesterol (HDL-C) levels and HDL subpopulations were assessed at baseline and at follow up. Single nucleotide polymorphisms (SNPs) in ESR1 and in the ATP binding cassette A1 (ABCA1), cholesteryl ester transfer protein (CETP), hepatic lipase (LIPC), lipoprotein lipase (LPL), and scavenger receptor class B type I (SRB1) genes were assessed for their association with baseline plasma levels and HT-related changes in levels of RLP-C and HDL subpopulations. RESULTS: Carriers of the ESR1 PvuII or IVS1-1505 variants had lower plasma TG concentrations and higher plasma HDL-C and alpha-1 and prealpha-1 HDL particle levels at baseline and showed greater increases in HDL-C, apo A-I and alpha-1 particle levels after HT than wild-type carriers. Carriers of the N291S and D9N variants in the LPL gene had significantly higher remnant lipoproteins and lower alpha-2 HDL particle levels at baseline. The CETP TaqIB SNP was a significant determinant of baseline plasma HDL-C and HDL subpopulation profile. CONCLUSIONS: Single nucleotide polymorphisms in ESR1, CETP and LPL had significant effects on baseline plasma levels of TG-rich and HDL subpopulations. With the exception of ESR1 SNPs, variation in genes involved in lipid metabolism has a very modest effect on lipoprotein response to HT.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 The genes and SNPs of interest were: oestrogen receptor a [ESR1; rs2234693 (PvuII, intron 1), rs9340799 (XbaI, intron 1), rs4870056 (IVS1-1505, intron 1), rs9340894 (intron 3), rs985192 (intron 4), rs926777 (intron 4), rs3020325 (intron 4), and rs3020368 (intron 5)], ABCA1 [(G3456C (E1112D) and rs2230806 (R219K)], CETP [rs708272 (TaqIB)], HL [LIPC; rs1800588 (C-514T)], LPL [rs1800590 (T-93G), rs1801177 (D9N), rs268 (9N291S), and rs328 (S447X)], and SR-BI [SCARB1; rs4238001 (G2S)]. Login to comment

[hide] A novel missense mutation of ABCA1 in transmembran... Atherosclerosis. 2009 Sep;206(1):216-22. Epub 2009 Feb 25. Maekawa M, Kikuchi J, Kotani K, Nagao K, Odgerel T, Ueda K, Kawano M, Furukawa Y, Sakurabayashi I
A novel missense mutation of ABCA1 in transmembrane alpha-helix in a Japanese patient with Tangier disease.
Atherosclerosis. 2009 Sep;206(1):216-22. Epub 2009 Feb 25., [PMID:19344898]

Abstract [show]
Tangier disease (TD) is a hereditary disorder characterized by the severe deficiency or absence of high-density lipoprotein cholesterol (HDL-C). TD is caused by mutations in the ATP-binding cassette transporter A1 (ABCA1) gene, most of which are located in the extracellular loops and nucleotide-binding domains. Here we describe the first case of TD carrying a missense mutation in a transmembrane alpha-helix of ABCA1. A 31-year-old Japanese woman had an extremely low level of HDL-C (1mg/dl) and yellowish tonsillar swelling, leading to the diagnosis of TD. The proband was homozygous for a point mutation of T4978C in exon 37, which results in the substitution of cysteine-1660 to arginine (C1660R) in the 8th transmembrane segment of ABCA1. Her parents, grandmother, and brother were found to be heterozygous for the same mutation. Both peripheral blood leukocytes from the patient and HEK293 cells transfected with T4978C-mutated ABCA1 normally expressed ABCA1 on the plasma membrane and had normal apolipoprotein A-I-binding ability. However, apolipoprotein A-I-mediated efflux of cholesterol and phospholipids was markedly diminished in HEK293 cells transfected with T4978C-mutated ABCA1. These results suggest that this mutant is normally translated and exists as a stable product with normal localization, yet is functionally defective. Cysteine-1660 appears to be a critical residue for cholesterol transport of ABCA1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 5 SNPs, InsG319, R219K, I680I, I883 M and T1472T, in this family (Supplementary Table 1). Login to comment
161 Among five SNPs identified in this family, previous epidemiological studies demonstrated that R219K and I883 M variants are associated with higher HDL-C levels [30,31], whereas InsG319 is negatively correlated with atherosclerosis independently of plasma HDL-C concentrations [32]. Login to comment
164 For instance, the R219K variant is significantly associated with higher HDL-C levels in normal body weight individuals, but with lower HDL-C levels in overweight people [30]. Login to comment
165 This may explain why HDL-C is low in the proband`s father despite the presence of homozygous R219K. Login to comment

[hide] A survey of ABCA1 sequence variation confirms asso... Hum Mutat. 2009 Sep;30(9):1348-54. Reynolds CA, Hong MG, Eriksson UK, Blennow K, Bennet AM, Johansson B, Malmberg B, Berg S, Wiklund F, Gatz M, Pedersen NL, Prince JA
A survey of ABCA1 sequence variation confirms association with dementia.
Hum Mutat. 2009 Sep;30(9):1348-54., [PMID:19606474]

Abstract [show]
We and others have conducted targeted genetic association analyses of ABCA1 in relation to Alzheimer disease risk with a resultant mixture of both support and refutation, but all previous studies have been based upon only a few markers. Here, a detailed survey of genetic variation in the ABCA1 region has been performed in a total of 1,567 Swedish dementia cases (including 1,275 with Alzheimer disease) and 2,203 controls, providing evidence of association with maximum significance at marker rs2230805 (odds ratio [OR]=1.39; 95% confidence interval [CI] 1.23-1.57, p=7.7x10(-8)). Haplotype-based tests confirmed association of this genomic region after excluding rs2230805, and imputation did not reveal additional markers with greater support. Significantly associating markers reside in two distinct linkage disequilibrium blocks with maxima near the promoter and in the terminal exon of a truncated ABCA1 splice form. The putative risk allele of rs2230805 was also found to be associated with reduced cerebrospinal fluid levels of beta-amyloid. The strongest evidence of association was obtained when all forms of dementia were considered together, but effect sizes were similar when only confirmed Alzheimer disease cases were assessed. Results further implicate ABCA1 in dementia, reinforcing the putative involvement of lipid transport in neurodegenerative disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 From the outset, we were particularly interested in rs2230806 (R219K), rs2230808 (R1587K), and rs4149313 (I883M), becuase these are the only known common nonsynonymous variants (nsSNPs) in the region. Login to comment

[hide] Relationships between common polymorphisms of aden... Metabolism. 2009 Jan;58(1):74-9. Porchay-Balderelli I, Pean F, Emery N, Maimaitiming S, Bellili N, Travert F, Mohammedi K, Roussel R, Marre M, Fumeron F
Relationships between common polymorphisms of adenosine triphosphate-binding cassette transporter A1 and high-density lipoprotein cholesterol and coronary heart disease in a population with type 2 diabetes mellitus.
Metabolism. 2009 Jan;58(1):74-9., [PMID:19059534]

Abstract [show]
Patients with type 2 diabetes mellitus (T2D) have a high coronary risk partly because of low levels of high-density lipoprotein-cholesterol (HDL-C). The adenosine triphosphate-binding cassette transporter A1 (ABCA1) plays a key role in HDL metabolism. We studied the association of common single nucleotide polymorphisms (SNPs) in the ABCA1 gene with HDL-C levels and coronary risk in a cohort of subjects with T2D. We studied 5 SNPs: +69C>T, +378G>C, R219K, I883M, and R1587K. The C allele of +378G>C was significantly associated with lower HDL-C concentrations (P = .04); and the M allele of I883M, with higher HDL-C concentrations (P = .03). No significant association was found between these SNPs and the incidence of new coronary events. Nevertheless, cross-sectional data on entry showed that the frequency of K219 was lower in patients with previous coronary heart disease (angina pectoris and/or myocardial infarction) (odds ratio, OR [95% confidence interval, CI] = 0.80 [0.65-0.98], P = .03, after adjustment for multiple risk factors other than HDL-C). The frequency of K1587 was higher in patients with angina pectoris (OR [95% CI] = 1.27 [1.01-1.58], P = .04, after multiple adjustment). The TT genotype of the C69T SNP was less frequent in subjects with prior myocardial infarction (OR [95% CI] = 0.28 [0.13-0.61], P = .001, after multiple adjustment). These associations persisted after further adjustment for HDL-C levels. In conclusion, common genetic variations of ABCA1 had a moderate influence on HDL-C levels and/or coronary heart disease in patients with T2D. These 2 effects were independent.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 We studied 5 SNPs: +69CNT, +378GNC, R219K, I883M, and R1587K. Login to comment
27 We chose to study 2 noncoding SNPs located in 5' untranslated regions- +69CNT and +378GNC-and 3 nonsynonymous SNPs- R219K, I883M, and R1587K-based on their potential regulatory role or their influence on lipid levels or CHD, as described in other population studies [5]. Login to comment
45 Genotyping The +69CNT (rs1800977), +378GNC (rs1800978), and R219K (+1051GNA, rs2230806) SNPs were genotyped using a polymerase chain reaction-molecular beacon technique [10]. Login to comment
65 A cross-sectional analysis of data for the patients on entry into the DIABHYCAR study showed that the prevalence of previous CHD depended on R219K genotype (Tables 4 and 5). Login to comment
77 The influence of +378GNC on HDL-C is consistent with the results we previously obtained for a sample from the French general population in the Data From an Epidemio- Table 2 Sequences of primers and probes used for genotyping ABCA1 SNPs SNP Primers (5'-3') Allele-specific probes (5'-3') +69CNT (rs1800977) a U: GAGGAGGGAGAGCACAGG Fam-GCGACAACTAGTCCCGGCAAAAGTCGC-dabcyl L: CTCACTCTCGCTCGCAATTA Tamra-GCGACAACTAGTCTCGGCAAAAGTCGC-dabcyl +378GNC (rs1800978) a U: CCTGCTGTGAGCTCTGG Fam-GCGACACGCTGGGGGTGCTGGCGTCGC-dabcyl L: AGGTTCTTCCACAGCAGCA Tamra-GCGACACGCTGGGCGTGCTGGCGTCGC-dabcyl R219K (rs2230806)a U: GATTCAACTTGGTGACCAAG Fam-GCGACCCTACCAAAGGAGAAACGTCGC-dabcyl L: GAACGAAGTACTCGCTCTGC Tamra-GCGACCCTACCAAGGGAGAAACGTCGC-dabcyl I883M (rs4149313)b U: CTACTGGTTTGGCGAGGAAA Fam-CTTTCTGATATTCTCTTC-Bhq L: AGCAGGAGGTCAACAGCACT Hex-CTTTCTGACATTCTCTTC-Bhq R1587K (rs2230808)b U: CCCTGCCAACTTTACCATGA Fam-CATTATTTTTGGTGTCC-Bhq L: CGATTTCTCAACAGCTTGGG Hex-CATTATTTCTGGTGTCC-Bhq a Molecular beacon. Login to comment
79 Table 3 High-density lipoprotein cholesterol levels (mean ± SD; in millimoles per liter) as a function of ABCA1 SNPs +69CNT +378GNC R219K I883M R1587K 0 1.30 ± 0.35 1.32 ± 0.36 1.31 ± 0.36 1.31 ± 0.35 1.33 ± 0.35 1 1.33 ± 0.37 1.30 ± 0.35 1.32 ± 0.35 1.34 ± 0.36 1.31 ± 0.36 2 1.31 ± 0.33 1.26 ± 0.24 1.33 ± 0.36 1.35 ± 0.33 1.29 ± 034 P .18 .04 .69 .03 .06 Trend test (multiple linear regression) with genotypes coded 0, 1, or 2 according to the number of minor alleles, adjusted for sex, age, BMI, smoking, HbA1c, and lipid-lowering treatment. Login to comment
81 The lack of association between +69CNT and R219K and HDL ( Systat Software Inc, San Jose, CA, USA). Login to comment
91 Associations between R219K and lipid levels or atherosclerosis progression and atherosclerosis have been widely reported [16,21-25]. Login to comment
96 The cholesterol efflux from cells in the arterial wall that have the potential to transform into foam cells, primarily macrophages, Table 4 Genotype distribution (percentage) of ABCA1 SNPs as a function of CHD, with P values for χ2 tests CHD history MI history Angina history Incident CHD Without With Without With Without With Without With n = 2647 n = 482 n = 2957 n = 172 n = 2750 n = 379 n = 2906 n = 223 CC 41.7 40.5 41.2 47.1 41.9 38.3 41.5 40.8 +69CNT CT 45.4 48.9 45.7 48.8 45.5 48.7 45.8 47.5 TT 13.0 10.6 13.1 4.1 12.5 13.0 12.7 11.7 P .23 .002 .40 .85 GG 75.3 74.6 75.3 73.5 75.2 74.8 75.2 74.9 +378GNC GC 22.9 23.5 22.8 25.3 23.0 22.8 22.9 23.3 CC 1.9 1.9 1.9 1.2 1.8 2.4 1.9 1.8 P .95 .63 .72 .99 RR 50.1 56.1 50.6 56.6 50.4 55.9 51.3 47.3 R219K RK 41.9 36.3 41.6 33.9 41.6 37.2 40.7 45.9 KK 8.0 7.6 7.8 9.5 8.1 7.0 8.0 6.8 P .05 .15 .13 .29 II 70.7 73.0 70.9 72.8 70.8 73.1 70.8 74.2 I883M IM 26.9 25.2 26.7 25.4 27.0 24.5 26.9 23.1 MM 2.4 1.9 2.3 1.8 2.3 2.4 2.3 2.7 P .56 .82 .61 .44 RR 54.8 51.2 54.3 53.5 54.8 50.4 54.0 57.5 R1587K RK 37.8 42.9 38.4 41.9 38.0 43.2 38.9 34.8 KK 7.3 5.9 7.3 4.7 7.2 6.4 7.1 7.7 P .09 .36 .16 .49 Table 5 Logistic regression analysis for CHD history (odds ratio with 95% CI) CHD MI Angina +69CNT Codominant 0.98 (0.84-1.14) P = .79 0.71 (0.56-0.91) P = .006 1.11 (0.94-1.30) P = .21 Recessive (TT vs C+) 0.83 (0.60-1.14) P = .26 0.28 (0.13-0.61) P = .001 1.10 (0.79-1.53) P = .57 R219K Codominant 0.86 (0.74-1.02) P = .08 0.92 (0.71-1.18) P = .50 0.86 (0.72-1.03) P = .10 Dominant (K+ vs RR) 0.80 (0.65-0.98) P = .03 0.81 (0.59-1.11) P = .19 0.82 (0.65-1.02) P = .08 R1587K Dominant (K+ vs RR) 1.22 (1.00-1.49) P = .06 1.04 (0.76-1.43) P = .79 1.27 (1.01-1.58) P = .04 Odds ratios (95% CI) for minor alleles of ABCA1 SNPs adjusted for age, sex, smoking, BMI, diabetes duration, hypertension, lipid-lowering treatment, serum creatinine, plasma triglyceride, and urinary albumin concentrations. Login to comment

[hide] IL12RB2 and ABCA1 genes are associated with suscep... Clin Cancer Res. 2008 Oct 15;14(20):6683-9. Isomura M, Oya N, Tachiiri S, Kaneyasu Y, Nishimura Y, Akimoto T, Hareyama M, Sugita T, Mitsuhashi N, Yamashita T, Aoki M, Sai H, Hirokawa Y, Sakata K, Karasawa K, Tomida A, Tsuruo T, Miki Y, Noda T, Hiraoka M
IL12RB2 and ABCA1 genes are associated with susceptibility to radiation dermatitis.
Clin Cancer Res. 2008 Oct 15;14(20):6683-9., [PMID:18927311]

Abstract [show]
PURPOSE: Severe acute radiation dermatitis is observed in approximately 5% to 10% of patients who receive whole-breast radiotherapy. Several factors, including treatment-related and patient-oriented factors, are involved in susceptibility to severe dermatitis. Genetic factors are also thought to be related to a patient's susceptibility to severe dermatitis. To elucidate genetic polymorphisms associated with a susceptibility to radiation-induced dermatitis, a large-scale single-nucleotide polymorphism (SNP) analysis using DNA samples from 156 patients with breast cancer was conducted. EXPERIMENTAL DESIGN: Patients were selected from more than 3,000 female patients with early breast cancer who received radiotherapy after undergoing breast-conserving surgery. The dermatitis group was defined as patients who developed dermatitis at a National Cancer Institute Common Toxicity Criteria grade of > or =2. For the SNP analysis, DNA samples from each patient were subjected to the genotyping of 3,144 SNPs covering 494 genes. RESULTS: SNPs that mapped to two genes, ABCA1 and IL12RB2, were associated with radiation-induced dermatitis. In the ABCA1 gene, one of these SNPs was a nonsynonymous coding SNP causing R219K (P = 0.0065). As for the IL12RB2 gene, the strongest association was observed at SNP-K (rs3790568; P = 0.0013). Using polymorphisms of both genes, the probability of severe dermatitis was estimated for each combination of genotypes. These analyses showed that individuals carrying a combination of genotypes accounting for 14.7% of the Japanese population have the highest probability of developing radiation-induced dermatitis. CONCLUSION: Our results shed light on the mechanisms responsible for radiation-induced dermatitis. These results may also contribute to the individualization of radiotherapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 In the ABCA1 gene, one of these SNPs was a nonsynonymous coding SNP causing R219K (P = 0.0065). Login to comment

[hide] Effect of ABCA1 mutations on risk for myocardial i... Curr Atheroscler Rep. 2008 Oct;10(5):413-26. Iatan I, Alrasadi K, Ruel I, Alwaili K, Genest J
Effect of ABCA1 mutations on risk for myocardial infarction.
Curr Atheroscler Rep. 2008 Oct;10(5):413-26., [PMID:18706283]

Abstract [show]
The adenosine triphosphate-binding cassette A1 (ABCA1) gene codes for a cellular phospholipid and cholesterol transporter that mediates the initial and essential step in high-density lipoprotein (HDL) biogenesis: the formation of nascent HDL particles. Mutations at the ABCA1 gene locus cause severe familial HDL deficiency and, in the homozygous form, cause Tangier disease. Several studies have investigated the influence of ABCA1 variation on lipid metabolism and coronary heart disease, but they have resulted in controversial and inconsistent results. Genetic variability at the ABCA1 gene has also been associated with increased risk of myocardial infarction. In one study, this association was independent of HDL cholesterol levels, raising the possibility that the measurement of HDL cholesterol levels may not provide adequate information on the functional roles of HDL particles. Nevertheless, genomic screening for complex diseases, such as coronary heart disease, and HDL deficiency in particular, may not add additional information to that gained from conventional global cardiovascular risk stratification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 To date, the largest study examining ABCA1 single nucleotide polymorphisms (SNPs) and HDL-C is the Copenhagen City Heart Study [24], in which the relationship between six ABCA1 nonsynonymous common SNPs (R219K, V771M, M825I, I883M, E1172D, and R1587K) and HDL-C was analyzed. Login to comment
109 As previously described [30,33,34], of the 16 polymorphisms located in the promoter and the 10 found in the coding region, it was concluded that only the R219K polymorphism was associated with MI, decreasing its risk (odds ratio of 0.80; 95% CI, 0.68-0.94; P = 0.007), whereas no haplotypes were involved in the susceptibility to CHD. Login to comment
112 Additional insights into the effects of ABCA1 on MI have recently been described by Frikke-Schmidt et al. [35•] in a study where six nonsynonymous ABCA1 SNPs, R219K, V771M, V825I, I883M, E1172D, and R1587K (identified by resequencing ABCA1 in 190 individuals of Danish ancestry [24]), were genotyped in 9259 individuals from the Copenhagen City Heart Study to assess their risk of CHD (Table 2). Login to comment
113 The principal finding of the study indicated that common genetic variation in ABCA1 predicts risk of CHD in the general population, but that their association was independent of plasma HDL-C levels: SNPs predicting increased MI risk were associated with either increases (V771 and V825I) or decreases (R1587K) in HDL-C, or no effect on HDL-C (R219K, I883M, E1172D). Login to comment
121 TD patients ( n = 5) 0.08 ± 0.05 ABCA1 heterozygous patients ( n = 77) 0.74 ± 0.24 Unaffected individuals ( n = 156) 1.31 ± 0.35 Brousseau et al. [30] / 2001 VA-HIT study, men with established CHD ( n = 1014) 0.83 ± 0.13 R219K, I883M, E1172D † Frequencies of the 3 ABCA1 variants were signifi cantly increased in VA-HIT. Login to comment
124 Framingham Offspring Study, CHD-free control men ( n = 1014) 1.14 ± 0.31 Clee et al. [33] / 2001 REGRESS cohort, with established CHD ( n = 804) R219K genotype: R219K † The R219K SNP is associated with a decreased progression of CHD, decreased TG, and increased HDL-C RR: 0.92 ± 0.22 RK: 0.93 ± 0.23 KK: 0.92 ± 0.20 Lutucuta et al. [38] / 2001 Lipoprotein Coronary Atherosclerosis Study patients ( n = 372) C-477T genotype: C-477T † , A-419C, G-320C The C-477T variant was strongly associated with the severity of coronary atherosclerosis, with modest effect on HDL-C CC: 1.14 ± 0.29 CT: 1.10 ± 0.28 TT: 1.19 ± 0.32 *Studies reporting the initial molecular and biochemical characterization of fewer than 5 probands with an ABCA1 gene defect and their families were not included in Table 2. Login to comment
132 GG: 0.93 ± 0.23 GC: 0.92 ± 0.22 CC: 0.94 ± 0.29 C-17G genotype: CC: 0.92 ± 0.22 CG: 0.93 ± 0.23 GG: 0.88 ± 0.21 C69T genotype: CC: 0.91 ± 0.22 CT: 0.91 ± 0.19 TT: 0.95 ± 0.30 A-1095G genotype: AA: 0.93 ± 0.24 AG: 0.93 ± 0.22 GG: 0.83 ± 0.20 InsG319 genotype: No ins: 0.92 ± 0.23 G: 0.93 ± 0.23 GG: 0.89 ± 0.30 Cenarro et al. [34] / 2003 Spanish heterozygous FH patients with premature CHD ( n = 216) or without ( n = 158) R219K genotype: R219K † The frequency of the K219 allele was signifi cantly higher in the FH group without premature CHD than in FH patients with premature CHD RR: 1.27 ± 0.36 RK + KK: 1.32 ± 0.40 *Studies reporting the initial molecular and biochemical characterization of fewer than 5 probands with an ABCA1 gene defect and their families were not included in Table 2. Login to comment
135 Genetic variation in ABCA1 and risk of myocardial infarction Study* / year Population screened HDL-C, mmol/L ABCA1 variants Conclusions Evans and Beil [41] / 2003 Patients attending a lipid outpatient clinic ( n = 813) R219K genotype: R219K † The K219 allele was signifi cantly protective against CHD in patients with hyperlipidemia and elevated Lp(a), as well as decreasing TG levels RR: 1.32 ± 0.03 RK: 1.34 ± 0.03 KK: 1.27 ± 0.31 Harada et al. [29] / 2003 Japanese patients ( n = 410) I883M genotype: I883M, R219K The I883M polymorphism was signifi cantly associated with higher HDL-C in Japanese patients, but not with CHD II: 1.16 ± 0.30 IM: 1.26 ± 0.42 MM: 1.27 ± 0.37; P = 0.05 R219K genotype: RR: 1.26 ± 0.41 RK: 1.25 ± 0.40 KK: 1.24 ± 0.35 Tan et al. [42] / 2003 Cases: Chinese ( n = 512), Malay ( n = 110), and Indian ( n = 164) men with established CHD Chinese: CAD: 0.89 ± 0.28, Ctl: 1.19 ± 0.32; P < 0.0005 C-14T, 237indelG, V825I † , M883I † , A8994G The V825I and M883I polymorphisms are positive markers for the CHD phenotype in Malays, but with no effect on HDL-C Malays: CAD: 0.83 ± 0.27, Ctl: 1.15 ± 0.27; P < 0.0005 Controls: Chinese ( n = 271), Malay ( n = 179), and Indian ( n = 231) men Indians: CAD: 0.79 ± 0.24, Ctl: 1.00 ± 0.26; P < 0.0005 Tregouet et al. [31] / 2004 Subgroup of ECTIM cohort ( n = 452 cases and n = 465 controls) NA C-564T, R219K † , R1587K ABCA1 polymorphisms, but not haplotypes, are involved in variability of apoA-I and the susceptibility to CHD. Login to comment
137 R219K was associated with MI (K219 allele associated with a decreased risk), but not with apoA-I. Login to comment
141 Genetic variation in ABCA1 and risk of myocardial infarction Study* / year Population screened HDL-C, mmol/L ABCA1 variants Conclusions Shioji et al. [43] / 2004 Japanese Suita Study ( n = 1880) Suita group: 1.44 ± 0.02 G-273C The G-273C polymorphism was signifi cantly associated with HDL-C in the general Japanese population but not on the incidence of MI MI group ( n = 598 men) MI group: 1.09 ± 0.01; P < 0.0001 Bertolini et al. [39] / 2004 FH patients: All FH patients: males: 1.18 ± 0.02, females: 1.39 ± 0.02; P < 0.0001 R219K † The K219 allele was signifi cantly protective against CHD, and this effect was more pronounced in males than in females and in smokers versus nonsmokers (but there was no signifi cant effect on lipid concentrations). Login to comment
146 Noncarriers ( n = 9039) Women: 1.72 ± 0.01 Men: 1.38 ± 0.01 K776N carriers ( n = 37) Women: 1.82 ± 0.11 Men: 1.18 ± 0.09 P = 0.05 Martin et al. [37] / 2006 Cohort of males diagnosed with MI ( n = 170) NA C-477T † , R219K, I883M In long-term MI prognosis, the C-477T ABCA1 variant was associated with an unfavorable clinical evolution Controls: valvular patients with normal coronariography controls ( n = 100) *Studies reporting the initial molecular and biochemical characterization of fewer than 5 probands with an ABCA1 gene defect and their families were not included in Table 2. Login to comment
149 Genetic variation in ABCA1 and risk of myocardial infarction Study* / year Population screened HDL-C, mmol/L ABCA1 variants Conclusions Andrikovics et al. [45] / 2006 Hungarian patients with ischemic stroke ( n = 244) NA R219K † , V771M † , I883M A higher frequency of R219K and V771M was observed in controls than in Hungarian stroke patients, suggesting a protective role against CHD Hungarian patients with CHD ( n = 150) Controls (n = 193) Benton et al. [46] / 2007 Subgroup of Multi-Ethnic Study of Atherosclerosis study group ( n = 969) R219K genotype: C-565T, R219K † The R219K polymorphism was associated with a 28% lower prevalence of coronary calcifi cation, a measure of subclinical atherosclerosis, and slightly higher HDL-C level RR: 1.34 ± 0.38 RK: 1.29 ± 0.35 KK: 1.37 ± 0.39 Tsai et al. [47] / 2007 Taiwanese patients with CHD ( n = 205) and controls ( n = 201) Cases: 1.04 ± 0.25 I823M The M823 allele was associated with higher HDL-C. Login to comment
152 Cases: 1.70 (1.5-2.0) Ctl: 1.30 (1.1-1.6) Pasdar et al. [49] / 2007 White ischemic stroke patients ( n = 400) Cases: 1.20 ± 0.40 L158L, R219K, G316G, R1587K The ABCA1 gene was not found to be associated with ischemic stroke, but R219K had the greatest impact on lipid profi le, especially on LDL and TG White controls ( n = 487) Ctl: 1.40 ± 0.40 Nebel et al. [50] / 2007 German patients with CHD ( n = 1090) and controls ( n = 728) NA R219K, V771M, I883M † , E1172D, R1587K Only the I883M polymorphism was signifi cantly associated with CHD *Studies reporting the initial molecular and biochemical characterization of fewer than 5 probands with an ABCA1 gene defect and their families were not included in Table 2. Login to comment
155 Genetic variation in ABCA1 and risk of myocardial infarction Study* / year Population screened HDL-C, mmol/L ABCA1 variants Conclusions Frikke-Schmidt et al. [35••] / 2008 Copenhagen City Heart Study: Women: R219K, V771M † , V825I † , I883M † , E1172D † , R1587K † Common genetic variation at the ABCA1 locus predicts IHD risk independently of plasma HDL-C levels. Login to comment
170 Three ABCA1 SNPs were analyzed (-477C/T, R219K, and I883) in a cohort of 170 young male survivors of MI (mean age, 43 ± 5 years) in order to determine their influence in long-term prognosis. Login to comment
174 Additionally, several recent studies have examined the role of the R219K SNP in lipoprotein metabolism and CHD. Login to comment

[hide] The influence of two variants in the adenosine tri... Metabolism. 2008 Oct;57(10):1398-404. Sandhofer A, Iglseder B, Kaser S, More E, Paulweber B, Patsch JR
The influence of two variants in the adenosine triphosphate-binding cassette transporter 1 gene on plasma lipids and carotid atherosclerosis.
Metabolism. 2008 Oct;57(10):1398-404., [PMID:18803945]

Abstract [show]
Variants in the adenosine triphosphate-binding-cassette transporter 1 (ABCA1) gene are known to affect high-density lipoprotein cholesterol and plasma triglycerides and the development of atherosclerosis. We investigated the influence of the R219K and I883M variants in the ABCA1 gene on plasma lipids and carotid intima media thickness and plaque extent in 688 healthy men (40-60 years old). The R219K variant showed no effect on plasma lipids, but carriers of the K allele displayed a lower intima media thickness (P = .001) and a reduced risk of advanced plaque extent (odds ratio [OR], 0.59; 0.39-0.88; P = .009) compared with noncarriers. However, this risk reduction was observed in nonsmokers only (OR, 0.47; 0.27-0.80; P < .001), but not in smokers (OR, 0.75; 0.41-1.39; P = .2). The I883M variant showed no effect on plasma lipids or carotid atherosclerosis. Risk of advanced plaque extent was reduced in subjects carrying the R219K variant alone (OR, 0.59; 0.38-0.94; P = .025), but not in subjects carrying both variants. Haplotype distribution did not differ between subjects with and without advanced atherosclerosis irrespective of smoking history. We conclude that smoking abrogates the protective effect of the R219K.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 We investigated the influence of the R219K and I883M variants in the ABCA1 gene on plasma lipids and carotid intima media thickness and plaque extent in 688 healthy men (40-60 years old). Login to comment
2 The R219K variant showed no effect on plasma lipids, but carriers of the K allele displayed a lower intima media thickness (P = .001) and a reduced risk of advanced plaque extent (odds ratio [OR], 0.59; 0.39-0.88; P = .009) compared with noncarriers. Login to comment
5 Risk of advanced plaque extent was reduced in subjects carrying the R219K variant alone (OR, 0.59; 0.38-0.94; P = .025), but not in subjects carrying both variants. Login to comment
7 We conclude that smoking abrogates the protective effect of the R219K. Login to comment
24 We investigated and report here the role of smoking on the influence of the R219K and I883M variants in the ABCA1 gene on plasma lipid levels and ultrasonographically quantified intima media thickness (IMT) and severity of atherosclerosis of the carotid artery in a cross-sectional cohort of 688 middle-aged men. Login to comment
43 The R219K and I883M status was determined using polymerase chain reaction-based restriction fragment length analysis, as described [5,6]. Login to comment
50 Table 1 Clinical and laboratory characteristics R219K I883M RR (350) RK (274) KK (64) RK + KK II (522) IM (151) MM (15) IM + MM (166) Age (y) 50.0 (5.2) 49.4 (5.5) 50.9 (5.5) 49.7 (5.5) 50.1 (5.3) 49.2 (5.4) 47.9 (5.7) 49.1 (5.4) BMI (kg/m2 ) 27.2 (3.4) 27.2 (3.8) 26.9 (4.4) 27.2 (3.9) 27.2 (3.9) 27.1 (4.1) 26.3 (4.7) 27.0 (4.1) SBP (mm Hg) 130.9 (11.8) 129.4 (12.1) 130.9 (13.3) 129.7 (12.3) 130.7 (12.1 129.0 (11.9) 127.9 (12.2) 128.9 (11.9) DBP (mm Hg) 80.3 (7.4) 79.1 (7.1) 79.7 (6.5) 79.27 (7.0) 79.9 (7.1) 79.5 (7.6) 76.1 (5.2) 79.2 (7.4) Smoking (%)† 49.1 40.5 53.6 46.2 47.5 40.8 50.0 47.2 DM (%)† 4.9 4.7 0 3.8 4.4 4.0 6.7 4.2 TC (mg/dL) 230.5 (41.7) 225.5 (40.3) 228.5 (36.0) 226.1 (39.5) 226.9 (40.2) 233.0 (42.5) 234.1 (35.8) 233.1 (41.8) LDL-C (mg/dL) 148.2 (37.7) 144.2 (37.2) 150.0 (35.7) 145.3 (37.0) 145.2 (37.2) 151.5 (37.9) 155.0 (34.8) 151.8⁎ (37.5) HDL-C (mg/dL) 54.6 (13.2) 53.4 (12.9) 53.5 (11.4) 53.5 (12.7) 53.9 (13.0) 54.0 (13.0) 57.6 (11.9) 54.3 (12.9) TGs (mg/dL) 138.4 (92.0) 138.7 (81.0) 132.8 (74.5) 137.6 (79.7) 138.5 (87.2) 138.5 (85.7) 116.2 (45.6) 136.5 (83.0) Apo A-I (mg/dL) 149.0 (22.2) 148.7 (23.0) 148.8 (20.1) 148.7 (22.4) 148.8 (22.5) 148.7 (21.4) 150.9 (23.8) 148.9 (21.6) Apo B (mg/dL) 119.7 (25.4) 119.8 (25.5) 120.9 (25.7) 119.2 (25.5) 118.7 (24.8) 122.0 (18.0) 118.9 (19.5) 121.7 (27.3) LDL size (nm) 26.4 (1.11) 26.2 (1.17) 26.3 (1.28) 26.2 (1.19) 26.3 (1.14) 26.2 (1.20) 26.4 (0.88) 26.3 (1.17) Values are means (SD). Login to comment
68 Frequencies of the R219K and I883M variants Allele frequency was 29.2% for the K allele at position 219 and 13.1% for the M allele at position 883; carrier frequency was 49.1% for the K allele and 21.9% for the M allele. Login to comment
69 Distribution of genotypes was in Hardy-Weinberg equilibrium (P = .30 and P = .33, for R219K and I883M, respectively). Login to comment
73 Effect of the R219K and I883M variants on plasma lipids and IMT Table 1 illustrates the clinical characteristics and laboratory parameters of the subjects according to the genotypes. Login to comment
74 Carriers of the I883M variant had a higher LDL-C compared with men homozygous for the wild-type allele. Login to comment
75 Carriers of the R219K variant had a lower IMT compared with noncarriers (781 ± 6 vs 802 ± 7 μm, P b.01), whereas the I883M variant had no effect on IMT (798 ± 9 vs 798 ± 6 μm, not significant [NS]) (Fig. 1). Login to comment
77 Effect of the R219K and I883M variants in combination on plasma lipids and IMT Furthermore, plasma lipids, apolipoproteins, and LDL size did not differ between the groups according to the combined carrier status of the 2 variants (Table 2). Login to comment
79 The R219K and I883M variants and IMT. Login to comment
85 Effect of the R219K and I883M variants on risk of atherosclerosis The risk of advanced atherosclerosis-defined as a plaque score of 3 and higher-was significantly reduced in carriers of the K allele (Table 3). Login to comment
92 Effect of the R219K and I883M variants in combination on risk of atherosclerosis The reduced risk of advanced atherosclerosis observed in carriers of the K allele at position 219 was attenuated by the carrier status at position 883. Login to comment
93 The unadjusted relative risk was 0.85 (95% CI, 0.72-1.00; P = .065) for carriers of the K allele alone, 1.04 (95% CI, 0.92-1.16; NS) for carriers of the M variant alone, and 0.87 (95% CI, 0.78-0.98; P b .05) for carriers of both variants, that is, R219K and I883M. Login to comment
100 A positive smoking history abolished the protective effect of the R219K variant. Login to comment
114 We therefore used this imaging technique to investigate the influence of the R219K and I883M variants in the ABCA1 gene on the extent of carotid atherosclerosis and plasma lipids in 688 middle-aged men. Login to comment
116 Men carrying the R219K variant had a reduced risk of carotid atherosclerosis and lower IMT values. Login to comment
119 This finding is in accordance with a previous report showing, for the R219K allele, less severe CAD and slower progression of CAD in carriers of the K allele [6]; but although Clee et al [6] demonstrated increased HDL-C and reduced TG levels in carriers, we observed no effect of the K allele on plasma lipids. Login to comment
127 Previous reports suggest that the R219K variant influences HDL-C concentration only in special subpopulations, such as smokers [8] or subjects with elevated Lp(a) or apo E3 [28], indicating a gene-environment or gene-gene interaction. Login to comment
128 However, in our population, the R219K variant was protective independent of Lp(a) concentration and apo E genotype (data not shown). Login to comment
129 In contrast to previous reports, the R219K variant was protective in nonsmokers only, suggesting that the "genetic advantage" of carrying the K variant is abolished by the established risk factor of smoking. Login to comment
136 However, this possible effect of the R219K variant needs further investigation. Login to comment
140 To further investigate if the R219K variant is the causative variant, we combined the R219K carrier status with the I883M carrier status. Login to comment
143 However, in our population, the I883M variant itself had no effect on carotid atherosclerosis. Login to comment
144 Therefore, we suggest that the R219K variant is possibly not the causative variant. Login to comment
145 In fact, the R219K variant may be in linkage disequilibrium with another variant responsible for the observed risk reduction. Login to comment
147 We conclude from this study that the R219K variant in the ABCA1 gene can alter risk of atherosclerosis independently from HDL-C and TG plasma concentration in nonsmoking, healthy, middle-aged men. Login to comment
148 Because smoking abolished the protective effect of the R219K variant, we hypothesize that smoking may influence ABCA1 efficacy. Login to comment
149 Considering the functions of ABCA1 other than lipid transport, the fact that the protective effect of the R219K is not dependent on plasma HDL-C or TG concentration suggests to us that another function of ABCA1 may be implicated. Login to comment
67 Frequencies of the R219K and I883M variants Allele frequency was 29.2% for the K allele at position 219 and 13.1% for the M allele at position 883; carrier frequency was 49.1% for the K allele and 21.9% for the M allele. Login to comment
72 Effect of the R219K and I883M variants on plasma lipids and IMT Table 1 illustrates the clinical characteristics and laboratory parameters of the subjects according to the genotypes. Login to comment
76 Effect of the R219K and I883M variants in combination on plasma lipids and IMT Furthermore, plasma lipids, apolipoproteins, and LDL size did not differ between the groups according to the combined carrier status of the 2 variants (Table 2). Login to comment
78 The R219K and I883M variants and IMT. Login to comment
84 Effect of the R219K and I883M variants on risk of atherosclerosis The risk of advanced atherosclerosis-defined as a plaque score of 3 and higher-was significantly reduced in carriers of the K allele (Table 3). Login to comment
91 Effect of the R219K and I883M variants in combination on risk of atherosclerosis The reduced risk of advanced atherosclerosis observed in carriers of the K allele at position 219 was attenuated by the carrier status at position 883. Login to comment
99 A positive smoking history abolished the protective effect of the R219K variant. Login to comment
113 We therefore used this imaging technique to investigate the influence of the R219K and I883M variants in the ABCA1 gene on the extent of carotid atherosclerosis and plasma lipids in 688 middle-aged men. Login to comment
115 Men carrying the R219K variant had a reduced risk of carotid atherosclerosis and lower IMT values. Login to comment
118 This finding is in accordance with a previous report showing, for the R219K allele, less severe CAD and slower progression of CAD in carriers of the K allele [6]; but although Clee et al [6] demonstrated increased HDL-C and reduced TG levels in carriers, we observed no effect of the K allele on plasma lipids. Login to comment
126 Previous reports suggest that the R219K variant influences HDL-C concentration only in special subpopulations, such as smokers [8] or subjects with elevated Lp(a) or apo E3 [28], indicating a gene-environment or gene-gene interaction. Login to comment
135 However, this possible effect of the R219K variant needs further investigation. Login to comment
139 To further investigate if the R219K variant is the causative variant, we combined the R219K carrier status with the I883M carrier status. Login to comment
146 We conclude from this study that the R219K variant in the ABCA1 gene can alter risk of atherosclerosis independently from HDL-C and TG plasma concentration in nonsmoking, healthy, middle-aged men. Login to comment

[hide] Effects of ABCA1 SNPs, including the C-105T novel ... Clin Chim Acta. 2008 Mar;389(1-2):79-86. Epub 2007 Dec 7. Genvigir FD, Soares SA, Hirata MH, Willrich MA, Arazi SS, Rebecchi IM, Oliveira R, Bernik MM, Dorea EL, Bertolami MC, Hirata RD
Effects of ABCA1 SNPs, including the C-105T novel variant, on serum lipids of Brazilian individuals.
Clin Chim Acta. 2008 Mar;389(1-2):79-86. Epub 2007 Dec 7., [PMID:18164264]

Abstract [show]
BACKGROUND: ABCA1 plays an important role in HDL metabolism. Single nucleotide polymorphisms (SNPs) in ABCA1 gene were associated with variation in plasma HDL-c. METHODS: The effect of the ABCA1 SNPs C-14T, R219K and of a novel variant C-105T on serum lipids was investigated in 367 unrelated Brazilian individuals (224 hypercholesterolemic and 143 normolipidemic). The relation between ABCA1 SNPs and the lipid-lowering response to atorvastatin (10 mg/day/4 weeks) was also evaluated in 141 hypercholesterolemic (HC) individuals. The polymorphisms were detected by PCR-RFLP and confirmed by DNA sequencing. RESULTS: Linkage disequilibrium was found between the SNPs C-105T and C-14T in the HC group. HC individuals carrying -105CT/TT genotypes had higher serum HDL-c and lower triglyceride and VLDL-c concentrations as well as lower TG/HDL-c ratio compared to the -105CC carriers (p<0.05). The R219K SNP was associated with reduced serum triglyceride, VLDL-c and TG/HDL-c ratio in the HC group (p<0.05), and with an increased serum apoAI in NL individuals. The effects of ABCA1 SNPs on basal serum lipids of HC individuals were not modified by atorvastatin treatment. CONCLUSIONS: The ABCA1 SNPs R219K and C-105T were associated with a less atherogenic lipid profile but not with the lowering-cholesterol response to atorvastatin in a Brazilian population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 Methods: The effect of the ABCA1 SNPs C-14T, R219K and of a novel variant C-105T on serum lipids was investigated in 367 unrelated Brazilian individuals (224 hypercholesterolemic and 143 normolipidemic). Login to comment
7 The R219K SNP was associated with reduced serum triglyceride, VLDL-c and TG/HDL-c ratio in the HC group (pb0.05), and with an increased serum apoAI in NL individuals. Login to comment
9 Conclusions: The ABCA1 SNPs R219K and C-105T were associated with a less atherogenic lipid profile but not with the lowering-cholesterol response to atorvastatin in a Brazilian population. Login to comment
25 The R219K single nucleotide polymorphism (SNP) has been associated with protection against coronary artery disease (CAD) risk and severity [18-23]. Login to comment
65 ABCA1 C-14T and R219K SNPs were detected by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) assays. Login to comment
66 The primers for C-14T (forward: 5'-CTCCACGTGCTTTCTGC- TGA-3', and reverse 5'-CACTCACTCTCGCTCGCAAT-3') and R219K (forward: 5'-GAAGAGATGATTCAACTTGGTGAC-3', and reverse 5'-GCCCAAAAG- TCTGAAAGAACAC-3') were selected using the ABCA1 reference sequence (GenBank Acession number AF275948) previously described [39]. Login to comment
68 The PCR thermal cycling conditions consisted of initial incubation at 98 °C for 3 min, followed by 29 cycles at 94 °C for 1 min, 57 °C for 2 min and 72 °C for 1 min for C-14T polymorphism or by 32 cycles at 94 °C for 45 s, 58 °C for 1.5 min and 72 °C for 1.5 min for R219K SNP and a final extension period of 72 °C for 10 min. Login to comment
70 PCR products of C-14T and R219K SNPs (173 bp and 295 bp respectively) were analyzed by 1% agarose gel electrophoresis after ethidium bromide staining. Login to comment
71 PCR products of the C-14T and R219K SNPs were initially digested with the MspI and StyI endonucleases (New England Biolabs Inc., Ipswich MA) respectively, at 37 °C. Login to comment
108 Genotype and allele frequencies of ABCA1 R219K, C-14T and C-105T SNPs in NL and HC groups are shown in Table 2. Login to comment
109 Table 2 Genotype and allele frequencies for ABCA1 R219K, C-14T and C-105T polymorphisms in the NL and HC groups Polymorphisms NL (143) HC (224) R219K genotypes, % RR 37.8 (54) 33.9 (76) χ2 =0.857 p=0.652 RK 43.3 (62) 48.2 (108) KK 18.9 (27) 17.9 (40) K allele 40.6 42.0 C-14T genotypes, % CC 42.0 (60) 43.3 (97) χ2 =2.000 p=0.363 CT 48.9 (70) 43.3 (97) TT 9.1 (13) 13.4 (30) T allele 33.6 35.0 C-105T genotypes, % CC 97.2 (139) 96.4 (216) Exact Fisher test p=1.000CT 2.8 (4) 3.1 (7) TT 0 (0) 0.5 (1) T allele 1.4 2.0 Number of individuals in parenthesis. Login to comment
110 Hardy-Weinberg Equilibrium: R219K SNP: χ2 =0.76 (pN0.05). Login to comment
113 Table 3 Effects of ABCA1 R219K polymorphism on basal serum lipids in NL and HC groups Variables NL genotypes (143) HC genotypes (224) 219RR (54) 219RK/ KK (89) p 219RR (76) 219RK/ KK (148) p Total cholesterol (mmol/l) 4.47±0.51 4.49±0.45 0.723 6.67±1.17 6.64±1.23 0.822 LDL-c (mmol/l) 2.59±0.48 2.55±0.44 0.696 4.39±1.11 4.41±1.13 0.890 HDL-c (mmol/l) 1.43±0.32 1.51±0.34 0.150 1.43±0.38 1.50±0.38 0.157 VLDL-c (mmol/l) 0.44±0.15 0.43±0.15 0.557 0.85±0.40 0.72±0.29 0.036 Triglyceride (mmol/l) 0.96±0.32 0.93±0.32 0.557 1.86±0.88 1.58±0.64 0.039 ApoAI (g/l) 1.36±0.29 1.46±0.27 0.035 1.37±0.28 1.40±0.30 0.513 ApoB (g/l) 0.88±0.24 0.84±0.21 0.416 1.31±0.33 1.31±0.28 0.876 ApoB/apoAI 0.67±0.23 0.60±0.21 0.074 1.00±0.33 0.99±0.37 0.732 TG/HDL-c 0.73±0.34 0.66±0.34 0.266 1.48±0.96 1.17±0.69 0.030 Number of individuals in parenthesis. Values are presented as mean±SD of log transformed data. Results were compared by t-test. ApoAI, apolipoprotein AI; apoB, apolipoprotein B; HC, hypercholesterolemic patients; HDL-c, high-density lipoprotein cholesterol; LDL-c, low-density lipoprotein cholesterol; NL, normolipidemic patients; TG, triglyceride; VLDL-c, very low-density lipoprotein cholesterol. Table 4 Effects of ABCA1 C-14T SNP on basal serum lipids in NL and HC groups Variables NL genotypes (143) HC genotypes (224) -14CC (60) -14CT/TT (83) p -14CC (97) -14CT/TT (127) p Total cholesterol (mmol/l) 4.45±0.39 4.51±0.52 0.739 6.68±1.29 6.63±1.14 0.778 LDL-c (mmol/l) 2.51±0.41 2.62±0.49 0.276 4.43±1.16 4.38±1.09 0.796 HDL-c (mmol/l) 1.53±0.34 1.45±0.34 0.262 1.50±0.41 1.45±0.36 0.466 VLDL-c (mmol/l) 0.44±0.15 0.44±0.15 0.922 0.75±0.36 0.78±0.31 0.138 Triglyceride (mmol/l) 0.94±0.33 0.95±0.32 0.922 1.62±0.79 1.71±0.69 0.151 ApoAI (g/l) 1.45±0.30 1.40±0.26 0.367 1.40±0.32 1.38±0.27 0.639 ApoB (g/l) 0.81±0.19 0.88±0.24 0.064 1.30±0.33 1.31±0.27 0.705 ApoB/apoAI 0.59±0.20 0.66±0.23 0.065 0.98±0.32 1.00±0.38 0.599 TG/HDL-c 0.67±0.36 0.70±0.33 0.500 1.23±0.85 1.31±0.77 0.147 Number of individuals in parenthesis. Values are presented as mean±SD of log transformed data. Results were compared by t-test. ApoAI, apolipoprotein AI; apoB, apolipoprotein B; HC, hypercholesterolemic patients; HDL-c, high-density lipoprotein cholesterol; LDL-c, low-density lipoprotein cholesterol; NL, normolipidemic patients; TG, triglyceride; VLDL-c, very low-density lipoprotein cholesterol. Login to comment
122 These results are suggestive that ABCA1 R219K SNP and possibly the novel variant C-105T are associated with a less atherogenic serum lipid profile. Login to comment
128 After the therapy, R219K and C-105T SNPs continued to show an association with a less atherogenic serum lipid profile (Fig. 2), but no ABCA1 SNP was associated with percentual variations in serum lipids after the treatment (data not shown). Login to comment
138 In this study ABCA1 R219K SNP was associated with an increased serum apoAI in the NL group and with a reduced serum triglyceride and VLDL-c in HC individuals. Login to comment
153 The C-105T SNP, like R219K also appears to be related to a less atherogenic lipid profile since the -105T allele was Fig. 2. Login to comment
155 A) R219K SNP. Login to comment
179 In our study, the HDL-c response to atorvastatin was independent of the ABCA1 C-105T, C-14T or R219K SNP. Login to comment
184 In addition, R219K and, possibly, C-105T polymorphisms are associated with a less atherogenic serum lipid profile in Brazilian hypercholesterolemic patients before and after treatment with atorvastatin. Login to comment

[hide] Investigation of ABCA1 C69T and G-191C polymorphis... In Vivo. 2008 Mar-Apr;22(2):187-90. Ergen A, Isbir S, Tekeli A, Isbir T
Investigation of ABCA1 C69T and G-191C polymorphisms in coronary artery disease.
In Vivo. 2008 Mar-Apr;22(2):187-90., [PMID:18468402]

Abstract [show]
BACKGROUND: Defects of lipoprotein metabolism are common risk factors for coronary artery disease. The ATP binding cassette transporter 1 (ABCA1) plays an important role in carrying cholesterol from peripheral tissues to the liver. The role of ABCA1 C69T and G-191C gene polymorphisms on plasma lipid levels of patients with coronary artery disease was investigated. PATIENTS AND METHODS: Seventy-seven patients with coronary artery disease and fifty healthy controls were studied. Gene polymorphisms were determined by polymerase chain reaction-restriction fragment length polymorphism method. RESULTS: No differences in the distribution of C69T and G-191C polymorphisms were observed in the study groups. Plasma triacylglycerol and VLDL-cholesterol levels were shown to be higher in the patient group with the C69T CC genotype compared to these patients with the CT genotype. The C69T polymorphism was associated with HDL-cholesterol levels, which insignificantly increased in the order of the CC>CT>TT genotypes in our study. No association was found between G-191C genotype and lipid levels. CONCLUSION: The results of our study suggested that polymorphisms of ABCA1 C69T polymorphism may be associated with plasma triacylglycerol and VLDL-cholesterol levels in coronary artery patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 They found that the rare alleles of C-14T(C69T) and V771M polymorphisms were associated with higher HDL-C levels in men and, in combination with the rare alleles of R219K and I883M, respectively, with higher HDL-C in both sexes. Login to comment
75 In another study of six common polymorphisms of ABCA1, very high HDL-C was found to be associated with a higher genotype frequency for R219K and higher genotype and allelic frequency for E1172D compared with lower HDL-C (21). Login to comment
79 They suggested that R219K polymorphism in Ergen et al: Investigation of ABCA1 C69T and G-191C Polymorphisms in Coronary Artery Disease 189 Table III. Login to comment

[hide] Effects of ABCA1 variants on rosiglitazone monothe... Acta Pharmacol Sin. 2008 Feb;29(2):252-8. Wang J, Bao YQ, Hu C, Zhang R, Wang CR, Lu JX, Jia WP, Xiang KS
Effects of ABCA1 variants on rosiglitazone monotherapy in newly diagnosed type 2 diabetes patients.
Acta Pharmacol Sin. 2008 Feb;29(2):252-8., [PMID:18215356]

Abstract [show]
AIM: The aim of the present study was to investigate the relationship between R219K, M883I, and R1587K variants of the ATP-binding cassette transporter subfamily A number 1 (ABCA1) gene and response to rosiglitazone treatment in newly diagnosed patients with type 2 diabetes. METHODS: A total of 105 diabetic patients with no history of antihyperglycemia medication were treated with rosiglitazone (4 or 8 mg daily) for 48 weeks. Three non-synonymous variants R219K, M883I, and R1587K, were genotyped in all patients. RESULTS: Ninety-three patients completed the entire study. The R219K variant of ABCA1 had an effect on rosiglitazone response with the per-allele odds ratio of 2.04 for treatment failure (P<0.05). The RR homozygotes had a better improvement in indicators of insulin sensitivity, as determined by a significantly greater decrease in the homeostasis model assessment index of insulin resistance (-2.39+/-0.46 vs -0.69+/-0.51, P<0.05). No genotype-phenotype association was detected for M883I and R1587K. CONCLUSION: The R219K variant of ABCA1 was associated with the therapeutic effect of rosiglitazone. The RR homozygotes had a better response to rosiglitazone treatment in terms of insulin sensitivity improvement than minor K allele carriers. Neither the M883I nor R1587K variant of the ABCA1 gene was associated with rosiglitazone response.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 (c)2008 CPS and SIMM Acta Pharmacol Sin 2008 Feb; 29 (2): 252-258 Full-lengtharticle Effects of ABCA1 variants on rosiglitazone monotherapy in newly diagnosed type 2 diabetes patients1 Jie WANG2 , Yu-qian BAO2 , Cheng HU2 , Rong ZHANG2 , Cong-rong WANG2 , Jun-xi LU2 , Wei-ping JIA2,3 , Kun-san XIANG2 Shanghai Diabetes Institute, Department of Endocrinology and Metabolism, Shanghai Jiao Tong University Affiliated Sixth People`s Hospital, Shanghai 200233, China Abstract Aim: The aim of the present study was to investigate the relationship between R219K, M883I, and R1587K variants of the ATP-binding cassette transporter subfamilyA number 1 (ABCA1) gene and response to rosiglitazone treatment in newly diagnosed patients with type 2 diabetes. Login to comment
2 Three non-synonymous variants R219K, M883I, and R1587K, were genotyped in all patients. Login to comment
4 The R219K variant of ABCA1had an effect on rosiglitazone response with the per-allele odds ratio of 2.04 for treatment failure (P<0.05). Login to comment
7 Conclusion: The R219K variant ofABCA1was associated with the therapeutic effect ofrosiglitazone. Login to comment
32 In this study, we selected 3 non-synonymous variants of ABCA1, R219K, M883I, and R1587K, toevaluate their effects on rosiglitazone treatment in newly diagnosed patients with type 2 diabetes. Login to comment
88 Pairwise linkage disequilibrium analyses among ABCA1 gene R219K, M883I and R1587K variants. Login to comment
89 | D´| \r2 R219K M883I R1587K R219K 0.041 0.027 M883I 0.372 0.031 R1587K 0.191 0.377 Linkage disequilibrium estimates are shown as |D´| in the lower triangle and r2 in the upper triangle. Login to comment
91 According to the first criterion, R219K was associated with response to rosiglitazone treatment with more treatment failures in the rare allele homozygotes KK. Login to comment
97 Association between ABCA1 genetic variants and the effect of rosiglitazone treatment on clinical features The association between R219K and clinical features is shown in Table 4. Login to comment
106 In this study, we found that the R219K variant of the ABCA1 gene was associated with response to rosiglitazone therapy in newly diagnosed type 2 diabetes patients. Login to comment
113 The main outcome of our study was that R219K was associated with insulin sensitivityimprovement. Login to comment
119 Criterion 1 Criterion 2 R219K RR RK KK RR RK KK Responder 14 (0.483) 19 (0.452) 2 (0.118) 24 (0.889) 33 (0.767) 11 (0.647) Non-responderb 15 (0.517) 23 (0.548) 15 (0.882) 3 (0.111) 10 (0.233) 6 (0.353) M883I MM MI II MM MI II Responder 15 (0.319) 15 (0.455) 5 (0.625) 33 (0.717) 29 (0.878) 6 (0.750) Non-responder 32 (0.681) 18 (0.545) 3 (0.375) 13 (0.283) 4 (0.121) 2 (0.250) R1587K RR RK KK RR RK KK Responder 13 (0.394) 18 (0.400) 4 (0.400) 26 (0.788) 37 (0.822) 5 (0.556) Non-responder 20 (0.606) 27 (0.600) 6 (0.600) 7 (0.212) 8 (0.178) 4 (0.444) pose that a small change in ABCA1 activity could affect rosiglitazone response without markedlyimpacting circulating cholesterol profiles. Login to comment
126 Association between ABCA1 R219K variant and clinical features. Login to comment
130 The K allele carriers of the R219K variant showed a relatively higher mean drug dose compared with the RR homozygotes, which may also reflect a poorer response torosiglitazone treatment. Login to comment
133 In conclusion, we provide evidence that the R219K variant of the ABCA1 gene either directly or as a marker with additional functional variant in linkage disequilibrium, has an effect on response torosiglitazone treatment. Login to comment

[hide] Novel rare mutations and promoter haplotypes in AB... Clin Genet. 2008 Feb;73(2):179-84. Slatter TL, Jones GT, Williams MJ, van Rij AM, McCormick SP
Novel rare mutations and promoter haplotypes in ABCA1 contribute to low-HDL-C levels.
Clin Genet. 2008 Feb;73(2):179-84., [PMID:18199144]

Abstract [show]
The ATP-binding cassette A1 (ABCA1) protein regulates plasma high-density lipoprotein (HDL) levels. Mutations in ABCA1 can cause HDL deficiency and increase the risk of premature coronary artery disease. Single nucleotide polymorphisms (SNPs) in ABCA1 are associated with variation in plasma HDL levels. We investigated the prevalence of mutations and common SNPs in ABCA1 in 154 low-HDL individuals and 102 high-HDL individuals. Mutations were identified in five of the low-HDL subjects, three having novel variants (I659V, R2004K, and A2028V) and two with a previously identified variant (R1068H). Analysis of four SNPs in the ABCA1 gene promoter (C-564T, G-407C, G-278C, and C-14T) identified the C-14T SNP and the TCCT haplotype to be over-represented in low-HDL individuals. The R1587K SNP was over-represented in low-HDL individuals, and the V825I and I883M SNPs over-represented in high-HDL individuals. We conclude that sequence variation in ABCA1 contributes significantly to variation in HDL levels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 Genotyping of ABCA1 SNPs by RFLP Fourteen SNPs including five promoter SNPs (C-564T, G-407C, G-278C, G-99C, and C-14T), one 5#-UTR SNP [-76(-75) insG], six non-synonymous coding SNPs (R219K, V771M, V825I, I883M, E1172D, and R1587K) and two 3#-UTR SNPs [A-960G -383(-381)delGTT] were genotyped in the low-, mid-, and high-HDL-C groups by restriction fragment length polymorphism (RFLP) analysis. Login to comment
55 Six of the non-synonymous variants were previously reported SNPs (R219K, V771M, V825I, I883M, E1172D and R1587K). Login to comment
105 a Coding haplotypes were derived from the following six non-synonymous SNPs (left to right): R219K (G.A), V771M (G.A), V825I (G.A), I883M (A.G), E1172D (G.C), and R1587K (G.A). Login to comment

[hide] Association of the ATP-binding cassette transporte... Diabetes. 2008 Feb;57(2):509-13. Epub 2007 Nov 14. Villarreal-Molina MT, Flores-Dorantes MT, Arellano-Campos O, Villalobos-Comparan M, Rodriguez-Cruz M, Miliar-Garcia A, Huertas-Vazquez A, Menjivar M, Romero-Hidalgo S, Wacher NH, Tusie-Luna MT, Cruz M, Aguilar-Salinas CA, Canizales-Quinteros S
Association of the ATP-binding cassette transporter A1 R230C variant with early-onset type 2 diabetes in a Mexican population.
Diabetes. 2008 Feb;57(2):509-13. Epub 2007 Nov 14., [PMID:18003760]

Abstract [show]
OBJECTIVE: The ATP-binding cassette transporter A1 (ABCA1) R230C variant is associated with low HDL cholesterol levels, obesity, and the metabolic syndrome in Mexican-Mestizos. Because a pivotal role for ABCA1 in pancreatic beta-cell function was recently observed in the mouse model, we assessed the association of this variant with type 2 diabetes in this population. RESEARCH DESIGN AND METHODS: The initial group included 446 unrelated Mexican individuals: 244 with type 2 diabetes aged 20-69 years (121 with onset </=45 years), and 202 nondiabetic control subjects aged >50 years. An independent study group included 242 type 2 diabetic case subjects and 225 control subjects with similar characteristics. RESULTS: R230C/C230C genotypes were significantly more frequent in type 2 diabetic individuals (24.6%) than in control subjects (11.4%) in the initial study group (OR 2.501; P = 0.001). After stratifying by age at diagnosis, the association was significant only in the early-onset group (age at diagnosis </=45 years) (OR 3.776, P = 3.3 x 10(-6)). Both associations remained significant after adjusting for admixture (P = 0.0008 and P = 8.1 x 10(-6), respectively). Similar trends were observed in the independent study group, and the combined analysis of both populations showed a highly significant association of the R230C variant with type 2 diabetes, particularly with that of early onset (P = 7.6 x 10(-6) and 9.4 x 10(-8), respectively). CONCLUSIONS: The R230C ABCA1 variant is associated with type 2 diabetes, particularly of early onset, in the Mexican-Mestizo population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 TABLE 3 Allelic association analyses results of individual SNPs in the ABCA1 gene in case-control samples of the initial study group dbSNP ID Position* ABCA1 region Major/minor allele MAF Allele frequencies P† P‡ Type 2 diabetes Nondiabetic rs2000069 106675690 Intron 5 C/T 0.380 0.372 0.390 0.729 0.999 rs2230806 (R219K) 106660688 Exon 7 G/A 0.327 0.312 0.346 0.311 0.845 rs9282541 (R230C) 106660656 Exon 7 C/T 0.097 0.131 0.056 0.0002 0.001 rs2487037 106657158 Intron 7 C/T 0.261 0.256 0.267 0.585 0.998 rs3818689 106634837 Intron 18 G/C 0.054 0.056 0.052 0.772 0.999 *Position is in contiguous NT_008470.18; †P values for type 2 diabetes with respect to the minor allele; ‡P values after Bonferroni correction for the five different SNPs tested. Login to comment
125 However, SNPs rs2230806 (R219K) and r2487037 were in high LD (r2 >0.8). Login to comment
126 However, SNPs rs2230806 (R219K) and r2487037 were in high LD (r2 >0.8). Login to comment

[hide] Genetic variation in ABCA1 predicts ischemic heart... Arterioscler Thromb Vasc Biol. 2008 Jan;28(1):180-6. Epub 2007 Oct 19. Frikke-Schmidt R, Nordestgaard BG, Jensen GB, Steffensen R, Tybjaerg-Hansen A
Genetic variation in ABCA1 predicts ischemic heart disease in the general population.
Arterioscler Thromb Vasc Biol. 2008 Jan;28(1):180-6. Epub 2007 Oct 19., [PMID:17951323]

Abstract [show]
OBJECTIVE: We tested the hypothesis that 6 nonsynonymous single nucleotide polymorphisms (SNPs) in ATP-Binding-Cassette transporter A1 (ABCA1) affect risk of ischemic heart disease (IHD) in the general population. METHODS AND RESULTS: We genotyped 9259 individuals from the Danish general population followed for 25 years. Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels. Despite this, 5 out of 6 SNPs (V771M, V825I, I883M, E1172D, R1587K) predicted increased risk of IHD. Similar results were obtained in a verification sample with 932 IHD cases versus 7999 controls. A stepwise regression approach identified V771M, I883M, and E1172D as the most important predictors of IHD and additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs. CONCLUSIONS: We show that 3 of 6 nonsynonymous SNPs in ABCA1 predict risk of IHD in the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels. Login to comment
10 A stepwise regression approach identified V771M, I883M, and E1172D as the most important predictors of IHD and additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs. Login to comment
16 In the present study we included 9259 individuals from the 1991 to 1994 examination, whom we genotyped for all nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals of Danish ancestry.8 Information on diagnosis of IHD (nϭ1170; World Health Organization; International Classification of Diseases, 8th edition: codes 410 to 414; 10th edition: codes I20-I25) was collected and verified until 31st December 2000 by reviewing all hospital admissions and diagnoses entered in the national Danish Patient Registry, all causes of death entered in the national Danish Causes of Death Registry, and medical records from hospitals and general practitioners. Login to comment
29 The cohort was participants in The Copenhagen City Heart Study who attended the 1991 to 1994 examination, and for whom combined genotypes for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) were available as well as all clinical and biochemical data (nϭ9028 out of nϭ9259; Table 1). Login to comment
38 SNP Genotyping The ABI PRISM 7900HT Sequence Detection System (Applied Biosystem Inc) was used to genotype for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals, as previously described.8 Biochemical Analyses Colorimetric and turbidimetric assays (Hitachi autoanalyzer) were used to measure plasma levels of total cholesterol, HDL-C, triglycerides, and apolipoproteins B and -AI (all Boehringer Mannheim GmbH). Login to comment
55 Frikke-Schmidt et al ABCA1 and Ischemic Heart Disease 181 the entire ABCA1 gene in 190 individuals of Danish descent were: 0.26 (R219K), 0.03 (V771M), 0.03 (E1172D), 0.06 (V825I), 0.12 (I883M), and 0.24 (R1587K).8 Similar allele frequencies have been reported for other White populations.14 Please see Data Supplements, Expanded Results for description of Hardy-Weinberg equilibrium. Login to comment
57 A strong positive DЈ was present for R219K/V771M, M825I/I883M, and E1172D/ R1587K (DЈϾ0.9), whereas a strong negative DЈ was present for R219K/V825I, V771M/V825I, and V771M/I883M (DЈϽ-0.9). Login to comment
60 Risk of IHD Prospective Study The cumulative incidence of IHD as a function of age was increased for V771M (GAϩAA versus GG, borderline Pϭ0.06), V825I (GAϩAA versus GG; Pϭ0.02), I883M (AGϩGG versus AA, Pϭ0.01), E1172D (GCϩCC versus GG, Pϭ0.03), and for R1587K (AA versus GG, borderline Pϭ0.06), but not for R219K (Figure 2). Login to comment
69 For R219K and R1587K, all 3 genotypes were presented (homozygote in red, heterozygote in black, common genotype in green). Login to comment
82 R1587K was associated with a decrease in HDL-C of 0.03 mmol/L (PϽ0.005), whereas R219K, I883M, and E1172D were not associated with changes in HDL-C levels (Figure 3, upper panel). Login to comment
85 Risk of Ischemic Heart Disease as a Function of ABCA1 Genotype in the Prospective Study n, % Number of Events Incidence Rate (95% CI) per 10 000 Person-Years Hazard Ratio (95% CI) Observed Expected Age Adjusted HDL-C Adjusted Multifactorially Adjusted R219K GG 4863 (54) 603 603 64 (59-70) 1 1 1 GA 3461 (39) 429 426 64 (58-71) 1.0 (0.9-1.1) 1.0 (0.9-1.1) 1.0 (0.9-1.2) AA 641 (7) 75 79 64 (50-80) 1.0 (0.8-1.2) 1.0 (0.8-1.2) 1.0 (0.8-1.3) V771M GG 8379 (93) 1023 1040 64 (60-68) 1 1 1 GAϩAA 586 (7) 84 69 75 (60-93)* 1.2 (1.0-1.5) 1.3 (1.0-1.6) 1.2 (1.0-1.5) M825I GG 7959 (89) 962 988 63 (59-67) 1 1 1 GAϩAA 1006 (11) 145 122 76 (64-89)† 1.2 (1.0-1.5) 1.2 (1.0-1.5) 1.2 (1.0-1.4) I883M AA 6934 (77) 827 864 62 (58-66) 1 1 1 AGϩGG 2031 (23) 280 245 72 (64-81)† 1.2 (1.0-1.4) 1.2 (1.1-1.4) 1.2 (1.1-1.4) E1172D GG 8469 (94) 1026 1045 63 (59-67) 1 1 1 GCϩCC 496 (6) 81 64 86 (68-106)† 1.3 (1.0-1.6) 1.3 (1.0-1.6) 1.3 (1.0-1.6) R1587K GG 5216 (58) 626 645 62 (58-67) 1 1 1 GA 3213 (36) 399 396 65 (58-71) 1.0 (0.9-1.2) 1.0 (0.9-1.2) 1.0 (0.9-1.2) AA 536 (6) 82 68 82 (65-102)* 1.2 (1.0-1.6) 1.2 (1.0-1.5) 1.3 (1.0-1.6) Nonincident cases (nϭ63) were excluded, leaving 8965 individuals for the survival analyses and Cox regression. Login to comment
89 Rs numbers: R219K (rs2230806); V771M (rs2066718); V825I (rs2066715); I883M (rs4149313); E1172D (rs33918808); R1587K (rs2230808). Login to comment
98 The rare allele of the R219K SNP has previously been reported to be associated with decreased14,17 or increased risk of coronary heart disease.18 The present largest prospective results as well as a recent case-control study did not find any association with atherosclerosis susceptibility.19 In support of I883M and E1172D as 2 of the 3 most important ABCA1 SNPs for IHD prediction, a previous study of 2028 White men found increased frequencies in cases compared with controls, and also detected increased risk of future IHD events associated with the 1172D allele.18 The pairwise LD structure of the SNPs is important for the interpretation of the association results. Login to comment
1 Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels. Login to comment
23 The cohort was participants in The Copenhagen City Heart Study who attended the 1991 to 1994 examination, and for whom combined genotypes for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) were available as well as all clinical and biochemical data (nafd;9028 out of nafd;9259; Table 1). Login to comment
32 SNP Genotyping The ABI PRISM 7900HT Sequence Detection System (Applied Biosystem Inc) was used to genotype for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals, as previously described.8 Biochemical Analyses Colorimetric and turbidimetric assays (Hitachi autoanalyzer) were used to measure plasma levels of total cholesterol, HDL-C, triglycerides, and apolipoproteins B and -AI (all Boehringer Mannheim GmbH). Login to comment
49 Frikke-Schmidt et al ABCA1 and Ischemic Heart Disease 181 at Semmelweis University (Egyetem) on December 3, 2015 http://atvb.ahajournals.org/ Downloaded from the entire ABCA1 gene in 190 individuals of Danish descent were: 0.26 (R219K), 0.03 (V771M), 0.03 (E1172D), 0.06 (V825I), 0.12 (I883M), and 0.24 (R1587K).8 Similar allele frequencies have been reported for other White populations.14 Please see Data Supplements, Expanded Results for description of Hardy-Weinberg equilibrium. Login to comment
51 A strong positive Db18; was present for R219K/V771M, M825I/I883M, and E1172D/ R1587K (Db18;b0e;0.9), whereas a strong negative Db18; was present for R219K/V825I, V771M/V825I, and V771M/I883M (Db18;b0d;afa;0.9). Login to comment
54 Risk of IHD Prospective Study The cumulative incidence of IHD as a function of age was increased for V771M (GAaf9;AA versus GG, borderline Pafd;0.06), V825I (GAaf9;AA versus GG; Pafd;0.02), I883M (AGaf9;GG versus AA, Pafd;0.01), E1172D (GCaf9;CC versus GG, Pafd;0.03), and for R1587K (AA versus GG, borderline Pafd;0.06), but not for R219K (Figure 2). Login to comment
63 For R219K and R1587K, all 3 genotypes were presented (homozygote in red, heterozygote in black, common genotype in green). Login to comment
76 R1587K was associated with a decrease in HDL-C of 0.03 mmol/L (Pb0d;0.005), whereas R219K, I883M, and E1172D were not associated with changes in HDL-C levels (Figure 3, upper panel). Login to comment
79 Risk of Ischemic Heart Disease as a Function of ABCA1 Genotype in the Prospective Study n, % Number of Events Incidence Rate (95% CI) per 10 000 Person-Years Hazard Ratio (95% CI) Observed Expected Age Adjusted HDL-C Adjusted Multifactorially Adjusted R219K GG 4863 (54) 603 603 64 (59-70) 1 1 1 GA 3461 (39) 429 426 64 (58-71) 1.0 (0.9-1.1) 1.0 (0.9-1.1) 1.0 (0.9-1.2) AA 641 (7) 75 79 64 (50-80) 1.0 (0.8-1.2) 1.0 (0.8-1.2) 1.0 (0.8-1.3) V771M GG 8379 (93) 1023 1040 64 (60-68) 1 1 1 GAaf9;AA 586 (7) 84 69 75 (60-93)* 1.2 (1.0-1.5) 1.3 (1.0-1.6) 1.2 (1.0-1.5) M825I GG 7959 (89) 962 988 63 (59-67) 1 1 1 GAaf9;AA 1006 (11) 145 122 76 (64-89)ߤ 1.2 (1.0-1.5) 1.2 (1.0-1.5) 1.2 (1.0-1.4) I883M AA 6934 (77) 827 864 62 (58-66) 1 1 1 AGaf9;GG 2031 (23) 280 245 72 (64-81)ߤ 1.2 (1.0-1.4) 1.2 (1.1-1.4) 1.2 (1.1-1.4) E1172D GG 8469 (94) 1026 1045 63 (59-67) 1 1 1 GCaf9;CC 496 (6) 81 64 86 (68-106)ߤ 1.3 (1.0-1.6) 1.3 (1.0-1.6) 1.3 (1.0-1.6) R1587K GG 5216 (58) 626 645 62 (58-67) 1 1 1 GA 3213 (36) 399 396 65 (58-71) 1.0 (0.9-1.2) 1.0 (0.9-1.2) 1.0 (0.9-1.2) AA 536 (6) 82 68 82 (65-102)* 1.2 (1.0-1.6) 1.2 (1.0-1.5) 1.3 (1.0-1.6) Nonincident cases (nafd;63) were excluded, leaving 8965 individuals for the survival analyses and Cox regression. Login to comment
83 Rs numbers: R219K (rs2230806); V771M (rs2066718); V825I (rs2066715); I883M (rs4149313); E1172D (rs33918808); R1587K (rs2230808). Login to comment
92 The rare allele of the R219K SNP has previously been reported to be associated with decreased14,17 or increased risk of coronary heart disease.18 The present largest prospective results as well as a recent case-control study did not find any association with atherosclerosis susceptibility.19 In support of I883M and E1172D as 2 of the 3 most important ABCA1 SNPs for IHD prediction, a previous study of 2028 White men found increased frequencies in cases compared with controls, and also detected increased risk of future IHD events associated with the 1172D allele.18 The pairwise LD structure of the SNPs is important for the interpretation of the association results. Login to comment

[hide] A novel intronic polymorphism of ABCA1 gene reveal... Am J Med Genet B Neuropsychiatr Genet. 2007 Dec 5;144B(8):1007-13. Chu LW, Li Y, Li Z, Tang AY, Cheung BM, Leung RY, Yik PY, Jin DY, Song YQ
A novel intronic polymorphism of ABCA1 gene reveals risk for sporadic Alzheimer's disease in Chinese.
Am J Med Genet B Neuropsychiatr Genet. 2007 Dec 5;144B(8):1007-13., [PMID:17510949]

Abstract [show]
Recent genetic studies have shown that variants of the ATP-binding cassette transporter A1, ABCA1, may be implicated in the pathogenesis of Alzheimer's disease (AD). In this case-control study, a panel of 19 single nucleotide polymorphisms (SNP) (including three amino-acid-coding SNPs used for replication of previous work, and 16 newly selected intronic tag SNPs) was genotyped. Nominally significant single marker P-values were observed in four SNPs, with the highest score of 0.003 for rs2297404 (OR = 1.88, 95%CI 1.23-2.87). In addition, six distinct linkage disequilibrium (LD) blocks were detected. LD block1 harbored three nominally significant SNPs (rs2297404, rs2230808, and rs2020927), and showed a different haplotype structure in the affected and unaffected groups. Of the four haplotypes identified, haplotype2 (CAC) was more prevalent in the disease group (0.323 in AD vs. 0.202 in control); while haplotype1 (TGG) was over-represented in the healthy controls (0.595 in control vs. 0.493 in AD), indicating disease risk conferring possibility of haplotype2. After doubling the sample size, the three nominally significant SNPs were still significantly associated with AD. Although coding SNP (rs2230808) was confirmed to have a significant association with AD, prediction of the effects of an amino acid substitution SNP rs2230808 (R1587K) on the three-dimensional structure and function of the ABCA1 protein using PolyPhen program revealed that it is unlikely to be functionally significant. However, the adjacent rs2297404 in the same LD block is potentially functionally significant because of its position in the immediate vicinity of a splicing branch site. Further functional analysis of this polymorphism should be a high priority.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
133 SNP18 (R219K) is in an N-terminal extracellular loop which possibly mediates ABCA1 interaction with ApoAI; while SNP10 (K1587R) is located in the regulatory segment 2 of the protein [Fitzgerald et al., 2002; Frikke-Schmidt et al., 2004]. Login to comment

[hide] R219K polymorphism of ATP binding cassette transpo... Arch Med Res. 2007 Nov;38(8):834-8. Epub 2007 Aug 2. Kitjaroentham A, Hananantachai H, Tungtrongchitr A, Pooudong S, Tungtrongchitr R
R219K polymorphism of ATP binding cassette transporter A1 related with low HDL in overweight/obese Thai males.
Arch Med Res. 2007 Nov;38(8):834-8. Epub 2007 Aug 2., [PMID:17923263]

Abstract [show]
BACKGROUND: ATP binding cassette transporter A1 (ABCA1) plays a role in the initial stage of removing cholesterol from the body via cholesterol efflux. Mutations of this gene cause wide-ranging HDL deficiency, as evident in Tangier disease and familial hypoalphalipoproteinemia. The aim of this study was to elucidate whether the presence of ABCA1 gene polymorphism could be a risk factor for overweight/obesity. METHODS: The presence of R219K and I883M genetic variant was determined by PCR-RFLP analysis in 112 overweight/obese and 117 control subjects of both sexes. Statistical analysis was performed to find an association between polymorphism and lipid data. RESULTS: Overweight/obese men carrying the mutant allele of R219K had lower level of HDL than the control (p = 0.006). However, no positive association was observed using bivariate logistic regression analysis. On the contrary, there was no difference in HDL level among genotypes in I883M polymorphism. Both polymorphisms appeared to be common in Thai ethnic groups. No difference was detected in genotype frequency between the two populations for both polymorphisms. CONCLUSIONS: Although the lower level of HDL in overweight/obese men carrying R219K in comparison to the control suggests the possible involvement of this gene with obesity, further investigations are needed to prove the influence of ABCA1 gene polymorphism on HDL level and to determine whether it could be a genetic determinant of obesity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 The presence of R219K and I883M genetic variant was determined by PCR-RFLP analysis in 112 overweight/obese and 117 control subjects of both sexes. Login to comment
9 Overweight/obese men carrying the mutant allele of R219K had lower level of HDL than the control ( p 5 0.006). Login to comment
15 Although the lower level of HDL in overweight/obese men carrying R219K in comparison to the control suggests the possible involvement of this gene with obesity, further investigations are needed to prove the influence of ABCA1 gene polymorphism on HDL level and to determine whether it could be a genetic determinant of obesity. Login to comment
16 Ó 2007 IMSS. Published by Elsevier Inc. Key Words: ABCA1, Overweight/obese, SNP, Polymorphism, R219K. Login to comment
32 Some of these ABCA1 polymorphisms such as R219K (10) and I883M (9) are associated with increased HDL levels. Login to comment
34 Thus, we studied the prevalence of two frequently occurring common variants of the ABCA1 gene, R219K and I883M polymorphisms, and any association between these two polymorphisms and the lipid profiles of Thai overweight/obese subjects. Login to comment
51 R219K (G1051A) The forward primer was 50 -GTATTT TTG CAA GGC TAC CAG TTA CAT TTG ACA A-30 and the reverse primer was 50 -GAT TGG CTT CAG GAT GTC CAT GTT GGA A-30 . Login to comment
62 Obviously, carrier frequency was high, 60e65% for R219K and almost 90% for I883M. Login to comment
64 To determine whether the presence of the mutant allele of the two variants (K allele for R219K and M allele for I883M) affects the HDL levels of overweight/obese subjects compared with the control, the HDL levels of the obese and control groups were compared according to their genotype, as shown in Table 3. Login to comment
65 A difference was observed in male subjects carrying the mutant allele R219K. Login to comment
67 Bivariate logistic regression was used to test support for the suggestion that the low HDL levels found in overweight/obese men carrying the mutant R219K allele is the result of ABCA1 gene polymorphism. Login to comment
68 Table 4 shows the logistic regression and odds ratios for possible association between HDL at cutoff point 35 mg/dL and obesity, cholesterol, triglycerides, LDL, the two ABCA1 polymorphisms-R219K and I883M-and gender. Login to comment
70 Accordingly, most of the overweight and obese men carrying the R219K mutant allele appeared to have HDL !50 mg/dL compared with the control (Figure 1), although they were smaller in number (22 vs. 63). Login to comment
71 Triglyceride was another parameter found to be higher in obese men carrying the R219K mutant allele. Login to comment
77 Our result was 61.61% in overweight/obese and 66.67% for R219K; for I883M, it was 87.5% and 90.18% for overweight/obese and control, respectively. Login to comment
79 However, this agrees with our result because the carrier frequency of R219K in Japanese is 74.6% (12). Login to comment
80 Both polymorphisms appear to be more common among populations of Asian ethnicity than Westerners because R219K carrier frequency in Europeans is 46% (10). Login to comment
90 Frequency of the two ABCA1 SNPs-R219K and I883M-in overweight/obese and control subjects ABCA1 genotype Overweight/obese n (%) Control n (%) Odds ratio (95% CI) p value* R219K n 5 112 n 5 117 219RR 43 39 0.800 0.422 219RK þ KK 57þ12 (61.61%) 65þ13 (66.67%) (0.450e1.430) I883M n 5 112 n 5 112 883II 14 11 0.760 883IM þ MM 47þ51 (87.50%) 57þ44 (90.18%) (0.310e1.890) 0.520 *p value 0.05 or less was considered statistically significant. Login to comment
92 Although several reports have confirmed that the K allele of R219K is associated with a slightly higher HDL concentration (10,15), this is not consistent with our finding in overweight/obese subjects. Login to comment
93 The overweight/obese men carrying R219K had significantly lower HDL concentrations than their controls, although a small number of individuals was tested. Login to comment
101 Lipid profiles of noncarriers and carriers of the K allele of the R219K polymorphism in overweight/obese and control subjects by gender Genotype RR RK þ KK Obese Control p value* Obese Control p value* Men n 5 18 n 5 33 n 5 22 n 5 63 Cholesterol 211.00 203.00 0.937 220.50 202.00 0.177 (103.00e374.00) (127.00e284.00) (136.00e276.00) (129.00e279.00) HDL 50.50 44.00 0.206 45.00 50.00 0.006* (31.00e64.00) (28.00e64.00) (33.00e69.00) (33.00e86.00) LDL 133.90 138.20 0.460 129.00 117.40 0.748 (26.00e291.00) (55.00e210.00) (75.00e193.00) (50.00e205.00) Triglycerides 137.50 138.00 0.261 188.50 118.00 0.000 (62.00e269.00) (47.00e269.00) (71.00e342.00) (35.00e327.00) Women n 5 25 n 5 6 n 5 47 n 5 15 Cholesterol 211.00 182.00 0.937 223.00 212.00 0.406 (139.00e427.00) (159.00e352.00) (136.00e388.00) (167.00e319.00) HDL 51.00 59.50 0.423 50.00 43.00 0.097 (29.00e78.00) (27.00e71.00) (34.00e79.00) (31.00e61.00) LDL 138.80 119.60 0.726 145.00 139.00 0.824 (44.00e359.00) (85.00e259.00) (50.00e284.00) (107.00e236.00) Triglycerides 133.00 110.50 0.516 117.00 88.00 0.565 (48.00e351.00) (45.00e307.00) (48.00e397.00) (50.00e355.00) *Mann-Whitney U Test (two-tailed). Login to comment
104 Logistic regression results for relationship between HDL at cutoff point 35 mg/dL and obesity, cholesterol, triglycerides, LDL, ABCA1 polymorphisms at R219K and I883M, and gender Variables Odds ratio 95% CI p value* Obesity 0.365 0.027e4.971 0.449 Cholesterol 2.775 1.502e5.129 0.001 Triglycerides 0.817 0.724e0.920 0.001 LDL 0.358 0.192e0.665 0.001 R219K 0.824 0.089e7.622 0.864 I883M 0.634 0.027e14.942 0.777 Gender 1.816 0.173e19.111 0.619 *p value 0.05 or less was considered statistically significant. Login to comment
112 In conclusion, our study showed that the R219K variant allele was associated with low levels of HDL in Thai overweight/obese men compared with their controls. Login to comment
31 Some of these ABCA1 polymorphisms such as R219K (10) and I883M (9) are associated with increased HDL levels. Login to comment
33 Thus, we studied the prevalence of two frequently occurring common variants of the ABCA1 gene, R219K and I883M polymorphisms, and any association between these two polymorphisms and the lipid profiles of Thai overweight/obese subjects. Login to comment
50 R219K (G1051A) The forward primer was 50 -GTATTT TTG CAA GGC TAC CAG TTA CAT TTG ACA A-30 and the reverse primer was 50 -GAT TGG CTT CAG GAT GTC CAT GTT GGA A-30 . Login to comment
61 Obviously, carrier frequency was high, 60e65% for R219K and almost 90% for I883M. Login to comment
63 To determine whether the presence of the mutant allele of the two variants (K allele for R219K and M allele for I883M) affects the HDL levels of overweight/obese subjects compared with the control, the HDL levels of the obese and control groups were compared according to their genotype, as shown in Table 3. Login to comment
66 Bivariate logistic regression was used to test support for the suggestion that the low HDL levels found in overweight/obese men carrying the mutant R219K allele is the result of ABCA1 gene polymorphism. Login to comment
69 Accordingly, most of the overweight and obese men carrying the R219K mutant allele appeared to have HDL !50 mg/dL compared with the control (Figure 1), although they were smaller in number (22 vs. 63). Login to comment
76 Our result was 61.61% in overweight/obese and 66.67% for R219K; for I883M, it was 87.5% and 90.18% for overweight/obese and control, respectively. Login to comment
78 However, this agrees with our result because the carrier frequency of R219K in Japanese is 74.6% (12). Login to comment
89 Frequency of the two ABCA1 SNPs-R219K and I883M-in overweight/obese and control subjects ABCA1 genotype Overweight/obese n (%) Control n (%) Odds ratio (95% CI) p value* R219K n 5 112 n 5 117 219RR 43 39 0.800 0.422 219RK &#fe; KK 57&#fe;12 (61.61%) 65&#fe;13 (66.67%) (0.450e1.430) I883M n 5 112 n 5 112 883II 14 11 0.760 883IM &#fe; MM 47&#fe;51 (87.50%) 57&#fe;44 (90.18%) (0.310e1.890) 0.520 *p value 0.05 or less was considered statistically significant. Login to comment
91 Although several reports have confirmed that the K allele of R219K is associated with a slightly higher HDL concentration (10,15), this is not consistent with our finding in overweight/obese subjects. Login to comment
100 Lipid profiles of noncarriers and carriers of the K allele of the R219K polymorphism in overweight/obese and control subjects by gender Genotype RR RK &#fe; KK Obese Control p value* Obese Control p value* Men n 5 18 n 5 33 n 5 22 n 5 63 Cholesterol 211.00 203.00 0.937 220.50 202.00 0.177 (103.00e374.00) (127.00e284.00) (136.00e276.00) (129.00e279.00) HDL 50.50 44.00 0.206 45.00 50.00 0.006* (31.00e64.00) (28.00e64.00) (33.00e69.00) (33.00e86.00) LDL 133.90 138.20 0.460 129.00 117.40 0.748 (26.00e291.00) (55.00e210.00) (75.00e193.00) (50.00e205.00) Triglycerides 137.50 138.00 0.261 188.50 118.00 0.000 (62.00e269.00) (47.00e269.00) (71.00e342.00) (35.00e327.00) Women n 5 25 n 5 6 n 5 47 n 5 15 Cholesterol 211.00 182.00 0.937 223.00 212.00 0.406 (139.00e427.00) (159.00e352.00) (136.00e388.00) (167.00e319.00) HDL 51.00 59.50 0.423 50.00 43.00 0.097 (29.00e78.00) (27.00e71.00) (34.00e79.00) (31.00e61.00) LDL 138.80 119.60 0.726 145.00 139.00 0.824 (44.00e359.00) (85.00e259.00) (50.00e284.00) (107.00e236.00) Triglycerides 133.00 110.50 0.516 117.00 88.00 0.565 (48.00e351.00) (45.00e307.00) (48.00e397.00) (50.00e355.00) *Mann-Whitney U Test (two-tailed). Login to comment
103 Logistic regression results for relationship between HDL at cutoff point 35 mg/dL and obesity, cholesterol, triglycerides, LDL, ABCA1 polymorphisms at R219K and I883M, and gender Variables Odds ratio 95% CI p value* Obesity 0.365 0.027e4.971 0.449 Cholesterol 2.775 1.502e5.129 0.001 Triglycerides 0.817 0.724e0.920 0.001 LDL 0.358 0.192e0.665 0.001 R219K 0.824 0.089e7.622 0.864 I883M 0.634 0.027e14.942 0.777 Gender 1.816 0.173e19.111 0.619 *p value 0.05 or less was considered statistically significant. Login to comment
111 In conclusion, our study showed that the R219K variant allele was associated with low levels of HDL in Thai overweight/obese men compared with their controls. Login to comment

[hide] Common genetic variation in the ATP-binding casset... Atherosclerosis. 2007 Nov;195(1):e172-80. Epub 2007 Mar 26. Jensen MK, Pai JK, Mukamal KJ, Overvad K, Rimm EB
Common genetic variation in the ATP-binding cassette transporter A1, plasma lipids, and risk of coronary heart disease.
Atherosclerosis. 2007 Nov;195(1):e172-80. Epub 2007 Mar 26., [PMID:17368464]

Abstract [show]
The ATP-binding cassette transporter A-1 (ABCA1) regulates cholesterol efflux from cells and is involved in high-density lipoprotein (HDL) metabolism and atherogenesis. We investigated whether common ABCA1 variants, previously reported to have phenotypic effects in humans, were associated with plasma lipids and CHD in a prospective study of coronary heart disease (CHD) in healthy women. Three polymorphisms in the promoter region (-565C/T, -191G/C, and -17C/G) and two in the coding region (I883M and R1587K) were genotyped in the Nurses' Health Study. During 8 years of follow-up, 249 incident cases of CHD were identified and matched to controls (1:2) on age and smoking. The I883M variant was associated with higher HDL-cholesterol levels among younger women. Nearly complete linkage disequilibrium was observed between -565C/T and -191G/C and their less common alleles predicted a lower risk of CHD (odds ratio of CHD per -191C allele: 0.8; 95% CI, 0.6-1.0). Neither the -17C/G SNP nor the 2 the coding polymorphisms were associated with risk of CHD. The -565C/T and the -191G/C variants were inversely associated with risk of CHD among healthy women, without pronounced effects on plasma lipids.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 Only the R1587K and the -565C/T promoter variant were found associated with apolipoprotein AI levels, the R219K SNP was associated with risk of myocardial infarction, and none of the 16 identified promoter SNPs were significantly associated with risk [7]. Login to comment
166 Moreover, we did not have information on the R219K SNP that has consistently been associated with lower CHD risk previously [7-9]. Login to comment

[hide] Association of genetic variants of ABCA1 with Alzh... Am J Med Genet B Neuropsychiatr Genet. 2007 Oct 5;144B(7):964-8. Rodriguez-Rodriguez E, Mateo I, Llorca J, Sanchez-Quintana C, Infante J, Garcia-Gorostiaga I, Sanchez-Juan P, Berciano J, Combarros O
Association of genetic variants of ABCA1 with Alzheimer's disease risk.
Am J Med Genet B Neuropsychiatr Genet. 2007 Oct 5;144B(7):964-8., [PMID:17510946]

Abstract [show]
ABCA1 plays key roles in cholesterol transport and apolipoprotein E (APOE) metabolism in the brain. To evaluate the relationship between ABCA1 genetic variants and Alzheimer's disease (AD), independently or in concert with the APOE epsilon4 allele, we examined three ABCA1 polymorphisms located in the coding region (R219K, I883M, and R1587K) and two ABCA1 polymorphisms in the promoter region (C-14T and C-477T) in a group of 372 Spanish AD patients and 440 controls. The ABCA1 219K, 883I, 1587R haplotype was significantly associated with AD, conferring a risk of 1.78 (P = 0.007). The ABCA1 C-14T polymorphism modified the risk of AD in an APOE epsilon4 allele-dependent fashion: in APOE epsilon4 carriers, homozygous for the ABCA1 -14T allele had 3.7 times higher risk of developing AD (OR = 13.99) than carriers of the ABCA1 -14CC and CT genotypes (OR = 3.79). These data suggest that the development of AD might be influenced by either a qualitative change of the ABCA1 protein caused by coding region variants (219K, 883I, and 1587R), or by a quantitative change in ABCA1 expression caused by promoter region variant (-14T) in concert with the APOE epsilon4 allele.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 To evaluate the relationship between ABCA1 genetic variants and Alzheimer`s disease (AD), independently or in concert with the APOE e4 allele, we examined three ABCA1 polymorphisms located in the coding region (R219K, I883M, and R1587K) and two ABCA1 polymorphisms in the promoter region (CÀ14T and CÀ477T) in a group of 372 Spanish AD patients and 440 controls. Login to comment
16 We focused on the ABCA1 I883M, R1587K, and R219K variants in the coding region since these give rise to amino acid changes [Singaraja et al., 2003], they are common in European populations [Singaraja et al., 2003], and have been reported to alter the susceptibility to AD [Katzov et al., 2004; Sundar et al., 2006]; in addition, we examined two potentially functional polymorphisms (CÀ14T and CÀ477T) in the promoter region of ABCA1 gene [Hodoglugil et al., 2005; Kyriakou et al., 2005]. Login to comment
35 Genotyping of ABCA1 I883M (rs 4149313), ABCA1 R1587K (rs 2230808), ABCA1 R219K (rs 2230806), ABCA1 CÀ14T (rs 1800977), and ABCA1 CÀ477T (rs 2422493) polymorphisms was performed by a Taq-Man single-nucleotide-polymorphism assay (Applied Biosystems, Warrington, Cheshire, UK) and an ABI PRISM 7000 sequence detection system (Applied Biosystems). Login to comment
43 RESULTS Control groups for ABCA1 I883M (P ¼ 0.16), ABCA1 R1587K (P ¼ 0.47), ABCA1 R219K (P ¼ 0.29), ABCA1 CÀ14T (P ¼ 0.46), and ABCA1 CÀ477T (P ¼ 0.70) polymorphisms were within the range of Hardy-Weinberg equilibrium; the same occurred in case groups for ABCA1 I883M (P ¼ 0.74), ABCA1 R1587K (P ¼ 0.29), ABCA1 R219K (P ¼ 0.82), ABCA1 CÀ14T (P ¼ 0.82), and ABCA1 CÀ477T (P ¼ 0.26). Login to comment
44 As shown in Table I, the distribution of the allele and genotype frequencies of the ABCA1 polymorphisms did not differ significantly between AD and control groups, except for ABCA1 R219K: when compared to 219RR genotype, the 219RK and KK genotypes were associated with AD (age, sex and APOE e4 status-adjusted OR ¼ 1.50; 95% CI ¼ 1.10-2.04; P ¼ 0.009). Login to comment
49 ABCA1 polymorphisms in the coding region were in linkage disequilibrium (LD): I883M and R1587K, D0 ¼ 0.2071, P ¼ 0.033; I883M and R219K, D0 ¼ 0.2616, P < 0.001; R1587K and R219K, D0 ¼ 0.2343, P < 0.001. Login to comment
62 We performed a meta-analysis for ABCA1 R219K polymorphism, and we pooled 10 case-control series [Wollmer et al., 2003; Katzov et al., 2004; Li et al., 2004; Ko¨lsch et al., 2006; Sundar et al., 2006] including the present study; the combined total of 3,162 patients and 2,725 controls from these studies were included in the meta-analysis, and using a random-effects model, the pooled OR (estimated by Der Simonian-Laird method) for AD associated with ABCA1 219RK and KK genotypes was 1.07 (95% CI ¼ 0.95-1.20), showing no association with AD risk. Login to comment
67 Distribution of ABCA1 Polymorphisms in Patients and Controls Stratified by APOE e4 Allele Polymorphism APOE e4 allele carriers APOE e4 allele noncarriers Total sample Patients Controls Patients Controls Patients Controls I883M II 121 (0.63) 47 (0.59) 117 (0.65) 237 (0.66) 238 (0.64) 284 (0.65) IM 64 (0.34) 33 (0.41) 57 (0.31) 110 (0.31) 121 (0.33) 143 (0.33) MM 6 (0.03) 0 (0.00) 7 (0.04) 11 (0.03) 13 (0.03) 11 (0.02) Total 191 80 181 358 372 438 Allele frequency I/M 0.80/0.20 0.79/0.21 0.80/0.20 0.82/0.18 0.80/0.20 0.81/0.19 R1587K RR 109 (0.58) 44 (0.57) 110 (0.63) 228 (0.65) 219 (0.60) 272 (0.64) RK 72 (0.38) 30 (0.39) 62 (0.35) 109 (0.31) 134 (0.36) 139 (0.32) KK 8 (0.04) 3 (0.04) 6 (0.02) 17 (0.04) 14 (0.04) 20 (0.04) Total 189 77 178 354 367 431 Allele frequency R/K 0.77/0.23 0.77/0.23 0.79/0.21 0.80/0.20 0.78/0.22 0.79/0.21 R219K RR 83 (0.43) 40 (0.51) 82 (0.45) 192 (0.54) 165 (0.44) 232 (0.53) RK 82 (0.43) 30 (0.38) 85(0.48) 136 (0.38) 167 (0.45) 166 (0.38) KK 26 (0.14) 9(0.11) 13 (0.07) 29 (0.08) 39 (0.11) 38 (0.09) Total 191 79 180 357 371 436 Allele frequency R/K 0.65/0.35 0.70/0.30 0.69/0.31 0.73/0.27 0.67/0.33 0.72/0.28 CÀ14T CC 81 (0.42) 34 (0.42) 67 (0.37) 147 (0.42) 148 (0.40) 181 (0.42) CT 79 (0.41) 42 (0.53) 96 (0.53) 161 (0.46) 175 (0.47) 203 (0.47) TT 31 (0.17) 4 (0.05) 18 (0.10) 44 (0.12) 49 (0.13) 48 (0.11) Total 191 80 181 352 372 432 Allele frequency C/T 0.63/0.37 0.69/0.31 0.64/0.36 0.65/0.35 0.63/0.37 0.65/0.35 CÀ477T CC 50 (0.26) 19 (0.24) 43 (0.24) 103 (0.29) 93 (0.25) 122 (0.28) CT 88 (0.46) 47 (0.59) 87 (0.48) 177 (0.49) 175 (0.47) 224 (0.51) TT 53 (0.28) 14 (0.17) 51 (0.28) 80 (0.22) 104 (0.28) 94 (0.21) Total 191 80 181 360 372 440 Allele frequency C/T 0.49/0.51 0.53/0.47 0.48/0.52 0.53/0.47 0.49/0.51 0.53/0.47 Figures in parentheses indicate frequencies; P > 0.05 for all comparisons except 219 RK and KK genotypes versus RR: age, sex and APOE e4 status-adjusted OR ¼ 1.50 (95% CI ¼ 1.10-2.04; P ¼ 0.009). Login to comment
76 Similarly, in a family-based association study using a set of Caribbean Hispanics, a possible interaction was found between ABCA1 R1587K and R219K polymorphisms and APOE [Shibata et al., 2006]. Login to comment
81 Distribution of ABCA1 Polymorphisms in Patients and Controls Stratified by Age Groups Polymorphism 72 yearsa >72 yearsa Patients Controls Patients Controls I883M II 123 (0.68) 47 (0.69) 115 (0.61) 237 (0.64) IM 52 (0.28) 18 (0.27) 69 (0.36) 125 (0.34) MM 7 (0.04) 3 (0.04) 6 (0.03) 8 (0.02) Total 182 68 190 370 Allele frequency I/M 0.82/0.18 0.82/0.18 0.79/0.21 0.81/0.19 R1587K RR 101 (0.57) 44 (0.65) 118 (0.63) 228 (0.63) RK 69 (0.39) 21 (0.31) 65 (0.34) 118 (0.32) KK 8 (0.04) 3 (0.04) 6 (0.03) 19 (0.05) Total 178 68 189 365 Allele frequency R/K 0.76/0.24 0.80/0.20 0.80/0.20 0.79/0.21 R219K RR 86 (0.47) 41 (0.60) 79 (0.42) 191 (0.52) RK 74 (0.41) 23 (0.34) 93 (0.49) 143 (0.39) KK 21 (0.12) 4 (0.06) 18 (0.09) 34 (0.09) Total 181 68 190 368 Allele frequency R/K 0.68/0.32 0.77/0.23 0.66/0.34 0.71/0.29 CÀ14T CC 65 (0.36) 31 (0.48) 83 (0.44) 150 (0.41) CT 96 (0.53) 28 (0.43) 79 (0.41) 175 (0.47) TT 21 (0.11) 6 (0.09) 28 (0.15) 43 (0.12) Total 182 65 190 368 Allele frequency C/T 0.62/0.38 0.69/0.31 0.64/0.36 0.65/0.35 CÀ477T CC 42 (0.23) 22 (0.32) 51 (0.27) 100 (0.27) CT 90 (0.49) 33 (0.49) 85 (0.45) 191 (0.51) TT 50 (0.28) 13 (0.19) 54 (0.28) 81 (0.22) Total 182 68 190 372 Allele frequency C/T 0.48/0.52 0.57/0.43 0.49/0.51 0.53/0.47 a Median age at AD onset (72 years) was set as cut-off; figures in parentheses indicate frequencies; P > 0.05 for all comparisons except 219 RK and KK genotypes versus RR: age, sex and APOE (4 status-adjusted OR ¼ 1.90 (95% CI ¼ 0.99-3.64; P ¼ 0.05) in the 72 years subgroup, and adjusted OR ¼ 1.51 (95% CI ¼ 1.02-2.23; P ¼ 0.04) in the >72 years subgroup. Login to comment
83 Odds Ratios for Alzheimer`s Disease Risk According to the Haplotype Frequencies of the ABCA1 Gene Coding Region Polymorphisms Among Patients and Controls R219K I883M R1587K Frequency in AD patients (n ¼ 369) Frequency in controls (n ¼ 435) ORa (95% CI) P* R I R 0.4794 0.5218 1 (reference) K I R 0.1402 0.1100 1.78 (1.17-2.70) 0.0073 R I K 0.0939 0.0995 0.83 (0.52-1.33) 0.43 K I K 0.0887 0.0808 1.27 (0.79-2.05) 0.31 R M R 0.0743 0.0869 0.92 (0.52-1.62) 0.78 K M R 0.0859 0.0701 1.49 (0.92-2.41) 0.11 R M K 0.0238 0.0147 4.85 (0.83-28.49) 0.081 K M K 0.0139 0.0163 1.13 (0.24-5.26) 0.88 a Odds ratios adjusting by age, sex and APOE genotype. Login to comment

[hide] Common coding polymorphisms in the ABCA1 gene and ... Atherosclerosis. 2007 Aug;193(2):458-60. Epub 2006 Oct 27. Nebel A, Croucher PJ, El Mokhtari NE, Flachsbart F, Schreiber S
Common coding polymorphisms in the ABCA1 gene and risk of early-onset coronary heart disease in northern Germany.
Atherosclerosis. 2007 Aug;193(2):458-60. Epub 2006 Oct 27., [PMID:17070530]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 In the present study, we have examined the potential association between the five known coding polymorphisms R219K, V771M, I883M, E1172D and R1587K in the ABCA1 gene and early-onset CHD in a large ethnically homogeneous sample from the northernmost province in Germany. Login to comment
21 Marker R219K showed marginal association (P = 0.066). Login to comment
25 We examined the five known ABCA1 polymorphisms R219K, V771M, I883M, E1172D and R1587K in early-onset 0021-9150/$ - see front matter (c) 2006 Elsevier Ireland Ltd. Login to comment
27 doi:10.1016/j.atherosclerosis.2006.09.022 Letter to the Editor / Atherosclerosis 193 (2007) 458-460 Table 1 Summary association statistics for common ABCA1 coding SNPs in German CHD patients and controls ABCA1 variant MAFa CHD MAFa control Pallele Pgenotype Pcarrier b ORcarrier c 95% CIcarrier d R219K (rs2230806)e 0.265 0.258 0.656 0.582 0.438 1.08 0.89-1.30 V771M (rs2066718)e 0.026 0.034 0.188 0.255 0.222 0.78 0.53-1.16 I883M (rs4149313)e 0.138 0.112 0.023 0.068 0.021 1.31 1.04-1.64 E1172D (hCV25924149)e 0.025 0.025 0.914 0.714 0.983 1.00 0.65-1.55 R1587K (rs2230808)e 0.261 0.234 0.067 0.197 0.097 1.18 0.97-1.42 a MAF, minor allele frequency. Login to comment
31 e R219K, V771M, I883M, E1172D and R1587K were typed using TaqMan® SNP Assays (Applied Biosystems, Foster City, USA). Login to comment
36 However, additional studies have indicated no relevant effects for the I883M genotype on CHD or HDH-C levels [8,10,11]. Login to comment
37 The other four SNPs R219K, V771M, E1172D and R1587K exhibited no clear effects in the German CHD samples investigated here. Login to comment
46 Table 2 Logistic regression analysis for five coding SNPs in the ABCA1 gene in German CHD patients and controls Predictora ORb 95% CIc P Gender 1.05 0.81-1.36 0.721 R219K 1.20 0.99-1.47 0.066 V771M 0.90 0.57-1.41 0.645 I883M 1.28 1.02-1.61 0.034 E1172D 0.78 0.52-1.19 0.253 R1587K 1.10 0.90-1.34 0.361 a Each marker binary classified for carriership of rare allele, gender was included as a predictive variable, logistic regression analysis was performed with the R-package [14]. Login to comment
26 doi:10.1016/j.atherosclerosis.2006.09.022 Letter to the Editor / Atherosclerosis 193 (2007) 458-460 Table 1 Summary association statistics for common ABCA1 coding SNPs in German CHD patients and controls ABCA1 variant MAFa CHD MAFa control Pallele Pgenotype Pcarrier b ORcarrier c 95% CIcarrier d R219K (rs2230806)e 0.265 0.258 0.656 0.582 0.438 1.08 0.89-1.30 V771M (rs2066718)e 0.026 0.034 0.188 0.255 0.222 0.78 0.53-1.16 I883M (rs4149313)e 0.138 0.112 0.023 0.068 0.021 1.31 1.04-1.64 E1172D (hCV25924149)e 0.025 0.025 0.914 0.714 0.983 1.00 0.65-1.55 R1587K (rs2230808)e 0.261 0.234 0.067 0.197 0.097 1.18 0.97-1.42 a MAF, minor allele frequency. Login to comment
30 e R219K, V771M, I883M, E1172D and R1587K were typed using TaqMan&#ae; SNP Assays (Applied Biosystems, Foster City, USA). Login to comment
45 Table 2 Logistic regression analysis for five coding SNPs in the ABCA1 gene in German CHD patients and controls Predictora ORb 95% CIc P Gender 1.05 0.81-1.36 0.721 R219K 1.20 0.99-1.47 0.066 V771M 0.90 0.57-1.41 0.645 I883M 1.28 1.02-1.61 0.034 E1172D 0.78 0.52-1.19 0.253 R1587K 1.10 0.90-1.34 0.361 a Each marker binary classified for carriership of rare allele, gender was included as a predictive variable, logistic regression analysis was performed with the R-package [14]. Login to comment

[hide] Associations between two common polymorphisms in t... Atherosclerosis. 2007 Aug;193(2):352-60. Epub 2006 Aug 1. Benton JL, Ding J, Tsai MY, Shea S, Rotter JI, Burke GL, Post W
Associations between two common polymorphisms in the ABCA1 gene and subclinical atherosclerosis: Multi-Ethnic Study of Atherosclerosis (MESA).
Atherosclerosis. 2007 Aug;193(2):352-60. Epub 2006 Aug 1., [PMID:16879828]

Abstract [show]
OBJECTIVE: ABCA1 controls the first step in reverse cholesterol transport. The potential associations between G1051A (R219K) and -565C/T genetic polymorphisms in the ABCA1 gene, high-density lipoprotein cholesterol (HDL-C) and subclinical cardiovascular disease in the general population remains unclear. We examined these associations in a sample of Multi-Ethnic Study of Atherosclerosis (MESA) participants. METHODS: Nine hundred and sixty-nine MESA participants were genotyped and underwent CT examinations for coronary artery calcification (CAC) and carotid ultrasound examinations for intima media thickness. Genetic association analyses were performed. RESULTS: The AA genotype was associated with a 2.4mg/dl higher HDL-C, adjusting for age, gender, race/ethnicity and clinic site (p=0.04). There was a 28% lower prevalence of CAC (p=0.002) in those with AA genotype that persisted after further adjustment for HDL-C. There were no significant associations between -565C/T genotype and HDL-C. There were trends towards a higher prevalence of CAC in those with CT (PR=1.13, p=0.08) and TT (PR=1.16, p=0.08) genotypes, compared with CC genotype. Neither G1051A nor -565C/T polymorphisms were associated with carotid intima media thickness. CONCLUSION: The AA genotype of the G1051A polymorphism is associated with slightly higher HDL-C and lower prevalence of CAC and thus may protect against subclinical cardiovascular disease. The T allele of -565 C/T polymorphism may increase risk for subclinical cardiovascular disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Atherosclerosis 193 (2007) 352-360 Associations between two common polymorphisms in the ABCA1 gene and subclinical atherosclerosis: Multi-Ethnic Study of Atherosclerosis (MESA) Jeana L. Bentonb, Jingzhong Dingi, Michael Y. Tsaid, Steven Sheae,f, Jerome I. Rotterg, Gregory L. Burkeh, Wendy Posta,c,* a Division of Cardiology, Department of Medicine, The Johns Hopkins University School of Medicine, Blalock 910H, 600 N. Wolfe Street, Baltimore, MD 21287, United States b The Johns Hopkins University School of Medicine, Baltimore, MD, United States c Department of Epidemiology, The Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD, United States d Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, United States e Department of Medicine, Columbia University, New York, NY, United States f Department of Epidemiology, Columbia University, New York, NY, United States g Medical Genetics Institute, Cedars-Sinai Medical Center, Los Angeles, CA, United States h Department of Public Health Sciences, Wake Forest University, Winston-Salem, NC, United States i Department of Internal Medicine/Geriatrics, Wake Forest University, Winston-Salem, NC, United States Received 15 February 2006; received in revised form 9 May 2006; accepted 9 June 2006 Available online 1 August 2006 Abstract Objective: ABCA1 controls the first step in reverse cholesterol transport. The potential associations between G1051A (R219K) and -565C/T genetic polymorphisms in the ABCA1 gene, high-density lipoprotein cholesterol (HDL-C) and subclinical cardiovascular disease in the general population remains unclear. Login to comment
24 Two common SNPs are G1051A (R219K, rs2230806) and -565C/T (previously designated as -477, rs2422493). Login to comment
88 G1051A (R219K) Demographic characteristics, laboratory values and subclinical disease measures for subjects stratified by G1051A genotype are presented in Table 3. Login to comment
25 Two common SNPs are G1051A (R219K, rs2230806) and -565C/T (previously designated as -477, rs2422493). Login to comment
89 G1051A (R219K) Demographic characteristics, laboratory values and subclinical disease measures for subjects stratified by G1051A genotype are presented in Table 3. Login to comment

[hide] Genetic determinants of HDL: monogenic disorders a... Curr Opin Cardiol. 2007 Jul;22(4):344-51. Klos KL, Kullo IJ
Genetic determinants of HDL: monogenic disorders and contributions to variation.
Curr Opin Cardiol. 2007 Jul;22(4):344-51., [PMID:17556888]

Abstract [show]
PURPOSE OF REVIEW: This review focuses on recent progress towards the characterization of genetic variations that contribute to interindividual variation in plasma high-density lipoprotein cholesterol levels in the general population. RECENT FINDINGS: Many of the genes that harbor rare mutations leading to extreme high-density lipoprotein cholesterol levels contain common variation that influences plasma high-density lipoprotein cholesterol in several study populations. Candidate gene association studies provide evidence that some of these variations have an effect on high-density lipoprotein cholesterol, dependent on epistatic interactions or environmental context. Both rare and common variations contribute to interindividual high-density lipoprotein cholesterol variation. Recent comparisons of candidate gene sequences between individuals in the tails of the high-density lipoprotein cholesterol distributions (the upper or lower 1-5%) of several study populations indicate that as many as 20% of individuals with low high-density lipoprotein cholesterol harbor a rare mutation in an investigated gene. For example, the ABCA1 gene region harbors rare mutations and common variants that contribute to interindividual high-density lipoprotein cholesterol variation in the general population. SUMMARY: The genetic control of high-density lipoprotein cholesterol level is complex. Maximizing the utility of genetic knowledge for predicting an individual's high-density lipoprotein cholesterol level or response to intervention will require a better understanding of the action of combinations of genetic variants and environmental exposures.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Increased HDL-C in rare allele carriers of the ABCA1 R219K polymorphism have now been reported for several samples of European extraction [28,29 ] and most recently in the Multi-Ethnic Study of Atherosclerosis (MESA) [30 ]. Login to comment
65 For other samples, a lack of association between HDL-C and R219K has been reported (e.g. [31,32 ]). Login to comment
66 Interestingly, haplotype analysis in a sample of healthy Pakistani people revealed that the effect of a V825L polymorphism in ABCA1 on HDL-C was dependent on allelic state at R219K [32 ] and, in Turkish people, an effect of R219K on HDL-C was only seen when in combination with the I883M polymorphism [33]. Login to comment
81 Sequence analyses, most notably of the ABCA1 region, suggest that both common variants and rare mutations contribute to interindividual variation in Genetic determinants of HDL Klos and Kullo 347 Table1Commonpolymorphisms(minorallelefrequency>5%)reportedtobeassociatedwithplasmaHDL-Cinmorethanonestudy;thereporteddirectionofeffectoftheless commonallele,andtheircontributionstocovariate-adjustedHDL-Cvariationaloneandincombinationwithotherpolymorphismsofthesamegene GenesymbolGenenamePolymorphismEffecta Single-sitevariationMultisitevariation ABCA1ATP-bindingcassette,sub-familyA (ABC1),member1 596G>A"HDL-C[52,53]4%[52] R219K"HDL-C[28,29 ,30 ]6%[54] V771M"HDL-C[30 ,33] V825I/V825L"HDL-C[30 ];#HDL-C[32 ] APOA5ApolipoproteinA-VÀ1131T>C#HDL-C[55-57] APOC3ApolipoproteinC-III482C>T#HDL-C[55,58 ]0.2-1.4%[58 ]1-6%[58 ,59] SstIS2allelewith#HDL-C[60,61] APOEApolipoproteinEÀ219G>T#HDL-C[27 ,62] e2/e3/e40.8-6.5%[63,64 ]8.3-15.3%[65] ARAndrogenreceptorEx1CAGrepeat"HDL-Cwithlength[66] CETPCholesterol-estertransferproteinÀ1946VNTR"HDL-Cwiththeshortallele[36,67] À629C>A"HDL-C[36,38,39,67-69]4.6-5.2%[39,64 ]5.5-9.8%[39,68] Taq1B"HDL-C[35]3.9%[39]5.5-15%[39,54] MspIin8#HDL-C[36,67] A373P/R451Q#HDL-C[67,68]8%[70] I405V"HDL-C[35] LIPCHepaticlipaseÀ514C>T"HDL-C[45]Upto31%[54] À250G>A"HDL-C[41,43]4.7%[67] LIPGEndotheliallipaseT111I"HDL-C[72,73 ];#HDL-C[74] LPLLipoproteinlipaseHindIII#HDL-CwiththeHþallele[49,75] N291S#HDL-C[50 ] S447X"HDL-C[48,75]0.8%[64 ]3%[35] PON1Paraoxonase1À107T>C"HDL-C[76-78] Q192R"HDL-C[77,79 ];#HDL-C[79 ] PPARDPeroxisomeproliferatorsactivatedreceptordelta294T>C#HDL-C[80] PPARGPeroxisomeproliferatorsactivatedreceptorgammaPro12Ala"HDL-C[81,82] SCARB1ScavengerreceptorclassB,member1A350A"HDL-C[64 ,83]1.3%[64 ] IVS5/A350A(/IVS10)haplotype#HDL-C[84 ] a Citationsrepresentaselectionofavailablestudiesprioritizedbasedonmeta-analysesofassociationresultsinnumerousstudygroups,andrecentstudiescontainingcomprehensivereviewsofpreviously reportedassociations. Login to comment

[hide] Functional polymorphism in ABCA1 influences age of... Hum Mol Genet. 2007 Jun 15;16(12):1412-22. Epub 2007 Apr 5. Kyriakou T, Pontefract DE, Viturro E, Hodgkinson CP, Laxton RC, Bogari N, Cooper G, Davies M, Giblett J, Day IN, Simpson IA, Albrecht C, Ye S
Functional polymorphism in ABCA1 influences age of symptom onset in coronary artery disease patients.
Hum Mol Genet. 2007 Jun 15;16(12):1412-22. Epub 2007 Apr 5., [PMID:17412755]

Abstract [show]
ATP-binding-cassette-transporter-A1 (ABCA1) plays a pivotal role in intracellular cholesterol removal, exerting a protective effect against atherosclerosis. ABCA1 gene severe mutations underlie Tangier disease, a rare Mendelian disorder that can lead to premature coronary artery disease (CAD), with age of CAD onset being two decades earlier in mutant homozygotes and one decade earlier in heterozygotes than in mutation non-carriers. It is unknown whether common polymorphisms in ABCA1 could influence age of symptom onset of CAD in the general population. We examined common promoter and non-synonymous coding polymorphisms in relation to age of symptom onset in a group of CAD patients (n = 1164), and also carried out in vitro assays to test effects of the promoter variations on ABCA1 promoter transcriptional activity and effects of the coding variations on ABCA1 function in mediating cellular cholesterol efflux. Age of symptom onset was found to be associated with the promoter - 407G > C polymorphism, being 2.82 years higher in C allele homozygotes than in G allele homozygotes and intermediate in heterozygotes (61.54, 59.79 and 58.72 years, respectively; P = 0.002). In agreement, patients carrying ABCA1 haplotypes containing the -407C allele had higher age of symptom onset. Patients of the G/G or G/C genotype of the -407G > C polymorphism had significant coronary artery stenosis (>75%) at a younger age than those of the C/C genotype (P = 0.003). Reporter gene assays showed that ABCA1 haplotypes bearing the -407C allele had higher promoter activity than haplotypes with the -407G allele. Functional analyses of the coding polymorphisms showed an effect of the V825I substitution on ABCA1 function, with the 825I variant having higher activity in mediating cholesterol efflux than the wild-type (825V). A trend towards higher symptom onset age in 825I allele carriers was observed. The data indicate an influence of common ABCA1 functional polymorphisms on age of symptom onset in CAD patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Coefficients (D 0 ) of pair-wise linkage disequilibrium between ABCA1 SNPs 21801 21652 21506 21395 21252 21217 21034 2940 2803 2565 2407 2302 2278 299 214 R219K V825I I883M 21652A.G 20.97 Ã 21506G.C 20.97 Ã 20.86 Ã 21395C.T 0.94 Ã 20.94 Ã 20.91 Ã 21252G.A 20.90 Ã 0.89 Ã 20.64 † 20.95 Ã 21217C.T 21.00 Ã 0.96 Ã 20.94 Ã 20.97 Ã 20.91 † 21034ATins/del 20.91 Ã 20.90 Ã 0.89 Ã 20.94 Ã 20.80 Ã 20.94 Ã 2940T.G 20.95 Ã 0.40 Ã 0.90 Ã 20.95 Ã 20.79 Ã 0.96 Ã 0.84 Ã 2803G.A 0.93 Ã 20.91 Ã 20.95 Ã 0.96 Ã 20.83 † 21.00 Ã 20.95 Ã 20.98 Ã 2565C.T 20.95 Ã 20.42 Ã 0.71 Ã 20.97 Ã 20.81 Ã 1.00 Ã 0.74 Ã 0.92 Ã 20.98 Ã 2407G.C 20.87 Ã 0.39 Ã 0.71 Ã 20.86 Ã 20.74 Ã 0.88 Ã 0.73 Ã 0.86 Ã 20.95 Ã 0.92 Ã 2302C.T 20.85 Ã 20.90 Ã 0.87 Ã 20.88 Ã 20.77 Ã 20.87 Ã 0.90 Ã 0.84 Ã 20.89 Ã 0.94 Ã 0.98 Ã 2278G.C 20.94 Ã 0.41 Ã 0.72 Ã 20.94 Ã 20.83 Ã 0.96 Ã 0.77 Ã 0.93 Ã 20.98 Ã 0.99 Ã 0.91 Ã 0.92 Ã 299G.C 0.79 Ã 20.81 Ã 20.84 Ã 0.82 Ã 20.96 Ã 20.88 Ã 20.80 Ã 20.82 Ã 20.96 Ã 20.85 Ã 20.75 Ã 20.88 Ã 20.85 Ã 214C.T 20.93 Ã 0.10 † 0.78 Ã 20.94 Ã 20.81 Ã 20.89 Ã 0.77 Ã 0.91 Ã 21.00 Ã 0.98 Ã 0.90 Ã 0.84 Ã 0.98 Ã 20.86 Ã R219K 0.14 † 20.17 † 20.18 ‡ 0.14 † 20.62 Ã 0.01 ‡ 20.16 ‡ 0.00 ‡ 0.09 ‡ 20.11 † 0.10 ‡ 20.17 ‡ 0.11 ‡ 0.04 ‡ 0.05 ‡ V825I 20.03 ‡ 20.39 † 0.14 † 0.19 ‡ 20.35 ‡ 20.62 ‡ 0.17 † 20.06 ‡ 0.02 ‡ 0.12 ‡ 0.15 ‡ 0.03 ‡ 20.12 ‡ 0.09 ‡ 0.04 ‡ 20.88 Ã I883M 0.08 ‡ 20.38 † 0.09 † 0.05 ‡ 20.24 ‡ 20.18 ‡ 0.11 † 0.02 ‡ 20.05 ‡ 0.04 ‡ 20.04 ‡ 0.04 ‡ 0.02 ‡ 20.12 ‡ 0.01 ‡ 0.25 Ã 0.81 Ã R1587K 0.00 ‡ 0.03 ‡ 20.04 ‡ 20.05 ‡ 0.06 ‡ 0.00 ‡ 0.01 ‡ 20.04 ‡ 20.08 ‡ 20.07 ‡ 20.08 ‡ 20.08 † 20.06 ‡ 0.01 ‡ 20.03 ‡ 0.14 † 20.27 ‡ 20.01 ‡ Ã P , 0.001. Login to comment
95 A G/G 59.94 (9.79), 708 0.57 299G.C (rs2740483) G/G 60.41 (9.90), 505 0.12 G/A 59.80 (9.88), 180 G/C 59.41 (9.68), 363 A/A 57.80 (8.82), 15 C/C 59.18 (9.35), 78 21217C.T (rs10991420) C/C 59.47 (9.82), 769 0.05 214C.T (rs1800977) C/C 59.80 (9.69), 460 0.54 C/T 61.11 (9.48), 209 C/T 59.74 (9.80), 401 T/T 59.82 (11.39), 11 T/T 60.68 (10.5), 113 21034ATins/del (rs34669957) AT/AT 59.63 (9.71), 621 0.37 R219K (rs2230806) R/R 60.07 (9.94), 503 0.52 AT/ 2 60.14 (9.73), 350 R/K 59.82 (9.84), 392 2/2 60.49 (11.13), 43 K/K 59.33 (8.81), 78 2940T.G (rs2980083) T/T 59.11 (9.51), 273 0.03 V825I (rs28587567) V/V 59.70 (9.86), 866 0.24 T/G 59.85 (9.68), 430 V/I 60.75 (9.52), 100 G/G 61.07 (9.86), 200 I/I 63.46 (9.07), 4 2803G.A (rs10991419) G/G 59.83 (9.74), 812 0.79 I883M (rs4149313) I/I 60.38 (9.66), 644 0.23 G/A 59.73 (9.91), 192 I/M 59.10 (9.65), 217 A/A 58.94 (10.85), 14 M/M 62.12 (6.36), 19 R1587K (rs2230808) R/R 60.23 (9.95), 496 0.30 R/K 58.90 (9.50), 301 K/K 60.93 (9.12), 41 1416 association was detected between the R219K SNP and plasma level of HDL. Login to comment
119 Plasma HDL levels (mmol/L) according to ABCA1 genotypes Polymorphism Genotype Mean (SD), n P-value Polymorphism Genotype Mean (SD), n P-value 21801C.T (rs2487046) C/C 1.26 (0.31), 93 0.88 2565C.T (rs2422493) C/C 1.25 (0.32), 81 0.78 C/T 1.23 (0.31), 122 C/T 1.24 (0.30), 137 T/T 1.29 (0.33), 40 T/T 1.23 (0.28), 54 21652A.G (rs10124728) A/A 1.22 (0.29), 99 0.37 2407G.C (rs2246293) G/G 1.24 (0.32), 76 0.80 A/G 1.25 (0.31), 131 G/C 1.23 (0.30), 123 G/G 1.29 (0.35), 30 C/C 1.24 (0.27), 52 21506G.C (rs2487047) G/G 1.26 (0.33), 156 0.47 2302C.T (rs2246298) C/C 1.26 (0.32), 165 0.67 G/C 1.21 (0.28), 90 C/T 1.21 (0.27), 68 C/C 1.24 (0.29), 14 T/T 1.27 (0.26), 13 21395C.T (rs2487048) C/C 1.26 (0.31), 96 0.83 2278G.C (rs1800976) G/G 1.25 (0.32), 80 0.79 C/T 1.22 (0.29), 115 G/C 1.24 (0.30), 126 T/T 1.26 (0.32), 45 C/C 1.23 (0.28), 51 21252G.A G/G 1.23 (0.29), 193 0.13 299G.C (rs2740483) G/G 1.25 (0.29), 139 0.83 G/A 1.27 (0.29), 44 G/C 1.23 (0.31), 93 A/A 1.27 (0.34), 7 C/C 1.30 (0.28), 21 21217C.T (rs10991420) C/C 1.25 (0.32), 202 0.64 214C.T (rs1800977) C/C 1.25 (0.31), 126 0.59 C/T 1.23 (0.28), 56 C/T 1.25 (0.32), 99 T/T 0.97 (2), 1 T/T 1.20 (0.23), 30 21034ATins/del (rs34669957) AT/AT 1.27 (0.33), 157 0.36 R219K (rs2230806) R/R 1.26 (0.30), 129 0.58 AT/ 2 1.21 (0.26), 89 R/K 1.23 (0.30), 104 2/2 1.24 (0.29), 14 K/K 1.25 (0.34), 18 2940T.G (rs2980083) T/T 1.24 (0.32), 70 0.77 V825I (rs28587567) V/V 1.23 (0.30), 232 0.01 T/G 1.24 (0.31), 117 V/I 1.34 (0.31), 26 G/G 1.22 (0.29), 53 I/I 1.54 (0.07), 3 2803G.A (rs10991419) G/G 1.26 (0.31), 208 0.40 I883M (rs4149313) I/I 1.20 (0.27), 172 0.0004 G/A 1.20 (0.28), 51 I/M 1.39 (0.36), 56 A/A 1.32 (0.47), 4 M/M 1.34 (0.34), 9 R1587K (rs2230808) R/R 1.27 (0.31), 142 0.39 R/K 1.24 (0.30), 84 K/K 1.18 (0.20), 9 Figure 2. Login to comment
126 Single nucleotide polymorphism selection and determination of genotypes The subjects of this study were genotyped for 15 common SNPs in the proximal promoter region, i.e. 21801C.T (rs2487046), 21652A.G (rs10124728), 21506G.C (rs2487047), 21395C.T (rs2487048), 21252G.A (rs number unavailable), 21217C.T (rs10991420), 21034A Tins/del (rs34669957), 2940T.G (rs2980083), 2803G.A (rs10991419), 2565C.T (rs2422493), 2407G.C (rs2246293), 2302C.T (rs2246298), 2278G.C (rs1800976), 299G.C (rs2740483) and 214C.T (rs1800977), respectively, and four common non-synonymous SNPs, i.e. R219K (rs2230806), V825I (rs28587567), I883M (rs4149313) and R1587K (rs2230808) (Fig. 1). Login to comment
76 Coefficients (D 0 ) of pair-wise linkage disequilibrium between ABCA1 SNPs 21801 21652 21506 21395 21252 21217 21034 2940 2803 2565 2407 2302 2278 299 214 R219K V825I I883M 21652A.G 20.97 21506G.C 20.97 20.86 21395C.T 0.94 20.94 20.91 21252G.A 20.90 0.89 20.64 ߤ 20.95 21217C.T 21.00 0.96 20.94 20.97 20.91 ߤ 21034ATins/del 20.91 20.90 0.89 20.94 20.80 20.94 2940T.G 20.95 0.40 0.90 20.95 20.79 0.96 0.84 2803G.A 0.93 20.91 20.95 0.96 20.83 ߤ 21.00 20.95 20.98 2565C.T 20.95 20.42 0.71 20.97 20.81 1.00 0.74 0.92 20.98 2407G.C 20.87 0.39 0.71 20.86 20.74 0.88 0.73 0.86 20.95 0.92 2302C.T 20.85 20.90 0.87 20.88 20.77 20.87 0.90 0.84 20.89 0.94 0.98 2278G.C 20.94 0.41 0.72 20.94 20.83 0.96 0.77 0.93 20.98 0.99 0.91 0.92 299G.C 0.79 20.81 20.84 0.82 20.96 20.88 20.80 20.82 20.96 20.85 20.75 20.88 20.85 214C.T 20.93 0.10 ߤ 0.78 20.94 20.81 20.89 0.77 0.91 21.00 0.98 0.90 0.84 0.98 20.86 R219K 0.14 ߤ 20.17 ߤ 20.18 ߥ 0.14 ߤ 20.62 0.01 ߥ 20.16 ߥ 0.00 ߥ 0.09 ߥ 20.11 ߤ 0.10 ߥ 20.17 ߥ 0.11 ߥ 0.04 ߥ 0.05 ߥ V825I 20.03 ߥ 20.39 ߤ 0.14 ߤ 0.19 ߥ 20.35 ߥ 20.62 ߥ 0.17 ߤ 20.06 ߥ 0.02 ߥ 0.12 ߥ 0.15 ߥ 0.03 ߥ 20.12 ߥ 0.09 ߥ 0.04 ߥ 20.88 I883M 0.08 ߥ 20.38 ߤ 0.09 ߤ 0.05 ߥ 20.24 ߥ 20.18 ߥ 0.11 ߤ 0.02 ߥ 20.05 ߥ 0.04 ߥ 20.04 ߥ 0.04 ߥ 0.02 ߥ 20.12 ߥ 0.01 ߥ 0.25 0.81 R1587K 0.00 ߥ 0.03 ߥ 20.04 ߥ 20.05 ߥ 0.06 ߥ 0.00 ߥ 0.01 ߥ 20.04 ߥ 20.08 ߥ 20.07 ߥ 20.08 ߥ 20.08 ߤ 20.06 ߥ 0.01 ߥ 20.03 ߥ 0.14 ߤ 20.27 ߥ 20.01 ߥ P , 0.001. Login to comment
96 A G/G 59.94 (9.79), 708 0.57 299G.C (rs2740483) G/G 60.41 (9.90), 505 0.12 G/A 59.80 (9.88), 180 G/C 59.41 (9.68), 363 A/A 57.80 (8.82), 15 C/C 59.18 (9.35), 78 21217C.T (rs10991420) C/C 59.47 (9.82), 769 0.05 214C.T (rs1800977) C/C 59.80 (9.69), 460 0.54 C/T 61.11 (9.48), 209 C/T 59.74 (9.80), 401 T/T 59.82 (11.39), 11 T/T 60.68 (10.5), 113 21034ATins/del (rs34669957) AT/AT 59.63 (9.71), 621 0.37 R219K (rs2230806) R/R 60.07 (9.94), 503 0.52 AT/ 2 60.14 (9.73), 350 R/K 59.82 (9.84), 392 2/2 60.49 (11.13), 43 K/K 59.33 (8.81), 78 2940T.G (rs2980083) T/T 59.11 (9.51), 273 0.03 V825I (rs28587567) V/V 59.70 (9.86), 866 0.24 T/G 59.85 (9.68), 430 V/I 60.75 (9.52), 100 G/G 61.07 (9.86), 200 I/I 63.46 (9.07), 4 2803G.A (rs10991419) G/G 59.83 (9.74), 812 0.79 I883M (rs4149313) I/I 60.38 (9.66), 644 0.23 G/A 59.73 (9.91), 192 I/M 59.10 (9.65), 217 A/A 58.94 (10.85), 14 M/M 62.12 (6.36), 19 R1587K (rs2230808) R/R 60.23 (9.95), 496 0.30 R/K 58.90 (9.50), 301 K/K 60.93 (9.12), 41 association was detected between the R219K SNP and plasma level of HDL. Login to comment
120 Plasma HDL levels (mmol/L) according to ABCA1 genotypes Polymorphism Genotype Mean (SD), n P-value Polymorphism Genotype Mean (SD), n P-value 21801C.T (rs2487046) C/C 1.26 (0.31), 93 0.88 2565C.T (rs2422493) C/C 1.25 (0.32), 81 0.78 C/T 1.23 (0.31), 122 C/T 1.24 (0.30), 137 T/T 1.29 (0.33), 40 T/T 1.23 (0.28), 54 21652A.G (rs10124728) A/A 1.22 (0.29), 99 0.37 2407G.C (rs2246293) G/G 1.24 (0.32), 76 0.80 A/G 1.25 (0.31), 131 G/C 1.23 (0.30), 123 G/G 1.29 (0.35), 30 C/C 1.24 (0.27), 52 21506G.C (rs2487047) G/G 1.26 (0.33), 156 0.47 2302C.T (rs2246298) C/C 1.26 (0.32), 165 0.67 G/C 1.21 (0.28), 90 C/T 1.21 (0.27), 68 C/C 1.24 (0.29), 14 T/T 1.27 (0.26), 13 21395C.T (rs2487048) C/C 1.26 (0.31), 96 0.83 2278G.C (rs1800976) G/G 1.25 (0.32), 80 0.79 C/T 1.22 (0.29), 115 G/C 1.24 (0.30), 126 T/T 1.26 (0.32), 45 C/C 1.23 (0.28), 51 21252G.A G/G 1.23 (0.29), 193 0.13 299G.C (rs2740483) G/G 1.25 (0.29), 139 0.83 G/A 1.27 (0.29), 44 G/C 1.23 (0.31), 93 A/A 1.27 (0.34), 7 C/C 1.30 (0.28), 21 21217C.T (rs10991420) C/C 1.25 (0.32), 202 0.64 214C.T (rs1800977) C/C 1.25 (0.31), 126 0.59 C/T 1.23 (0.28), 56 C/T 1.25 (0.32), 99 T/T 0.97 (2), 1 T/T 1.20 (0.23), 30 21034ATins/del (rs34669957) AT/AT 1.27 (0.33), 157 0.36 R219K (rs2230806) R/R 1.26 (0.30), 129 0.58 AT/ 2 1.21 (0.26), 89 R/K 1.23 (0.30), 104 2/2 1.24 (0.29), 14 K/K 1.25 (0.34), 18 2940T.G (rs2980083) T/T 1.24 (0.32), 70 0.77 V825I (rs28587567) V/V 1.23 (0.30), 232 0.01 T/G 1.24 (0.31), 117 V/I 1.34 (0.31), 26 G/G 1.22 (0.29), 53 I/I 1.54 (0.07), 3 2803G.A (rs10991419) G/G 1.26 (0.31), 208 0.40 I883M (rs4149313) I/I 1.20 (0.27), 172 0.0004 G/A 1.20 (0.28), 51 I/M 1.39 (0.36), 56 A/A 1.32 (0.47), 4 M/M 1.34 (0.34), 9 R1587K (rs2230808) R/R 1.27 (0.31), 142 0.39 R/K 1.24 (0.30), 84 K/K 1.18 (0.20), 9 Figure 2. Login to comment
127 Single nucleotide polymorphism selection and determination of genotypes The subjects of this study were genotyped for 15 common SNPs in the proximal promoter region, i.e. 21801C.T (rs2487046), 21652A.G (rs10124728), 21506G.C (rs2487047), 21395C.T (rs2487048), 21252G.A (rs number unavailable), 21217C.T (rs10991420), 21034A Tins/del (rs34669957), 2940T.G (rs2980083), 2803G.A (rs10991419), 2565C.T (rs2422493), 2407G.C (rs2246293), 2302C.T (rs2246298), 2278G.C (rs1800976), 299G.C (rs2740483) and 214C.T (rs1800977), respectively, and four common non-synonymous SNPs, i.e. R219K (rs2230806), V825I (rs28587567), I883M (rs4149313) and R1587K (rs2230808) (Fig. 1). Login to comment

[hide] The effect of ABCA1 gene polymorphisms on ischaemi... BMC Med Genet. 2007 Jun 6;8:30. Pasdar A, Yadegarfar G, Cumming A, Whalley L, St Clair D, MacLeod MJ
The effect of ABCA1 gene polymorphisms on ischaemic stroke risk and relationship with lipid profile.
BMC Med Genet. 2007 Jun 6;8:30., [PMID:17553166]

Abstract [show]
BACKGROUND: Ischaemic stroke is a common disorder with genetic and environmental components contributing to overall risk. Atherothromboembolic abnormalities, which play a crucial role in the pathogenesis of ischaemic stroke, are often the end result of dysregulation of lipid metabolism. The ATP Binding Cassette Transporter (ABCA1) is a key gene involved in lipid metabolism. It encodes the cholesterol regulatory efflux protein which mediates the transfer of cellular phospholipids and cholesterol to acceptor apolipoproteins such as apolipoprotein A-I (ApoA-I). Common polymorphisms in this gene affect High Density Lipoprotein Cholesterol (HDL-C) and Apolipoprotein A-I levels and so influence the risk of atherosclerosis. This study has assessed the distribution of ABCA1 polymorphisms and haplotype arrangements in patients with ischaemic stroke and compared them to an appropriate control group. It also examined the relationship of these polymorphisms with serum lipid profiles in cases and controls. METHODS: We studied four common polymorphisms in ABCA1 gene: G/A-L158L, G/A-R219K, G/A-G316G and G/A-R1587K in 400 Caucasian ischaemic stroke patients and 487 controls. Dynamic Allele Specific Hybridisation (DASH) was used as the genotyping assay. RESULTS: Genotype and allele frequencies of all polymorphisms were similar in cases and controls, except for a modest difference in the ABCA1 R219K allele frequency (P-value = 0.05). Using the PHASE2 program, haplotype frequencies for the four loci (158, 219, 316, and 1587) were estimated in cases and controls. There was no significant difference in overall haplotypes arrangement in patients group compared to controls (p = 0.27). 2211 and 1211 haplotypes (1 = common allele, 2 = rare allele) were more frequent in cases (p = 0.05). Adjusted ORs indicated 40% and 46% excess risk of stroke for these haplotypes respectively. However, none of the adjusted ORs were statistically significant. Individuals who had R219K "22" genotype had a higher LDL level (p = 0.001). CONCLUSION: Our study does not support a major role for the ABCA1 gene as a risk factor for ischaemic stroke. Some haplotypes may confer a minor amount of increased risk or protection. Polymorphisms in this gene may influence serum lipid profile.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Methods: We studied four common polymorphisms in ABCA1 gene: G/A-L158L, G/A-R219K, G/ A-G316G and G/A-R1587K in 400 Caucasian ischaemic stroke patients and 487 controls. Login to comment
9 Results: Genotype and allele frequencies of all polymorphisms were similar in cases and controls, except for a modest difference in the ABCA1 R219K allele frequency (P-value = 0.05). Login to comment
14 Individuals who had R219K "22" genotype had a higher LDL level (p = 0.001). Login to comment
33 The only published study in ischaemic stroke on 244 Hungarian patients [25] suggests a protective role for the ABCA1-R219K and V771M polymorphisms. Login to comment
46 We used different sets of primers for each SNP as follows: 1- ABCA1-rs2230805 (G/A; L158L); designated as [ABCA1-6] ABCA1-2230805F: 5'-biotin-TAGACTTTGGGAGAGA- GAGGTTGT-3' ABCA1-2230805R: 5'-AATGAAACCTTCTCTGGGTTCC-3' 2- ABCA1-rs2234884 (G1051A; R219K); designated as [ABCA1-3] ABCA1-2234884F: 5'-biotin-AATTTCTGAGCTTTGT- GGACTA-3' ABCA1-2234884R: 5'-GCTCTGCTGCAGTCATTTTCTC-3' 3- ABCA1-rs2246841 (G888A; G316G); designated as [ABCA1-5] ABCA1-2246841F: 5'-biotin-TACCAGTTGAGAGACTT- GATCTTC-3' ABCA1-2246841R: 5'-TCTCGTATTGTCTGTGGGCATC-3' 4- ABCA1-rs1997618 (c/t, T1555I) ABCA1-1997618F: 5'-biotin-CCGAGTCAAGAAGTTAAT- GATGC-3' ABCA1-1997618R: 5'-GCTTTAGGTGTTTCTTCATTT- GTTT-3' 5- ABCA1-rs2234886 (G5155A; R1587K); designated as [ABCA1-4] ABCA1-2234886F: 5'-biotin-CAGCGGTTTACCTTGACAT- TATT-3' ABCA1-2234886R: 5'-GAAGATTTATGACAGGACT- GGACAC-3' 6- ABCA1-rs1883024 (c/t, P1648L) ABCA1-1883024F: 5'-biotin-TATACA- GACACAGCCACACTTA-3' ABCA1-1883024R: 5'-ATCTCACCAAGCAGCAGTTCTC-3' Of the six ABCA1 SNPs, only four SNPs (G/A-L158L, G/A-R219K, G/A-G316G and G/A-R1587K) were polymorphic in the Scottish population. Login to comment
60 Haplotype frequencies for the four loci (G/A-L158L, G/A-R219K, G/A-G316G and G/A-R1587K) were estimated for cases and controls, using PHASE Ver.2.11 [28]. Login to comment
63 ABCA1-3 (G1051A; R219K) "G" allele frequency (R variant) was 68.2% in cases and 73.2% in controls (p = 0.05; OR = 0.79, 95%CI: 0.62-1.00), ABCA1-5 (G/A; G316G) "G" allele frequency (G variant) was 88% in cases and 86.7% in controls (p = 0.42; OR = 1.13, 95%CI: 0.84-1.52); ABCA1-4 (G5155A; R1587K) "G" allele frequency (R variant) was 77.4% in cases and 75.9% in controls (p = 0.47; OR = 1.09, 95%CI: 0.86-1.37). Login to comment
65 In addition to a trend to lower ABCA1-3 (G1051A; R219K) "G" allele frequency in all cases (p = 0.05), especially in males (p = 0.04), the "22" genotype was higher in LVD cases (p = 0.04) and also in patients over 65 years (p Table 2: Different stroke subtypes based on TOAST classification Subtype All Stroke Samples Number % Large Vessel Disease (LVD) 141 35.3% Small Vessel Disease (SVD) 98 24.5% Cardioembolic 76 19% Other/Unclear 85 21.3% Hemorrhagic Stroke 0 0 TOTAL 400 100% Table 1: Specifications of cases and controls Cases (n = 400) Controls (n = 487) Mean age (± SD)§ 66 (± 11) 64.2(± 12.3) Sex (M:F Ratio)§ 1.4 0.97 Hypertension*§ 41% 18% Diabetes Mellitus**§ 12.2% 3.2% Total Cholesterol mmol/l (Ave., SD)§ 5.6 (± 1.3) 5.8 (± 1.2) HDL mmol/l (Ave., SD)§ 1.2 (± 0.4) 1.4 (± 0.4) LDL mmol/l (Ave., SD) 3.5 (± 1.2) 3.5 (± 1.1) Total Triglyceride mmol/l (Ave., SD) 1.7 (± 1.1) 1.8 (± 1.1) Glucose mmol/l§ 6.4 (± 2.4) 5.9 (± 1.2) * Hypertension defined as blood pressure > 160/90 mmHg or history of hypertension/on hypertensive therapy ** History of diabetes or confirmed laboratory diagnosis §Significant difference (P < 0.05) between cases and controls = 0.01), compared to controls. Login to comment
70 Cases with ABCA1-3 (G1051A; R219K) "22" genotype had a higher LDL level compared to controls which remained significant after Bonferroni correction (p = 0.003). Login to comment
72 However, in this subgroup, females with ABCA1-3 (G1051A; R219K) "11" and ABCA1-4 (G5155A; R1587K) "22" genotypes had a higher level of IDL (p = 0.01 and p = 0.02) respectively. Login to comment
73 Effects of alleles on lipid profile Comparing the lipid profiles in carriers of different ABCA1 alleles revealed that individuals who were the ABCA1-R219K carrier (K allele) had a lower TG level than non carriers (p = 0.005). Login to comment
84 Other works have reported that CAD patients who are carriers of R219K allele had less severe atherosclerosis [31] and overall lower risk of CAD [36]. Login to comment
85 Andrikovics et al recently reported a higher frequency of R219K in controls than in Hungarian stroke patients and suggested a protective role for this polymorphism [25]. Login to comment
89 While the R219K -G1051A- (A or "K" variant) has been associated with decreased TG, increased HDL and subsequently a lower risk for atherosclerotic progression, in contrast the R allele has been associated with vascular disease [31]. Login to comment
90 This has not been confirmed in our study, although in our stroke population those with R219K "22" genotype (AA) had a higher level of LDL and the "K allele" carriers had a lower TG. Login to comment
92 The HDL level showed no significant difference among different R219K genotypes. Login to comment
102 Other studies have shown an association between the R219K polymorphism and MI, but no association between haplotype arrangements and MI. Login to comment
112 Among the studied ABCA1 gene polymorphisms, R219K has the greatest impact on lipid profile especially LDL and TG. Login to comment
59 Haplotype frequencies for the four loci (G/A-L158L, G/A-R219K, G/A-G316G and G/A-R1587K) were estimated for cases and controls, using PHASE Ver.2.11 [28]. Login to comment
62 ABCA1-3 (G1051A; R219K) "G" allele frequency (R variant) was 68.2% in cases and 73.2% in controls (p = 0.05; OR = 0.79, 95%CI: 0.62-1.00), ABCA1-5 (G/A; G316G) "G" allele frequency (G variant) was 88% in cases and 86.7% in controls (p = 0.42; OR = 1.13, 95%CI: 0.84-1.52); ABCA1-4 (G5155A; R1587K) "G" allele frequency (R variant) was 77.4% in cases and 75.9% in controls (p = 0.47; OR = 1.09, 95%CI: 0.86-1.37). Login to comment
64 In addition to a trend to lower ABCA1-3 (G1051A; R219K) "G" allele frequency in all cases (p = 0.05), especially in males (p = 0.04), the "22" genotype was higher in LVD cases (p = 0.04) and also in patients over 65 years (p Table 2: Different stroke subtypes based on TOAST classification Subtype All Stroke Samples Number % Large Vessel Disease (LVD) 141 35.3% Small Vessel Disease (SVD) 98 24.5% Cardioembolic 76 19% Other/Unclear 85 21.3% Hemorrhagic Stroke 0 0 TOTAL 400 100% Table 1: Specifications of cases and controls Cases (n = 400) Controls (n = 487) Mean age (&#b1; SD)&#a7; 66 (&#b1; 11) 64.2(&#b1; 12.3) Sex (M:F Ratio)&#a7; 1.4 0.97 Hypertension*&#a7; 41% 18% Diabetes Mellitus**&#a7; 12.2% 3.2% Total Cholesterol mmol/l (Ave., SD)&#a7; 5.6 (&#b1; 1.3) 5.8 (&#b1; 1.2) HDL mmol/l (Ave., SD)&#a7; 1.2 (&#b1; 0.4) 1.4 (&#b1; 0.4) LDL mmol/l (Ave., SD) 3.5 (&#b1; 1.2) 3.5 (&#b1; 1.1) Total Triglyceride mmol/l (Ave., SD) 1.7 (&#b1; 1.1) 1.8 (&#b1; 1.1) Glucose mmol/l&#a7; 6.4 (&#b1; 2.4) 5.9 (&#b1; 1.2) * Hypertension defined as blood pressure > 160/90 mmHg or history of hypertension/on hypertensive therapy ** History of diabetes or confirmed laboratory diagnosis &#a7;Significant difference (P < 0.05) between cases and controls = 0.01), compared to controls. Login to comment
69 Cases with ABCA1-3 (G1051A; R219K) "22" genotype had a higher LDL level compared to controls which remained significant after Bonferroni correction (p = 0.003). Login to comment
71 However, in this subgroup, females with ABCA1-3 (G1051A; R219K) "11" and ABCA1-4 (G5155A; R1587K) "22" genotypes had a higher level of IDL (p = 0.01 and p = 0.02) respectively. Login to comment
83 Other works have reported that CAD patients who are carriers of R219K allele had less severe atherosclerosis [31] and overall lower risk of CAD [36]. Login to comment
88 While the R219K -G1051A- (A or "K" variant) has been associated with decreased TG, increased HDL and subsequently a lower risk for atherosclerotic progression, in contrast the R allele has been associated with vascular disease [31]. Login to comment
91 The HDL level showed no significant difference among different R219K genotypes. Login to comment
101 Other studies have shown an association between the R219K polymorphism and MI, but no association between haplotype arrangements and MI. Login to comment
111 Among the studied ABCA1 gene polymorphisms, R219K has the greatest impact on lipid profile especially LDL and TG. Login to comment

[hide] Common ABCA1 variants, HDL levels, and cellular ch... J Lipid Res. 2007 Jun;48(6):1409-16. Epub 2007 Mar 19. Soro-Paavonen A, Naukkarinen J, Lee-Rueckert M, Watanabe H, Rantala E, Soderlund S, Hiukka A, Kovanen PT, Jauhiainen M, Peltonen L, Taskinen MR
Common ABCA1 variants, HDL levels, and cellular cholesterol efflux in subjects with familial low HDL.
J Lipid Res. 2007 Jun;48(6):1409-16. Epub 2007 Mar 19., [PMID:17372331]

Abstract [show]
HDL promotes cholesterol efflux from peripheral cells via ABCA1 in the first step of reverse cholesterol transport (RCT). We investigated whether the early steps of RCT were disturbed in subjects with familial low HDL and an increased risk for early atherosclerosis. Cholesterol efflux from monocyte-derived macrophages to lipid-free apolipoprotein A-I (apoA-I; %) was measured in 22 patients with familial low HDL without Tangier disease mutations and in 21 healthy controls. In addition, we defined the different alleles of ABCA1 using single-nucleotide polymorphism haplotypes and measured ABCA1 and ABCG1 mRNA transcript levels in cholesterol-loaded macrophages. Similar ABCA1-mediated cholesterol efflux levels were observed for macrophages derived from control subjects and from low-HDL subjects. However, when efflux of cholesterol was estimated as cholesterol efflux to apoA-I (%)/relative ABCA1 mRNA expression level, cholesterol removal was significantly (P = 0.001) lower in the low-HDL group. Cholesterol-loaded macrophages from low-HDL subjects showed significantly increased levels of ABCA1 mRNA but not of ABCG1 mRNA and were more often carriers of the rare ABCA1 alleles L158 and R219K. These results suggest that defective ABCA1 function in cholesterol-loaded macrophages is one potential contributor to the impaired RCT process and the increased coronary heart disease risk in subjects with familial low HDL.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Cholesterol-loaded macrophages from low-HDL subjects showed significantly increased levels of ABCA1 mRNA but not of ABCG1 mRNA and were more often carriers of the rare ABCA1 alleles L158 and R219K. Login to comment
137 Three SNPs differed significantly between the low-HDL family members and control subjects [L158 (rs2230805), P 5 0.004; R219K (rs2230806), P 5 0.005; and rs2297409, P 5 0.006], so that the rare alleles of each of these SNPs were overrepresented among low-HDL subjects (Table 3). Login to comment
138 The variants L158 and R219K showed significant association with low HDL-C levels (P 5 0.009 and P 5 0.007, respectively), and T1427 showed association with high HDL-C (P 5 0.028). Login to comment
140 We constructed allelic haplotypes of the three SNPs that showed association with either high or low HDL-C levels (L158, R219K, and T1427T) using PHASE version 2.0 software. Login to comment
146 Comparisons of the ABCA1 allele frequencies between 47 low-HDL family members (19 unaffected and 28 affected subjects) and 25 control subjects, and ABCA1 genotype effects on cholesterol efflux, HDL-C, and mean IMT in the pooled study group (n 5 72) Single-Nucleotide Polymorphism Identification Number Amino Acid Residue Allele Frequencies and P Value in Low-HDL Family Members Versus Control Subjectsa HDL-C Pb Mean IMT Pc rs2472459 - NS NS NS rs2246293 - NS NS NS rs2515616 - NS NS NS rs1800978 - NS NS NS rs2740492 - NS NS NS rs3858075 - NS NS NS rs1929842 - NS NS NS rs2230805 L158 (0.45 vs. 0.12) 0.004 0.009 NS rs2230806 R219K (0.40 vs. 0.08) 0.005 0.007 NS rs2487037 - NS NS NS rs2297409 - (0.30 vs. 0.04) 0.006 NS NS rs2066716 T1427 (0.11 vs. 0.32) 0.053 0.003 NS rs2230808 R1587K NS NS NS rs2066881 - NS NS NS rs4149341 - NS NS 0.025 a For statistically significant differences, the corresponding allele frequencies are given in parentheses (in low-HDL family members vs. control subjects), followed by Chi-square P value, with Fisher`s exact test for the differences in allele frequencies between low-HDL family members and control subjects. Login to comment
158 Interestingly, the carrier status of the haplotype containing the R219K variant was not associated with the cholesterol efflux activity, implying that this particular variant does not result in the disturbed function of ABCA1 in macrophages but rather tags the allelic variant related to serum HDL-C level regulation, possibly at the hepatic level. Login to comment
162 The efflux (%) was not changed significantly between carriers and noncarriers of the rare alleles in R219K. Login to comment
191 In turn, in healthy subjects and CHD patients of European 1414 Journal of Lipid Research Volume 48, 2007 atHealthScienceLibraryCB#7585,onSeptember24,2012www.jlr.orgDownloadedfrom 0.DC1.html and French-Canadian origin, the common variant R219K was associated with increased levels of HDL, decreased TGs, and reduced severity of atherosclerosis (42, 43). Login to comment
194 Of these, T1427 gave corresponding results in both data sets, showing association with increased HDL-C. The variant R219K showed association with low serum HDL levels but not with the cholesterol efflux in our study sample. Login to comment
204 In summary, based on our data, we conclude that 1) macrophages derived from Finnish subjects with familial low HDL displayed similar cholesterol-loading capacity but decreased cholesterol efflux to apoA-I via the ABCA1 pathway after loading; 2) familial low HDL in these families is not caused by rare mutations in ABCA1; rather, the common allelic variants are associated with HDL-C levels, as indicated by the dose-dependent contribution of the haplotype carrying the common R219K change in these subjects; and 3) relative ABCA1 mRNA expression in cholesterol-loaded macrophages was increased significantly in the low-HDL group. Login to comment
136 Three SNPs differed significantly between the low-HDL family members and control subjects [L158 (rs2230805), P 5 0.004; R219K (rs2230806), P 5 0.005; and rs2297409, P 5 0.006], so that the rare alleles of each of these SNPs were overrepresented among low-HDL subjects (Table 3). Login to comment
139 We constructed allelic haplotypes of the three SNPs that showed association with either high or low HDL-C levels (L158, R219K, and T1427T) using PHASE version 2.0 software. Login to comment
145 Comparisons of the ABCA1 allele frequencies between 47 low-HDL family members (19 unaffected and 28 affected subjects) and 25 control subjects, and ABCA1 genotype effects on cholesterol efflux, HDL-C, and mean IMT in the pooled study group (n 5 72) Single-Nucleotide Polymorphism Identification Number Amino Acid Residue Allele Frequencies and P Value in Low-HDL Family Members Versus Control Subjectsa HDL-C Pb Mean IMT Pc rs2472459 - NS NS NS rs2246293 - NS NS NS rs2515616 - NS NS NS rs1800978 - NS NS NS rs2740492 - NS NS NS rs3858075 - NS NS NS rs1929842 - NS NS NS rs2230805 L158 (0.45 vs. 0.12) 0.004 0.009 NS rs2230806 R219K (0.40 vs. 0.08) 0.005 0.007 NS rs2487037 - NS NS NS rs2297409 - (0.30 vs. 0.04) 0.006 NS NS rs2066716 T1427 (0.11 vs. 0.32) 0.053 0.003 NS rs2230808 R1587K NS NS NS rs2066881 - NS NS NS rs4149341 - NS NS 0.025 a For statistically significant differences, the corresponding allele frequencies are given in parentheses (in low-HDL family members vs. control subjects), followed by Chi-square P value, with Fisher`s exact test for the differences in allele frequencies between low-HDL family members and control subjects. Login to comment
157 Interestingly, the carrier status of the haplotype containing the R219K variant was not associated with the cholesterol efflux activity, implying that this particular variant does not result in the disturbed function of ABCA1 in macrophages but rather tags the allelic variant related to serum HDL-C level regulation, possibly at the hepatic level. Login to comment
161 The efflux (%) was not changed significantly between carriers and noncarriers of the rare alleles in R219K. Login to comment
190 In turn, in healthy subjects and CHD patients of European 1414 Journal of Lipid Research Volume 48, 2007 at SEMMELWEIS EGYETEM NET KORELET, on December , and French-Canadian origin, the common variant R219K was associated with increased levels of HDL, decreased TGs, and reduced severity of atherosclerosis (42, 43). Login to comment
193 Of these, T1427 gave corresponding results in both data sets, showing association with increased HDL-C. The variant R219K showed association with low serum HDL levels but not with the cholesterol efflux in our study sample. Login to comment
203 In summary, based on our data, we conclude that 1) macrophages derived from Finnish subjects with familial low HDL displayed similar cholesterol-loading capacity but decreased cholesterol efflux to apoA-I via the ABCA1 pathway after loading; 2) familial low HDL in these families is not caused by rare mutations in ABCA1; rather, the common allelic variants are associated with HDL-C levels, as indicated by the dose-dependent contribution of the haplotype carrying the common R219K change in these subjects; and 3) relative ABCA1 mRNA expression in cholesterol-loaded macrophages was increased significantly in the low-HDL group. Login to comment

[hide] Gender-specific association of ATP-binding cassett... Neurobiol Aging. 2007 Jun;28(6):856-62. Epub 2006 May 24. Sundar PD, Feingold E, Minster RL, DeKosky ST, Kamboh MI
Gender-specific association of ATP-binding cassette transporter 1 (ABCA1) polymorphisms with the risk of late-onset Alzheimer's disease.
Neurobiol Aging. 2007 Jun;28(6):856-62. Epub 2006 May 24., [PMID:16725228]

Abstract [show]
Alzheimer's disease (AD) is a multifactorial neurodegenerative disorder caused by a complex interaction of genetic and environmental factors. Increasing evidence highlights a potential role for cholesterol in the pathophysiology of AD. The ABCA1 gene, located in close vicinity to the 9q linkage peaks identified by genome-wide AD linkage studies, plays an important role in cellular cholesterol efflux, and is likely a good candidate gene. However, results from published genetic association studies between ABCA1 and AD are ambiguous. In the present study, we examined the role of two ABCA1 polymorphisms, R219K (rs2230806) and G-17C (rs2740483) in modifying the risk of late-onset AD (LOAD) in a large American white cohort of 992 AD cases and 699 controls. We observed significant gender x R219K interaction (p=0.00008). Female carriers of the 219K allele showed a 1.75-fold increased risk of developing AD compared to non-219K carrier females (95% CI 1.34-2.29; p=0.00004). The overall two-site haplotype distribution was also significant between female AD cases and controls (p=0.017). The risk associated with the R219K polymorphism was independent of the recently reported significant association in the ubiquilin (UBQLN1) gene in this region on chromosome 9q. Our data suggest a gender-specific and APOE and UBQLN1 independent association between the ABCA1/R219K polymorphism and LOAD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 In the present study, we examined the role of two ABCA1 polymorphisms, R219K (rs2230806) and G-17C (rs2740483) in modifying the risk of late-onset AD (LOAD) in a large American white cohort of 992 AD cases and 699 controls. Login to comment
5 We observed significant gender × R219K interaction (p = 0.00008). Login to comment
8 The risk associated with the R219K polymorphism was independent of the recently reported significant association in the ubiquilin (UBQLN1) gene in this region on chromosome 9q. Login to comment
9 Our data suggest a gender-specific and APOE and UBQLN1 independent association between the ABCA1/R219K polymorphism and LOAD. Login to comment
31 In the present case-control association study, we examined the role of two ABCA1 polymorphisms: R219K (rs2230806) located in exon 7 resulting in a G to A nucleotide change at position 1051 and G-17C (rs2740483) located in the promoter region with LOAD risk. Login to comment
32 Previously R219K has been found to be associated with HDL-C levels and coronary artery disease (CAD) risk [5,8] but has shown inconsistent association with AD [17,22,32]. Login to comment
43 The R219K and G-17C genotypes were determined by pyrosequencing on the PSQTM HS 96 system (Biotage, Uppsala, Sweden). Login to comment
44 Duplex pyrosequencing assay was performed using the following PCR (F, R) and sequencing (S) primers for R219K: F-5 -/5Bio/TGCAAGGCTACCAGTT- ACATT-3 ; R-5 -TAGGCTTCAGGATGTCCATGTT-3 ; S-5 -GCAGCCAGTTTCTCC-3 and G-17C: F-5 -CGTG- CTTTCTGCTGAGTGACTG-3 ; R-5 -/5Bio/CGAGCGCA- GAGGTTACTATC-3 ; S-5 -ACAGAGGCCGGGA-3 according to the previously described procedure [7]. Login to comment
53 For the simultaneous analysis of ABCA1 and UBQLN1, we included the ABCA1/R219K SNP and three UBQLN1 SNPs (intron 6 A → C, intron 8 T → C and intron 9 A → G). Login to comment
58 Associations between ABCA1 polymorphisms and late-onset AD We genotyped 1691 subjects for the R219K SNP (992 cases and 699 controls) and 1379 subjects for the G-17C Table 1 Distribution of ABCA1 polymorphisms in American white LOAD cases and controls Genotype Total Female Male AD Controls AD Controls AD Controls n (%) n (%) n (%) n (%) n (%) n (%) R219K RR 489 49.3 374 53.5 306 46.4 249 57.64a 183 55.0 125 46.82b RK 424 42.7 274 39.2 296 44.9 151 35.0 128 38.4 123 46.1 KK 79 8.0 51 7.3 57 8.7 32 7.4 22 6.6 19 7.1 Total 992 699 659 432 333 267 Allele frequency R/K 70.7/29.3 73.1/26.9 68.9/31.1 75.1/24.9c 74.2/25.8 69.9/30.1 G-17C GG 422 50.4 291 53.8 280 50.0 174 52.4 142 51.1 117 56.0 CG 319 38.1 203 37.5 216 38.6 125 37.7 103 37.1 78 37.3 CC 97 11.6 47 8.7 64 11.4 33 9.9 33 11.9 14 6.7 Total 838 541 560 332 278 209 Allele frequency G/C 69.4/30.6 72.6/27.4 69.3/30.7 71.2/28.8 69.6/30.4 74.6/25.4 a Significantly different between female AD cases and controls (RR vs. RK + KK; p = 0.0003). Login to comment
62 The genotype distributions of the R219K polymorphism followed HWE in both AD cases and controls. Login to comment
65 The genotype and allele frequencies for the R219K and G-17C polymorphisms were comparable between AD cases and controls in the total sample (Table 1). Login to comment
67 Since the (gender × R219K) interaction term in the regression model was highly significant (p = 0.00008), we further examined the data stratified by gender. Login to comment
71 To exclude the possibility if the additional 312 individuals that were genotyped for the R219K SNP but not for the G-17C SNP could have impacted the result of the R219K SNP, we reanalyzed the data on 1370 individuals having genotypes for both SNPs. Login to comment
72 The results for the R219K SNP were essentially the same as shown in Table 1. Login to comment
73 Both AD and controls were in HWE for the R219K SNP. Login to comment
76 Estimated haplotypes and late-onset AD risk The R219K and G-17C polymorphisms were not in linkage disequilibrium with each other (D = 0.084; p = 0.43). Login to comment
85 We fit a logistic regression model with the following independent variables: age, Table 2 Estimated haplotype frequencies among American white LOAD cases and controls Subjects Haplotype SNPs Haplotype frequency (%) p-Value R219K G-17C Total AD C Total n = 1370 n = 833 n = 537 1 R C 19.9 20.7 18.7 2 R G 52.0 50.3 54.7 3 K C 9.3 9.8 8.6 4 K G 18.7 19.2 18.0 ln(L) -2524.12 -1554.79 -966.69 0.15a Female n = 884 n = 555 n = 329 1 R C 20.2 20.1 20.3 2 R G 51.7 49.2 55.8 3 K C 9.6 10.5 8.1 4 K G 18.5 20.1 15.8 ln(L) -1636.2 -1042.6 -588.48 0.017a Male n = 486 n = 278 n = 208 1 R C 19.5 21.9 16.0 2 R G 52.6 52.4 53.2 3 K C 8.8 8.5 9.5 4 K G 19.0 17.2 21.3 ln(L) -887.54 -509.96 -374.35 0.09a a Calculated from the T5 statistic: 2[ln(L)case + ln(L)control - ln(L)case + control]; d.f. = 3. gender, APOE*4, ABCA1, UBQLN1 joint genotype at three sites (intron 6, intron 8 and intron 9), gender × ABCA1 interaction, and UBQLN1 × ABCA1 interaction (see Section 2 for precise definitions of these variables). Login to comment
92 Initial stud- Table 3 Logistic regression results for UBQLN1 3-site joint genotypes (Intron 6, Intron 8, Intron 9) and ABCA1/R219K OR 95% CI p-Value Baselinea 1.00 Sex 1.05 0.72-1.53 0.813 APOE*4 carriers 5.00 3.79-6.61 <0.0001 UBQLN1/haplotype H5 carriers 0.22 0.06-0.81 0.023 UBQLN1/one copy of haplotype H4 1.36 1.01-1.82 0.040 UBQLN1/two copies of haplotype H4 6.45 2.05-20.26 0.0014 ABCA1 1.57 1.13-2.19 0.0077 Sex × ABCA1 0.0135 a Female non-APOE*4, ABCA1/RR, UBQLN1/haplotypes non-H4 and H5-UBQLN1 haplotype H4 and haplotype H5 are described in Kamboh et al. [16]. Login to comment
100 In the current study, we examined the role of two ABCA1 polymorphisms, R219K and G-17C, with the risk of AD in a large case-control cohort of American whites. Login to comment
101 We found a significant interaction with the R219K polymorphism and gender (p = 0.00008). Login to comment
103 The R219K association was confirmed in the two-site haplotype analysis, where the overall haplotype distribution was significant in females only (p = 0.017). Login to comment
105 Intriguingly, male AD cases and controls showed an opposite trend in R219K allele and haplotype frequency distribution compared to females. Login to comment
106 The underlying mechanism for the gender-specific differences in frequency and effect on AD risk for the R219K polymorphism in our study is unclear. Login to comment
107 Although both male and female controls in our study appeared to be in HWE for the R219K polymorphism, it needs to be taken into account that theirR219Kfrequenciesmaynotberepresentativeofthegen- eral population at large because this control group selectively included older, non-demented individuals. Login to comment
113 We do not know if different frequencies of the R219K SNP between our older normal males and females represent a survival effect because reported AD case-control studies have not presented gender-stratified genotype data for comparison. Login to comment
114 Most of the earlier studies with the R219K SNP were carried out in relation to CAD risk and with the exception of one study all other studies presented gender-combined data. Login to comment
123 Previous studies have not investigated the gender-specific effect of the R219K polymorphism on AD risk. Login to comment
124 Wollmer et al. [32] did not observe any effect of either the R219K SNP or another ABCA1 SNP, rs2230808 (R1587K), on LOAD risk, but reported a significant association of the 219K allele in delaying the AAO of AD. Login to comment
127 In contrast to our findings, Katzov et al. [17] found a significantly higher frequency of the R219K/KK genotype among 185 Swedish controls compared to 390 LOAD subjects (p = 0.014), however, the controls in their study were not in HWE showing an unusually inflated frequency of the R219K/KK genotype. Login to comment
128 While Li et al. [22] did not observe any effect of R219K on LOAD, the rs2230808 SNP was associated with significant protective effect against LOAD. Login to comment
131 The obvious difference between our study and those reported previously is that we used a very large LOAD case-control cohort from a single geographical location (1691 subjects) that is more than double than the previously reported largest LOAD case-control series of 796 individuals for the R219K SNP [22]. Login to comment
132 Similar to the previous studies, the R219K SNP in our study did not show significant difference between cases and controls in the gender-combined total sample. Login to comment
133 The other difference between our study and other studies is that we analyzed gender-specific effect of the R219K SNP in our large case-control cohort and found opposite association of the same allele in males and females. Login to comment
136 To our knowledge, the functional significance of the R219K SNP has not been evaluated. Login to comment
137 However, a recent study by Katzov et al. [18] has shown that the R219K SNP could affect the Abeta metabolism in an allele-specific manner such that the 219K allele carriers were associated with significantly higher CSF Abeta42 levels than the RR homozygotes (p = 0.0007). Login to comment
150 In summary, we report a significant association for the ABCA1/R219K polymorphism with LOAD risk in American white subjects, with a more pronounced effect in females. Login to comment

[hide] Polymorphisms of cholesterol metabolism genes CYP4... Brain Res. 2007 May 25;1147:34-8. Epub 2007 Feb 8. Wang F, Jia J
Polymorphisms of cholesterol metabolism genes CYP46 and ABCA1 and the risk of sporadic Alzheimer's disease in Chinese.
Brain Res. 2007 May 25;1147:34-8. Epub 2007 Feb 8., [PMID:17335784]

Abstract [show]
Recent studies have demonstrated that cholesterol metabolism might play an important role in Alzheimer's disease (AD). Cholesterol 24-hydroxylase (CYP46) and ATP-binding cassette transporter A1 (ABCA1) have both been proposed to be involved in cholesterol metabolism in the brain. The purpose of this case-control study was to determine whether single nucleotide polymorphisms (SNPs) A-->G in the intron 2 of CYP46 gene and G-->A (R219K) in the exon 7 of ABCA1 gene are associated with sporadic AD in the Chinese Han population. Genotypes were determined by PCR-restriction fragment length polymorphism (PCR-RFLP) in 168 sporadic AD patients and 215 controls. There was no significant difference in the genotype or allele frequencies for CYP46 gene between AD patients and controls. However, we found an obvious association between the polymorphism of ABCA1 gene and AD (chi(2)=8.230, P=0.016). The risk for AD was significantly decreased in K allele (RK+KK genotypes) (adjusted OR=0.57, 95% CI=0.36-0.91, P=0.019) or KK homozygote carriers (adjusted OR=0.40; 95% CI=0.21-0.77, P=0.006) compared with RR genotypes carriers. Our results do not support a genetic association between the intron 2 polymorphism of CYP46 gene and the risk of sporadic AD, but reveal that KK genotype or K allele of ABCA1 gene may have a protective effect for sporadic AD in Chinese.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 The purpose of this case-control study was to determine whether single nucleotide polymorphisms (SNPs) A→G in the intron 2 of CYP46 gene and G→A (R219K) in the exon 7 of ABCA1 gene are associated with sporadic AD in the Chinese Han population. Login to comment
29 Among the examined sites, single nucleotide polymorphisms (SNPs) A→G in the intron 2 of CYP46 gene (rs754203) and G→A (R219K) in the exon 7 of ABCA1 gene (rs2230806) were most promising., We have therefore performed a case-control study to evaluate the association between these two SNPs and sporadic AD in the Chinese Han population. Login to comment
52 Recently, there were a few studies about the R219K polymorphism of ABCA1 gene in AD patients and their results were inconsistent (Table 3). Login to comment
63 The R219K among them predicts a G to A exchange in exon 7 resulting in an arginine to lysine exchange at amino acid 219 which occurs in the first extracellular loop of the ABCA1 protein. Login to comment
73 In conclusion, our study does not support an association between the genetic variability in CYP46 gene and the risk of AD. However, our data revealed that ABCA1 KK genotype and Table 3 - Studies about R219K polymorphism within ABCA1 gene in AD patients Studies Number (cases/controls) Race K allele (%) (cases/controls) Conclusion Wollmer et al., 2003 169/166 Caucasian 29.9/27.7 A delayed age-at-onset Katzov et al., 2004 390/185 Swedish 21.5/27.5 Positive Li et al., 2004 419/377 Caucasian 27.4/27.4 Negative Shibata et al., 2006 218/195 Caucasian 26.0/22.0 Negative 118 AD families Hispanic origin 36.5 A possible interaction between ABCA1 and APOE Sundar et al., 2006 992/699 American whites Total: 29.3/26.9 Positive in female Female: 31.1/24.9 Male: 25.8/30.1 Table 2 - Genotype and allele distributions of R219K polymorphism within ABCA1 gene in AD patients and controls by stratifying for gender or APOE ε4 status Group n Allele (%) Genotype (%) R K RR RK KK Male AD 74 88 (59.5) 60 (40.5) 27 (36.5) 34 (45.9) 13 (17.6) Control 89 94 (52.8) 84 (47.2) 27 (30.3) 40 (44.9) 22 (24.7) χ2 =1.449, P=0.229 χ2 =1.433, P=0.489 Female AD 94 121 (64.4) 67 (35.6) 38 (40.4) 45 (47.9) 11 (11.7) Control 126 129 (51.2) 123 (48.8) 30 (23.8) 69 (54.8) 27 (21.4) χ2 =7.613, P=0.006 χ2 =8.251, P=0.016 ε4 allele carrier AD 42 47 (56.0) 37 (44.0) 12 (28.6) 23 (54.8) 7 (16.7) Control 21 20 (47.6) 22 (52.4) 5 (23.8) 10 (47.6) 6 (28.6) χ2 =0.781, P=0.377 χ2 =1.216, P=0.545 Non-ε4 carrier AD 126 162 (64.3) 90 (35.7) 53 (42.1) 56 (44.4) 17 (13.5) Control 194 203 (52.3) 185 (47.7) 52 (26.8) 99 (51.0) 43 (22.) Login to comment
198 R219K polymorphism of the ABCA1 gene and its modulation of the variations in serum high-density lipoprotein cholesterol and triglycerides related to age and adiposity in white versus black young adults. Login to comment
197 R219K polymorphism of the ABCA1 gene and its modulation of the variations in serum high-density lipoprotein cholesterol and triglycerides related to age and adiposity in white versus black young adults. Login to comment

[hide] Genetic etiology of isolated low HDL syndrome: inc... Arterioscler Thromb Vasc Biol. 2007 May;27(5):1139-45. Epub 2007 Feb 15. Kiss RS, Kavaslar N, Okuhira K, Freeman MW, Walter S, Milne RW, McPherson R, Marcel YL
Genetic etiology of isolated low HDL syndrome: incidence and heterogeneity of efflux defects.
Arterioscler Thromb Vasc Biol. 2007 May;27(5):1139-45. Epub 2007 Feb 15., [PMID:17303779]

Abstract [show]
OBJECTIVE: We have used a multitiered approach to identify genetic and cellular contributors to high-density lipoprotein (HDL) deficiency in 124 human subjects. METHODS AND RESULTS: We resequenced 4 candidate genes for HDL regulation and identified several functional nonsynonymous mutations including 2 in apolipoprotein A-I (APOA1), 4 in lecithin:cholesterol acyltransferase (LCAT), 1 in phospholipid transfer protein (PLTP), and 7 in the ATP-binding cassette transporter ABCA1, leaving 88% (110/124) of HDL deficient subjects without a genetic diagnosis. Cholesterol efflux assays performed using cholesterol-loaded monocyte-derived macrophages from the 124 low HDL subjects and 48 control subjects revealed that 33% (41/124) of low HDL subjects had low efflux, despite the fact that the majority of these subjects (34/41) were not carriers of dysfunctional ABCA1 alleles. In contrast, only 2% of control subjects presented with low efflux (1/48). In 3 families without ABCA1 mutations, efflux defects were found to cosegregate with low HDL. CONCLUSIONS: Efflux defects are frequent in low HDL syndromes, but the majority of HDL deficient subjects with cellular cholesterol efflux defects do not harbor ABCA1 mutations, suggesting that novel pathways contribute to this phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N. Login to comment
42 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N. Login to comment

[hide] Apolipoprotein E levels in cerebrospinal fluid and... Mol Neurodegener. 2007 Apr 12;2:7. Wahrle SE, Shah AR, Fagan AM, Smemo S, Kauwe JS, Grupe A, Hinrichs A, Mayo K, Jiang H, Thal LJ, Goate AM, Holtzman DM
Apolipoprotein E levels in cerebrospinal fluid and the effects of ABCA1 polymorphisms.
Mol Neurodegener. 2007 Apr 12;2:7., [PMID:17430597]

Abstract [show]
BACKGROUND: Animal studies suggest that brain apolipoprotein E (apoE) levels influence amyloid-beta (Abeta) deposition and thus risk for Alzheimer's disease (AD). We have previously demonstrated that deletion of the ATP-binding cassette A1 transporter (ABCA1) in mice causes dramatic reductions in brain and cerebrospinal fluid (CSF) apoE levels and lipidation. To examine whether polymorphisms in ABCA1 affect CSF apoE levels in humans, we measured apoE in CSF taken from 168 subjects who were 43 to 91 years old and were either cognitively normal or who had mild AD. We then genotyped the subjects for ten previously identified ABCA1 single nucleotide polymorphisms (SNPs). RESULTS: In all subjects, the mean CSF apoE level was 9.09 microg/ml with a standard deviation of 2.70 microg/ml. Levels of apoE in CSF samples taken from the same individual two weeks apart were strongly correlated (r2 = 0.93, p < 0.01). In contrast, CSF apoE levels in different individuals varied widely (coefficient of variation = 46%). CSF apoE levels did not vary according to AD status, APOE genotype, gender or race. Average apoE levels increased with age by approximately 0.5 microg/ml per 10 years (r2 = 0.05, p = 0.003). We found no significant associations between CSF apoE levels and the ten ABCA1 SNPs we genotyped. Moreover, in a separate sample of 1225 AD cases and 1431 controls, we found no association between the ABCA1 SNP rs2230806 and AD as has been previously reported. CONCLUSION: We found that CSF apoE levels vary widely between individuals, but are stable within individuals over a two-week interval. AD status, APOE genotype, gender and race do not affect CSF apoE levels, but average CSF apoE levels increase with age. Given the lack of association between CSF apoE levels and genotypes for the ABCA1 SNPs we examined, either these SNPs do not affect ABCA1 function or if they do, they do not have strong effects in the CNS. Finally, we find no evidence for an association between the ABCA1 SNP rs2230806 and AD in a large sample set.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 In particular, studies have implicated the following SNPs in affecting levels of plasma HDL-C: rs2230806 (R219K) [33], rs2066718 (V771M) [31,32], rs2066715 (V825I) [31], rs4149313 (I883M) [34], rs2230808 (R1587K) [31]. Login to comment
42 Additionally, studies by others have reported that the ABCA1 SNP rs2230806 (R219K) affects risk for AD [35-38]. Login to comment
70 The subjects for whom we had CSF apoE data were genotyped for the following ABCA1 SNPs: rs2230806 (R219K), rs2066718 (V771M), rs2066715 (V825I), rs4149313 (I883M), rs2230808 (R1587K), rs1883025 (intron), rs2275544 (intron), rs2777799 (intron), rs3904999 (intron) and rs6479283 (intron). Login to comment
149 Genotyping The following SNPS in ABCA1 were genotyped in the Washington University sample of 168 subjects: rs2230806 (R219K), rs2066718 (V771M), rs2066715 (V825I), rs4149313 (I883M), rs2230808 (R1587K), rs1883025 (intron), rs2275544 (intron), rs2777799 (intron), rs3904999 (intron) and rs6479283 (intron). Login to comment

[hide] ABCA1 polymorphisms and Alzheimer's disease. Neurosci Lett. 2007 Apr 12;416(2):180-3. Epub 2007 Feb 7. Wavrant-De Vrieze F, Compton D, Womick M, Arepalli S, Adighibe O, Li L, Perez-Tur J, Hardy J
ABCA1 polymorphisms and Alzheimer's disease.
Neurosci Lett. 2007 Apr 12;416(2):180-3. Epub 2007 Feb 7., [PMID:17324514]

Abstract [show]
In our search for genetic factors related to the development of Alzheimer's disease, we have genotyped 332 pedigrees for three coding polymorphisms in the ABCA1 gene, two of which are known to alter plasma cholesterol levels, as well as a non-coding polymorphism within the promoter. We show an apparent weak association of rs2230806 (p-value=0.01) with the disease in a sibpair series of Alzheimer's disease that had shown previously evidence for linkage to the chromosome 9 locus where ABCA1 maps.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 doi:10.1016/j.neulet.2007.02.010 The SNPs used were rs2230806 (also designated as rs2234884) which encodes variant R219K (c.969A > G, numbering according to GenBank reference NM 005502) with a reported ~25% minor allele frequency in Caucasian populations [5,7], rs2066718 which is a V771M (c.2624A > G) variant with a reported ~3% minor allele frequency [5,7], rs2230808 which encodes a R1587K (c.5073A > G) variant with a reported 26% minor allele frequency [5,7] and finally rs2422493 which is a 5 UTR polymorphism located at -477 in the promoter with a reported 46% minor allele frequency [23,25]. Login to comment
41 These previous findings emphasize the Table 1 Genotype frequency of ABCA1 polymorphisms in USA sibpair series SNP ID (function) Total (Nf = 331) ApoE-␧4- (Nf = 76) ApoE-␧4+ (Nf = 227) Fam Freq p-Value Fam Freq p-Value Fam Freq p-Value rs2422493 (promoter) C/C 45 0.266 0.62 5 0.245 N/A 25 0.284 0.62 T/C 79 0.494 0.17 14 0.494 0.29 38 0.489 0.35 T/T 44 0.241 0.02* 10 0.261 0.30 21 0.227 0.08 rs2230806 (R219K) A/A 17 0.095 0.93 2 0.058 N/A 10 0.111 0.86 A/G 66 0.399 0.23 12 0.483 0.01* 31 0.388 0.70 G/G 56 0.507 0.21 11 0.459 0.02* 25 0.500 0.59 rs2066718 (V771M) A/A 0 0 N/A 0 0 N/A 0 0 N/A A/G 14 0.100 0.69 2 0.162 N/A 6 0.102 N/A G/G 14 0.900 0.69 2 0.838 N/A 6 0.898 N/A rs2230808 (R1587K) A/A 15 0.066 0.06 5 0.044 N/A 8 0.064 N/A A/G 62 0.426 0.69 14 0.505 0.64 32 0.420 0.90 G/G 56 0.509 0.55 13 0.451 0.57 29 0.515 0.67 Fam, number of informative families; Freq, frequency; Nf, number of nuclear families; N/A, non-applicable. Login to comment

[hide] Genotypic variation in ATP-binding cassette transp... Transl Res. 2007 Apr;149(4):205-10. Mantaring M, Rhyne J, Ho Hong S, Miller M
Genotypic variation in ATP-binding cassette transporter-1 (ABCA1) as contributors to the high and low high-density lipoprotein-cholesterol (HDL-C) phenotype.
Transl Res. 2007 Apr;149(4):205-10., [PMID:17383594]

Abstract [show]
The ATP-binding cassette transporter-1 (ABCA1) mediates cholesterol efflux and genotypic variation in ABCA1 and may impact reverse cholesterol transport and influence cardiovascular disease (CVD) risk. However, although mutations in ABCA1 have generally been identified with low HDL-C, few have undertaken a comparative evaluation between high and low high-density lipoprotein-cholesterol (HDL-C). Therefore, to evaluate for potential gain-of-function polymorphisms/mutations in ABCA1, 56 consecutive subjects were screened presenting with high (60-99 mg/dL [1.6-2.6 mmol/L]) or very high HDL-C (>100 mg/dL [2.6 mmol/L]) and were compared with subjects with average or low HDL-C (n = 68). Carrier frequencies of common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K were also assessed. All 50 exons and exon-intron boundaries of ABCA1 were screened using single-stranded conformation polymorphism (SSCP). DNA samples with SSCP-shifts or differing band patterns were sequenced. For the 6 common polymorphisms, genotyping was determined by polymerase chain reaction (PCR)-restriction fragment length polymorphism. Overall, 5 novel nonsynonymous mutations were identified, all of which were associated with low HDL-C. Of the 6 common ABCA1 polymorphisms, very high HDL-C was associated with a higher genotype frequency for R219K (P(trend) = 0.04) and higher genotype and allelic frequency for E1172D (P(trend) = 0.0004, P(trend) = 0.0002, respectively) compared with lower HDL-C. These data reaffirm that rare mutations in ABCA1 are associated with low HDL-C. However, at least 1 ABCA1 polymorphism (eg, E1172D) may contribute to the high HDL-C phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Carrier frequencies of common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K were also assessed. Login to comment
8 Of the 6 common ABCA1 polymorphisms, very high HDL-C was associated with a higher genotype frequency for R219K (Ptrend ‫؍‬ 0.04) and higher genotype and allelic frequency for E1172D (Ptrend ‫؍‬ 0.0004, Ptrend ‫؍‬ 0.0002, respectively) compared with lower HDL-C. Login to comment
17 doi:10.1016/j.trsl.2006.11.007 itating the egress of cholesterol and phospholipids from interstitial macrophages.2 To date, numerous functional mutations or single nucleotide polymorphisms in ABCA1 have been associated with low HDL-C.3,4 Structural mutations causing ABCA1 deficiency have been implicated in Tangler disease, a co-dominant disorder characterized by yellowish-orange engorgement of tonsils, hepatosplenomegaly, and very low HDL.5 A milder clinical phenotype, familial hypoalphalipoproteinemia (FHA), results from a single defective ABCA1 allele and occurs in the general population at the lower end of the HDL-C spectrum.6,7 Alternatively, at least 1 common ABCA1 polymorphism (ie, R219K) has been associated with a modified risk of CVD without significantly impacting HDL-C levels.8-11 In contrast, fewer data are available evaluating the extent to which variation in ABCA1 contributes to the high HDL-C phenotype,7,12 as previously characterized by reduced CVD risk.13 Therefore, this study evaluated subjects at the upper and lower tails of the HDL-C spectrum to assess the relative impact of novel mutations and common polymorphisms in ABCA1 on the HDL-C phenotype. Login to comment
36 DNA was PCR amplified and digested using standard methods and the frequency of the 6 common polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K) in ABCA1, which was determined as described by Clee et al.8 Sequencing of PCR-amplified DNA. Login to comment
54 The prevalence of 6 common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K was also evaluated. Login to comment
57 Very high HDL-C was associated with a higher genotype frequency of R219K (RK and KK, 68.2%; Ptrend ϭ 0.04) although allele frequency was not materially different. Login to comment
76 Finally, although this small sample size did not permit assessment of CVD risk for the R219K variant, a higher prevalence of the K allele was found among subjects with very high HDL-C, suggesting that carriers Table III. Login to comment
77 Genotype and allele frequencies for 6 common ABCA1 polymorphisms in subgroups with HDL-C defined as very high (n ϭ 22), high (n ϭ 34), average (n ϭ 36), or low (n ϭ 32) R219K Genotype frequencies P value Allele frequencies P valueR/R R/K K/K R K Very high 31.8% 45.5% 22.7% 0.04 0.55 0.45 0.20 High 45.7% 51.4% 2.9% 0.71 0.29 Average 43.2% 56.8% 0.0% 0.72 0.28 Low 50.0% 40.0% 10.0% 0.70 0.30 V771M V/V V/M M/M V M Very high 59.0% 36.0% 4.5% 0.11 0.77 0.23 0.04 High 85.7% 14.3% 0.0% 0.93 0.07 Average 86.1% 13.9% 0.0% 0.93 0.07 Low 80.0% 20.0% 0.0% 0.90 0.10 V825I V/V V/I I/I V I Very high 77.3% 22.7% 0.0% 0.58 0.89 0.11 0.62 High 88.6% 11.4% 0.0% 0.94 0.06 Average 88.9% 11.1% 0.0% 0.94 0.06 Low 82.8% 17.2% 0.0% 0.92 0.08 I883M I/I I/M M/M I M Very high 40.9% 45.5% 13.6% 0.29 0.64 0.36 0.05 High 60.0% 34.3% 5.7% 0.78 0.22 Average 73.0% 24.3% 2.7% 0.85 0.15 Low 66.7% 26.7% 6.7% 0.80 0.20 E1172D E/E E/D D/D E D Very high 68.2% 31.8% 0.0% 0.0004 0.82 0.18 0.0002 High 94.3% 5.7% 0.0% 0.97 0.03 Average 94.6% 5.4% 0.0% 0.97 0.03 Low 100.00% 0.0% 0.0% 1.00 0.00 R1587K R/R R/K K/K R K Very high 31.8% 50.0% 18.2% 0.16 0.57 0.43 0.07 High 65.6% 25.0% 9.4% 0.78 0.22 Average 55.6% 41.7% 2.8% 0.76 0.24 Low 51.9% 33.3% 14.8% 0.69 0.31 of R219K may have a basis for reduced CVD risk as previously suggested.8-11,24 CONCLUSION The data extend previous findings that novel mutations in ABCA1 are associated with the low rather than the high HDL-C (FHA) phenotype. Login to comment
16 doi:10.1016/j.trsl.2006.11.007 itating the egress of cholesterol and phospholipids from interstitial macrophages.2 To date, numerous functional mutations or single nucleotide polymorphisms in ABCA1 have been associated with low HDL-C.3,4 Structural mutations causing ABCA1 deficiency have been implicated in Tangler disease, a co-dominant disorder characterized by yellowish-orange engorgement of tonsils, hepatosplenomegaly, and very low HDL.5 A milder clinical phenotype, familial hypoalphalipoproteinemia (FHA), results from a single defective ABCA1 allele and occurs in the general population at the lower end of the HDL-C spectrum.6,7 Alternatively, at least 1 common ABCA1 polymorphism (ie, R219K) has been associated with a modified risk of CVD without significantly impacting HDL-C levels.8-11 In contrast, fewer data are available evaluating the extent to which variation in ABCA1 contributes to the high HDL-C phenotype,7,12 as previously characterized by reduced CVD risk.13 Therefore, this study evaluated subjects at the upper and lower tails of the HDL-C spectrum to assess the relative impact of novel mutations and common polymorphisms in ABCA1 on the HDL-C phenotype. Login to comment
35 DNA was PCR amplified and digested using standard methods and the frequency of the 6 common polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K) in ABCA1, which was determined as described by Clee et al.8 Sequencing of PCR-amplified DNA. Login to comment
53 The prevalence of 6 common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K was also evaluated. Login to comment
56 Very high HDL-C was associated with a higher genotype frequency of R219K (RK and KK, 68.2%; Ptrend afd; 0.04) although allele frequency was not materially different. Login to comment

[hide] A novel haplotype in ABCA1 gene effects plasma HDL... Int J Cardiol. 2007 Jan 31;115(1):7-13. Epub 2006 Jun 23. Saleheen D, Khanum S, Haider SR, Nazir A, Ahmad U, Khalid H, Hussain I, Shuja F, Shahid K, Habib A, Frossard PM
A novel haplotype in ABCA1 gene effects plasma HDL-C concentration.
Int J Cardiol. 2007 Jan 31;115(1):7-13. Epub 2006 Jun 23., [PMID:16806540]

Abstract [show]
BACKGROUND AND OBJECTIVES: ATP-binding cassette transporter 1 (ABCA1) is a trans-membrane protein responsible for the efflux of cholesterol and phospholipids across the cell membrane, an essential step in the reverse cholesterol transport system. This study investigates the effect of five non-synonymous SNPs of ABCA1 gene on plasma HDL-C levels in Pakistani individuals free of ischemic heart disease and stroke. METHODS: Five non-synonymous SNPs were selected after sequencing ABCA1 gene in patients of Hypoalphalipoproteinemia. The presence of these SNPs was then checked in 200 individuals by using PCR-RFLP. Plasma glucose and lipid fractions were measured in fasting state. Ethical approval was obtained from the Ethical Review Committee, Aga Khan University and informed consent was obtained from all subjects. RESULTS: LL genotype of V825L polymorphism was associated with decreased levels of HDL-C [-0.17 (-0.32 to -0.19); P=0.02] and P774 allele showed a significant increase in HDL-C levels as compared to T774 allele [-0.15 (-0.18 to -0.02); P=0.01]. R219K, A399V and V771M polymorphisms did not show any association with levels of HDL-C, LDL-C, cholesterol and triglycerides. Haplotype analysis between R219K and V825L polymorphisms showed a unique interaction between R219 allele and L825 allele. The RL haplotype was found to be associated with decreased levels of HDL-C [-0.12 (-0.22 to -0.03); P=0.001]. CONCLUSIONS: ABCA1 polymorphisms are associated with varying levels of HDL-C in Pakistani individuals. These results warrant further investigations as ABCA1 polymorphisms may have a major role in the high incidence of cardiovascular disorders in South Asians.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 R219K, A399V and V771M polymorphisms did not show any association with levels of HDL-C, LDL-C, cholesterol and triglycerides. Login to comment
8 Haplotype analysis between R219K and V825L polymorphisms showed a unique interaction between R219 allele and L825 allele. Login to comment
50 Subjects were classified as having diabetes mellitus if he or she already Table 1 Methods for restriction fragment length polymorphism for screening of ABCA1 SNPs Variant Forward oligo (5VY3V), reverse oligo (5VY3V) Annealing temperature Enzyme Product (bp), wild-type allele, variant allele R219K (G1051A) ''aaagacttcaaggacccagctt``, ''cctcacattccgaaagcatta`` 62.5 -C EcoNI 309, 184, 125 V399A (T1591C) ''ctcattgtctgtgcttctcctc``, ''gtgaccagaaactcacctctcc`` 64.0 -C HphI 117, 71, 48, 188, 48 V771M (G2706A) ''tacaagtgagtgcttgggattg``, ''cccattggaaaagacaatcatc`` 60.0 -C BsaAI 254, 137, 391 V825L (G2868A) ''ttctgcaccttatgattgatcc``, ''agcacaaagaaaggacatcagc`` 62.5 -C BsaI 265, 127, 392 Polymerase chain reaction (PCR) was carried out using a Perkin Elmer GeneAmp PCR system 2400 (Perkin Elmer Corp., Applied Biosystems Division, USA). Login to comment
77 R219K, V399A and V771M polymorphisms did not show any association with levels of HDL-C, LDL-C, cholesterol and triglycerides. Login to comment
80 R219K, V399A and T774P polymorphisms followed the HWE however V825L and V771M showed a departure from HWE. Login to comment
82 Linkage disequilibrium and haplotype analysis R219K polymorphism was in significant linkage disequilibrium (LD) with V825L and V771M (DV=0.50; P-value<10À3 ). Login to comment
92 On two-point haplotype analysis, the haplotype model between R219K and V825L polymorphisms showed RL haplotype to be associated with decreased levels of HDL-C. Importantly, this association remained significant when age, gender, hypertension and diabetes mellitus were introduced in to the haplotype model. Login to comment
97 South Asian populations (from Pakistan, India, Bangladesh and Sri Lanka) represent a quarter of the developing world and harbor thirty percent of the global Table 4 Haplotype association analysis of the ABCA1 gene polymorphisms in relation with the HDL-C levels Haplotype Haplotype frequencies Haplotypic additive effects [95% CI] P-value R219K RV 0.47 + V825L RL 0.18 À0.12 [À0.22 to À0.03] 0.001 KV 0.28 À0.04 [À0.10 to 0.01] 0.15 KL 0.06 0.08 [À0.06 to 0.22] 0.25 T774P TV 0.21 0.03 [À0.05 to 0.12] 0.41 V825L TL 0.09 0.10 [À0.06 to 0.27] 0.22 PV 0.47 + PL 0.21 À0.06 [À0.14 to 0.02] 0.15 R219K RM 0.55 + V771M RV 0.07 À0.13 [À0.45 to 0.19] 0.41 KM 0.34 À0.02 [À0.09 to 0.05] 0.54 KV 0.04 0.07 [À0.12 to 0.27] 0.46 Table 3 Mean HDL-C levels (S.D.) for the genotypes and alleles of the studied polymorphisms Frequencies HDL-C (S.D.) b (95% CI) P-value R219K RR 39.8 1.06 (0.30) À0.02 (À0.16 to 0.13) 0.85 RK 46.0 1.10 (0.28) 0.00 (À0.14 to 0.14) 0.99 KK 14.3 1.10 (0.31) + R 62.7 1.08 (0.26) 0.01 (À0.05 to 0.07) 0.79 K 37.3 1.09 (0.31) V399A AA 6.0 1.01 (0.23) À0.03 (À0.24 to 0.16) 0.70 AV 34.7 1.11 (0.28) 0.10 (À0.04 to 0.16) 0.22 VV 59.3 1.04 (0.31) + A 23.3 1.09 (0.28) À0.03 (À0.10 to 0.05) 0.58 V 76.7 1.04 (0.31) T774P PP 9.6 1.10 (0.31) 0.20 (0.01 to 0.40) 0.03 PT 37.5 1.03 (0.32) 0.13 (À0.03 to 0.20) 0.14 TT 52.9 0.97 (0.28) + P 28.4 1.05 (0.32) À0.15 (À0.18 to À0.02) 0.01 T 71.6 0.99 (0.29) V771M MM 6.1 1.09 (0.30) 0.01 (À0.24 to 0.25) VM 10.1 0.98 (0.24) À0.07 (À0.27 to 0.12) 0.46 VV 83.8 1.07 (0.29) + 0.94 M 11.1 1.04 (0.27) 0.03 (À0.10 to 0.15) 0.71 V 88.9 1.07 (0.29) V825L LL 9.8 0.89 (0.299) À0.17 (À0.32 to À0.19) 0.02 LV 32.8 1.06 (0.265) À0.03 (À0.11 to 0.076) 0.70 VV 57.5 1.07 (0.30) + L 26.1 1.07 (0.29) 0.10 (À0.00 to .13) 0.05 V 73.9 1.00 (0.28) P-values are adjusted for age and gender. Login to comment
107 On haplotype analysis, the RL haplotype generated from the R219K and V825L polymorphisms was strongly associated with decreased levels of HDL-C. Importantly, association of this haplotype was stronger than the association observed for V825L polymorphism. Login to comment
113 R219K is the most widely studied polymorphism in association with coronary artery disease, atherosclerosis and HDL-C levels [21,23,24,28]. Login to comment

[hide] ABCA1 single nucleotide polymorphisms on high-dens... Obesity (Silver Spring). 2006 Nov;14(11):1874-9. Porchay I, Pean F, Bellili N, Royer B, Cogneau J, Chesnier MC, Caradec A, Tichet J, Balkau B, Marre M, Fumeron F
ABCA1 single nucleotide polymorphisms on high-density lipoprotein-cholesterol and overweight: the D.E.S.I.R. study.
Obesity (Silver Spring). 2006 Nov;14(11):1874-9., [PMID:17135600]

Abstract [show]
The adenosine triphosphate-binding cassette A1 (ABCA1) gene plays a key role in reverse cholesterol transport. Some ABCA1 gene polymorphisms have been associated with high-density lipoprotein-cholesterol (HDL-C) concentrations. The aim of this study was to assess the effect of three polymorphisms, C69T, G378C, and G1051A (R219K), on HDL-C levels and their interaction with BMI in more than 5000 French whites from the D.E.S.I.R. (Data from an Epidemiological Study on the Insulin Resistance syndrome) cohort study. The T allele of the C69T single nucleotide polymorphism (SNP) was associated with higher HDL-C levels in normal-weight men (BMI <25 kg/m(2)). The C allele of the G378C SNP was associated with lower HDL-C in overweight subjects (BMI > or =25 kg/m(2)). For the G1051A SNP, in the normal-weight group, the minor A allele was significantly associated with higher HDL-C levels. In contrast, in overweight people, the minor allele was associated with lower HDL-C levels. After accounting for multiple testing, empiric p values remained significant for the associations between G378C SNP and HDL-C in the overweight group and between G1051A SNP and HDL-C in the normal-weight group. This study suggests that ABCA1 gene polymorphisms modulate HDL-C concentrations, in interaction with BMI, and, thus, they might influence cardiovascular risk in the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 The aim of this study was to assess the effect of three polymorphisms, C69T, G378C, and G1051A (R219K), on HDL-C levels and their interaction with BMI in more than 5000 French whites from the D.E.S.I.R. (Data from an Epidemiological Study on the Insulin Resistance syndrome) cohort study. Login to comment
27 We analyzed two SNPs with a potential regulating role located in 5Ј-untranslated regions, C69T (rs1800977) and G378C (rs1800978) (5), and one SNP G1051A (rs2230806) (6) leading to an amino acid substitution, R219K, in a large cohort from the D.E.S.I.R. (Data from an Epidemiological Study on the Insulin Resistance syndrome) Study (18). Login to comment
74 The G1051A SNP controls the substitution of arginine 219 by a lysine in the first extracellular domain of ABCA1. Login to comment

[hide] ABCA1 polymorphisms and prognosis after myocardial... Int J Cardiol. 2006 Jun 16;110(2):267-8. Epub 2005 Nov 28. Martin M, Gonzalez P, Reguero JJ, Batalla A, Garcia Castro M, Coto E, Moris C
ABCA1 polymorphisms and prognosis after myocardial infarction in young patients.
Int J Cardiol. 2006 Jun 16;110(2):267-8. Epub 2005 Nov 28., [PMID:16313984]

Abstract [show]
High-density cholesterol (HDL) levels are affected by genetic influences and certain behaviors. Low levels of HDL-C are considered as an independent risk factor for premature coronary heart disease. In patients with Tangier disease, characterised by low HDL levels, mutations in the ATP binding cassette transporter have been described. We have analysed three polymorphisms of the ABCA1 gene (-477C/T, R219 K, and I883M) in a cohort of young male survivors of myocardial infarction in order to know their influence in long-term prognosis. In premature heart disease, knowing prognosis factors is specially relevant.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
9 In order to know whether there is a relationship between ABCA1 polymorphisms and prognosis after myocardial infarction in young patients, we have analysed three polymorphisms in ABCA1 gene (À477C/T, R219K, I883M) in a cohort of young male survivors of first myocardial infarction. Login to comment
19 Table 1 Frequency of genotypes of ABCA1 gene in study and control group Genotypes Patients (%) Controls (%) p ABCA1 R219K RR 48 49 ns RK 42 40 KK 10 11 ABCA1 À477C/T CC 24 30 ns TC 50 50 TT 26 20 ABCA1 I883M AA 69 80 ns AG/GG 31 20 International Journal of Cardiology 110 (2006) - 268 www.elsevier.com/locate/ijcard Fasting blood samples were drawn for measurements of total plasma cholesterol, HDL-C and triglycerides in the first 24 h after admission. Login to comment

[hide] ABC A-subfamily transporters: structure, function ... Biochim Biophys Acta. 2006 May;1762(5):510-24. Epub 2006 Feb 28. Kaminski WE, Piehler A, Wenzel JJ
ABC A-subfamily transporters: structure, function and disease.
Biochim Biophys Acta. 2006 May;1762(5):510-24. Epub 2006 Feb 28., [PMID:16540294]

Abstract [show]
ABC transporters constitute a family of evolutionarily highly conserved multispan proteins that mediate the translocation of defined substrates across membrane barriers. Evidence has accumulated during the past years to suggest that a subgroup of 12 structurally related "full-size" transporters, referred to as ABC A-subfamily transporters, mediates the transport of a variety of physiologic lipid compounds. The emerging importance of ABC A-transporters in human disease is reflected by the fact that as yet four members of this protein family (ABCA1, ABCA3, ABCR/ABCA4, ABCA12) have been causatively linked to completely unrelated groups of monogenetic disorders including familial high-density lipoprotein (HDL) deficiency, neonatal surfactant deficiency, degenerative retinopathies and congenital keratinization disorders. Although the biological function of the remaining 8 ABC A-transporters currently awaits clarification, they represent promising candidate genes for a presumably equally heterogenous group of Mendelian diseases associated with perturbed cellular lipid transport. This review summarizes our current knowledge on the role of ABC A-subfamily transporters in physiology and disease and explores clinical entities which may be potentially associated with dysfunctional members of this gene subfamily.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 On the other hand, one dimorphism in the ABCA1 gene, R219K, appears to exert atheroprotective effects [30]. Login to comment

[hide] Association studies of cholesterol metabolism gene... Neurosci Lett. 2006 Jan 2;391(3):142-6. Epub 2005 Sep 12. Shibata N, Kawarai T, Lee JH, Lee HS, Shibata E, Sato C, Liang Y, Duara R, Mayeux RP, St George-Hyslop PH, Rogaeva E
Association studies of cholesterol metabolism genes (CH25H, ABCA1 and CH24H) in Alzheimer's disease.
Neurosci Lett. 2006 Jan 2;391(3):142-6. Epub 2005 Sep 12., [PMID:16157450]

Abstract [show]
Recent studies have demonstrated that cholesterol metabolism has an important role in Alzheimer's disease (AD) pathogenesis, suggesting that cholesterol-related genes may be significant genetic risk factors for AD. Based on the results of genome-wide screens, along with biological studies, we selected three genes as candidates for AD risk factors: ATP-binding cassette transporter A1 (ABCA1), cholesterol 25-hydroxylase (CH25H) and cholesterol 24-hydroxylase (CH24H). Case-control of North American Caucasians and AD families of Caribbean Hispanic origin were examined. Although excellent biological candidates, the case-control dataset did not support the hypothesis that these three genes were associated with susceptibility to AD. Similarly, no association was found in the Caribbean Hispanic families for CH25H. However, we did observe a possible interaction between ABCA1 and APOE in the Hispanics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 In a previous study, investigating sporadic AD patients, the A-allele of the non-synonymous R219K SNP (rs2230806) in ABCA1 was associated with a reduction of total cholesterol in cerebrospinal fluid and a delay in age-at-onset [17]. Login to comment
72 However, the current study failed to detect a significant effect of the R219K variation on age-at-onset. Login to comment

[hide] Variations on a gene: rare and common variants in ... Annu Rev Nutr. 2006;26:105-29. Brunham LR, Singaraja RR, Hayden MR
Variations on a gene: rare and common variants in ABCA1 and their impact on HDL cholesterol levels and atherosclerosis.
Annu Rev Nutr. 2006;26:105-29., [PMID:16704350]

Abstract [show]
Cholesterol and its metabolites play a variety of essential roles in living systems. Virtually all animal cells require cholesterol, which they acquire through synthesis or uptake, but only the liver can degrade cholesterol. The ABCA1 gene product regulates the rate-controlling step in the removal of cellular cholesterol: the efflux of cellular cholesterol and phospholipids to an apolipoprotein acceptor. Mutations in ABCA1, as seen in Tangier disease, result in accumulation of cellular cholesterol, reduced plasma high-density lipoprotein cholesterol, and increased risk for coronary artery disease. To date, more than 100 coding variants have been identified in ABCA1, and these variants result in a broad spectrum of biochemical and clinical phenotypes. Here we review genetic variation in ABCA1 and its critical role in cholesterol metabolism and atherosclerosis in the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
605 Many of these variants have been studied in relationship to their association with HDL cholesterol levels and atherosclerosis (11, 15, 22, 27, 28, 38, TABLE 4 Nonsynonymous single-nucleotide polymorphisms (SNPs) in ABCA1 SNP id Nucleotidea Amino acidb Observed heterozygosity rs2230806 G969A R219K 0.488 rs9282541 C1001T R230C 0.029 rs9282543 T1509C V399A 0.020 rs4131108 A1556C M415L - rs13306068 A1949G I546V - rs2066718 G2624A V771M 0.074 rs2472458 G2804A D831N - rs4149313 A2962G I883M - rs2482437 C3326T E1005K - rs13306072 G3473A V1054I - rs13306073 G3599A V1096I - rs1997618 T4977C I1555T - rs2230808 A5073G K1587R 0.480 rs1883024 T5256C L1648P - - C5505G S1731C - a Nucleotide position is with respect to NM 005502. b Amino acid position is with respect to NP 005493. Login to comment
622 Notably, only two of the 15 common ABCA1 nonsynonymous SNPs, I883M and R219K,arerepresentedintheHapMapdataset,whichisanincompletedataset(the phaseIprojecthavingsetouttoidentify1SNPevery5000basepairs)(7).However, it is apparent from the haplotypes in which I883M and R219K reside that the minor alleles of each of these are unique to one particular, different haplotype, which may explain in part why these two SNPs have been consistently found to be associated with HDL levels and atherosclerosis risk. Login to comment
763 The association of the R219K polymorphism in the ATP-binding cassette transporter 1 (ABCA1) gene with coronary artery disease and hyperlipidemia. Login to comment
974 R219K polymorphism of the ABCA1 gene and its modulation of the variations in serum high-density lipoprotein cholesterol and triglycerides related to age and adiposity in white versus black young adults. Login to comment

[hide] Decreased frequencies of ABCA1 polymorphisms R219K... Cerebrovasc Dis. 2006;21(4):254-9. Epub 2006 Jan 27. Andrikovics H, Pongracz E, Kalina E, Szilvasi A, Aslanidis C, Schmitz G, Tordai A
Decreased frequencies of ABCA1 polymorphisms R219K and V771M in Hungarian patients with cerebrovascular and cardiovascular diseases.
Cerebrovasc Dis. 2006;21(4):254-9. Epub 2006 Jan 27., [PMID:16446539]

Abstract [show]
BACKGROUND AND PURPOSE: Genetic polymorphisms in ABC transporter A1 (ABCA1) may alter the regulation of plasma high-density lipoprotein (HDL), promoting or protecting from vascular diseases. METHODS: We investigated 244 unrelated, consecutively enrolled patients with ischemic stroke, 150 patients with coronary heart disease (CHD) and 193 blood donors for allele frequencies (AFs) of three common ABCA1 polymorphisms (R219K, V771M and I883M). RESULTS: Compared to controls (30.8 +/- 4.7 and 4.9 +/- 2.2%, respectively), decreased AFs were found in both patient groups for R219K and V771M (28.7 +/- 4.1 and 3.1 +/- 1.6% in stroke, and 25.7 +/- 5.0%; 1.3 +/- 1.3% in CHD patients, respectively). In a subset of stroke patients younger than 50, both variants occurred in significantly lower frequencies (22.4 +/- 5.5 and 1.8 +/- 1.7%, respectively). Similarly, among CHD patients younger than 60, AFs of R219K and V771M (22.6 +/- 7.5 and 0 +/- 1.6%, respectively) were decreased. V771M was almost exclusively (35/36) found in individuals carrying the R219K allele. CONCLUSIONS: Our data confirm earlier observations that ABCA1 R219K and V771M polymorphisms may be associated with a protective role against CHD and extend those to another important pathologic condition, namely stroke.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Fax +41 61 306 12 34 E-Mail karger@karger.ch www.karger.com Original Paper Cerebrovasc Dis 2006;21:254-259 DOI: 10.1159/000091223 Decreased Frequencies of ABCA1 Polymorphisms R219K and V771M in Hungarian Patients with Cerebrovascular and Cardiovascular Diseases Hajnalka Andrikovicsa Endre Pongráczb Ákos Kalinac Anikó Szilvásia Charalampos Aslanidisd Gerd Schmitzd Attila Tordaia a Department of Molecular Genetics, National Medical Center, b Neurology Department, Central Hospital, Ministry of Interior, and c Hospital of the National Railways, Budapest, Hungary; d Institute for Clinical Chemistry and Laboratory Medicine, University of Regensburg, Germany and 0 8 1.6%, respectively) were decreased. Login to comment
1 V771M was almost exclusively (35/36) found in individuals carrying the R219K allele. Login to comment
2 Conclusions: Our data confirm earlier observations that ABCA1 R219K and V771M polymorphisms may be associated with a protective role against CHD and extend those to another important pathologic condition, namely stroke. Login to comment
7 Methods: We investigated 244 unrelated, consecutively enrolled patients with ischemic stroke, 150 patients with coronary heart disease (CHD) and 193 blood donors for allele frequencies (AFs) of three common ABCA1 polymorphisms (R219K, V771M and I883M). Login to comment
8 Results: Compared to controls (30.8 8 4.7 and 4.9 8 2.2%, respectively), decreased AFs were found in both patient groups for R219K and V771M (28.7 8 4.1 and 3.1 8 1.6% in stroke, and 25.7 8 5.0%; 1.3 8 1.3% in CHD patients, respectively). Login to comment
10 Similarly, among CHD patients younger than 60, AFs of R219K and V771M (22.6 8 7.5 Received: July 25, 2005 Accepted: October 12, 2005 Published online: January 27, 2006 Attila Tordai Department of Molecular Genetics National Medical Center, Diószegi út 64 HU-1113 Budapest (Hungary) Tel./Fax +36 1 385 2255, E-Mail tordai@biomembrane.hu (c) 2006 S. Karger AG, Basel 1015-9770/06/0214-$23.50/0 Accessible online at: www.karger.com/ced To date, the ABCA1 gene proved to be highly polymorphic with large numbers of sequence variations leading to amino acid changes or affecting the putative promoter region [8] (see also http://www.abca1 mutants.all.at). Login to comment
28 DNA Isolation and Detection of ABCA1 R219K, V771M and I883M Alleles with LightCycler Hybridization Probe Technique DNA isolation was performed from anticoagulated peripheral blood with the standard 'salting-out` procedure. Login to comment
29 The following ABCA1sequencevariantswerestudied:R219K(exon7,c.969A]G, substitution of Arg219 by Lys); V771M (exon 16, c.2624G]A, substitution of Val771 by Met), and I883M (exon 18, c.2962A]G, substitution of Ile883 by Met). Login to comment
53 2006;21:254-259256 Results Genotyping for R219K, V771M and I883M ABCA1 Allelic Variants Using genomic DNA samples, simultaneous genotyping was carried out in the control blood donor and the stroke- and CHD-affected patient groups by PCR and fluorescent allelic discrimination techniques. Login to comment
55 In the control group, AF figures (30.8 8 4.7, 4.9 8 2.2 and 12.4 8 4.5%) were found in the expected range for R219K, V771M and I883M, respectively. Login to comment
56 Decreased AFs were found in both patient groups for R219K and V771M variants (28.9 8 4.1 and 3.3 8 1.6% in stroke, and 25.7 8 5.0% and 1.3 8 1.3% in CHD, respectively). Login to comment
59 In a subset of stroke patients with disease onset before 50 (n = 114), both variants occurred in significantly lower frequencies compared to the control group [R219K: 22.4 8 5.5%, p = 0.013, crude OR = 0.55 (0.34-0.88); V771M: 1.8 8 1.7%, p = 0.045, crude OR = 0.33 (0.111.00)]. Login to comment
60 A similar tendency was observed in the CHD group in a subset of patients younger than 60 (n = 62) for R219K and V771M, but only the V771M AF decrease was significant [22.6 8 3.6%, p 1 0.05; and 0 8 1.6%, p = 0.005, crude OR = 0.07 (0.004-1.2)]. Login to comment
62 Figure 1 further illustrates the tendency of R219K and V771M AF decreases following stratification of the patient groups by age at onset. Login to comment
63 Multivariate analyses (logistic regression) also showed that the R219K and V771M variants are protective factors against stroke, independently from age and sex [R219K: p = 0.032, adjusted OR: 0.68 (0.48-0.97); V771M: p = 0.017, adjusted OR: 0.34 (0.14-0.82)]. Login to comment
66 Similarly to results of the entire stroke group, R219K AF reduction was 27.4 8 4.9%, p = 0.015, adjusted OR: 0.59 (0.39-0.91), and V771M AF reduction was 3.3 8 2.0%, p = 0.042, adjusted OR: 0.36 (0.13-0.97) compared to control. Login to comment
67 We also observed significant R219K and V771M AF reduction in patients with CT-proven ischemic stroke [n = 124; R219K: 24.6 8 5.5%, p = 0.049, adjusted OR: 0.64 (0.41-0.99), and V771M: 1.2 8 1.4%, p = 0.021, adjusted OR: 0.19 (0.05-0.78)] compared to control. Login to comment
70 Genotyping results and statistical analyses for three common ABCA1 polymorphisms (R219K, V771M and I883M) in the control and patient groups Polymorphism AF % (895% CI) Heterozygous individuals n (%) Homozygous individuals n (%) p value Adjusted OR (95% CI) R219K Controls (n = 193) 30.8 (4.7) 73 (37.8) 23 (11.9) Patients with stroke (n = 244) 28.9 (4.1) 84 (34.1) 29 (11.8) 0.032 0.68 (0.48-0.97) Patients with CHD (n = 150) 25.7 (5.0) 55 (36.7) 11 (7.3) NS NS V771M Controls (n = 193) 4.9 (2.2) 19 (9.8) 0 Patients with stroke (n = 244) 3.3 (1.6) 14 (5.7) 1 (0.4) 0.017 0.34 (0.14-0.82) Patients with CHD (n = 150) 1.3 (1.3) 4 (2.7) 0 0.027 0.08 (0.01-0.75) I883M Controls (n = 105) 12.4 (4.5) 24 (22.9) 1 (1.0) Patients with stroke (n = 244) 15.2 (3.2) 61 (24.8) 7 (2.9) NS NS Patients with CHD (n = 150) 12.3 (3.8) 29 (19.3) 4 (2.6) NS NS AF = Allele frequency; CI = confidence interval; NS = nonsignificant. Login to comment
72 showed that R219K and V771M variants also play a protective role against stroke independently from age and sex in the stroke patient subgroup without ischemic heart disease [R219K: p = 0.040, adjusted OR: 0.69 (0.48-0.98), and V771M: p = 0.034, adjusted OR: 0.39 (0.16-0.93)]. Login to comment
73 These results indicate that the protective role of R219K and V771M in the stroke group cannot be explained with the frequent coexistence of CHD. Login to comment
78 We observed lower R219K and V771M AFs in the low-risk group (R219K: 27.4 8 5.2 vs. 30.6 8 6.6%, and V771M: 2.1 8 1.7 vs. 4.6 8 3.0%, respectively), but the differences were not significant. Login to comment
81 However, the genotype distribution of R219K showed a significant (p = 0.00465) alteration from HWE exclusively in the stroke-affected patient group. Login to comment
84 The V771M allele was almost exclusively found in individuals carrying the R219K allele (36/37 V771M carriers were positive for R219K). Login to comment
86 0.0005 by the Arlequin software) was observed between V771M and R219K. Login to comment
87 Moreover, a similar, non-random allelic association was observed between R219K and I883M variants (p ! Login to comment
89 Combining all genotyping results, 94/135 (69.6%) of I883M carriers were also positive for R219K, while only 148/374 (39.6%) of I883M wild-type individuals were positive for R219K. Login to comment
90 The distribution of double-positive (R219K and I883M carriers) and single-positive (only I883M carriers) individuals was similar in the control, in the stroke and in the CHD-affected groups. Login to comment
91 These results suggest that the R219K and I883M polymorphisms are also in linkage disequilibrium in our population, although the common occurrence of these variants in the same individual is not likely to be related to disease development. Login to comment
94 Comparisons of AFs of the ABCA1 R219K and V771M variants in the control and patient groups. Login to comment
96 AF values and 95% CIs (bars) are presented for the R219K (a) and V771M (b) variants. Login to comment
106 The most common missense polymorphism in the coding region of the ABCA1 gene is R219K with an AF of the K allele of 25-46% in the Caucasian population. Login to comment
107 Two large studies investigating 2,028 and 794 individuals came to contradictory conclusions about the possible role of R219K in arteriosclerosis. Login to comment
108 Brousseau et al. [15] reported an elevated R219K AF in patients with CHD and a low HDL level compared to disease-free individuals, suggesting that the mutant allele may cause a decrease in the HDL level, subsequently promoting arteriosclerosis and the development of CHD. Login to comment
109 In their study, no correlation between R219K genotypes and the plasma lipid parameters could be observed either in the control group (mean age: 53 years) or in the CHD patient group (mean age: 64 years). Login to comment
110 In another study, primarily focusing on ABCA1 haplotype analyses, R219K was also found to be associated with an increased risk for myocardial infarction [16]. Login to comment
111 In contrast, Clee et al. [9] found that R219K carrier patients have reduced severity of CHD, decreased focal and diffuse arteriosclerosis and fewer coronary events than wild-type CHD patients. Login to comment
112 They showed decreased triglyceride and increased HDL levels in their R219K carrier patients, although this difference existed only in the individuals younger than 57 years. Login to comment
113 They concluded that R219K alone is an independent protective factor against CHD. Login to comment
114 Further studies also described a putative protective effect of the R219K variant [18-20]. Login to comment
117 Moreover, the mean age of R219K homozygous and heterozygous patients with stroke was significantly higher than the age of R219K wild-type patients (58.2 8 13.0, 55.4 8 13.8 vs. 51.2 8 14.9 years, respectively). Login to comment
118 In our CHD patient group, the mean age of the patients with different R219K genotype did not differ significantly. Login to comment
119 However, upon subgroup analyses, among patients affected by both diseases with younger ages at onset, both variants R219K and V771M showed significantly decreased AFs (fig. 1). Login to comment
121 They explained this observation with the linkage disequilibrium between the R219K and V771M variants. Login to comment
122 In our study, the V771M variant, or compound heterozygosity for V771M and R219K, showed significant AF reduction in the patient groups, in spite of the fact that our controls were relatively younger than our patients with stroke or CHD. Login to comment
128 Our data confirm earlier observations that ABCA1 R219K and V771M polymorphisms may play a protective role against CHD and extend those to another frequently occurring pathologic condition, namely stroke. Login to comment

[hide] Quantitative trait loci in ABCA1 modify cerebrospi... J Hum Genet. 2006;51(3):171-9. Epub 2005 Dec 22. Katzov H, Bennet AM, Hoglund K, Wiman B, Lutjohann D, Brookes AJ, Andreasen N, Blennow K, De Faire U, Prince JA
Quantitative trait loci in ABCA1 modify cerebrospinal fluid amyloid-beta 1-42 and plasma apolipoprotein levels.
J Hum Genet. 2006;51(3):171-9. Epub 2005 Dec 22., [PMID:16372134]

Abstract [show]
The ATP-binding cassette transporter A1 encoded by ABCA1 plays an integral role in the efflux of cellular cholesterol and phospholipids, but may also be a central mediator of beta-amyloid (Abeta) processing. Here, genetic association of the common R219K variant of ABCA1 is shown with cerebrospinal fluid (CSF) Abeta 1-42 levels, reinforcing emerging evidence of a connection between lipid and Abeta metabolism. In support of this finding we demonstrate for the first time that CSF cholesterol and Abeta 1-42 are correlated. To affirm the plausible impact of ABCA1 variation on cholesterol and related traits as well as to empower a survey of possible interactions (e.g. age, gender, and smoking), a large Swedish population consisting of over 2,700 individuals was enlisted and extensive measures of plasma lipid parameters carried out. These analyses revealed that R219K has a strong effect on apolipoprotein B (APOB) and LDL-cholesterol (LDL-C) among smokers (P = 0.000055 and P = 0.00059, respectively), but not among non-smokers. In contrast, no effect was evident with apolipoprotein A (APOA1) or HDL-cholesterol (HDL-C) levels. Plasma APOB and LDL-C, but not APOA1 and HDL-C, were shown to be markedly elevated in smokers versus non-smokers, affirming that smoking may selectively impact the former pathway. No other genetic markers in ABCA1 exhibit effects as large as R219K, although a modest independent effect of R1587K was observed. Our data illuminate a possible genetic link between Abeta and cholesterol metabolism, but also provide an intriguing example of an environmental exposure that may modify a genotype-phenotype relationship.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 Here, genetic association of the common R219K variant of ABCA1 is shown with cerebrospinal fluid (CSF) Ab1-42 levels, reinforcing emerging evidence of a connection between lipid and Ab metabolism. Login to comment
7 No other genetic markers in ABCA1 exhibit effects as large as R219K, although a modest independent effect of R1587K was observed. Login to comment
40 Genotyping Information on the R219K, I883M, and R1587K variants [representing cDNA (GenBank accession number NM_005502.2) rs2230806, c.658 G>A; rs4149313, c.2650 A>G; rs2230808, c.4762 G>A, respectively] may be found at dbSNP (http://www.ncbi.nlm.nih.gov/ SNP/). Login to comment
70 We focussed on the R219K, I883M, and R1587K variants since these give rise to amino acid changes and because they are common in European populations (Clee et al. 2001). Login to comment
72 A significant effect of the R219K variant on CSF Ab1-42 levels was observed whereby RK heterozygotes had the highest trait levels (547±19.2, n=141; 658±35.1, n=71; 443±60.6, n=4; F2,212=6.2, P=0.0024, for RR, RK, and KK genotype classes, respectively; pg/ ml ±SEM). Login to comment
88 In an initial screen, we tested the R219K variant using ANOVA for effects upon these selected traits in the entire set of samples. Login to comment
96 To begin exploring this latter possibility in the CVD sample (since it affords the most power to detect such effects), genotyping of the I883M and R1587K variants was performed, and ANOVA used to model the potential independent main effects in a joint analysis of all three markers (including R219K). Login to comment
98 In smokers, the main effect for R219K improved when adjusting for the other sites from F2,943=8.4, P=0.00024 in isolation to F2,898=9.9, P=0.000055 when all three markers were included. Login to comment
100 The I883M variant was not associated with the APOB trait either in isolation or in the full model. Login to comment
122 To explore the possible functional effects of ABCA1 variants, we used the PolyPhen tool (http://www.bor Table 1 Quantitative trait analyses for the R219K variant. Login to comment
126 HDL-C High density lipoprotein cholesterol, LDL-C low density lipoprotein cholesterol, TC total cholesterol, TG triglycerides Table 2 Phenotypic effects of the R219K variant in smokers and non-smokers ApoB KK RK RR F value P value Non-smokers 1.56±0.04 (102) 1.51±0.02 (573) 1.50±0.01 (878) 1.1 0.32 Smokers 1.80±0.06 (53) 1.56±0.02 (366) 1.62±0.02 (527) 8.4 0.00024 TC Non-smokers 6.06±0.11 (102) 5.97±0.04 (574) 5.93±0.04 (879) 0.84 0.43 Smokers 6.62±0.16 (53) 6.14±0.06 (367) 6.15±0.05 (526) 4.0 0.019 LDL-C Non-smokers 4.14±0.10 (102) 4.03±0.04 (568) 3.99±0.03 (868) 1.34 0.26 Smokers 4.54±0.16 (50) 4.13±0.05 (355) 4.17±0.05 (516) 3.5 0.031 Values are the mean ± SEM according to R219K genotype. Login to comment
127 The number of individuals in each category is shown in parenthesis. Comparisons were performed by ANOVATC total cholesterol, LDL-C low density lipoprotein cholesterol Traits KK RK RR F value P value APOA1a (g/l) 1.46±0.02 (157) 1.48±0.01 (966) 1.47±0.01 (1,439) 0.23 0.79 APOB (g/l) 1.64±0.03 (157) 1.53±0.01 (966) 1.55±0.01 (1,439) 5.4 0.0046 HDL-C (mmol/l) 1.16±0.26 (156) 1.20±0.01 (961) 1.20±0.01 (1,427) 1.1 0.34 LDL-C (mmol/l) 4.26±0.86 (154) 4.08±0.03 (951) 4.05±0.03 (1,415) 0.26 0.038 TC (mmol/l) 6.24±0.09 (157) 6.04±0.04 (969) 6.01±0.03 (1,439) 3.02 0.049 TGa (mmol/l) 1.87±0.11 (157) 1.71±0.04 (969) 1.72±0.03 (1,441) 1.38 0.25 a Log-transformed traits k.embl-heidelberg.de/PolyPhen/) (Ramensky et al. 2002) for five coding SNPs (cSNPs) in ABCA1 (R219K rs2230806; V771M rs2066718; V825I rs4149312; I883M rs2066714; R1587K rs2230808) (Frikke-Schmidt et al. 2004). Login to comment
128 As a control we also tested the APOE-e4 (R130C rs428358) variant. Login to comment
153 MI Myocardial infarction R219K (rs2230806) KK RK RR P value Smokers MI 29 (0.05) 205 (0.39) 293 (0.56) 0.98 Controls 24 (0.06) 162 (0.38) 236 (0.56) Non-smokers MI 35 (0.06) 198 (0.36) 314 (0.57) 0.87 Controls 67 (0.67) 377 (0.37) 566 (0.56) I883M (rs4149313) II IM MM Smokers MI 418 (0.76) 127 (0.23) 4 (0.01) 0.14 Controls 349 (0.81) 77 (0.18) 3 (0.01) Non-smokers MI 445 (0.78) 115 (0.2) 12(.02) 0.31 Controls 843 (0.81) 184 (0.18) 16 (0.02) R1587K (rs2230808) (rs2230808) KK RK RR Smokers MI 29 (0.05) 160 (0.30) 342 (0.64) 0.025 Controls 14 (0.03) 159 (0.38) 250 (0.59) Non-smokers MI 25 (0.04) 182 (0.33) 346 (0.62) 0.66 Controls 57 (0.05) 329 (0.32) 650 (0.63) also serve as a point to revisit in large published studies, such as that of Frikke-Schmidt et al. (2004). Login to comment
159 Fig. 2 Diplotype analysis of quantitative traits considering the joint contributions of the R219K and R1587K variants. Login to comment
160 Categories represent the diplotype configurations of each individual from among four possible haplotypes (RR, KK, RK, and KR, where R219K is at the first position). Login to comment
164 The highest trait levels occur in individuals that are homozygous for the K variant of R219K and homozygous for the R variant of R1587K. Login to comment
166 Among discovered and examined variable sites, the best evidence for potentially functional polymorphism is for the commonly studied R219K and R1587K variants (Tregouet et al. 2004). Login to comment
6 No other genetic markers in ABCA1 exhibit effects as large as R219K, although a modest independent effect of R1587K was observed. Login to comment
39 Genotyping Information on the R219K, I883M, and R1587K variants [representing cDNA (GenBank accession number NM_005502.2) rs2230806, c.658 G>A; rs4149313, c.2650 A>G; rs2230808, c.4762 G>A, respectively] may be found at dbSNP (http://www.ncbi.nlm.nih.gov/ SNP/). Login to comment
74 A significant effect of the R219K variant on CSF Ab1-42 levels was observed whereby RK heterozygotes had the highest trait levels (547&#b1;19.2, n=141; 658&#b1;35.1, n=71; 443&#b1;60.6, n=4; F2,212=6.2, P=0.0024, for RR, RK, and KK genotype classes, respectively; pg/ ml &#b1;SEM). Login to comment
90 In an initial screen, we tested the R219K variant using ANOVA for effects upon these selected traits in the entire set of samples. Login to comment
124 To explore the possible functional effects of ABCA1 variants, we used the PolyPhen tool (http://www.bor Table 1 Quantitative trait analyses for the R219K variant. Login to comment
129 The number of individuals in each category is shown in parenthesis. Comparisons were performed by ANOVATC total cholesterol, LDL-C low density lipoprotein cholesterol Traits KK RK RR F value P value APOA1a (g/l) 1.46&#b1;0.02 (157) 1.48&#b1;0.01 (966) 1.47&#b1;0.01 (1,439) 0.23 0.79 APOB (g/l) 1.64&#b1;0.03 (157) 1.53&#b1;0.01 (966) 1.55&#b1;0.01 (1,439) 5.4 0.0046 HDL-C (mmol/l) 1.16&#b1;0.26 (156) 1.20&#b1;0.01 (961) 1.20&#b1;0.01 (1,427) 1.1 0.34 LDL-C (mmol/l) 4.26&#b1;0.86 (154) 4.08&#b1;0.03 (951) 4.05&#b1;0.03 (1,415) 0.26 0.038 TC (mmol/l) 6.24&#b1;0.09 (157) 6.04&#b1;0.04 (969) 6.01&#b1;0.03 (1,439) 3.02 0.049 TGa (mmol/l) 1.87&#b1;0.11 (157) 1.71&#b1;0.04 (969) 1.72&#b1;0.03 (1,441) 1.38 0.25 a Log-transformed traits k.embl-heidelberg.de/PolyPhen/) (Ramensky et al. 2002) for five coding SNPs (cSNPs) in ABCA1 (R219K rs2230806; V771M rs2066718; V825I rs4149312; I883M rs2066714; R1587K rs2230808) (Frikke-Schmidt et al. 2004). Login to comment
155 MI Myocardial infarction R219K (rs2230806) KK RK RR P value Smokers MI 29 (0.05) 205 (0.39) 293 (0.56) 0.98 Controls 24 (0.06) 162 (0.38) 236 (0.56) Non-smokers MI 35 (0.06) 198 (0.36) 314 (0.57) 0.87 Controls 67 (0.67) 377 (0.37) 566 (0.56) I883M (rs4149313) II IM MM Smokers MI 418 (0.76) 127 (0.23) 4 (0.01) 0.14 Controls 349 (0.81) 77 (0.18) 3 (0.01) Non-smokers MI 445 (0.78) 115 (0.2) 12(.02) 0.31 Controls 843 (0.81) 184 (0.18) 16 (0.02) R1587K (rs2230808) (rs2230808) KK RK RR Smokers MI 29 (0.05) 160 (0.30) 342 (0.64) 0.025 Controls 14 (0.03) 159 (0.38) 250 (0.59) Non-smokers MI 25 (0.04) 182 (0.33) 346 (0.62) 0.66 Controls 57 (0.05) 329 (0.32) 650 (0.63) also serve as a point to revisit in large published studies, such as that of Frikke-Schmidt et al. (2004). Login to comment
161 Fig. 2 Diplotype analysis of quantitative traits considering the joint contributions of the R219K and R1587K variants. Login to comment
162 Categories represent the diplotype configurations of each individual from among four possible haplotypes (RR, KK, RK, and KR, where R219K is at the first position). Login to comment
168 Among discovered and examined variable sites, the best evidence for potentially functional polymorphism is for the commonly studied R219K and R1587K variants (Tregouet et al. 2004). Login to comment

[hide] Lack of ABCA1 considerably decreases brain ApoE le... J Biol Chem. 2005 Dec 30;280(52):43224-35. Epub 2005 Oct 5. Koldamova R, Staufenbiel M, Lefterov I
Lack of ABCA1 considerably decreases brain ApoE level and increases amyloid deposition in APP23 mice.
J Biol Chem. 2005 Dec 30;280(52):43224-35. Epub 2005 Oct 5., [PMID:16207713]

Abstract [show]
ABCA1 (ATP-binding cassette transporter A1) is a major regulator of cholesterol efflux and high density lipoprotein (HDL) metabolism. Mutations in human ABCA1 cause severe HDL deficiencies characterized by the virtual absence of apoA-I and HDL and prevalent atherosclerosis. Recently, it has been reported that the lack of ABCA1 causes a significant reduction of apoE protein level in the brain of ABCA1 knock-out (ABCA1-/-) mice. ApoE isoforms strongly affect Alzheimer disease (AD) pathology and risk. To determine further the effect of ABCA1 on amyloid deposition, we used APP23 transgenic mice in which the human familial Swedish AD mutant is expressed only in neurons. We demonstrated that the targeted disruption of ABCA1 increases amyloid deposition in APP23 mice, and the effect is manifested by an increased level of Abeta immunoreactivity, as well as thioflavine S-positive plaques in brain parenchyma. We found that the lack of ABCA1 also considerably increased the level of cerebral amyloid angiopathy and exacerbated cerebral amyloid angiopathy-related microhemorrhage in APP23/ABCA1-/- mice. Remarkably, the elevation in parenchymal and vascular amyloid in APP23/ABCA1-/- mice was accompanied by a dramatic decrease in the level of soluble brain apoE, although insoluble apoE was not changed. The elevation of insoluble Abeta fraction in old APP23/ABCA1-/- mice, accompanied by a lack of changes in APP processing and soluble beta-amyloid in young APP23/ABCA1-/- animals, supports the conclusion that the ABCA1 deficiency increases amyloid deposition. These results suggest that ABCA1 plays a role in the pathogenesis of parenchymal and cerebrovascular amyloid pathology and thus may be considered a therapeutic target in AD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
233 Wollmer et al. (20) found that the R219K variant of ABCA1, associated with increased HDL-cholesterol levels and a decreased risk of atherosclerosis (43), delayed the age of onset of LOAD. Login to comment
229 Wollmer et al. (20) found that the R219K variant of ABCA1, associated with increased HDL-cholesterol levels and a decreased risk of atherosclerosis (43), delayed the age of onset of LOAD. Login to comment

[hide] The absence of ABCA1 decreases soluble ApoE levels... J Biol Chem. 2005 Dec 30;280(52):43243-56. Epub 2005 Oct 5. Hirsch-Reinshagen V, Maia LF, Burgess BL, Blain JF, Naus KE, McIsaac SA, Parkinson PF, Chan JY, Tansley GH, Hayden MR, Poirier J, Van Nostrand W, Wellington CL
The absence of ABCA1 decreases soluble ApoE levels but does not diminish amyloid deposition in two murine models of Alzheimer disease.
J Biol Chem. 2005 Dec 30;280(52):43243-56. Epub 2005 Oct 5., [PMID:16207707]

Abstract [show]
ABCA1, a cholesterol transporter expressed in the brain, has been shown recently to be required to maintain normal apoE levels and lipidation in the central nervous system. In addition, ABCA1 has been reported to modulate beta-amyloid (Abeta) production in vitro. These observations raise the possibility that ABCA1 may play a role in the pathogenesis of Alzheimer disease. Here we report that the deficiency of ABCA1 does not affect soluble or guanidine-extractable Abeta levels in Tg-SwDI/B or amyloid precursor protein/presenilin 1 (APP/PS1) mice, but rather is associated with a dramatic reduction in soluble apoE levels in brain. Although this reduction in apoE was expected to reduce the amyloid burden in vivo, we observed that the parenchymal and vascular amyloid load was increased in Tg-SwDI/B animals and was not diminished in APP/PS1 mice. Furthermore, we observed an increase in the proportion of apoE retained in the insoluble fraction, particularly in the APP/PS1 model. These data suggested that ABCA1-mediated effects on apoE levels and lipidation influenced amyloidogenesis in vivo.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
335 Wollmer et al. (74) reported that the R219K gain-of-function single nucleotide polymorphism in ABCA1 (R219K) has been suggested to delay the age of onset of AD by 1.6 years. Login to comment
336 Katzov et al. (75) reported significant associations with the R219K, R1587K, and V771M on AD in single marker and haplotype analyses conducted on European subjects. Login to comment
337 Katzov et al. (75) reported significant associations with the R219K, R1587K, and V771M on AD in single marker and haplotype analyses conducted on European subjects. Login to comment

[hide] Common polymorphisms of ATP binding cassette trans... Atherosclerosis. 2005 Dec;183(2):199-212. Epub 2005 Jun 2. Hodoglugil U, Williamson DW, Huang Y, Mahley RW
Common polymorphisms of ATP binding cassette transporter A1, including a functional promoter polymorphism, associated with plasma high density lipoprotein cholesterol levels in Turks.
Atherosclerosis. 2005 Dec;183(2):199-212. Epub 2005 Jun 2., [PMID:15935359]

Abstract [show]
The role of high levels of high density lipoprotein cholesterol (HDL-C) in protection against development of atherosclerosis is generally attributed to its role in reverse cholesterol transport, and the ATP binding cassette transporter A1 (ABCA1) is a key element of this process. We examined polymorphisms in ABCA1 in Turks, a population characterized by very low HDL-C levels. We discovered 36 variations in ABCA1 and genotyped informative polymorphisms in over 2,300 subjects. The rare alleles of C-14T and V771M polymorphisms were associated with higher HDL-C levels in men and, in combination with the rare alleles of R219K and I883M, respectively, with higher HDL-C in both sexes. Rare alleles of the C-14T and V771M polymorphisms were more frequent in the high HDL-C (>OR=40mg/dl) than in the low HDL-C group (<OR=30mg/dl) in men (P<0.05). Moreover, the T allele of C-14T had more in vitro transcriptional activity than the C allele (20-88%), depending on the cell line (P<0.05), suggesting its functionality. Haplotype construction and haplotype association with phenotype were performed in the promoter and coding region of ABCA1 separately. Analysis of the promoter haplotype block supported the association with the C-14T polymorphism. The C-14T and R219K polymorphisms were on different haplotype blocks. Analysis of the coding region structure revealed that the rare M allele of V771M was distributed predominantly among three common haplotypes, but the sum of their frequencies comprise only two-thirds of the frequency of the M allele. The rare alleles of the V771M and the I883M polymorphisms do not exist together on any of the common haplotypes. In conclusion, we describe a functional promoter polymorphism (C-14T) and a coding sequence variant (V771M) of ABCA1 and their interactions with two other variants (R219K and I883M) on plasma HDL-C levels in Turks.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 The rare alleles of C-14T and V771M polymorphisms were associated with higher HDL-C levels in men and, in combination with the rare alleles of R219K and I883M, respectively, with higher HDL-C in both sexes. Login to comment
8 The C-14T and R219K polymorphisms were on different haplotype blocks. Login to comment
11 In conclusion, we describe a functional promoter polymorphism (C-14T) and a coding sequence variant (V771M) of ABCA1 and their interactions with two other variants (R219K and I883M) on plasma HDL-C levels in Turks. Login to comment
21 Some common polymorphisms of ABCA1, including R219K 0021-9150/$ - see front matter (c) 2005 Elsevier Ireland Ltd. All rights reserved. Login to comment
31 In onestudy,wheremalesandfemaleswereanalyzedseparately, R219K and I883M were associated with elevated HDL-C levels in females only [9]. Login to comment
104 The G-803A Table 2 ABCA1 polymorphisms Nucleotide changea Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in 5 and promoter regions G-803A ~10 92/141 [19] T-564C 72.7 47.7 728/1268 [18] G-407C 62.5 40.7 220/233 [18] G-99C 42.2 24.2 875/1130 [46] C-14T 61.2 37.7 916/1416 [46] InsG 319 26.6 14.2 848/1288 [46] Nucleotide changed Amino acid change Exon Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in coding sequence Nonsynonymous G(70943)A R219K 7 62.3 38.5 996/1466 db 2230806 G(102555)A V771M 16 10.0 5.1 981/1477 db 2066718 G(103777)A V825I 17 12.3 6.2 960/1145 db 4149312 A(105057)G I883M 18 38.1 21.8 1084/1448 db 4149313 G(112177)C E1172D 24 9.0 4.6 1001/1237 [12,13] A(116887)G Q1328R 28 0.003e 0.0015 172/156 NR G(129004)A R1587K 35 55.1 33.0 937/1351 db 2230808 T(133402)C Y1767H 39 ~1.0e 40/55 NR G(133420)A V1773M 39 ~1.0e 40/55 NR Synonymous C(100538)A I620I 15 ~4.0 40/55 NR C(109469)T V990V 21 ~3.0 87/90 [17] T(109861)G V1053V 22 ~1.0 90/90 [12] C(109868)T L1056L 22 ~5.0 90/90 NR C(109906)T R1068R 22 ~3.0 90/90 NR A(113280)G E1211E 25 ~4.0 40/55 [17] A(116879)G T1325T 28 ~1.0 40/55 NR T(137043)C Y1921Y 43 ~1.0 40/55 NR Nucleotide changed Intron Carrier of rare allele (%) Intronic location nb Referencesc Frequency in noncoding sequence G(23816)A 1 ~1.0 11 bp 5 exon 1b 94 NR G(23819)C 1 42 8 bp 5 exon 1b 94 NR A(22997)T 1 46 90 bp 5 exon 1d 91 NR A(23004)G 1 ~1.0 83 bp 5 exon 1d 91 NR G(23058)C 1 46 29 bp 5 exon 1d 91 NR G(40504)A 3 2.6 26 bp 3 of exon 3 192 NR C(45217)T 4 0.7 64 bp 3 of exon 4 142 NR T(98628)A 14 35-40 24 bp 3 of exon 14 190 db 4743763 C(100332)T 14 4.3 59 bp 5 of exon 15 90 db 2066717 C(108020)T 19 0.7 3 bp 5 of exon 20 144 NR DelTTT(134503-6) 39 7.0 20-23 bp 5 of exon 40 90 NR C(142026)T 46 8.6 34 bp 5 of exon 47 116 NR A(142751)G 48 15.9 13 bp 3 of exon 48 107 NR a Relative to transcriptional start. Login to comment
109 Table 3 ABCA1 polymorphisms and mean plasma HDL-C levels (mg/dl ± S.D.) in a random Turkish population Females Males AAa AB BB AAa AB BB Promoter and 5 region T-564C 40.4 ± 8.4 (205) 41.0 ± 7.9 (365) 39.9 ± 7.6 (158) 35.6 ± 7.4 (339) 35.5 ± 6.5 (635) 34.9 ± 6.5 (294) G-407C 41.3 ± 11.2 (82) 40.7 ± 7.7 (101) 40.7 ± 12.2 (37) 35.7 ± 6.9 (88) 35.3 ± 6.7 (96) 35.4 ± 7.4 (49) G-99C 40.7 ± 7.5 (505) 41.0 ± 7.2 (317) 41.3 ± 8.4 (53) 35.1 ± 6.5 (654) 35.0 ± 6.3 (405) 34.9 ± 6.5 (71) C-14T 41.3 ± 9.0 (361) 41.0 ± 9.0 (417) 41.0 ± 9.4 (138) 34.8 ± 7.0b (547) 35.5 ± 7.5 (675) 36.7 ± 8.1b (194) InsG 319 41.3 ± 8.1 (641) 40.5 ± 7.7 (193) 43.1 ± 8.0 (14) 35.3 ± 6.4 (933) 34.7 ± 6.4 (332) 34.5 ± 6.5 (23) Nonsynonymous R219K 41.2 ± 9.4 (364) 40.8 ± 8.6 (480) 41.2 ± 10 (152) 35.2 ± 7.3 (574) 35.3 ± 7.3 (688) 35.2 ± 7.6 (204) V771M 40.9 ± 9.2 (896) 42.8 ± 9.3 (82) 38.7 ± 10 (3) 35.1 ± 7.2c (1330) 37.1 ± 8.0c (144) 45.7 ± 10.7 (3) V825I 40.6 ± 9.4 (842) 38.9 ± 8.5 (117) 42 (1) 35.8 ± 8.7 (1005) 37.1 ± 9.5 (140) (-) I883M 41.1 ± 9.5 (643) 40.8 ± 8.4 (372) 41.4 ± 9.1 (69) 35.0 ± 7.0 (922) 35.7 ± 8.0 (457) 35.6 ± 7.4 (69) E1172D 40.5 ± 8.8 (907) 40.5 ± 7.6 (93) 29 (1) 34.6 ± 7.3 (1129) 35.4 ± 7.6 (105) 30.7 ± 8.7 (3) R1587K 41.1 ± 9.4 (410) 40.8 ± 9.6 (433) 41.0 ± 10.1 (94) 35.9 ± 8.1 (617) 35.1 ± 7.6 (579) 35.3 ± 8.6 (155) Numbers of subjects are shown in parenthesis. Login to comment
116 Informative associations between HDL-C levels and the R219K, V771M, and I883M polymorphisms will be discussed. Login to comment
168 Effect of combined ABCA1 polymorphisms on HDL-C levels in a random Turkish population The R219K and I883M polymorphisms have been shown to affect lipid metabolism or CAD risk [9,10,12,15,43]. Login to comment
170 In contrast, the combinations of C-14T with R219K and of V771M with I883M were associated with altered HDL-C levels. Login to comment
171 As shown in Table 4, subjects were stratified according to their R219K genotype (RR, RK, or KK) versus C-14T (CC, CT, or TT). Login to comment
181 Separate haplotype blocks of ABCA1 In order to assess whether the length of the ABCA1 locus could be treated as a single haplotype block, haplotypes were constructed and significant LDs between polymorphisms were calculated using 10 common ABCA1 polymorphisms Table 4 Interactive effects of ABCA1 polymorphisms on mean plasma HDL-C levels (mg/dl ± S.D.) R219K C-14T Females Males RR CC 41.4 ± 8.5 (128) 34.7 ± 6.7 (207) CT 41.6 ± 9.8 (150) 35.7 ± 7.6 (253) TT 41.3 ± 8.9 (55) 36.3 ± 7.8 (84) RK CC 41.8 ± 8.3 (169) 34.8 ± 7.4 (261) CT 39.9 ± 8.3 (203) 35.5 ± 6.8 (309) TT 39.5 ± 9.0 (60) 36.8 ± 8.5 (84) KK CC 39.8 ± 11.2 (60) 34.0 ± 6.2 (69) CT 41.1 ± 9.0 (60) 35.7 ± 8.4 (102) TT 44.7 ± 9.8a (22) 37.1 ± 7.8a (22) I883M V771M II VV 40.9 ± 9.8 (499) 34.8 ± 6.8 (797) VM 41.4 ± 8.3 (74) 36.7 ± 8.3b (112) IM VV 40.3 ± 8.0 (313) 35.1 ± 8.1 (427) VM 44.2 ± 11.5b (17) 37.3 ± 7.4b (26) MM VV 41.6 ± 9.2 (60) 35.6 ± 7.5 (67) Numbers of subjects are shown in parenthesis. Login to comment
204 However, further analysis Table 5 Allele frequency and significant (P < 0.01) pair-wise linkage disequilibrium coefficients between the ABCA1 polymorphisms in a random Turkish population Position Allele % T-564C G-99C C-14T InsG 319 R219K V771M V825I I883M E1172D R1587K T-564C 52.3/47.7 - G-99C 75.8/24.2 0.36 - C-14T 62.3/37.7 -0.96 -0.98 - InsG 319 85.8/14.2 - - - - R219K 61.5/38.5 - - - - V771M 94.9/5.1 - - - 0.99 - V825I 93.8/6.2 -0.40 -0.69 - - -0.76 - - I883M 78.2/21.8 - -0.42 - - 0.20 -0.79 0.91 - E1172D 95.4/4.6 - - - - - 0.34 - - - R1587K 67.0/33.0 - - -0.23 - - 0.56 - - 0.87 - Table 6 Common haplotypes of promoter and coding regions of ABCA1 gene in a random Turkish population Promoter region haplotypes % T-564C G-99C C-14T InsG 319 1 31.7 0 0 1 0 2 20.1 1 1 0 0 3 19.9 1 0 0 0 4 12.7 0 0 0 0 5 4.6 0 0 1 1 6 4.2 1 1 0 1 7 3.2 1 0 0 1 8 2.5 0 0 0 1 Sum 98.9 Coding region haplotypes % R219K V771M V825I I883M E1172D R1587K 1 39.3 0 0 0 0 0 0 2 12.6 1 0 0 0 0 0 3 12.0 0 0 0 0 0 1 4 8.7 1 0 0 1 0 0 5 8.3 1 0 0 0 0 1 6 4.0 0 0 1 1 0 0 7 3.4 0 0 0 0 1 1 8 1.6 1 0 0 1 0 1 9 1.3 1 1 0 0 0 0 10 1.3 0 1 0 0 1 1 11 1.3 0 0 1 1 0 1 12 1.1 1 1 0 0 0 1 Sum 95.1 0: common allele; 1: rare allele. Login to comment
209 We observed an interaction between the C-14T and R219K polymorphisms (Table 4). Login to comment
210 In an effort to construct haplotypes including these two polymorphisms, a haplotype block including five polymorphisms (T-564C, G-99C, C-14T, InsG 319, and R219K) was used for mapping. Login to comment
213 Therefore, haplotype-to-phenotype associations containing the C-14T and R219K polymorphisms within the same block could not be conducted. Login to comment
215 Haplotype structure and haplotype-phenotype association of polymorphisms in the coding region of ABCA1 When the haplotype structure of the coding region was constructed using six polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K; Table 6), 12 haplotypes with a frequency >1% accounted for 95.1% of all haplotypes. Login to comment
231 There was negative LD (rare allele to common allele) between I883M and V771M as seen in Table 4. Login to comment
232 The R219K, C-14T, and V771M polymorphisms were not in LD in the Turkish population. Login to comment
279 In the analysis of covariance, where the sources of variance on plasma HDL-C levels were examined, introduction of interaction variables (smoking or alcohol consumption) × (C-14T or V771M) to the model showed that neither parameter modulated (P > 0.05) the effect of polymorphisms on HDL-C levels in males or females or when data for both genders were pooled. Login to comment
280 However, we are able to see an association with elevated HDL-C in females through the combined effect between C-14T and R219K. Login to comment
282 We tried to examine the combined effect of the C-14T and R219K polymorphisms by examining the haplotypes that contain these two rare allele genotypes; unfortunately, haplotype construction was complicated by an inability to predict a unique set of diplotypes. Login to comment
283 This prevented further statistical association of haplotypes that include both the C-14T and the R219K polymorphisms in the same haplotype block. Login to comment
284 R219K by itself did not affect plasma lipid levels in Turks and Danes [17]. Login to comment
288 On the other hand, the R219K polymorphism did not affect the severity of coronary atherosclerosis in the Veterans Administration HDL Cholesterol Intervention Trial [13] or in Japanese CAD patients [14]. Login to comment
289 In Turks, the interaction of C-14T and R219K may play a role in altering plasma HDL-C levels and possibly CAD risk. Login to comment
304 A functional promoter polymorphism, C-14T, and a coding sequence polymorphism, V771M, in the ABCA1 gene appeared to affect HDL-C levels in Turks and these results could be replicated when our entire data set was randomly divided in two different subsets (Supplemental Table II). Login to comment
305 Two combinations of rare alleles-C-14T with R219K and V771M with I883M-were associated with high HDL-C in both males and females. Login to comment
103 The G-803A Table 2 ABCA1 polymorphisms Nucleotide changea Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in 5 and promoter regions G-803A ~10 92/141 [19] T-564C 72.7 47.7 728/1268 [18] G-407C 62.5 40.7 220/233 [18] G-99C 42.2 24.2 875/1130 [46] C-14T 61.2 37.7 916/1416 [46] InsG 319 26.6 14.2 848/1288 [46] Nucleotide changed Amino acid change Exon Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in coding sequence Nonsynonymous G(70943)A R219K 7 62.3 38.5 996/1466 db 2230806 G(102555)A V771M 16 10.0 5.1 981/1477 db 2066718 G(103777)A V825I 17 12.3 6.2 960/1145 db 4149312 A(105057)G I883M 18 38.1 21.8 1084/1448 db 4149313 G(112177)C E1172D 24 9.0 4.6 1001/1237 [12,13] A(116887)G Q1328R 28 0.003e 0.0015 172/156 NR G(129004)A R1587K 35 55.1 33.0 937/1351 db 2230808 T(133402)C Y1767H 39 ~1.0e 40/55 NR G(133420)A V1773M 39 ~1.0e 40/55 NR Synonymous C(100538)A I620I 15 ~4.0 40/55 NR C(109469)T V990V 21 ~3.0 87/90 [17] T(109861)G V1053V 22 ~1.0 90/90 [12] C(109868)T L1056L 22 ~5.0 90/90 NR C(109906)T R1068R 22 ~3.0 90/90 NR A(113280)G E1211E 25 ~4.0 40/55 [17] A(116879)G T1325T 28 ~1.0 40/55 NR T(137043)C Y1921Y 43 ~1.0 40/55 NR Nucleotide changed Intron Carrier of rare allele (%) Intronic location nb Referencesc Frequency in noncoding sequence G(23816)A 1 ~1.0 11 bp 5 exon 1b 94 NR G(23819)C 1 42 8 bp 5 exon 1b 94 NR A(22997)T 1 46 90 bp 5 exon 1d 91 NR A(23004)G 1 ~1.0 83 bp 5 exon 1d 91 NR G(23058)C 1 46 29 bp 5 exon 1d 91 NR G(40504)A 3 2.6 26 bp 3 of exon 3 192 NR C(45217)T 4 0.7 64 bp 3 of exon 4 142 NR T(98628)A 14 35-40 24 bp 3 of exon 14 190 db 4743763 C(100332)T 14 4.3 59 bp 5 of exon 15 90 db 2066717 C(108020)T 19 0.7 3 bp 5 of exon 20 144 NR DelTTT(134503-6) 39 7.0 20-23 bp 5 of exon 40 90 NR C(142026)T 46 8.6 34 bp 5 of exon 47 116 NR A(142751)G 48 15.9 13 bp 3 of exon 48 107 NR a Relative to transcriptional start. Login to comment
108 Table 3 ABCA1 polymorphisms and mean plasma HDL-C levels (mg/dl &#b1; S.D.) in a random Turkish population Females Males AAa AB BB AAa AB BB Promoter and 5 region T-564C 40.4 &#b1; 8.4 (205) 41.0 &#b1; 7.9 (365) 39.9 &#b1; 7.6 (158) 35.6 &#b1; 7.4 (339) 35.5 &#b1; 6.5 (635) 34.9 &#b1; 6.5 (294) G-407C 41.3 &#b1; 11.2 (82) 40.7 &#b1; 7.7 (101) 40.7 &#b1; 12.2 (37) 35.7 &#b1; 6.9 (88) 35.3 &#b1; 6.7 (96) 35.4 &#b1; 7.4 (49) G-99C 40.7 &#b1; 7.5 (505) 41.0 &#b1; 7.2 (317) 41.3 &#b1; 8.4 (53) 35.1 &#b1; 6.5 (654) 35.0 &#b1; 6.3 (405) 34.9 &#b1; 6.5 (71) C-14T 41.3 &#b1; 9.0 (361) 41.0 &#b1; 9.0 (417) 41.0 &#b1; 9.4 (138) 34.8 &#b1; 7.0b (547) 35.5 &#b1; 7.5 (675) 36.7 &#b1; 8.1b (194) InsG 319 41.3 &#b1; 8.1 (641) 40.5 &#b1; 7.7 (193) 43.1 &#b1; 8.0 (14) 35.3 &#b1; 6.4 (933) 34.7 &#b1; 6.4 (332) 34.5 &#b1; 6.5 (23) Nonsynonymous R219K 41.2 &#b1; 9.4 (364) 40.8 &#b1; 8.6 (480) 41.2 &#b1; 10 (152) 35.2 &#b1; 7.3 (574) 35.3 &#b1; 7.3 (688) 35.2 &#b1; 7.6 (204) V771M 40.9 &#b1; 9.2 (896) 42.8 &#b1; 9.3 (82) 38.7 &#b1; 10 (3) 35.1 &#b1; 7.2c (1330) 37.1 &#b1; 8.0c (144) 45.7 &#b1; 10.7 (3) V825I 40.6 &#b1; 9.4 (842) 38.9 &#b1; 8.5 (117) 42 (1) 35.8 &#b1; 8.7 (1005) 37.1 &#b1; 9.5 (140) (-) I883M 41.1 &#b1; 9.5 (643) 40.8 &#b1; 8.4 (372) 41.4 &#b1; 9.1 (69) 35.0 &#b1; 7.0 (922) 35.7 &#b1; 8.0 (457) 35.6 &#b1; 7.4 (69) E1172D 40.5 &#b1; 8.8 (907) 40.5 &#b1; 7.6 (93) 29 (1) 34.6 &#b1; 7.3 (1129) 35.4 &#b1; 7.6 (105) 30.7 &#b1; 8.7 (3) R1587K 41.1 &#b1; 9.4 (410) 40.8 &#b1; 9.6 (433) 41.0 &#b1; 10.1 (94) 35.9 &#b1; 8.1 (617) 35.1 &#b1; 7.6 (579) 35.3 &#b1; 8.6 (155) Numbers of subjects are shown in parenthesis. Login to comment
115 Informative associations between HDL-C levels and the R219K, V771M, and I883M polymorphisms will be discussed. Login to comment
167 Effect of combined ABCA1 polymorphisms on HDL-C levels in a random Turkish population The R219K and I883M polymorphisms have been shown to affect lipid metabolism or CAD risk [9,10,12,15,43]. Login to comment
169 In contrast, the combinations of C-14T with R219K and of V771M with I883M were associated with altered HDL-C levels. Login to comment
180 Separate haplotype blocks of ABCA1 In order to assess whether the length of the ABCA1 locus could be treated as a single haplotype block, haplotypes were constructed and significant LDs between polymorphisms were calculated using 10 common ABCA1 polymorphisms Table 4 Interactive effects of ABCA1 polymorphisms on mean plasma HDL-C levels (mg/dl &#b1; S.D.) R219K C-14T Females Males RR CC 41.4 &#b1; 8.5 (128) 34.7 &#b1; 6.7 (207) CT 41.6 &#b1; 9.8 (150) 35.7 &#b1; 7.6 (253) TT 41.3 &#b1; 8.9 (55) 36.3 &#b1; 7.8 (84) RK CC 41.8 &#b1; 8.3 (169) 34.8 &#b1; 7.4 (261) CT 39.9 &#b1; 8.3 (203) 35.5 &#b1; 6.8 (309) TT 39.5 &#b1; 9.0 (60) 36.8 &#b1; 8.5 (84) KK CC 39.8 &#b1; 11.2 (60) 34.0 &#b1; 6.2 (69) CT 41.1 &#b1; 9.0 (60) 35.7 &#b1; 8.4 (102) TT 44.7 &#b1; 9.8a (22) 37.1 &#b1; 7.8a (22) I883M V771M II VV 40.9 &#b1; 9.8 (499) 34.8 &#b1; 6.8 (797) VM 41.4 &#b1; 8.3 (74) 36.7 &#b1; 8.3b (112) IM VV 40.3 &#b1; 8.0 (313) 35.1 &#b1; 8.1 (427) VM 44.2 &#b1; 11.5b (17) 37.3 &#b1; 7.4b (26) MM VV 41.6 &#b1; 9.2 (60) 35.6 &#b1; 7.5 (67) Numbers of subjects are shown in parenthesis. Login to comment
203 However, further analysis Table 5 Allele frequency and significant (P < 0.01) pair-wise linkage disequilibrium coefficients between the ABCA1 polymorphisms in a random Turkish population Position Allele % T-564C G-99C C-14T InsG 319 R219K V771M V825I I883M E1172D R1587K T-564C 52.3/47.7 - G-99C 75.8/24.2 0.36 - C-14T 62.3/37.7 -0.96 -0.98 - InsG 319 85.8/14.2 - - - - R219K 61.5/38.5 - - - - V771M 94.9/5.1 - - - 0.99 - V825I 93.8/6.2 -0.40 -0.69 - - -0.76 - - I883M 78.2/21.8 - -0.42 - - 0.20 -0.79 0.91 - E1172D 95.4/4.6 - - - - - 0.34 - - - R1587K 67.0/33.0 - - -0.23 - - 0.56 - - 0.87 - Table 6 Common haplotypes of promoter and coding regions of ABCA1 gene in a random Turkish population Promoter region haplotypes % T-564C G-99C C-14T InsG 319 1 31.7 0 0 1 0 2 20.1 1 1 0 0 3 19.9 1 0 0 0 4 12.7 0 0 0 0 5 4.6 0 0 1 1 6 4.2 1 1 0 1 7 3.2 1 0 0 1 8 2.5 0 0 0 1 Sum 98.9 Coding region haplotypes % R219K V771M V825I I883M E1172D R1587K 1 39.3 0 0 0 0 0 0 2 12.6 1 0 0 0 0 0 3 12.0 0 0 0 0 0 1 4 8.7 1 0 0 1 0 0 5 8.3 1 0 0 0 0 1 6 4.0 0 0 1 1 0 0 7 3.4 0 0 0 0 1 1 8 1.6 1 0 0 1 0 1 9 1.3 1 1 0 0 0 0 10 1.3 0 1 0 0 1 1 11 1.3 0 0 1 1 0 1 12 1.1 1 1 0 0 0 1 Sum 95.1 0: common allele; 1: rare allele. Login to comment
208 We observed an interaction between the C-14T and R219K polymorphisms (Table 4). Login to comment
212 Therefore, haplotype-to-phenotype associations containing the C-14T and R219K polymorphisms within the same block could not be conducted. Login to comment
214 Haplotype structure and haplotype-phenotype association of polymorphisms in the coding region of ABCA1 When the haplotype structure of the coding region was constructed using six polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K; Table 6), 12 haplotypes with a frequency >1% accounted for 95.1% of all haplotypes. Login to comment
281 We tried to examine the combined effect of the C-14T and R219K polymorphisms by examining the haplotypes that contain these two rare allele genotypes; unfortunately, haplotype construction was complicated by an inability to predict a unique set of diplotypes. Login to comment
287 On the other hand, the R219K polymorphism did not affect the severity of coronary atherosclerosis in the Veterans Administration HDL Cholesterol Intervention Trial [13] or in Japanese CAD patients [14]. Login to comment

[hide] Accurate prediction of the functional significance... PLoS Genet. 2005 Dec;1(6):e83. Epub 2005 Dec 30. Brunham LR, Singaraja RR, Pape TD, Kejariwal A, Thomas PD, Hayden MR
Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene.
PLoS Genet. 2005 Dec;1(6):e83. Epub 2005 Dec 30., [PMID:16429166]

Abstract [show]
The human genome contains an estimated 100,000 to 300,000 DNA variants that alter an amino acid in an encoded protein. However, our ability to predict which of these variants are functionally significant is limited. We used a bioinformatics approach to define the functional significance of genetic variation in the ABCA1 gene, a cholesterol transporter crucial for the metabolism of high density lipoprotein cholesterol. To predict the functional consequence of each coding single nucleotide polymorphism and mutation in this gene, we calculated a substitution position-specific evolutionary conservation score for each variant, which considers site-specific variation among evolutionarily related proteins. To test the bioinformatics predictions experimentally, we evaluated the biochemical consequence of these sequence variants by examining the ability of cell lines stably transfected with the ABCA1 alleles to elicit cholesterol efflux. Our bioinformatics approach correctly predicted the functional impact of greater than 94% of the naturally occurring variants we assessed. The bioinformatics predictions were significantly correlated with the degree of functional impairment of ABCA1 mutations (r2 = 0.62, p = 0.0008). These results have allowed us to define the impact of genetic variation on ABCA1 function and to suggest that the in silico evolutionary approach we used may be a useful tool in general for predicting the effects of DNA variation on gene function. In addition, our data suggest that considering patterns of positive selection, along with patterns of negative selection such as evolutionary conservation, may improve our ability to predict the functional effects of amino acid variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 À;3), R219K, V771M, I883M, D1289N, and P2150L, four had cholesterol efflux values that were not statistically different from wild-type ABCA1. Login to comment
46 This included two variants, D1289N and P2150L, that have been previously reported to be disease-causing mutations [4,8,9], as well as two cSNPs, R219K and V771M. Login to comment
48 This SNP has been reported to be associated with decreased HDL cholesterol and increased severity of atherosclerosis in Table 1. subPSEC Scores and Probability of Functional Impairment (Pdeleterious) for ABCA1 Mutations and SNPs Mutations SNPs Variant SubPSEC Pdeleterious Variant subPSEC Pdeleterious P85L À4.62 0.83 R219K À0.57 0.08 H160F À2.79 0.45 V399A À2.26 0.32 R230C À4.27 0.78 V771M À2.86 0.46 A255T À1.81 0.23 T774P À1.99 0.27 E284K À2.34 0.34 K776N À3.53 0.63 Y482C À4.21 0.77 V825I À1.06 0.13 R587W À6.04 0.95 I883M À1.38 0.17 W590S À5.19 0.9 E1172D À1.96 0.26 W590L À4.48 0.82 R1587K À0.58 0.08 Q597R À7.15 0.98 S1731C À4.21 0.77 T929I À4.29 0.78 N935H À8.54 1 N935S À7.53 0.99 A937V À6.6 0.97 A1046D À7.52 0.99 M1091T À3.56 0.64 D1099Y À6.09 0.96 D1289N À2.48 0.37 L1379F À3.81 0.69 C1477R À5.44 0.92 S1506L À5.17 0.9 N1611D À5.69 0.94 R1680W À6.02 0.95 V1704D À3.21 0.55 N1800H À4.23 0.77 R1901S À5.06 0.89 F2009S À2.73 0.43 R2081W À8.08 0.99 P2150L À2.88 0.47 Q2196H À2.74 0.43 DOI: 10.1371/journal.pgen.0010083.t001 PLoS Genetics | www.plosgenetics.org December 2005 | Volume 1 | Issue 6 | e83 0740 Accurate Prediction of ABCA1 Variants Synopsis A major goal of human genetics research is to understand how genetic variation leads to differences in the function of genes. Login to comment
75 Cholesterol Efflux Values for 293 Cells Transfected with ABCA1 Variants and subPSEC and PolyPhen Predictions of the Functional Impact of these Variants Variant Variant Type subPSEC Cholesterol Efflux PolyPhen R2081W Mutation À8.08 21.1 6 21%* Probably damaging N935S Mutation À7.53 29.3 6 13%* Benign A1046D Mutation À7.52 16.8 6 7%* Possibly damaging Q597R Mutation À7.15 17.7 6 14%* Probably damaging R587W Mutation À6.04 31.7 6 33%* Probably damaging C1477R Mutation À5.44 20.5 6 10%* Probably damaging W590S Mutation À5.19 47.1 6 13%* Probably damaging S1506L Mutation À5.17 17.8 6 15%* Probably damaging T929I Mutation À4.29 69.9 6 11%* Possibly damaging N1800H Mutation À4.23 31.3 6 16%* Possibly damaging S1731C SNP À4.21 12.3 6 10%* Possibly damaging M1091T Mutation À3.56 6.9 6 20%* Probably damaging P2150L Mutation À2.88 88.4 6 21% Probably damaging V771M SNP À2.86 145.4 6 33% Benign D1289N Mutation À2.48 137.7 6 86% Benign I883M SNP À1.38 69.1 6 16%* Benign R219K SNP À0.57 103.7 6 21.05 Benign Wild-type - 0.0 100% - *p , 0.01 compared to wild-type ABCA1. Login to comment

[hide] Mutation in ABCA1 predicted risk of ischemic heart... J Am Coll Cardiol. 2005 Oct 18;46(8):1516-20. Epub 2005 Sep 23. Frikke-Schmidt R, Nordestgaard BG, Schnohr P, Steffensen R, Tybjaerg-Hansen A
Mutation in ABCA1 predicted risk of ischemic heart disease in the Copenhagen City Heart Study Population.
J Am Coll Cardiol. 2005 Oct 18;46(8):1516-20. Epub 2005 Sep 23., [PMID:16226177]

Abstract [show]
OBJECTIVES: We tested whether heterozygosity for the K776N mutation (frequency: 0.4%) in ATP-binding cassette transporter A1 (ABCA1) predicted ischemic heart disease (IHD) in the Copenhagen City Heart Study population. BACKGROUND: In a complex trait like IHD, genetic variation is considered to be conferred by common DNA polymorphisms, although rare mutations may have a larger impact. Tangier disease, a rare high-density lipoprotein cholesterol (HDL-C) deficiency syndrome with IHD, is caused by homozygous ABCA1 mutations. METHODS: We analyzed blood samples from a large cohort study of 9,076 Danish individuals followed for 24 years (167,287 person-years), during which 1,033 incident IHD events occurred. The hypothesis was retested in an independent case-control study comparing 562 IHD patients with 3,103 controls. RESULTS: The cumulative incidence of IHD as a function of age was increased in K776N heterozygotes compared with non-carriers (log-rank test: p = 0.005). At the age of 80 years, 48% of heterozygotes and 23% of non-carriers had IHD. Incidence rates in non-carriers and K776N heterozygotes were 61 and 157 per 10,000 person-years. The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5). Adjusting for HDL-C, or for smoking, diabetes, and hypertension did not change the result, suggesting that genotype predicted risk of IHD beyond that offered by HDL-C, and by other conventional risk factors. Similar trends were obtained in an independent case-control study. CONCLUSIONS: Heterozygosity for an ABCA1 mutation (K776N) conferred two- to three-fold risk of IHD in 37 participants in the Copenhagen City Heart study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 However, at the individual level, K776N appears to have a marked impact on risk. Login to comment
109 However, several arguments favor a true observation: 1) the involved amino acid residue is completely conserved between species and relatively conserved between 12 ABCAs with very different transport functions; 2) the amino acid substitution changes the charge of the side-chain, potentially leading to structural alterations of the protein, and consequently to altered protein interactions or transport properties; 3) in the CFTR (or ABCC7), a disease-causing mutation (R347P) has been identified at a site that corresponds to residue 764 in ABCA1 (15), and thus in close vicinity to K776N; 4) the present study is of a large cohort, and therefore includes only incident cases, avoiding the normal pitfalls of case reports and case-control studies (30); 5) we observed a similar trend on risk of IHD in a separate case-control study; 6) we have previously determined effects on lipids and lipoproteins of all non-synonymous SNPs identified in ABCA1 (R219K, V771M, V825I, I883M, E1172D, R1587K). Login to comment

[hide] ATP-binding cassette transporter A1: a cell choles... Physiol Rev. 2005 Oct;85(4):1343-72. Oram JF, Heinecke JW
ATP-binding cassette transporter A1: a cell cholesterol exporter that protects against cardiovascular disease.
Physiol Rev. 2005 Oct;85(4):1343-72., [PMID:16183915]

Abstract [show]
Blood high-density lipoprotein (HDL) levels are inversely related to risk for cardiovascular disease, implying that factors associated with HDL metabolism are atheroprotective. One of these factors is ATP-binding cassette transporter A1 (ABCA1), a cell membrane protein that mediates the transport of cholesterol, phospholipids, and other metabolites from cells to lipid-depleted HDL apolipoproteins. ABCA1 transcription is highly induced by sterols, a major substrate for cellular export, and its expression and activity are regulated posttranscriptionally by diverse processes. Liver ABCA1 initiates formation of HDL particles, and macrophage ABCA1 protects arteries from developing atherosclerotic lesions. ABCA1 mutations can cause a severe HDL deficiency syndrome characterized by cholesterol deposition in tissue macrophages and prevalent atherosclerosis. Genetic manipulations of ABCA1 expression in mice also affect plasma HDL levels and atherogenesis. Metabolites elevated in individuals with the metabolic syndrome and diabetes destabilize ABCA1 protein and decrease cholesterol export from macrophages. Moreover, oxidative modifications of HDL found in patients with cardiovascular disease reduce the ability of apolipoproteins to remove cellular cholesterol by the ABCA1 pathway. These observations raise the possibility that an impaired ABCA1 pathway contributes to the enhanced atherogenesis associated with common inflammatory and metabolic disorders. The ABCA1 pathway has therefore become an important new therapeutic target for treating cardiovascular disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
431 The most studied of these SNPs is the R219K variant, with the K allele being associated with higher levels of HDL (255). Login to comment
430 The most studied of these SNPs is the R219K variant, with the K allele being associated with higher levels of HDL (255). Login to comment

[hide] A novel missense mutation in ABCA1 results in alte... Blood. 2005 Jul 15;106(2):542-9. Epub 2005 Mar 24. Albrecht C, McVey JH, Elliott JI, Sardini A, Kasza I, Mumford AD, Naoumova RP, Tuddenham EG, Szabo K, Higgins CF
A novel missense mutation in ABCA1 results in altered protein trafficking and reduced phosphatidylserine translocation in a patient with Scott syndrome.
Blood. 2005 Jul 15;106(2):542-9. Epub 2005 Mar 24., [PMID:15790791]

Abstract [show]
Scott syndrome (SS) is a bleeding disorder characterized by a failure to expose phosphatidylserine (PS) to the outer leaflet of the platelet plasma membrane. Because the adenosine triphosphate (ATP)-binding cassette transporter A1 (ABCA1) is implicated in the exofacial translocation of PS, we assessed its role in the pathophysiology of a patient with SS. Substantially reduced levels of ABCA1 mRNA were found in the patient's leukocytes, compared with controls. The SS patient was heterozygous for a novel missense mutation c.6064G>A (ABCA1 R1925Q), absent from unaffected family members and controls. Both mutant and wild-type alleles were reduced in mRNA expression, and no causative mutation for this phenomenon was identified in the ABCA1 gene or its proximal promoter, suggesting a putative second mutation in a trans-acting regulatory gene may also be involved in the disorder in this patient. In vitro expression studies showed impaired trafficking of ABCA1 R1925Q to the plasma membrane. Overexpression of wild-type ABCA1 in SS lymphocytes complemented the Ca2+-dependent PS exposure at the cell surface. These data identify a mutation in ABCA1 that contributes to the defective PS translocation phenotype in our patient with SS.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
115 The R1925Q variant was not found in 164 alleles of a control population of British origin,32 evidenced by WAVE analysis. Login to comment
116 For comparison, the allele frequency of the polymorphism in exon 6 (R219K) in this population was 0.22, similar to that observed in other European populations (0.254).33 To investigate whether there was differential expression of the 2 alleles, a PCR product spanning the c.6064GϾA mutation was generated by RT-PCR from total RNA isolated from leukocytes of 544 ALBRECHT et al BLOOD, 15 JULY 2005 the SS patient. Login to comment

[hide] Toll-like receptor 4 variant D299G is associated w... Hum Mol Genet. 2005 Jun 1;14(11):1449-55. Epub 2005 Apr 13. Zareparsi S, Buraczynska M, Branham KE, Shah S, Eng D, Li M, Pawar H, Yashar BM, Moroi SE, Lichter PR, Petty HR, Richards JE, Abecasis GR, Elner VM, Swaroop A
Toll-like receptor 4 variant D299G is associated with susceptibility to age-related macular degeneration.
Hum Mol Genet. 2005 Jun 1;14(11):1449-55. Epub 2005 Apr 13., [PMID:15829498]

Abstract [show]
Age-related macular degeneration (AMD) is a genetically heterogeneous disease that leads to progressive and irreversible vision loss among the elderly. Inflammation, oxidative damage, cholesterol metabolism and/or impaired function of retinal pigment epithelium (RPE) have been implicated in AMD pathogenesis. We examined toll-like receptor 4 (TLR4) as a candidate gene for AMD susceptibility because: (i) the TLR4 gene is located on chromosome 9q32-33, a region exhibiting evidence of linkage to AMD in three independent reports; (ii) the TLR4-D299G variant is associated with reduced risk of atherosclerosis, a chronic inflammatory disease with subendothelial accumulation; (iii) the TLR4 is not only a key mediator of proinflammatory signaling pathways but also linked to regulation of cholesterol efflux and (iv) the TLR4 participates in phagocytosis of photoreceptor outer segments by the RPE. We examined D299G and T399I variants of TLR4 in a sample of 667 unrelated AMD patients and 439 unrelated controls, all of Caucasian ancestry. Multiple logistic regression demonstrated an increased risk of AMD in carriers of the G allele at TLR4 residue 299 (odds ratio=2.65, P=0.025), but lack of an independent effect by T399I variant. TLR4-D299G showed an additive effect on AMD risk (odds ratio=4.13, P=0.002) with allelic variants of apolipoprotein E (APOE) and ATP-binding cassette transporter-1 (ABCA1), two genes involved in cholesterol efflux. Interestingly, the effect of TLR4, APOE and ABCA1 variants on AMD susceptibility was opposite to that of association with atherosclerosis risk. Our data provide evidence of a link between multiple diverse mechanisms underlying AMD pathogenesis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 Interaction of TLR4-D299G with ABCA1-R219K and APOE variants Given that ABCA1 and APOE are downstream in TLR4 signaling pathway (48,49), participate in cholesterol metabolism and are associated with atherosclerosis (43,53), we determined whether ABCA1 and APOE variants interact with TLR4-D299G in contributing to AMD susceptibility. Login to comment
70 The frequency of the K allele of ABCA1-R219K (associated with reduced risk of atherosclerosis) (53) was similar between AMD patients and controls (0.29 versus 0.29, P . Login to comment
79 There was no significant interaction between TLR4-D299G, ABCA1-R219K and APOE on AMD susceptibility (Table 4). Login to comment
80 Nevertheless, ABCA1-R219K further contributed to the additive effect and the risk of AMD was increased by 4-fold in carriers of the risk alleles for all three genes (Gþ, Kþ and 142) when compared with those without the risk alleles (G2, K2 and 14þ) (Table 4). Login to comment
83 Age at diagnosis of AMD did not vary significantly in the presence of the TLR4-D299G-G allele (70.6 + 9.3 versus 71.4 + 8.7) or the ABCA1-R219K-K allele (71.7 + 8.7 versus 70.9 + 8.8). Login to comment
107 Here, we show that the variants reported to correlate with reduced risk of atherogenesis (TLR4-D299G, ABCA1-R219K and APOE-12/3) are associated with increased risk of AMD. Login to comment
137 APOE and ABCA1-R219K genotypes were obtained using previously described methods by PCR and restriction digestion (53,64). Login to comment
148 Additive effects between the TLR4-D299G and/or APOE and/or ABCA1-R219K were analyzed by logistic regression, where those carrying the risk alleles for any given combination of SNPs were compared with those who lacked the risk alleles for those SNPs (e.g. TLR4-G and ABCA1-K carriers compared with TLR4-DD and TLR4-RR individuals). Login to comment
71 Interaction of TLR4-D299G with ABCA1-R219K and APOE variants Given that ABCA1 and APOE are downstream in TLR4 signaling pathway (48,49), participate in cholesterol metabolism and are associated with atherosclerosis (43,53), we determined whether ABCA1 and APOE variants interact with TLR4-D299G in contributing to AMD susceptibility. Login to comment
72 The frequency of the K allele of ABCA1-R219K (associated with reduced risk of atherosclerosis) (53) was similar between AMD patients and controls (0.29 versus 0.29, P . Login to comment
82 Nevertheless, ABCA1-R219K further contributed to the additive effect and the risk of AMD was increased by 4-fold in carriers of the risk alleles for all three genes (G&#fe;, K&#fe; and 142) when compared with those without the risk alleles (G2, K2 and 14&#fe;) (Table 4). Login to comment
85 Age at diagnosis of AMD did not vary significantly in the presence of the TLR4-D299G-G allele (70.6 + 9.3 versus 71.4 + 8.7) or the ABCA1-R219K-K allele (71.7 + 8.7 versus 70.9 + 8.8). Login to comment
109 Here, we show that the variants reported to correlate with reduced risk of atherogenesis (TLR4-D299G, ABCA1-R219K and APOE-12/3) are associated with increased risk of AMD. Login to comment

[hide] The liver X receptor ligand T0901317 decreases amy... J Biol Chem. 2005 Feb 11;280(6):4079-88. Epub 2004 Nov 22. Koldamova RP, Lefterov IM, Staufenbiel M, Wolfe D, Huang S, Glorioso JC, Walter M, Roth MG, Lazo JS
The liver X receptor ligand T0901317 decreases amyloid beta production in vitro and in a mouse model of Alzheimer's disease.
J Biol Chem. 2005 Feb 11;280(6):4079-88. Epub 2004 Nov 22., [PMID:15557325]

Abstract [show]
Recent studies indicate that oxysterols, which are ligands for the nuclear hormone liver X receptors (LXR), decrease amyloid beta (Abeta) secretion in vitro. The effect was attributed primarily to the ATP-binding cassette transporter A1 (ABCA1) transcriptionally up-regulated by ligand-activated LXRs. We now examined the effect of the synthetic LXR ligand T0901317, which can be used in vivo, on Abeta production in vitro and in APP23 transgenic mice. T0901317 applied to a variety of in vitro models, including immortalized fibroblasts from Tangier patients, and primary embryonic mouse neurons caused a concentration-dependent decrease in Abeta secretion, and this effect was increased by the addition of apolipoprotein A-I. The inhibition of Abeta production by T0901317 was cell-type specific, being more prominent in primary neurons than in non-neuronal cells. Tangier fibroblasts lacking a functional ABCA1 secreted more Abeta than control fibroblasts, thus demonstrating the role of ABCA1 in amyloid precursor protein (APP) processing and Abeta generation. T0901317 treatment of 11-week-old APP23 mice for 6 days showed a significant increase in ABCA1 expression and a decrease in the ratio of soluble APP (sAPP)beta- to sAPPalpha-cleavage products. Most importantly, the treatment caused a statistically significant reduction in the levels of soluble Abeta40 and of Abeta42 in the brain these mice. Our experiments demonstrate that T0901317 decreases amyloidogenic processing of APP in vitro and in vivo, thus supporting the search for potent and specific LXR ligands with properties allowing therapeutic application.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
14 Wollmer et al. (15) found that the R219K variant of ABCA1, associated with increased HDL cholesterol levels and a decreased risk of atherosclerosis (16), delayed the age of onset of late onset Alzheimer`s disease. Login to comment

[hide] Genotypic effect of the -565C>T polymorphism in th... Arterioscler Thromb Vasc Biol. 2005 Feb;25(2):418-23. Epub 2004 Nov 4. Kyriakou T, Hodgkinson C, Pontefract DE, Iyengar S, Howell WM, Wong YK, Eriksson P, Ye S
Genotypic effect of the -565C>T polymorphism in the ABCA1 gene promoter on ABCA1 expression and severity of atherosclerosis.
Arterioscler Thromb Vasc Biol. 2005 Feb;25(2):418-23. Epub 2004 Nov 4., [PMID:15528481]

Abstract [show]
OBJECTIVE: Loss-of-function mutations of the ATP-binding cassette transporter A1 (ABCA1) gene cause Tangier disease, a rare genetic disorder with accumulation of lipid-laden macrophages and increased risk of atherosclerosis. Common variants of this gene may be a genetic factor for atherosclerosis in the general population. This study was performed to test the reported association between the -565C>T polymorphism and atherosclerosis severity and to investigate whether this variant per se had an effect on promoter activity of the ABCA1 gene. METHODS AND RESULTS: A cohort of patients with coronary atherosclerosis were genotyped for the -565C>T polymorphism. Logistic regression analyses showed that homozygotes of the -565T allele had greatest mean number of diseased coronary arteries, particular in nonsmokers. Real-time reverse-transcriptase polymerase chain reaction showed that in atherosclerotic plaques removed from patients undergoing endarteretomy, ABCA1 expression levels were lowest in those who had the T/T genotype and highest in those of the C/C genotype. Transfection and reporter assays demonstrated that in cultured macrophages, the -565T allelic promoter had a lower activity in driving gene expression than the -565C allelic promoter. Electrophoretic mobility shift assays displayed differential binding of nuclear proteins to the 2 alleles. CONCLUSIONS: These results indicate that the -565C>T polymorphism has an allele-specific effect on ABCA1 gene expression and provide further evidence of a genotypic effect on coronary atherosclerosis severity. The study showed that the ABCA1 gene -565C>T polymorphism was associated with severity of coronary atherosclerosis in a cohort of patients from Southern England and that this sequence variant per se had an effect on promoter activity of the ABCA1 gene. The data support the notion that common ABCA1 gene variants can contribute to interindividual variability in atherosclerosis susceptibility and severity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 An interaction between another ABCA1 gene polymorphism (ie, R219K) and smoking has been reported previously, although the underlying mechanisms remain unknown.16 TABLE 2. Login to comment
93 For example, the R219K polymorphism has been shown to be associated with risk of myocardial infarction and/or severity of atherosclerosis,15-19 the V825I, M883I, and R1587K polymorphisms with various cardiovascular traits,17,20,21 the -191GϾC, -17CϾG, and 69CϾT polymorphisms with risk of coronary events in patients with coronary atherosclerosis,22 and the 319insG polymorphism with severity of atherosclerosis.22 Taken together, these data suggest that the development and outcome of atherosclerosis might be influenced by a qualitative change of the ABCA1 protein caused by coding region variants and a quantitative change in ABCA1 expression caused by regulatory region variants. Login to comment
95 For example, in a study of 465 Japanese patients with myocardial infarction or angina pectoris, Takagi et al23 did not find an association between severity of atherosclerosis and the -565CϾT polymorphism, nor did they find an association between severity of atherosclerosis and the ABCA1 gene R219K polymorphism, which has been shown to be associated with atherosclerosis severity in several other studies.15-19 Thus, it appears that the genotypic effects of ABCA1 may be influenced by other factors such as genetic backgrounds and environmental factors. Login to comment
81 An interaction between another ABCA1 gene polymorphism (ie, R219K) and smoking has been reported previously, although the underlying mechanisms remain unknown.16 TABLE 2. Login to comment
89 For example, in a study of 465 Japanese patients with myocardial infarction or angina pectoris, Takagi et al23 did not find an association between severity of atherosclerosis and the afa;565Cb0e;T polymorphism, nor did they find an association between severity of atherosclerosis and the ABCA1 gene R219K polymorphism, which has been shown to be associated with atherosclerosis severity in several other studies.15-19 Thus, it appears that the genotypic effects of ABCA1 may be influenced by other factors such as genetic backgrounds and environmental factors. Login to comment

[hide] Screening for functional sequence variations and m... Atherosclerosis. 2004 Aug;175(2):269-79. Probst MC, Thumann H, Aslanidis C, Langmann T, Buechler C, Patsch W, Baralle FE, Dallinga-Thie GM, Geisel J, Keller C, Menys VC, Schmitz G
Screening for functional sequence variations and mutations in ABCA1.
Atherosclerosis. 2004 Aug;175(2):269-79., [PMID:15262183]

Abstract [show]
Mutations in the ATP-binding cassette 1 transporter gene (ABCA1) are responsible for the genetic HDL-deficiency syndromes, which are characterized by severely diminished plasma HDL-C levels and a predisposition to cardiovascular disease and splenomegaly. The ABCA1 gene contains 50 exons and codes for a 2261-amino acid long membrane protein that facilitates phospholipid and cholesterol transport. Several mutations have been identified so far as responsible either for Tangier disease or for reduced HDL levels. We have selectively looked for additional polymorphisms in functionally relevant regions of the gene in cohorts constituted of individuals with altered HDL levels as well as healthy blood donors and octogenarians, and screened for mutations in the complete coding region of selected individuals with extremely aberrant HDL levels. In the promoter region, which is important for regulation of gene expression, we have identified several polymorphisms including one VNTR polymorphism, located at a putative ZNF202 binding site, which displayed different binding of ZNF202 in an electromobility shift assay. Three novel SNPs were discovered in the promoter region (G1047C, C1152T and C1440T). The prevalence of exchange G1047C (G-395C) was found significantly increased in probands with low HDL compared to probands with high HDL. Exchanges C1152T (C-290T) and C1440T (C-7T) were significantly more frequent in the cohort with low HDL compared to healthy blood donors and octogenarians. In the C-terminal part of ABCA1, known to interact with other proteins, two novel sequence variations (F2163S and V2244I) have been found in one phenotype related to cardiovascular disease, but none in the aforementioned cohorts. In one individual with extremely high HDL levels, the V771M polymorphism was found in a homozygous state. In patients with HDL deficiency, three novel mutations have been identified (W590L, W840R and R1068C). To facilitate further research in ABCA1 sequence variations and expand our understanding of their effects, we are introducing a webpage archive (http://www.abca1-mutants.all.at) containing all sequence variations reported in ABCA1 so far. This webpage provides a more recent and detailed summary of sequence variations and mutations in ABCA1 than existing databases and should also be of interest for molecular diagnosis of ABCA1-related HDL deficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
188 The patient was also heterozygous for two known polymorphisms (R219K and I883M), but no second mutation could be identified so far. Login to comment
197 Three other known sequence variations have been found (heterozygous R219K, heterozygous E1172D and homozygous R1587K). Login to comment

[hide] Genetic determinants of low high-density lipoprote... Curr Opin Cardiol. 2004 Jul;19(4):380-4. Miller M, Zhan M
Genetic determinants of low high-density lipoprotein cholesterol.
Curr Opin Cardiol. 2004 Jul;19(4):380-4., [PMID:15218400]

Abstract [show]
PURPOSE OF REVIEW: High-density lipoprotein cholesterol (HDL-C) has been well established as an inverse predictor of coronary heart disease (CHD), and in recent years, investigations have focused on the genetic regulation of high-density lipoprotein. Although numerous candidate genes contribute to the low HDL-C phenotype, their impact on CHD is heterogeneous, reflecting diverse gene-gene interactions and gene-environmental relationships. This review summarizes recent data involving HDL regulatory genes and their role in atherothrombosis. RECENT FINDINGS: The primary genetic determinants associated with relative HDL-C deficiency states are the ATP binding cassette protein, ABCA1; apolipoprotein (APO) A1; and lecithin cholesteryl acyl transferase. Other potentially important candidates invoked in low HDL-C syndromes in humans include APOC3, lipoprotein lipase, sphingomyelin phosphodiesterase 1, and glucocerebrosidase. Molecular variation in ABCAI and APOAI and, in selected cases, lecithin cholesteryl acyl transferase deficiency have been associated with increased CHD, whereas two notable variants, APOAIMilano and APOAIParis, are associated with reduced risk. SUMMARY: Low HDL-C syndromes have generally been correlated with an increased risk of CHD. However, single-gene abnormalities responsible for HDL-C deficiency states may have variable effects on atherothrombotic risk.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 During the past year, several but not all ABCA1 variants have been associated with reduced HDL-C and CHD [14•-16•,17,18]; in populations, one specific polymorphism (R219K) was associated with reduced CHD risk [19•,20•]. Login to comment

[hide] Two novel missense mutations in ABCA1 result in al... Biochim Biophys Acta. 2004 May 24;1689(1):47-57. Albrecht C, Baynes K, Sardini A, Schepelmann S, Eden ER, Davies SW, Higgins CF, Feher MD, Owen JS, Soutar AK
Two novel missense mutations in ABCA1 result in altered trafficking and cause severe autosomal recessive HDL deficiency.
Biochim Biophys Acta. 2004 May 24;1689(1):47-57., [PMID:15158913]

Abstract [show]
Extremely low concentrations of high density lipoprotein (HDL)-cholesterol and apolipoprotein (apo) AI are features of Tangier disease caused by autosomal recessive mutations in ATP-binding cassette transporter A1 (ABCA1). Less deleterious, but dominantly inherited mutations cause HDL deficiency. We investigated causes of severe HDL deficiency in a 42-year-old female with progressive coronary disease. ApoAI-mediated efflux of cholesterol from the proband's fibroblasts was less than 10% of normal and nucleotide sequencing revealed inheritance of two novel mutations in ABCAI, V1704D and L1379F. ABCA1 mRNA was approximately 3-fold higher in the proband's cells than in control cells; preincubation with cholesterol increased it 5-fold in control and 8-fold in the proband's cells, but similar amounts of ABCA1 protein were present in control and mutant cells. When transiently transfected into HEK293 cells, confocal microscopy revealed that both mutant proteins were retained in the endoplasmic reticulum, while wild-type ABCA1 was located at the plasma membrane. Severe HDL deficiency in the proband was caused by two novel autosomal recessive mutations in ABCA1, one (V1704D) predicted to lie in a transmembrane segment and the other (L1379F) in a large extracellular loop. Both mutations prevent normal trafficking of ABCA1, thereby explaining their inability to mediate apoA1-dependent lipid efflux.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
150 In comparison, the allele frequency of the R219K polymorphism was 0.22 (K allele), similar to that found in other European populations [31]. Login to comment
149 In comparison, the allele frequency of the R219K polymorphism was 0.22 (K allele), similar to that found in other European populations [31]. Login to comment

[hide] Haplotypes and SNPs in 13 lipid-relevant genes exp... Hum Mol Genet. 2004 May 15;13(10):993-1004. Epub 2004 Mar 25. Knoblauch H, Bauerfeind A, Toliat MR, Becker C, Luganskaja T, Gunther UP, Rohde K, Schuster H, Junghans C, Luft FC, Nurnberg P, Reich JG
Haplotypes and SNPs in 13 lipid-relevant genes explain most of the genetic variance in high-density lipoprotein and low-density lipoprotein cholesterol.
Hum Mol Genet. 2004 May 15;13(10):993-1004. Epub 2004 Mar 25., [PMID:15044381]

Abstract [show]
Single nucleotide polymorphisms (SNPs) and derived haplotypes within multiple genes may explain genetic variance in complex traits; however, this hypothesis has not been rigorously tested. In an earlier study we analyzed six genes and have now expanded this investigation to include 13. We studied 250 families including 1054 individuals and measured lipid phenotypes. We focused on low-density cholesterol (LDL), high-density cholesterol (HDL) and their ratio (LDL/HDL). A component analysis of the phenotypic variance relying on a standard genetic model' showed that the genetic variance on LDL explained 26%, on HDL explained 38% and on LDL/HDL explained 28% of the total variance, respectively. Genotyping of 93 SNPs in 13 lipid-relevant genes generated 230 haplotypes. The association of haplotypes in all the genes tested explained a major fraction of the genetic phenotypic variance component. For LDL, the association with haplotypes explained 67% and for HDL 58% of the genetic variance relative to the polygenic background. We conclude that these haplotypes explain most of the genetic variance in LDL, HDL and LDL/HDL in these representative German families. An analysis of the contribution to the genetic variance at each locus showed that APOE (50%), CETP (28%), LIPC (9%), APOB (8%) and LDLR (5%) influenced variation in LDL. LIPC (53%), CETP (25%), ABCA1 (10%), LPL (6%) and LDLR (6%) influenced the HDL variance. The LDL/HDL ratio was primarily influenced by APOE (36%), CETP (27%) and LIPC (31%). This expanded analysis substantially increases the explanation of genetic variance on these complex traits.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 SNP characteristics including SNP identification system, localization, allele frequencies, nucleotide exchange and pseudonym are shown Gene/SNP no. SNP Id. Localization Allele frequency Nucleotide exchange Pseudonym APOB apob.snp1 rs512535 Promotor 0.45 G/A G-837A apob.snp2 rs1367117 Exon/non-syn 0.32 C/T Thr71Ile apob.snp3 rs520354 Intron 0.44 T/C apob.snp4 rs679899 Exon/non-syn 0.44 C/T Ala618Val apob.snp5 rs673548 Intron 0.21 C/T apob.snp6 rs693 Exon/syn 0.50 T/C XbaI apob.snp7 rs1800479 Intron 0.16 C/G Gþ50/in27C apob.snp8 rs1801703 Exon/non-syn 0.01 C/T Val4101Met apob.snp9 rs1042034 Exon/non-syn 0.22 T/C Asn4311Ser APOE apoe.snp1 rs449647 Promotor 0.17 A/T t-491a apoe.snp2 rs405509 Promotor 0.48 C/A g-219t apoe.snp3 rs440446 Intron 0.36 G/C Variant 1163 apoe.snp4 rs769450 Intron 0.41 C/T Variant 2440 apoe.snp5 rs429358 Exon/non-syn 0.16 T/C Cys112Arg apoe.snp6 rs7412 Exon/non-syn 0.06 C/T Arg158Cys ABCA1 abca1.snp1 rs2422493 Promotor 0.45 G/A 2477c/t abca1.snp2 rs1800977 50 UTR 0.50 C/T t69c abca1.snp3 50 UTR 0.04 C/G c117g abca1.snp4 rs2575879 Intron 0.46 G/C abca1.snp5 rs1800978 50 UTR 0.01 G/C G378C abca1.snp6 rs1999429 Intron 0.03 G/T abca1.snp7 rs2230806 Exon/non-syn 0.26 C/T Arg219Lys abca1.snp8 rs2274873 Exon/syn 0.08 C/T Pro312Pro abca1.snp9 rs4149313 Exon/non-syn 0.13 T/C A3044G, Ile883Met abca1.snp10 Exon/non-syn 0.03 C/G G3911C, Glu1172Asp abca1.snp11 rs2066716 Exon/syn 0.08 G/A Thr1367Thr abca1.snp12 rs363717 30 UTR 0.20 A/G CETP cetp.snp1 rs4783961 Promotor 0.47 C/T 2971 g/a cetp.snp2 rs1800776 Promotor 0.07 G/T 2631 cetp.snp3 rs1800775 Promotor 0.49 G/T 2629 cetp.snp4 rs711752 Intron 0.45 C/T Gþ202/in1A cetp.snp5 rs708272 Intron 0.45 C/T Taq1B; Gþ279/in1A cetp.snp6 rs158478 Intron 0.46 C/A EcoNI cetp.snp7 rs1532625 Intron 0.43 G/A Cþ8/in7T cetp.snp8 rs289718 Intron 0.29 T/C cetp.snp9 rs289719 Intron 0.29 C/T cetp.snp10 rs5880 Exon/non-syn 0.04 C/G CETPu1, Ala373Pro cetp.snp11 rs5882 Exon/non-syn 0.35 A/G CETPu2 cetp.snp12 rs1801706 30 UTR 0.18 C/T Gþ84A LCAT lcat.snp1 rs1109166 Intron 0.17 A/G lcat.snp2 rs4986970 Exon/non-syn 0.04 A/T Ser232Thr lcat.snp3 rs5923 Exon/syn 0.04 G/A LCATu3 LIPC lipc.snp1 rs723967 50 regiona 0.46 G/A lipc.snp2 rs1800588 Promotor 0.28 G/A 2C480T lipc.snp3 rs1869144 Intron 0.39 A/G lipc.snp4 rs6078 Exon/non-syn 0.04 G/A LIPCu1; Val73Met lipc.snp5 rs690 Exon/syn 0.49 T/G LIPCu3; Val155Val lipc.snp6 rs6082 Exon/syn 0.08 A/G LIPCu5; Gly197Gly lipc.snp7 rs6083 Exon/non-syn 0.36 T/C LIPCu6; Asn193Ser lipc.snp8 rs6084 Exon/syn 0.44 C/G LIPCu8; Thr224Thr lipc.snp9 rs6074 Exon/syn 0.13 G/T Thr479Thr LPL lpl.snp1 Promotor 0.00 C/A G-95T lpl.snp2 rs1800590 Promotor 0.01 A/C G-93T lpl.snp3 rs1031045 Intron 0.01 C/T lpl.snp4 rs253 Intron 0.47 C/T Continued Human Molecular Genetics, 2004, Vol. 13, No. 10 995 13 candidate genes important to lipid metabolism. Login to comment
79 SNP characteristics including SNP identification system, localization, allele frequencies, nucleotide exchange and pseudonym are shown Gene/SNP no. SNP Id. Localization Allele frequency Nucleotide exchange Pseudonym APOB apob.snp1 rs512535 Promotor 0.45 G/A G-837A apob.snp2 rs1367117 Exon/non-syn 0.32 C/T Thr71Ile apob.snp3 rs520354 Intron 0.44 T/C apob.snp4 rs679899 Exon/non-syn 0.44 C/T Ala618Val apob.snp5 rs673548 Intron 0.21 C/T apob.snp6 rs693 Exon/syn 0.50 T/C XbaI apob.snp7 rs1800479 Intron 0.16 C/G G&#fe;50/in27C apob.snp8 rs1801703 Exon/non-syn 0.01 C/T Val4101Met apob.snp9 rs1042034 Exon/non-syn 0.22 T/C Asn4311Ser APOE apoe.snp1 rs449647 Promotor 0.17 A/T t-491a apoe.snp2 rs405509 Promotor 0.48 C/A g-219t apoe.snp3 rs440446 Intron 0.36 G/C Variant 1163 apoe.snp4 rs769450 Intron 0.41 C/T Variant 2440 apoe.snp5 rs429358 Exon/non-syn 0.16 T/C Cys112Arg apoe.snp6 rs7412 Exon/non-syn 0.06 C/T Arg158Cys ABCA1 abca1.snp1 rs2422493 Promotor 0.45 G/A 2477c/t abca1.snp2 rs1800977 50 UTR 0.50 C/T t69c abca1.snp3 50 UTR 0.04 C/G c117g abca1.snp4 rs2575879 Intron 0.46 G/C abca1.snp5 rs1800978 50 UTR 0.01 G/C G378C abca1.snp6 rs1999429 Intron 0.03 G/T abca1.snp7 rs2230806 Exon/non-syn 0.26 C/T Arg219Lys abca1.snp8 rs2274873 Exon/syn 0.08 C/T Pro312Pro abca1.snp9 rs4149313 Exon/non-syn 0.13 T/C A3044G, Ile883Met abca1.snp10 Exon/non-syn 0.03 C/G G3911C, Glu1172Asp abca1.snp11 rs2066716 Exon/syn 0.08 G/A Thr1367Thr abca1.snp12 rs363717 30 UTR 0.20 A/G CETP cetp.snp1 rs4783961 Promotor 0.47 C/T 2971 g/a cetp.snp2 rs1800776 Promotor 0.07 G/T 2631 cetp.snp3 rs1800775 Promotor 0.49 G/T 2629 cetp.snp4 rs711752 Intron 0.45 C/T G&#fe;202/in1A cetp.snp5 rs708272 Intron 0.45 C/T Taq1B; G&#fe;279/in1A cetp.snp6 rs158478 Intron 0.46 C/A EcoNI cetp.snp7 rs1532625 Intron 0.43 G/A C&#fe;8/in7T cetp.snp8 rs289718 Intron 0.29 T/C cetp.snp9 rs289719 Intron 0.29 C/T cetp.snp10 rs5880 Exon/non-syn 0.04 C/G CETPu1, Ala373Pro cetp.snp11 rs5882 Exon/non-syn 0.35 A/G CETPu2 cetp.snp12 rs1801706 30 UTR 0.18 C/T G&#fe;84A LCAT lcat.snp1 rs1109166 Intron 0.17 A/G lcat.snp2 rs4986970 Exon/non-syn 0.04 A/T Ser232Thr lcat.snp3 rs5923 Exon/syn 0.04 G/A LCATu3 LIPC lipc.snp1 rs723967 50 regiona 0.46 G/A lipc.snp2 rs1800588 Promotor 0.28 G/A 2C480T lipc.snp3 rs1869144 Intron 0.39 A/G lipc.snp4 rs6078 Exon/non-syn 0.04 G/A LIPCu1; Val73Met lipc.snp5 rs690 Exon/syn 0.49 T/G LIPCu3; Val155Val lipc.snp6 rs6082 Exon/syn 0.08 A/G LIPCu5; Gly197Gly lipc.snp7 rs6083 Exon/non-syn 0.36 T/C LIPCu6; Asn193Ser lipc.snp8 rs6084 Exon/syn 0.44 C/G LIPCu8; Thr224Thr lipc.snp9 rs6074 Exon/syn 0.13 G/T Thr479Thr LPL lpl.snp1 Promotor 0.00 C/A G-95T lpl.snp2 rs1800590 Promotor 0.01 A/C G-93T lpl.snp3 rs1031045 Intron 0.01 C/T lpl.snp4 rs253 Intron 0.47 C/T Continued 13 candidate genes important to lipid metabolism. Login to comment

[hide] Genetic polymorphisms affecting the phenotypic exp... Atherosclerosis. 2004 May;174(1):57-65. Bertolini S, Pisciotta L, Di Scala L, Langheim S, Bellocchio A, Masturzo P, Cantafora A, Martini S, Averna M, Pes G, Stefanutti C, Calandra S
Genetic polymorphisms affecting the phenotypic expression of familial hypercholesterolemia.
Atherosclerosis. 2004 May;174(1):57-65., [PMID:15135251]

Abstract [show]
The clinical expression of heterozygous familial hypercholesterolemia (FH) is highly variable even in patients carrying the same LDL receptor (LDL-R) gene mutation. This variability might be due to environmental factors as well as to modifying genes affecting lipoprotein metabolism. We investigated Apo E (2, 3, 4), MTP (-493G/T), Apo B (-516C/T), Apo A-V (-1131T/C), HL (-514C/T and -250G/A), FABP-2 (A54T), LPL (D9N, N291S, S447X) and ABCA1 (R219K) polymorphisms in 221 unrelated FH index cases and 349 FH relatives with defined LDL-R gene mutations. We found a significant and independent effect of the following polymorphisms on: (i) plasma LDL-C (Apo E, MTP and Apo B); (ii) plasma HDL-C (HL, FABP-2 and LPL S447X); (iii) plasma triglycerides (Apo E and Apo A-V). In subjects with coronary artery disease (CAD+), the prevalence of FABP-2 54TT genotype was higher (16.5% versus 5.2%) and that of ABCA1 219RK and KK genotypes lower (33.0% versus 51.5%) than in subjects with no CAD. Independent predictors of increased risk of CAD were male sex, age, arterial hypertension, LDL-C level and FABP-2 54TT genotype, and of decreased risk the 219RK and KK genotypes of ABCA1. These findings show that several common genetic variants influence the lipid phenotype and the CAD risk in FH heterozygotes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 We investigated Apo E (ε2, ε3, ε4), MTP (-493G/T), Apo B (-516C/T), Apo A-V (-1131T/C), HL (-514C/T and -250G/A), FABP-2 (A54T), LPL (D9N, N291S, S447X) and ABCA1 (R219K) polymorphisms in 221 unrelated FH index cases and 349 FH relatives with defined LDL-R gene mutations. Login to comment
25 Finally, we investigated the R219K variant of the ABCA1 gene, since the K allele appeared to be protective against CAD in both FH and non-FH subjects [22,23]. Login to comment
42 The polymorphisms Apo E, MTP -493G/T, LPL N291S, Apo B -516C/T, HL -514C/T, FABP-2 A54T, Apo A-V -1131T/C, ABCA1 R219K and LPL S447X were studied using methods previously described [2,6,11,13,14,16,19,23,25]. Login to comment
119 The other polymorphisms we investigated (N291S and D9N of LPL gene and R219K of ABCA1 gene) were found to have no significant effect on plasma lipids (data not shown). Login to comment
173 Several recent studies have investigated the role of the R219K polymorphism of ABCA1 transporter on plasma lipoprotein profile or CAD [40]. Login to comment
116 The other polymorphisms we investigated (N291S and D9N of LPL gene and R219K of ABCA1 gene) were found to have no significant effect on plasma lipids (data not shown). Login to comment
170 Several recent studies have investigated the role of the R219K polymorphism of ABCA1 transporter on plasma lipoprotein profile or CAD [40]. Login to comment

[hide] In-depth haplotype analysis of ABCA1 gene polymorp... Arterioscler Thromb Vasc Biol. 2004 Apr;24(4):775-81. Epub 2004 Feb 12. Tregouet DA, Ricard S, Nicaud V, Arnould I, Soubigou S, Rosier M, Duverger N, Poirier O, Mace S, Kee F, Morrison C, Denefle P, Tiret L, Evans A, Deleuze JF, Cambien F
In-depth haplotype analysis of ABCA1 gene polymorphisms in relation to plasma ApoA1 levels and myocardial infarction.
Arterioscler Thromb Vasc Biol. 2004 Apr;24(4):775-81. Epub 2004 Feb 12., [PMID:14962947]

Abstract [show]
OBJECTIVE: By regulating the cellular cholesterol efflux from peripheral cells to high-density lipoprotein, the ABCA1 protein is suspected to play a key role in lipid homeostasis and atherosclerosis. Twenty-six polymorphisms of the ABCA1 gene were genotyped and tested for association with plasma levels of ApoA1 and myocardial infarction (MI) in the ECTIM study. METHODS AND RESULTS: In addition to single-locus analysis, a systematic exploration of all possible haplotype effects was performed, with this exploration being performed on a minimal set of "tag" polymorphisms that define the haplotype structure of the gene. Two polymorphisms were associated with plasma levels of ApoA1, 1 in the promoter (C-564T) and 1 in the coding (R1587K) regions, whereas only 1 polymorphism (R219K) was associated with the risk of MI. However, no haplotype effect was detected on ApoA1 variability or on the risk of MI. CONCLUSIONS: ABCA1 gene polymorphisms but not haplotypes are involved in the variability of plasma ApoA1 and the susceptibility to coronary artery disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Two polymorphisms were associated with plasma levels of ApoA1, 1 in the promoter (C-564T) and 1 in the coding (R1587K) regions, whereas only 1 polymorphism (R219K) was associated with the risk of MI. Login to comment
79 Strong LD was also present in the coding region for 1 cluster of polymorphisms (R219K, G316G, I680I, V771 M, V825I, I883 M) located in exons 8 to 17. Login to comment
84 Description and Frequency of ABCA1 Gene Polymorphisms in the 2 Centers From the United Kingdom Sequence Allele Frequency† Name 5Ј Flanking Nucleotide Change 3Ј Flanking Belfast (Nϭ888) Glasgow (Nϭ725) A-1814G CAGCCTCCTG A/g GATAACAGGC 0.339 0.366 C-1801T TAACAGGCGC C/t CGCCACCACA 0.443 0.433 A-1652G CACTGCGCCC A/g GCTCAGATCC 0.350 0.364 G-1506C CTCTTCTATG G/c GTCTGTCCTG 0.203 0.205 C-1395T TGAATGTCTG C/t ATGCAGGTGG 0.428 0.425 G-1252A TGCCCTTCAA G/a GTGGCTACAA 0.095 0.088 C-1217T AGGTAGGAGA C/t CTTGTGGCCT 0.120 0.121 -1034ins/del ATATTTAGAC ϮAT ATGGTGTGTA 0.210 0.220 T-940G GGCAAACAGA T/g AAGTTGGAGG 0.486 0.483 G-803A AAATTAAAAG G/a GGGCTGGTCC 0.108 0.093 -777rpt/23nt* CTGTGTTTTTGTTTGTTTGTTTC 0.527 0.518 -777rpt/28nt CTGTGTTTTTGTTTGTTTTGTTTGTTTC 0.267 0.272 -777rpt/32nt CTGTGTTTTTGTTTGTTTGTTTTGTTTGTTTC 0.206 0.210 C-564T GAGGACTGTC C/t GCCTTCCCCT 0.456 0.472 G-407C GCGGAAAGCA G/c GATTTAGAGG 0.455 0.459 C-302T CGTCTTAGGC C/t GGCGGGCCCG 0.196 0.189 G-278C GGGGGAAGGG G/c ACGCAGACCG 0.435 0.424 C-14T GGAACTAGTC C/t CGGCAAAAAC 0.335 0.346 R219K GGCCTACCAA G/a GGAGAAACTG 0.283 0.278 G316G AGGGAGGGGG G/a CTGAAGATCA 0.114 0.095 I680I ACAACAGCAT C/a CTCTGGTTTA 0.129 0.118 V771 M GCAGGACTAC G/a TGGGCTTCAC 0.029 0.034 V825I CACCACTTCG G/a TCTCCATGAT 0.056 0.060 I883 M AGAAGAGAAT A/g TCAGAAAGTA 0.137 0.126 L1122L GAAGAACCAG C/t TGGGAACAGG 0.023 0.017 E1172D GCGACCATGA G/c AGTGACACGC 0.026 0.027 T1427T GCAGAGACAC G/a CCCTGCCAGG 0.069 0.083 R1587K CTGGACACCA G/a AAATAATGTC 0.216 0.226 *1 subject carried an additional GTTT deletion, leading to an allele of 19 nucleotides. Login to comment
98 Coding Region By single-locus analysis, the R219K polymorphism was associated with MI, with K219 allele being associated with a decreased risk consistently in the 2 centers (population adjusted ORϭ0.80 [0.68-0.94], Pϭ0.007). Login to comment
104 The "best" model encountered in the systematic exploration was the model with the R219K polymorphism alone, suggesting that apart from the raw effect of the R219K polymorphism, no other polymorphism was associated with the risk of MI. Login to comment
124 Discussion Much attention has been focused on the association of ABCA1 gene polymorphisms with different phenotypes including lipid variables and clinical endpoints.23,25-29,39 Several studies have consistently reported an association between the R219K polymorphism and coronary artery disease.23,26,27 This polymorphism has been shown to be associated with triglycerides23 but not with HDL-C.26,27 Inconsistent results were also observed for other ABCA1 gene polymorphisms including V825I, I883 M, and E1172D. Login to comment
133 Haplotype Structure Defined by the Polymorphisms of the ABCA1 Gene Coding Region (N‫)6921؍‬ Polymorphisms Estimated Haplotype Frequencies R219K G316G (G/A) I680I (C/A) V771 M V825I I883 M L1122L (C/T) E1172D T1427T (G/A) R1587K Controls (Nϭ639) Cases (Nϭ657) R G C V V I C E G R 0.470 0.522 R G C V V I C E G K 0.089 0.085 R G C V V I C E A R 0.026 0.031 R G C V V I C D G K 0.018 0.019 R G C V V I T E G R 0.016 0.017 R G A V I M C E G R 0.015 0.015 R G A V I M C E G K 0.015 0.015 R G A V I M C E A R 0.028 0.026 K G C V V I C E G R 0.077 0.063 K G C V V I C E G K 0.041 0.037 K G A V V M C E G R 0.026 0.020 K G A V V M C E G K 0.014 0.012 K G A V V M C E A R 0.016 0.019 K A C V V I C E G R 0.042 0.035 K A C V V I C E G K 0.034 0.027 K A C M V I C E G R 0.028 0.027 The haplotype structure of the coding region of the ABCA1 gene can be completely defined by a minimal subset of 8 "tag" polymorphisms indicated in boxes. Login to comment
144 Conversely, the R219K polymorphism was associated with MI but not with ApoA1 levels. Login to comment
149 There are also a number of inconsistencies in the results that we are unable to explain for the moment, especially the fact that R1587K affects plasma ApoA1 but appears unrelated to MI and conversely that R219K is associated with MI but does not affect plasma ApoA1 levels. Login to comment
3 Two polymorphisms were associated with plasma levels of ApoA1, 1 in the promoter (C-564T) and 1 in the coding (R1587K) regions, whereas only 1 polymorphism (R219K) was associated with the risk of MI. Login to comment
75 Strong LD was also present in the coding region for 1 cluster of polymorphisms (R219K, G316G, I680I, V771 M, V825I, I883 M) located in exons 8 to 17. Login to comment
80 Description and Frequency of ABCA1 Gene Polymorphisms in the 2 Centers From the United Kingdom Sequence Allele Frequencyߤ Name 5b18; Flanking Nucleotide Change 3b18; Flanking Belfast (Nafd;888) Glasgow (Nafd;725) A-1814G CAGCCTCCTG A/g GATAACAGGC 0.339 0.366 C-1801T TAACAGGCGC C/t CGCCACCACA 0.443 0.433 A-1652G CACTGCGCCC A/g GCTCAGATCC 0.350 0.364 G-1506C CTCTTCTATG G/c GTCTGTCCTG 0.203 0.205 C-1395T TGAATGTCTG C/t ATGCAGGTGG 0.428 0.425 G-1252A TGCCCTTCAA G/a GTGGCTACAA 0.095 0.088 C-1217T AGGTAGGAGA C/t CTTGTGGCCT 0.120 0.121 afa;1034ins/del ATATTTAGAC afe;AT ATGGTGTGTA 0.210 0.220 T-940G GGCAAACAGA T/g AAGTTGGAGG 0.486 0.483 G-803A AAATTAAAAG G/a GGGCTGGTCC 0.108 0.093 afa;777rpt/23nt* CTGTGTTTTTGTTTGTTTGTTTC 0.527 0.518 afa;777rpt/28nt CTGTGTTTTTGTTTGTTTTGTTTGTTTC 0.267 0.272 afa;777rpt/32nt CTGTGTTTTTGTTTGTTTGTTTTGTTTGTTTC 0.206 0.210 C-564T GAGGACTGTC C/t GCCTTCCCCT 0.456 0.472 G-407C GCGGAAAGCA G/c GATTTAGAGG 0.455 0.459 C-302T CGTCTTAGGC C/t GGCGGGCCCG 0.196 0.189 G-278C GGGGGAAGGG G/c ACGCAGACCG 0.435 0.424 C-14T GGAACTAGTC C/t CGGCAAAAAC 0.335 0.346 R219K GGCCTACCAA G/a GGAGAAACTG 0.283 0.278 G316G AGGGAGGGGG G/a CTGAAGATCA 0.114 0.095 I680I ACAACAGCAT C/a CTCTGGTTTA 0.129 0.118 V771 M GCAGGACTAC G/a TGGGCTTCAC 0.029 0.034 V825I CACCACTTCG G/a TCTCCATGAT 0.056 0.060 I883 M AGAAGAGAAT A/g TCAGAAAGTA 0.137 0.126 L1122L GAAGAACCAG C/t TGGGAACAGG 0.023 0.017 E1172D GCGACCATGA G/c AGTGACACGC 0.026 0.027 T1427T GCAGAGACAC G/a CCCTGCCAGG 0.069 0.083 R1587K CTGGACACCA G/a AAATAATGTC 0.216 0.226 *1 subject carried an additional GTTT deletion, leading to an allele of 19 nucleotides. Login to comment
94 Coding Region By single-locus analysis, the R219K polymorphism was associated with MI, with K219 allele being associated with a decreased risk consistently in the 2 centers (population adjusted ORafd;0.80 [0.68-0.94], Pafd;0.007). Login to comment
100 The "best" model encountered in the systematic exploration was the model with the R219K polymorphism alone, suggesting that apart from the raw effect of the R219K polymorphism, no other polymorphism was associated with the risk of MI. Login to comment
120 Discussion Much attention has been focused on the association of ABCA1 gene polymorphisms with different phenotypes including lipid variables and clinical endpoints.23,25-29,39 Several studies have consistently reported an association between the R219K polymorphism and coronary artery disease.23,26,27 This polymorphism has been shown to be associated with triglycerides23 but not with HDL-C.26,27 Inconsistent results were also observed for other ABCA1 gene polymorphisms including V825I, I883 M, and E1172D. Login to comment
129 Haplotype Structure Defined by the Polymorphisms of the ABCA1 Gene Coding Region (Nd1d;1296) Polymorphisms Estimated Haplotype Frequencies R219K G316G (G/A) I680I (C/A) V771 M V825I I883 M L1122L (C/T) E1172D T1427T (G/A) R1587K Controls (Nafd;639) Cases (Nafd;657) R G C V V I C E G R 0.470 0.522 R G C V V I C E G K 0.089 0.085 R G C V V I C E A R 0.026 0.031 R G C V V I C D G K 0.018 0.019 R G C V V I T E G R 0.016 0.017 R G A V I M C E G R 0.015 0.015 R G A V I M C E G K 0.015 0.015 R G A V I M C E A R 0.028 0.026 K G C V V I C E G R 0.077 0.063 K G C V V I C E G K 0.041 0.037 K G A V V M C E G R 0.026 0.020 K G A V V M C E G K 0.014 0.012 K G A V V M C E A R 0.016 0.019 K A C V V I C E G R 0.042 0.035 K A C V V I C E G K 0.034 0.027 K A C M V I C E G R 0.028 0.027 The haplotype structure of the coding region of the ABCA1 gene can be completely defined by a minimal subset of 8 "tag" polymorphisms indicated in boxes. Login to comment
140 Conversely, the R219K polymorphism was associated with MI but not with ApoA1 levels. Login to comment
145 There are also a number of inconsistencies in the results that we are unable to explain for the moment, especially the fact that R1587K affects plasma ApoA1 but appears unrelated to MI and conversely that R219K is associated with MI but does not affect plasma ApoA1 levels. Login to comment

[hide] Genetic variants of ABCA1 modify Alzheimer disease... Hum Mutat. 2004 Apr;23(4):358-67. Katzov H, Chalmers K, Palmgren J, Andreasen N, Johansson B, Cairns NJ, Gatz M, Wilcock GK, Love S, Pedersen NL, Brookes AJ, Blennow K, Kehoe PG, Prince JA
Genetic variants of ABCA1 modify Alzheimer disease risk and quantitative traits related to beta-amyloid metabolism.
Hum Mutat. 2004 Apr;23(4):358-67., [PMID:15024730]

Abstract [show]
Linkage studies have provided evidence that one or more loci on chromosome 9q influence Alzheimer disease (AD). The gene encoding the ATP-binding cassette A1 transporter (ABCA1) resides within proximity of previously identified linkage peaks and represents a plausible biological candidate for AD due to its central role in cellular lipid homeostasis. Several single nucleotide polymorphisms (SNPs) spanning ABCA1 have been genotyped and haplotype-based association analyses performed in four independent case-control samples, consisting of over 1,750 individuals from three European populations representing both early and late-onset AD. Prominent effects were observed for a common (H2) and rarer haplotype (H5) that were enriched in AD cases across studied populations (odds ratio [OR] 1.59, 95% confidence interval [CI] 1.36-1.82; P<0.00001 and OR 2.90; 95% CI 2.54-3.27; P<0.00001, respectively). Two other common haplotypes in the studied region (H1 and H3) were significantly under-represented in AD cases, suggesting that they may harbor alleles that decrease disease risk (OR 0.79, 95% CI 0.64-0.94; P=0.0065 and OR 0.70, 95% CI 0.46-0.93; P=0.011, respectively). While findings were significant in both early and late-onset samples, haplotype effects were more distinct in early-onset materials. For late-onset samples, ancillary evidence was obtained that both single marker alleles and haplotypes of ABCA1 contribute to variable cerebrospinal fluid tau and beta amyloid (Abeta42) protein levels, and brain Abeta load. Results indicate that variants of ABCA1 may affect the risk of AD, providing further support for a genetic link between AD and cholesterol metabolism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Details of ABCA1 SNPs, and Oligos for PCR and DASHn Variant dbSNP rsID Base change Forward primer sequence (50 ^30 ) Reverse primer sequence (30 ^50 ) Probe sequence (50 ^30 ) p.R219K rs2230806 c.658G4A g.10300705G4A b-TTTCTGAGCTTTGTGGCCTACC GCTCTGCTGCAGCCAGTTTCTC GTTTCTCCCTTGGTAGG p.V771M rs2066718 c.2314G4A g.102969093G4A b-TGTGTGTGGCATGGCAGGACTA GCGAAGATCTTGAGTGTGAAGC GAAGCCCACGTAGTCCT p.V825I rs4149312 c.2476G4A g.102967871G4A b-ATGGCTTCAATCTCACCACTTG GGTGTCAAACAGCATCATGGAG CATGGAGACCCAAGTGG p.I883M rs4149313 c.2650A4G g.102966591A4G b-GAGGTCAACAGCACTTACTTTCT AGAAGAGCCACCCTTGTTCCAA AAGAGAATGTCAGAAAG p.R1587K rs2230808 c.4762G4A g.102942642G4A b-ATTTATGACAGGACTGGACACC AGCGGTTTACCTTGACATTATT CATTATTTCTGGTGTCC n Genotyping of SNPs was performed using dynamic allele speci'c hybridization (DASH) [Prince et al., 2001]. Login to comment
81 Among these models, significant association for marker rs2230806 (c.658G4A, p.R219K) was observed (P=0.014 for genotypes, P=0.048 for alleles; Table 3). Login to comment
93 Single MarkerAssociations forABCA1and Alzheimer Diseasew p.R219K (rs2230806) G/G G/A A/A P value Set A AD 238 (.62) 125 (.33) 21 (.05) 0.014n Controls 102 (.58) 51 (.29) 22 (.13) Set B AD 58 (.48) 53 (.44) 9 (.08) 0.76 Controls 76 (.53) 59 (.41) 9 (.06) Set C AD 82 (.57) 53 (.37) 8 (.06) 0.66 Controls 183 (.56) 117 (.36) 26 (.08) Set D AD 183 (.56) 122 (.37) 22 (.07) 0.93 Controls 60 (.57) 40 (.38) 6 (.06) p.I883M (rs4149313) C/C C/T T/T Set A AD 2 (.01) 81 (.21) 301 (.78) 0.39 Controls 0 (.00) 31 (.18) 145 (.82) Set B AD 0 (.00) 29 (.24) 91 (.76) 0.27 Controls 3 (.02) 32 (.21) 115 (.77) Set C AD 2 (.01) 27 (.19) 116 (.80) 0.84 Controls 3 (.01) 53 (.17) 256 (.82) Set D AD 3 (.01) 68 (.21) 253 (.78) 0.61 Controls 2 (.02) 19 (.19) 83 (.80) p.R1587K (rs2230808) G/G G/A A/A Set A AD 253 (.66) 114 (.30) 15 (.04) 0.13 Controls 101 (.57) 66 (.38) 9 (.05) Set B AD 56 (.46) 58 (.48) 7 (.06) 0.016n Controls 96 (.64) 48 (.32) 7 (.05) Set C AD 80 (.55) 56 (.39) 9 (.06) 0.70 Controls 189 (.58) 121 (.37) 15 (.05) Det D AD 185 (.57) 118 (.36) 24 (.07) 0.18 Controls 68 (.64) 28 (.26) 10 (.09) p.V771M (rs2066718) G/G G/A A/A Set A AD 365 (.95) 20 (.05) 0 (.00) 0.28 Controls 167 (.95) 7 (.04) 1 (.01) Set B AD 109 (.98) 2 (.02) 0 (.00) 0.029n Controls 126 (.92) 11 (.08) 0 (.00) p.V825I (rs4149312) G/G G/A A/A Set A AD 341 (.93) 20 (.05) 4 (.01) 0.17 Controls 164 (.92) 15 (.08) 0 (.00) w Genotype frequencies for all studied SNPs in ABCA1 are presented. Login to comment
144 Single Marker QuantitativeTrait Associationsn p.R219K (rs2230806) Trait G/G G/A A/A P-value Set A CSF Tau 6407280 (156) 6447280 (78) 7097240 (12) NS CSFAb42 4627167 (149) 4877176 (75) 5067230 (11) NS AAO 72.478.4 (205) 72.377.8 (99) 72.577.0 (18) NS SP-NFT 7.472.0 (43) 6.972.2 (25) 4.771.2 (3) 0.039 Set B AAO 52.077.6 (56) 52.276.2 (52) 55.474.9 (8) NS Set C AAO 76.777.1 (80) 77.276.4 (52) 74.478.1 (8) NS Set D Ab load 4.671.9 (35) 4.372.3 (26) 4.972.7 (7) NS AAO 71.9712.3 (81) 7378.9 (58) 70.176.2 (10) NS p.I883M (rs4149313) Trait C/C C/T T/T Set A CSF Tau 5747318 (2) 6907328 (52) 6337262 (192) NS CSFAb42 354754 (2) 4437137 (48) 4817181 (185) NS AAO 64.978.6 (2) 72.078.8 (68) 72.477.8 (253) NS SP-NFT N/A 6.372.4 (16) 7.371.9 (55) 0.078 Set B AAO N/A 52.075.7 (28) 52.477.2 (88) NS Set C AAO 73.5719. Login to comment
201 The observation of an association with the common rs2230806 (R219K) variant was in indirect agreement with a smaller, recently published study, which suggested an effect upon AAO [Wollmer et al., 2003]. Login to comment

[hide] A promoter variant of the ATP-binding cassette tra... J Hum Genet. 2004;49(3):141-7. Epub 2004 Feb 21. Shioji K, Nishioka J, Naraba H, Kokubo Y, Mannami T, Inamoto N, Kamide K, Takiuchi S, Yoshii M, Miwa Y, Kawano Y, Miyata T, Miyazaki S, Goto Y, Nonogi H, Tago N, Iwai N
A promoter variant of the ATP-binding cassette transporter A1 gene alters the HDL cholesterol level in the general Japanese population.
J Hum Genet. 2004;49(3):141-7. Epub 2004 Feb 21., [PMID:14986172]

Abstract [show]
To investigate the effects of polymorphisms in the ATP-binding cassette transporter A1 ( ABCA1) gene on the high-density lipoprotein cholesterol (HDL-C) level and the incidence of myocardial infarction (MI), we performed association studies. Sequence analysis identified 14 polymorphisms in the promoter region of ABCA1. After considering linkage disequilibrium, three polymorphisms in the promoter region and 11 polymorphisms from the JSNP database were determined in 1,880 subjects recruited from the Suita Study, representing the general population in Japan. We evaluated the association between the ABCA1 genotype and HDL-C level adjusted not only for standard factors, but also for genetic factors including ApoA1 and ApoE genotypes. Of the 14 polymorphisms tested, the G(-273)C ( P=0.0074), C(-297)T ( P=0.0195), and IMS-JST071749 ( P=0.0093) polymorphisms were significantly associated with the HDL-C level in the Suita population. We could reconfirm that the G(-273)C genotype was influential in another set of subjects ( P=0.0310, n=743). However, the distribution of the ABCA1 G(-273)C genotype in subjects with MI ( n=598) was not different from that in the control population ( n=801). These results indicate that ABCA1 G(-273)C has a significant effect on the HDL-C level in the general Japanese population, but not on the incidence of MI.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 Well-known common variants, ABCA1 R219K and I823M, were also selected (Wang et al. 2000; Clee et al. 2001; Harada et al. 2003). Login to comment
65 Among the polymorphisms selected from JSNPs, including R219K and I823M, only the IMS-JST071749 polymorphism was associated with the HDL-C level (P=0.0060 adjusted for age, sex, BMI, smoking, and consumption of alcohol; P=0.0093 when also adjusted for the ApoE and ApoA1 (IMS-JST005603) genotypes). Login to comment
66 The R219K and I823M polymorphisms were not associated with the HDL-C level [P=0.3877 (R219K) and P=0.2286 (I823M) adjusted for age, sex, BMI, smoking and consumption of alcohol; P=0.1926 (R219K) and P=0.1209 (I823M) when also adjusted for the ApoE and ApoA1 genotypes]. Login to comment

[hide] Leukocyte ABCA1 gene expression is associated with... Metabolism. 2004 Jan;53(1):17-21. Albrecht C, Simon-Vermot I, Elliott JI, Higgins CF, Johnston DG, Valabhji J
Leukocyte ABCA1 gene expression is associated with fasting glucose concentration in normoglycemic men.
Metabolism. 2004 Jan;53(1):17-21., [PMID:14681836]

Abstract [show]
Adenosine triphosphate (ATP)-binding cassette transporter A1 (ABCA1) mediates the efflux of cholesterol to apolipoprotein A1, a process necessary for high-density lipoprotein (HDL) formation and reverse cholesterol transport. In patients with Tangier disease, mutations in ABCA1 result in low circulating HDL-cholesterol and predisposition to coronary heart disease (CHD). ABCA1 gene expression is decreased in diabetic mice. In humans, glycated hemoglobin (HbA(1c)) predicted future CHD events, even within the normal range. We hypothesised that leukocyte ABCA1 gene expression would be inversely associated with indices of glycemia in normoglycemic men. Fasting blood samples were taken from 32 healthy, nonsmoking, normoglycemic men (age 23 to 46 years). ABCA1, peroxisome proliferator-activated receptor gamma (PPARgamma), and liver X receptor alpha (LXRalpha) gene expressions in circulating leukocytes were measured using TaqMan technology. Significant inverse associations between ABCA1 gene expression and both fasting glucose concentration (r = -0.49, P =.008) and age (r = -0.39, P =.043) were found. There was no association with HbA(1c) (r = -0.23, P =.238) or HDL-cholesterol concentration (r = 0.02, P =.904). In a multiple regression model, fasting glucose remained a significant independent predictor (P =.037), whereas age did not (P =.226). Mechanisms underlying the association were explored; there were no significant associations between fasting glucose concentration and leukocyte PPARgamma gene expression, or between fasting glucose concentration and leukocyte LXRalpha gene expression. This is the first demonstration of an association between ABCA1 gene expression and fasting glucose concentration in vivo.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 More common variants in the gene encoding ABCA1, such as the R219K variant, which has a carrier frequency of 46% in Europeans, are also associated with altered lipid levels and a modified risk of CHD.9 The association between ABCA1 and CHD is only partly explained by HDL-cholesterol concentrations. Login to comment

[hide] Heterozygosity for ABCA1 gene mutations: effects o... Atherosclerosis. 2003 Dec;171(2):311-9. Kuivenhoven JA, Hovingh GK, van Tol A, Jauhiainen M, Ehnholm C, Fruchart JC, Brinton EA, Otvos JD, Smelt AH, Brownlee A, Zwinderman AH, Hayden MR, Kastelein JJ
Heterozygosity for ABCA1 gene mutations: effects on enzymes, apolipoproteins and lipoprotein particle size.
Atherosclerosis. 2003 Dec;171(2):311-9., [PMID:14644402]

Abstract [show]
A cohort of 13 female and 14 male heterozygotes for ATP binding cassette A1 (ABCA1) gene defects was directly compared with 13 and 14 unaffected female and male family members of almost exact same age. The activities of three proteins that play key roles in HDL metabolism were measured in addition to extensive lipid and (apo) lipoprotein subfraction analysis. Compared to controls, LCAT activity was reduced by 15% in affected subjects (P < 0.001) while PLTP activity was unaffected. Interestingly, CETP activity was elevated by 50% in the heterozygote siblings of one kindred but was unaffected in heterozygotes of the three other families. With respect to lipids, the heterozygotes had normal total cholesterol (TC), and LDL-cholesterol concentrations but presented with a trend towards increased triglyceride levels (13%; P = 0.08). HDL metabolism, by contrast, was severely affected as illustrated by 40% reductions in HDL-cholesterol (P < 0.001) with concomitant reductions in apoAI (25%; P < 0.001) levels and in lipoprotein subfraction LpAI (28%; P < 0.001), LpAI:AII (24%; P=0.014), and LpCIII:nonB (34%; P < 0.001) concentrations. We furthermore observed reduced average HDL particle size (5%; P = 0.004; 16% in female and 3.6% in male) and reduced plasma apoCIII concentration (15%; P = 0.006) while apoAII, apoAIV, apoE and apoB levels were unchanged. In conclusion, heterozygosity for ABCA1 defects was associated with reduced LCAT activity in absence of effects on PLTP activity. Of special interest was our finding that the effects of compromised ABCA1 function on HDL were more pronounced in women than in men.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
141 With respect to R219K that we have described to be associated with decreased TG levels [25], this can be explained by the fact that this mutation is thought to enhance ABCA1 function, while the defects studied in the present report concern loss-of-function mutations. Login to comment

[hide] Novel polypyrimidine variation (IVS46: del T -39..... Circ Res. 2003 Nov 14;93(10):1006-12. Epub 2003 Oct 23. Hong SH, Rhyne J, Miller M
Novel polypyrimidine variation (IVS46: del T -39...-46) in ABCA1 causes exon skipping and contributes to HDL cholesterol deficiency in a family with premature coronary disease.
Circ Res. 2003 Nov 14;93(10):1006-12. Epub 2003 Oct 23., [PMID:14576201]

Abstract [show]
Recent studies have implicated mutations in the ATP-binding cassette transporter A1, ABCA1, as a cause of Tangier disease (TD) and familial hypoalphalipoproteinemia (FHA). We investigated a proband with very low levels of high-density lipoprotein cholesterol (HDL-C, 6 mg/dL) and a history of premature coronary heart disease (CHD). Sequencing of the ABCA1 gene revealed 2 distinct variants. The first mutation was a G5947A substitution (R1851Q). The second mutation was a single-nucleotide deletion of thymidine in a polypyrimidine tract located 33 to 46 bps upstream to the start of exon 47. This mutation does not involve the 3' acceptor splice site and is outside the lariat branchpoint sequence (IVS46: del T -39...-46). Amplification of cDNA obtained in cultured fibroblasts of the proband and affected family member revealed an abnormally spliced cDNA sequence with skipping of exon 47. These variants were not identified in over 400 chromosomes of healthy whites. Compound heterozygotes (n=4) exhibited the lowest HDL-C (11+/-5 mg/dL) and ApoA-I (35+/-15 mg/dL) compared with wild-type (n=25) (HDL-C 51+/-14 mg/dL; ApoA-I 133+/-21 mg/dL) (P<0.0005) or subjects affected with either R1851Q (n=6) (HDL-C 36+/-8; ApoA-I 117+/-19) or IVS46: del T -39...-46 (n=5) (HDL-C 31+9; ApoA-I 115+28 (P<0.01). These data suggest that polypyrimidine tract variation may represent a novel mechanism for altered splicing and exon skipping that is independent of traditional intronic variants as previously identified in acceptor/donor splice regions or the lariat branchpoint domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Moreover, several noncoding (eg, C-17G) and coding (eg, R219K) single-nucleotide polymorphisms that do not affect levels of HDL-C have coincided with reduced CHD.23,24 In contrast, most but not all studies evaluating ABCA1 variants have demonstrated an association TABLE 1. Login to comment
92 Moreover, several noncoding (eg, C-17G) and coding (eg, R219K) single-nucleotide polymorphisms that do not affect levels of HDL-C have coincided with reduced CHD.23,24 In contrast, most but not all studies evaluating ABCA1 variants have demonstrated an association TABLE 1. Login to comment

[hide] Efflux and atherosclerosis: the clinical and bioch... Arterioscler Thromb Vasc Biol. 2003 Aug 1;23(8):1322-32. Epub 2003 May 22. Singaraja RR, Brunham LR, Visscher H, Kastelein JJ, Hayden MR
Efflux and atherosclerosis: the clinical and biochemical impact of variations in the ABCA1 gene.
Arterioscler Thromb Vasc Biol. 2003 Aug 1;23(8):1322-32. Epub 2003 May 22., [PMID:12763760]

Abstract [show]
Approximately 50 mutations and many single nucleotide polymorphisms have been described in the ABCA1 gene, with mutations leading to Tangier disease and familial hypoalphalipoproteinemia. Homozygotes and heterozygotes for mutations in ABCA1 display a wide range of phenotypes. Identification of ABCA1 as the molecular defect in these diseases has allowed for ascertainment based on genetic status and determination of genotype-phenotype correlations and has permitted us to identify mutations conferring a range of severity of cellular, biochemical, and clinical phenotypes. In this study we review how genetic variation at the ABCA1 locus affects its role in the maintenance of lipid homeostasis and the natural progression of atherosclerosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
136 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon -1095A/G Promoter ⅐ ⅐ ⅐ -477C/T Promoter ⅐ ⅐ ⅐ -419A/C Promoter ⅐ ⅐ ⅐ -320G/C Promoter ⅐ ⅐ ⅐ -191G/C Promoter ⅐ ⅐ ⅐ C69T 5ЈUTR 1 C117G 5ЈUTR 1 InsG319 5ЈUTR 2 G378C 5ЈUTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
147 The R219K, V771M, and I883M variants have been recognized as putative antiatherogenic polymorphisms, associated with increased HDL-C and decreased triglyceride levels (K219 and M883) and increased HDL-C and ApoA-I (M771).41,75,82 The E1172D, R1587K cSNPs have been reported to be associated with decreased HDL-C.75 Five promoter SNPs are associated with increased severity of atherosclerosis, including the -191C/-320C/-477T hap- lotype76,78 as well as the G-191C and A-1096G SNPs. Login to comment
148 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ⅐ ⅐ ⅐ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ⅐ ⅐ ⅐ ⅐ ⅐ ⅐ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
153 The V825I, I883M, and E1172D SNPs have also been associated with increased clinical events and severity of atherosclerosis.75,77 The R219K Variant The R219K SNP has been most studied and highlights many of the difficulties associated with the study of SNPs in general. Login to comment
160 Clee et al75 reported significant LD between the R219K and the V771M, K776N, I883M, and R1587K cSNPs but found that after carriers of these variants were excluded, R219K remained significantly associated with degree of atherosclerosis and triglyceride levels. Login to comment
162 Functional Effects of cSNPs and Regulatory SNPs in the ABCA1 Gene Nucleotide Amino Acid/Position Lipids CAD/Atherosclerosis Antiatherogenic SNPs C-17G Promoter No change 2 InsG319 5ЈUTR No change 2 G1051A R219K 2 TG, 1 HDL, 1 ApoA-1, 1 ApoB, 1 LDL 2 A3044G I883M 2 TG, 1 HDL 1 Proatherogenic SNPs -191C/-320C/-477T haplotype Promoter No change 1 G-191C Promoter No change 1 A-1095G Promoter No change 1 C117G 5ЈUTR 1 TG No change G2706A V771M No change 1 G2868A V825I No change 1 G3911C E1172D 2 HDL, 2 ApoB 1 G5155A R1587K 2 HDL No change Associations with lipid levels and CAD are shown by arrows to represent the direction of association. Login to comment
171 The noncoding SNPs G-191C, C-69T, C-17G, and InsG319 and the cSNPs R219K, V771M, and V825I have all been found to be associated with differences in severity of atherosclerosis but not with changes in HDL-C levels in at least 1 study. Login to comment
128 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon afa;1095A/G Promoter ዼ ዼ ዼ afa;477C/T Promoter ዼ ዼ ዼ afa;419A/C Promoter ዼ ዼ ዼ afa;320G/C Promoter ዼ ዼ ዼ afa;191G/C Promoter ዼ ዼ ዼ C69T 5b18;UTR 1 C117G 5b18;UTR 1 InsG319 5b18;UTR 2 G378C 5b18;UTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 Singaraja et al Clinical and Biochemical Impact of ABCA1 Variants markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
139 The R219K, V771M, and I883M variants have been recognized as putative antiatherogenic polymorphisms, associated with increased HDL-C and decreased triglyceride levels (K219 and M883) and increased HDL-C and ApoA-I (M771).41,75,82 The E1172D, R1587K cSNPs have been reported to be associated with decreased HDL-C.75 Five promoter SNPs are associated with increased severity of atherosclerosis, including the afa;191C/afa;320C/afa;477T hap- lotype76,78 as well as the G-191C and A-1096G SNPs. Login to comment
140 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ዼ ዼ ዼ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ዼ ዼ ዼ ዼ ዼ ዼ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
145 The V825I, I883M, and E1172D SNPs have also been associated with increased clinical events and severity of atherosclerosis.75,77 The R219K Variant The R219K SNP has been most studied and highlights many of the difficulties associated with the study of SNPs in general. Login to comment
152 Clee et al75 reported significant LD between the R219K and the V771M, K776N, I883M, and R1587K cSNPs but found that after carriers of these variants were excluded, R219K remained significantly associated with degree of atherosclerosis and triglyceride levels. Login to comment
154 Functional Effects of cSNPs and Regulatory SNPs in the ABCA1 Gene Nucleotide Amino Acid/Position Lipids CAD/Atherosclerosis Antiatherogenic SNPs C-17G Promoter No change 2 InsG319 5b18;UTR No change 2 G1051A R219K 2 TG, 1 HDL, 1 ApoA-1, 1 ApoB, 1 LDL 2 A3044G I883M 2 TG, 1 HDL 1 Proatherogenic SNPs afa;191C/afa;320C/afa;477T haplotype Promoter No change 1 G-191C Promoter No change 1 A-1095G Promoter No change 1 C117G 5b18;UTR 1 TG No change G2706A V771M No change 1 G2868A V825I No change 1 G3911C E1172D 2 HDL, 2 ApoB 1 G5155A R1587K 2 HDL No change Associations with lipid levels and CAD are shown by arrows to represent the direction of association. Login to comment
163 The noncoding SNPs G-191C, C-69T, C-17G, and InsG319 and the cSNPs R219K, V771M, and V825I have all been found to be associated with differences in severity of atherosclerosis but not with changes in HDL-C levels in at least 1 study. Login to comment

[hide] R219K polymorphism of the ABCA1 gene and its modul... Metabolism. 2003 Jul;52(7):930-4. Srinivasan SR, Li S, Chen W, Boerwinkle E, Berenson GS
R219K polymorphism of the ABCA1 gene and its modulation of the variations in serum high-density lipoprotein cholesterol and triglycerides related to age and adiposity in white versus black young adults. The Bogalusa heart study.
Metabolism. 2003 Jul;52(7):930-4., [PMID:12870173]

Abstract [show]
Mutations in adenosine triphosphate (ATP)-binding cassette transporter 1 (ABCA1) gene have been established as the molecular defect in Tangier disease and familial hypoalphalipoproteinemia, uncommon genetic disorders characterized by deficient or depressed high-density lipoprotein (HDL) cholesterol and increased triglycerides. However, information regarding the frequency of common variants, including Arg219Lys (R219K) within the coding region of the ABCA1 gene and their effect on these phenotypes in the general population is limited. This study examined the frequency and phenotypic effect of R219K variant in a community-based sample of 887 white and 390 black young adults aged 20 to 38 years. The frequency of the variant allele (K219) was higher in blacks than in whites (0.595 v 0.262, P<.001), with carriers (KK+RK) representing 83.8% of blacks versus 44.2% of whites. After adjusting for age, body mass index (BMI), and sex, the genotype effect on HDL cholesterol and natural logarithm of triglycerides was not apparent in whites or blacks. However, significant interaction effects of genotype and age on HDL cholesterol (P<.001) and genotype and BMI on triglycerides (P=.029) were found in whites. Carriers (KK+RK), unlike noncarriers (RR) showed a positive relationship between age and HDL cholesterol (regression coefficient beta=0.28, P=.029 for carriers v beta=-0.18, P=.112 for noncarriers). In addition, the variant allele attenuated the adverse positive relationship between BMI and triglycerides (beta=0.032, P<.001 for carriers v beta=0.046, P<.001 for noncarriers). These results indicate that the K219 allele frequency differs markedly between blacks and whites, and that the variant-allele modulates the association between age and HDL cholesterol, as well as body fatness and triglycerides in a beneficial manner only in whites.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 R219K Polymorphism of the ABCA1 Gene and Its Modulation of the Variations in Serum High-Density Lipoprotein Cholesterol and Triglycerides Related to Age and Adiposity in White Versus Black Young Adults. Login to comment
2 However, information regarding the frequency of common variants, including Arg219Lys (R219K) within the coding region of the ABCA1 gene and their effect on these phenotypes in the general population is limited. Login to comment
3 This study examined the frequency and phenotypic effect of R219K variant in a community-based sample of 887 white and 390 black young adults aged 20 to 38 years. Login to comment
10 SERUM HIGH-DENSITY lipoprotein (HDL) cholesterol is inversely related to coronary artery disease (CAD).1 This has been attributed, in part, to the key role HDL plays in the transport of cholesterol from peripheral tissues including the arterial wall to the liver, an antiatherogenic process known as reverse cholesterol transport.2 In addition, HDL is metabolically inversely related to triglyceride-rich lipoproteins,3,4 another strong risk factor for CAD.5 In the general population, factors such as age, race, sex, body fatness, variability in lipoprotein lipase, hepatic triglyceride lipase, and cholesteryl ester transfer protein activities and apolipoprotein (apo) A-I production rate influence HDL cholesterol levels.6-10 It has been known that familial disorders of HDL metabolism contribute to very low levels of HDL cholesterol.11 Mutations in the gene encoding adenosine triphosphate (ATP)- binding cassette transporter 1 (ABCA1) have been identified as the molecular basis of 2 familial HDL disorders, Tangier disease and familial hypoalphalipoproteinemia.12-14 As a cholesterol efflux regulatory protein, ABCA1 participates in the biogenesis of HDL by facilitating both translocation of cholesterol and phospholipid to the plasma membrane and efflux on to lipid poor apo A-I particles.15,16 Because mutations associated with severe functional impairment of ABCA1 are not common among individuals with low HDL cholesterol, research has been focused recently on common single nucleotide polymorphisms in the coding and promotor regions of ABCA1.17-20 The ABCA1 gene, localized on chromosome 9q31, contains 49 exons that range in size from 33 to 249 bp and is over 70 kb in length.21 A G to A transversion at nucleotide position 1051 in exon 7 results in the substitutions of a lysine for arginine at amino acid residue 219 (R219K). Login to comment
12 As part of the Bogalusa Heart Study, a biracial (black-white) community-based investigation of early natural history of cardiovascular disease, the present study examines the 219K allele frequency and the effect of R219K polymorphism on serum HDL cholesterol and triglycerides in young adults. Login to comment
14 Of these, 1,277 individuals (887 whites and 390 blacks) aged 20 to 38 years who had ABCA1 R219K genotype data formed the study sample for this report. Login to comment
30 Genotyping of R219K Polymorphism Genotyping of the ABCA1 R219K variant was performed using the TaqMan assay (Applied Biosystems, Foster City, CA). Login to comment
35 Based on the analysis of 67 pairs of blind duplicates, there was 98.5% concordance in R219K genotyping. Login to comment
41 Multiple regression model was used to examine the independent effects of R219K polymorphism and the interaction effect between genotype and age, sex, or BMI (or subscapular skinfold) on levels of HDL cholesterol and triglycerides. Login to comment
42 RESULTS The R219K genotype and allele frequencies by race are given in Table 1. Login to comment
45 Genotype and Allele Frequencies for the R219K Polymorphism of ABCA1 Gene by Race: The Bogalusa Heart Study White (n ϭ 887) Count (%) Black (n ϭ 390) Count (%) Genotype* RR 495 (55.8) 63 (16.2) RK 320 (36.1) 190 (48.7) KK 72 (8.1) 137 (35.1) Allele* R 1,310 (73.8) 316 (40.5) K 464 (26.2) 464 (59.5) *Race difference, P Ͻ .001. Login to comment
47 Levels of Serum HDL Cholesterol and Triglycerides in Whites and Blacks by R219K Genotype of ABCA1: The Bogalusa Heart Study K219 Allele PNoncarrier Carrier Whites No. Login to comment
66 DISCUSSION The present community-based study demonstrates that (1) the relative allele frequency of the R219K polymorphism of the ABCA1 gene differs markedly between blacks and whites and (2) the R219K variant significantly alters association of HDL cholesterol with age, and triglycerides with adiposity in whites, but not in blacks. Login to comment
70 Heterozygotes for ABCA1 deficiency have decreased HDL cholesterol and increased triglycerides.24,25 In contrast, the phenotypic effects of the common variants, such as R219K and I823M located in the coding region of the ABCA1 gene, are found to be just opposite, suggesting these common variants are associated with an enhanced ABCA1 function.17,18 In the current study, no genotypic effects on HDL cholesterol and triglycerides were apparent in whites or blacks. However, when interaction terms of genotype with age, sex, or adiposity were included in the model, significant interaction effects of genotype and age on HDL cholesterol and genotype and adiposity on triglycerides were noted in whites, but not in blacks. Login to comment
72 Effect of Interaction Between R219K Genotype of ABCA1 and Age, Sex or BMI on Levels of Serum HDL Cholesterol and Triglycerides by Race: The Bogalusa Heart Study Independent Variable White Black HDL Cholesterol Triglycerides* HDL Cholesterol Triglycerides* beta† P beta P beta P beta P Age -0.122 .240 0.010 .045 0.385 .303 0.004 .736 Sex 7.056 Ͻ.001 -0.055 .265 -1.604 .692 -0.264 .052 BMI -0.646 Ͻ.001 0.045 Ͻ.001 -0.899 Ͻ.001 0.016 .081 Genotype -0.449 .697 -0.061 .276 -2.260 .531 0.015 .906 Age* genotype 0.524 Ͻ.001 -0.006 .391 -0.484 .233 0.014 .305 Sex* genotype 0.744 .624 0.041 .576 3.891 .375 0.029 .844 BMI* genotype 0.019 .883 -0.014 .029 0.293 .311 -0.003 .779 NOTE. Login to comment
77 Relationship of serum HDL cholesterol to age in whites by R219K genotype of ABCA1. Login to comment
81 Based on earlier findings that the expression and activity of P-glycoprotein, another ABC transporter, increases with age,26 it has been suggested that ABCA1 activity may normally increase with age, but this was blunted in ABCA1 heterozygotes.24 With respect to common R219K polymorphism, an earlier study found that the age-related increases in HDL cholesterol and cholesterol efflux in older age groups (median age, 56.7 years) were also blunted in carriers of the K219 allele, although homozygous carriers of this common variant displayed reduced severity of CAD, decreased progression of atherosclerosis, and a trend toward increased HDL cholesterol.17 It is not clear whether differences in age and preexisting CAD among subjects between studies may account for the conflicting finding regarding R219K variant. Login to comment
85 The observed lack of phenotypic effects of R219K polymorphism and its interaction with age or adiposity in blacks suggests that other factors may play a dominant role in determining levels of HDL cholesterol and triglycerides in this group. Login to comment
87 Further, obesity has relatively less impact on these variables in blacks.9,10 Studies, including our own, have shown that blacks versus whites have markedly higher lipoprotein lipase activity and lower hepatic triglyceride lipase activity,30-32 key parameters associated with metabolism and systemic levels of triglyceride-rich lipoproteins and HDL.33 Because these metabolic parameters favor a relatively higher HDL cholesterol and lower triglyceride trait in blacks, the phenotypic effects of the R219K variant per se may not be evident in this group. Login to comment

[hide] Genetics of HDL regulation in humans. Curr Opin Lipidol. 2003 Jun;14(3):273-9. Miller M, Rhyne J, Hamlette S, Birnbaum J, Rodriguez A
Genetics of HDL regulation in humans.
Curr Opin Lipidol. 2003 Jun;14(3):273-9., [PMID:12840658]

Abstract [show]
PURPOSE OF REVIEW: To review gene regulation of HDL-cholesterol and discuss molecular abnormalities in HDL candidate genes that may lead to human pathologic states. RECENT FINDINGS: The inverse association between HDL-cholesterol and vascular disease, especially coronary heart disease, has long been recognized, but understanding gene regulation of HDL in humans gained considerable momentum following the identification of ABCA1 as playing a pivotal role in reverse cholesterol transport. Recent data suggest that potentially important targets for upregulating HDL in humans include upregulators of ABCA1 and APOA1 (e.g. peroxisome proliferator activated receptor and liver X receptor agonists) and downregulators of CETP (e.g. JTT-705). A host of other nuclear receptors under investigation in animal models may advance to human testing in the near future. SUMMARY: Disorders affecting HDL metabolism are complex because monogenic disorders causing low HDL do not necessarily correlate with premature vascular disease. To date, pathologic phenotypes have only been deduced among several HDL candidate genes. Understanding the genetic underpinnings associated with variant HDL and reverse cholesterol transport provides an exceptional opportunity to identify novel agents that may optimize this process and reduce vascular event rates beyond currently available LDL lowering therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 TD 1051 G/A 7 R219K extracellular [67,68] FHA 1083 C/T 7 R230C extracellular [70] FHA 1158 G/A 8 A255T extracellular [75.] Login to comment

[hide] ABCA1 modulates CSF cholesterol levels and influen... Neurobiol Aging. 2003 May-Jun;24(3):421-6. Wollmer MA, Streffer JR, Lutjohann D, Tsolaki M, Iakovidou V, Hegi T, Pasch T, Jung HH, Bergmann K, Nitsch RM, Hock C, Papassotiropoulos A
ABCA1 modulates CSF cholesterol levels and influences the age at onset of Alzheimer's disease.
Neurobiol Aging. 2003 May-Jun;24(3):421-6., [PMID:12600718]

Abstract [show]
Increased formation of the beta-amyloid peptide (Abeta) is a central event in the pathogenesis of Alzheimer's disease (AD). High cellular cholesterol load promotes Abeta formation. The ATP-binding cassette transporter A1 (ABCA1) mediates cholesterol efflux from cells. We hypothesized that genetic variability in ABCA1 may influence cholesterol metabolism in the central nervous system (CNS) and, thus, interfere with the development of AD. Healthy elderly carriers of the A allele of a non-synonymous (R219K) single nucleotide polymorphism (SNP) in the ABCA1 gene (rs2234884) had on average 33% lower total cholesterol in cerebrospinal fluid (CSF) than non-carriers. In 169 patients with late onset, sporadic AD, this allele was associated with delayed age at onset of the disease by 1.7 years on average. Rs2234884 and another non-synonymous SNP (R1587K) in ABCA1 (rs2234886) failed to show significant association with the risk for AD. We conclude that genetic variability of ABCA1 influences the development of AD, possibly by interfering with CNS cholesterol homeostasis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 Healthy elderly carriers of the A allele of a non-synonymous (R219K) single nucleotide polymorphism (SNP) in the ABCA1 gene (rs2234884) had on average 33% lower total cholesterol in cerebrospinal fluid (CSF) than non-carriers. Login to comment
112 Discussion We found that the A allele of a non-synonymous (R219K) SNP in ABCA1 (rs2234884) is associated with low cholesterol levels in the CSF of cognitively healthy elderly individuals. Login to comment

[hide] The association of the R219K polymorphism in the A... J Mol Med (Berl). 2003 Apr;81(4):264-70. Epub 2003 Mar 26. Evans D, Beil FU
The association of the R219K polymorphism in the ATP-binding cassette transporter 1 ( ABCA1) gene with coronary heart disease and hyperlipidaemia.
J Mol Med (Berl). 2003 Apr;81(4):264-70. Epub 2003 Mar 26., [PMID:12700893]

Abstract [show]
The R219K polymorphism in the ATP-binding cassette transporter 1 gene ( ABCA1) has been associated with reduced severity of atherosclerosis, fewer coronary events, decreased triglycerides and a trend to increased HDL in men with coronary heart disease (CHD). This study examined the frequency and the effect on CHD and plasma lipids of the polymorphism in patients of both sexes attending a lipid out-patient clinic. The overall frequency of the K allele was 0.26. It was lower in patients with CHD (0.21) than in those without (0.27) but this was not statistically significant. Amongst patients with elevated Lp(a) the frequency of the K allele was significantly lower in those with CHD (0.16) than in those without (0.29). There were no statistically significant differences in total cholesterol, LDL, HDL, apoB or apoAI between carriers and non-carriers. When patients with probable secondary hypertriglyceridaemia (triglycerides >1000 mg/dl), type 2 diabetes and carriers of lipoprotein lipase polymorphisms associated with hypertriglyceridaemia were excluded, the K allele was significantly associated with reduced triglycerides but only in patients with apoE 3/3 genotype. In conclusion, we provide additional evidence that the R219K polymorphism in the ABCA1 gene either directly or as a result of linkage disequilibrium with additional functional variant(s), has a protective effect against CHD and is associated with lower plasma triglycerides in sub-groups of patients with hyperlipidaemia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Abstract The R219K polymorphism in the ATP-binding cassette transporter 1 gene (ABCA1) has been associated with reduced severity of atherosclerosis, fewer coronary events, decreased triglycerides and a trend to increased HDL in men with coronary heart disease (CHD). Login to comment
7 In conclusion, we provide additional evidence that the R219K polymorphism in the ABCA1 gene either directly or as a result of linkage disequilibrium with additional functional variant(s), has a protective effect against CHD and is associated with lower plasma triglycerides in sub-groups of patients with hyperlipidaemia. Login to comment
10 Evans (✉) · F. U. Beil Klinik und Poliklinik für Innere Medizin, Medizinische Klinik I, Universitätsklinikum Hamburg-Eppendorf, Martinistrasse 52, 20246 Hamburg, Germany e-mail: evans@uke.uni-hamburg.de Tel.: +49-40-428036978, Fax: +49-40-428038290 J Mol Med (2003) 81:264-270 DOI 10.1007/s00109-003-0426-y O R I G I N A L A RT I C L E David Evans · F. Ulrich Beil The association of the R219K polymorphism in the ATP-binding cassette transporter 1 (ABCA1) gene with coronary heart disease and hyperlipidaemia Received: 31 October 2002 / Accepted: 16 January 2003 / Published online: 26 March 2003 (c) Springer-Verlag 2003 DAVID EVANS received his Ph.D. in virology in 1979 from the University of Glasgow, UK. Login to comment
22 Clee et al. [15] investigated the phenotypic effects of the R219K polymorphism in 804 Dutch subjects with confirmed coronary artery disease. Login to comment
31 The aim of this study was to investigate the role of the R219K polymorphism in CHD and plasma lipid levels in patients attending a lipid out-patient clinic. Login to comment
44 Genotyping DNA was extracted using standard methods and the frequency of the R219K polymorphism in ABCA1 was determined as described by Clee et al. [15], apoE and lipoprotein lipase LPL polymorphisms were determined as described [19, 20, 21]. Login to comment
60 Carriers of the K allele had lower triglycerides and, although not statistically significant, the P value Table 2 R219K polymorphism in the ABCA1 gene and coronary heart disease (CHD) All Men Women* Lp(a)>20 mg/dl n Age (years) n Age (years) n Age (years) All** Men Women CHD present RR 72 56.1±1.5 49 54.7±1.9 23 59.2±2 33 22 11 RK+KK 35+7 54.5±1.8 25+7 53.1±1.9 10+0 59.2±3.9 13+1 9+1 4+0 K frequency 0.21 0.24 0.15 0.16 0.19 0.10 CHD absent RR 337 43.2±0.7 178 42.8±0.8 159 43.7±1.2 78 32 46 RK+KK 245+47 43.7±0.8 128+29 44.2±0.9 117+18 43.1±1.3 66+12 31+8 35+4 K frequency 0.27 0.28 0.26 0.29 0.31 0.24 *P=0.05, difference in allele frequency between the presence and absence of CHD in women (Fisher`s exact test) **P=0.007, combined difference in allele frequency between the presence and absence of CHD (Fisher's exact test) Table 3 R219K polymorphism in the ABCA1 gene and plasma lipids (HDL-c high-density lipoprotein cholesterol, LDL-c low-density lipoprotein cholesterol) Before treatment After diet advice RR (n=279) RK (n=206) KK (n=30) RR (n=338) RK (n=229) KK (n=43) Age (years) 45.8±0.6 45.3±0.7 45.6±2.2 45.9±1 46.2±1 43.7±2 Body mass index 26.4±0.2 26.2±0.3 25.9±0.7 26.5±0.2 26.1±0.3 24.4±1.6 Total cholesterol (mg/dl) 285±4.9 284±6.1 280±10 278±5 284±6 274±8 Triglycerides (mg/dl) 328±30 288±32 236±49 317±26 297±30 216±27 HDL-c (mg/dl) 51±1 52±1 49±12 47±1 48±1 45±2 LDL-c (mg/dl) 188±4 188±5 194±12 190±5 192±5 195±10 ApoB (mg/dl) 135±2 130±3 142±8 - - - ApoAI (mg/dl) 131±2 133±2 127±5 - - - Fig. 1 ABCA1 R219K genotype frequencies and coronary heart disease in patients with elevated (>20 mg/dl) lipoprotein(a) Table 4 R219K polymorphism in the ABCA1 gene and plasma triglycerides before treatment: successive exclusion of factors associated with elevated triglycerides and interaction with apoE genotype (DM2, triglycerides >1000 mg/dl, apoE 2/2, LPL D9N, N291S carriers excluded) Patients excluded RR RK KK Pb apoE genotype None 0.17 n 279 206 30 Triglycerides 328±30 288±32 236±49 DM2, triglycerides >1000 mg/dl 0.13 n 258 191 29 Triglycerides 232±11 207±13 195±27 DM2, triglycerides >1000 mg/dl, apoE 2/2 0.09 ns 255 188 29 Triglycerides 232±12 203±13 195±27 DM2, triglycerides >1000 mg/dl, apoE 2/2, 0.07 LPL D9N, N291S carriers n 194 141 22 Triglycerides 234±14 200±15 158±17 3/3 0.035 n 113 76 11 Triglycerides 200±15 152±14 148±14 */4a 0.24 n 70 53 8 Triglycerides 270±28 249±30 140±28 3/4 0.23 n 59 44 7 Triglycerides 250±28 256±34 125±27 2/3 0.87 n 15 12 3 Triglycerides 321±55 290±54 243±86 was lower (P=0.13 vs. 0.17) despite the lower number of patients. Login to comment
76 Discussion In this communication we confirm in patients of both sexes with hyperlipidaemia the findings of Clee et al. [15] in men with CHD that the K allele of the R219K polymorphism in the ABCA1 gene has a protective effect against CHD and is associated with reduced plasma tri- glyceride levels. Login to comment
80 Unlike Clee et al. [15] we did not find an association between the R219K polymorphism and HDL, nor did we find that the age of the patient affected the influence of the polymorphism; however, we did find an association with plasma triglycerides. Login to comment
87 Clee et al. [15] found that the R219K polymorphism was in linkage disequilibrium with two less frequent variants, V771M and K776N; however, excluding patients who were also carriers of these polymorphisms did not alter the results they obtained for the R219K polymorphism. Login to comment
88 Similarly they observed that the R219K effects were independent of the I883M and R1587K variants. Login to comment
90 Although there is considerable amount of linkage disequilibrium between the polymorphisms, they did not report the extent of disequilibrium with the R219K polymorphism. Login to comment
91 Neither Brousseau et al. [16] nor Wang et al. [13] report on linkage disequilibrium between the R219K and other polymorphisms. Login to comment
92 Lutucuta et al. [17] also reported the effect of polymorphisms in the promoter of the ABCA1 gene on coronary atherosclerosis but did not determine whether this was due to disequilibrium with the R219K polymorphism. Login to comment
93 Therefore given the large number of polymorphisms described to date in the ABCA1 gene we cannot in this communication conclude that the effects which we see of the K allele of the R219K polymorphism are the direct result of the polymorphism, or whether it is a marker for functional variation elsewhere in the gene. Login to comment
95 In conclusion here we provide evidence that the R219K polymorphism in the ABCA1 gene has a protective effect against CHD in patients at high risk due to hyperlipidaemia and especially those with concomitantly elevated Lp(a). Login to comment

[hide] A common variant in the ABCA1 gene is associated w... J Med Genet. 2003 Mar;40(3):163-8. Cenarro A, Artieda M, Castillo S, Mozas P, Reyes G, Tejedor D, Alonso R, Mata P, Pocovi M, Civeira F
A common variant in the ABCA1 gene is associated with a lower risk for premature coronary heart disease in familial hypercholesterolaemia.
J Med Genet. 2003 Mar;40(3):163-8., [PMID:12624133]

Abstract [show]
Familial hypercholesterolaemia (FH) is a common autosomal codominant hereditary disease caused by defects in the LDL receptor (LDLR) gene, and one of the most common characteristics of affected subjects is premature coronary heart disease (CHD). In heterozygous FH patients, the clinical expression of FH is highly variable in terms of the severity of hypercholesterolaemia and the age of onset and severity of CHD. Identification of mutations in the ATP binding cassette transporter 1 (ABCA1) gene in patients with Tangier disease, who exhibit reduced HDL cholesterol and apolipoprotein A1 concentrations and premature coronary atherosclerosis, has led us to hypothesise that ABCA1 could play a key role in the onset of premature CHD in FH. In order to know if the presence of the R219K variant in the ABCA1 gene could be a protective factor for premature CHD in FH, we have determined the presence of this genetic variant by amplification by PCR and restriction analysis in a group of 374 FH subjects, with and without premature CHD. The K allele of the R219K variant was significantly more frequent in FH subjects without premature CHD (0.32, 95% CI 0.27 to 0.37) than in FH subjects with premature CHD (0.25, 95% CI 0.21 to 0.29) (p<0.05), suggesting that the genetic variant R219K in ABCA1 could influence the development and progression of atherosclerosis in FH subjects. Moreover, the K allele of the R219K polymorphism seems to modify CHD risk without important modification of plasma HDL-C levels, and it appears to be more protective for smokers than non-smokers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
128 In order to know if the presence of the R219K variant in the ABCA1 gene could be a protective factor for premature CHD in FH, we have determined the presence of this genetic variant by amplification by PCR and restriction analysis in a group of 374 FH subjects, with and without premature CHD. Login to comment
129 The K allele of the R219K variant was significantly more frequent in FH subjects without premature CHD (0.32, 95% CI 0.27 to 0.37) than in FH subjects with premature CHD (0.25, 95% CI 0.21 to 0.29) (p<0.05), suggesting that the genetic variant R219K in ABCA1 could influence the development and progression of atherosclerosis in FH subjects. Login to comment
130 Moreover, the K allele of the R219K polymorphism seems to modify CHD risk without important modification of plasma HDL-C levels, and it appears to be more protective for smokers than non-smokers. Login to comment
137 In order to discover if the presence of the R219K polymorphism in the ABCA1 gene plays a protective role for premature CHD in FH, we have analysed this genetic variant in a group of FH subjects. Login to comment
138 In this work, we report that the common variant R219K in the ABCA1 gene is significantly more frequent in FH subjects without premature CHD than in FH subjects with premature CHD, suggesting that genetic variation in ABCA1 influences the atherosclerosis process in FH subjects. Login to comment
195 R219K polymorphism analysis Genomic DNA from peripheral blood was isolated using a previously described method, with minor modifications.27 A 166 bp fragment of exon 7 of the ABCA1 gene involving nucleotide 1051 of the cDNA sequence28 was amplified by polymerase chain reaction (PCR), using the following primers: R219Ks: 5'-GCAAGGCTACCAGTTACATTTGACAAG-3' and R219Kas: 5'- GATTGGCTTCAGGATGTCCATGTTGG-3'. Login to comment
206 Associations between R219K polymorphism and lipid data were analysed by multivariate ANOVA adjusted by age, gender, and BMI. Login to comment
219 The R219K polymorphism is the result of a nucleotide change G→A at position 1051 of the cDNA sequence, and it results in the substitution of lysine for arginine at amino acid 219 of the ABCA1 protein. Login to comment
222 The R219K polymorphism was in Hardy-Weinberg equilibrium in the control and premature CHD groups. Login to comment
223 The genotype frequency distribution for the R219K polymorphism is shown in table 2. Login to comment
226 The allelic frequencies for the minor K allele of the R219K polymorphism were 0.32 (95% CI 0.27 to 0.37) and 0.25 (95% CI 0.21 to 0.29) for control and premature CHD groups, respectively (p<0.05). Login to comment
227 The presence of the K allele of the R219K polymorphism reduced the coronary event risk in the FH studied population (odds ratio 0.63, 95% CI 0.42 to 0.95). Login to comment
228 The clinical and biochemical characteristics of carriers and non-carriers of the K allele for the R219K variant in the ABCA1 Table 1 Clinical and biochemical characteristics of the FH subjects included in this study Male p Female p Control PCHD Control PCHD No 66 144 92 72 Age (years) 64.3 (6.6) 51.1 (10.4) <0.001 70.5 (5.6) 57.8 (10.5) <0.001 BMI (kg/m2 ) 27.2 (3.0) 27.0 (3.5) NS 27.0 (4.3) 28.2 (4.6) NS TC (mmol/l) 10.7 (1.8) 10.8 (1.9) NS 11.1 (1.9) 11.2 (2.2) NS LDL-C (mmol/l) 8.7 (1.8) 8.9 (1.9) NS 9.0 (1.9) 9.2 (2.4) NS TG (mmol/l) 1.55 (0.71) 1.57 (0.73) NS 1.42 (0.66) 1.39 (0.60) NS HDL-C (mmol/l) 1.24 (0.36) 1.14 (0.30) NS 1.45 (0.36) 1.42 (0.44) NS Lp(a) (µmol/l) 1.50 (1.52) 2.11 (2.01) 0.049 2.11 (2.07) 1.96 (2.16) NS Xanthomas 46.0% 41.1% NS 28.9% 33.8% NS Arcus cornealis 77.8% 55.4% 0.002 63.3% 40.0% 0.003 Hypertension 27.9% 18.0% NS 36.1% 39.3% NS Smoking 61.7% 79.7% 0.008 2.4% 14.8% 0.006 DM-2 11.9% 2.3% 0.006 7.3% 5.2% NS Values are mean (SD) for quantitative variables, and percentages for qualitative variables. Login to comment
231 Male subjects with the RR genotype had higher LDL-C levels than K allele carriers of the R219K polymorphism (p=0.04). Login to comment
233 On the other hand, subjects not carrying the K allele of the R219K polymorphism had more xanthomas than subjects with the RK or KK genotypes (p=0.04). Login to comment
235 The remaining variables, age, BMI, lipid and lipoprotein levels, and presence of arcus cornealis, did not show differences between carriers and non-carriers of the K allele of the R219K polymorphism. Login to comment
236 To assess whether the presence of the K allele of the R219K variant has an effect on the age of onset of the first coronary event in the premature CHD group, we analysed the distribution of carriers and non-carriers of the K allele in subjects who suffered their first coronary event before 40 years old (first quartile) (PCHD<40 group, n=53), in subjects who suffered their first coronary event after 40 years old (PCHD>40 group, n=163), and in the control group. Login to comment
238 A different distribution was observed, with fewer carriers of the K allele of the R219K polymorphism in the PCHD<40 group than in the PCHD>40 and fewer than in the control group. Login to comment
244 The effect of the K allele of the R219K polymorphism on a premature event of CHD (before 40 years) was analysed in smokers and non-smokers separately. Login to comment
247 In subjects with premature CHD before 40 years old, the odds ratio of carrying the K allele in smokers v non-smokers was 0.35 (95% Figure 1 Determination of the R219K genotype by PCR amplification and restriction analysis. Login to comment
252 Table 2 Genotype and allele frequencies distribution for the R219K polymorphism in the control and premature coronary heart disease groups of FH subjects studied Genotype frequencies Allele frequencies RR RK KK p RR RK+KK p R K p Control 45.6% 44.9% 9.5% 0.037 45.6% 54.4% 0.029 0.68 0.32 0.036 PCHD 56.9% 36.1% 6.9% 56.9% 43.1% 0.75 0.25 PCHD, premature coronary heart disease. Login to comment
254 These results would suggest that the protective effect of the K allele of the R219K variant on premature CHD risk is more pronounced in smokers. Login to comment
257 Specifically, the R219K polymorphism has been shown to be associated with decreased TG levels and a decreased severity of CHD, these effects being compatible with a net increase in ABCA1 function and accelerated reverse cholesterol transport.21 This polymorphism could influence the phenotype of FH in such a way that subjects carrying the protective allele have a slower progression of atherosclerosis and a delayed onset of CHD. Login to comment
258 Previous studies have reported a carrier frequency of the R219K polymorphism of 46% in the European population,21 which is similar (47.8%) to that found in our FH patients. Login to comment
260 In the present work, we have found that the frequency of the K allele of the R219K variant is significantly higher in the group of FH subjects without premature CHD than in the group of FH subjects with premature CHD. Login to comment
261 The presence of the K allele of the R219K polymorphism seems to be protective against onset of premature CHD in FH subjects. Login to comment
262 One result of our study is that the K allele of the R219K variant seems to modify CHD risk without important modification of plasma HDL-C concentration. Login to comment
266 It is possible that the R219K variant increases the activity of ABCA1 in a similar way, although the precise mechanism underlying the functional effect of this variant will require further analyses. Login to comment
267 In this series of FH patients studied, we have observed a correlation between the presence of the K allele of the R219K variant and the age of onset of the first coronary event. Login to comment
269 Comparison of the odds ratio of the control v the PCHD<40 group (OR=0.51) with the odds ratio of the control v the premature CHD total group (OR=0.63) suggests that younger subjects lacking the K allele of the R219K variant have a higher coronary risk. Login to comment
270 This observation confirms the protective effect of the K allele, as subjects lacking the K allele of the R219K variant develop CHD at an earlier age than subjects carrying this allele. Login to comment
271 Another observation of our study is that the R219K variant appears to be more protective for smokers and ex-smokers than non-smokers in the PCHD<40 group. Login to comment
274 Similarly, in our series of FH patients, smoking increases the risk of CHD in all subjects, but particularly in those subjects lacking the K allele of the R219K polymorphism in ABCA1. Login to comment
275 Smoking increases the rate of oxidation of lipoprotein particles, and it might be possible that this oxidative stress would be alleviated in part through the ABCA1 pathway, since ABCA1 has been reported to mediate the cellular secretion of α tocopherol, the active form of vitamin E with antioxidant properties.37 Thus, it might be possible that Table 3 Clinical and biochemical characteristics of non-carriers and carriers of the K allele of the R219K polymorphism in FH subjects studied Male Female All RR RK+KK p RR RK+KK p RR RK+KK p No 120 90 75 89 195 179 Age (years) 55.4 (10.8) 55.1 (11.7) NS 63.6 (10.3) 66.1 (10.2) NS 58.5 (11.3) 60.6 (12.3) NS BMI (kg/m2 ) 27.2 (3.4) 26.9 (3.2) NS 27.1 (4.4) 27.9 (4.6) NS 27.2 (3.8) 27.4 (3.9) NS TC (mmol/l) 10.9 (2.0) 10.5 (1.7) NS 11.2 (2.3) 11.1 (1.9) NS 11.1 (2.1) 10.8 (1.8) NS LDL-C (mmol/l) 9.1 (2.0) 8.6 (1.8) 0.04 9.1 (2.4) 9.1 (1.9) NS 9.1 (2.1) 8.8 (1.9) NS TG (mmol/l) 1.53 (0.65) 1.60 (0.81) NS 1.46 (0.64) 1.38 (0.63) NS 1.49 (0.64) 1.49 (0.73) NS HDL-C (mmol/l) 1.17 (0.32) 1.19 (0.33) NS 1.42 (0.38) 1.45 (0.41) NS 1.27 (0.36) 1.32 (0.40) NS Lp(a) (µmol/l) 1.93 (1.70) 1.96 (2.12) NS 2.00 (2.17) 2.07 (2.05) NS 1.96 (1.90) 2.00 (2.08) NS Xanthomas 47.4% 36.4% NS 34.2% 28.4% NS 42.3% 32.4% 0.04 Arcus cornealis 57.9% 68.2% NS 52.8% 53.4% NS 55.9% 60.8% NS Values are mean (SD) for quantitative variables, and percentages for qualitative variables. Login to comment
277 Figure 2 Percentage of non-carriers and carriers of the K allele of the R219K polymorphism in each of the three groups of FH subjects analysed: free of premature coronary heart disease (controls), premature coronary heart disease with first coronary event after 40 years old (PCHD>40), and premature coronary heart disease with first coronary event before 40 years old (PCHD<40); p indicates the difference between the control and PCHD<40 groups. Login to comment
278 subjects carrying the K allele of the R219K variant would be more protected against lipoprotein oxidation and subsequent risk of atherosclerosis. Login to comment
280 In this work we show that the R219K variant of ABCA1 influences premature CHD frequency in subjects with heterozygous familial hypercholesterolaemia. Login to comment
281 FH subjects are a very high cardiovascular risk owing to their high LDL-C levels as a consequence of a mutation in the LDLR gene, but other genetic and/or environmental factors modify the disease expression18 and it is possible that one of them could be the variant R219K in ABCA1. Login to comment
283 Although the ABCA1 locus, and specifically the polymorphism R219K, influences the early onset of CHD in FH, other different loci are also implicated with small and/or large contributions, the disease expression being the result of the interaction of these loci.16 Further studies to that effect will help to identify FH subjects at high risk of premature CHD, which will be helpful for better prevention and management of cardiovascular disease in familial hypercholesterolaemia. Login to comment

[hide] ATP-binding cassette A1 protein and HDL homeostasi... Atheroscler Suppl. 2002 Dec;3(4):13-22. Owen JS, Mulcahy JV
ATP-binding cassette A1 protein and HDL homeostasis.
Atheroscler Suppl. 2002 Dec;3(4):13-22., [PMID:12573359]

Abstract [show]
For three decades, low-density lipoprotein (LDL) dominated research into cholesterol metabolism and atherosclerosis, whereas scant attention was paid to high-density lipoprotein (HDL), an equally important risk factor for cardiovascular disease. This low interest reflected the lack of knowledge about physiological HDL receptors. As a result, our understanding of HDL-cell interactions failed to develop alongside that of LDL, and mechanisms through which atheroprotective HDL promoted clearance of cholesterol from peripheral cells remained poorly-defined. Interest was kindled with the recognition that scavenger receptor class B, type I is the cell-surface protein in hepatocytes and steroidogenic tissues which selectively extracts cholesteryl esters from HDL. Greater impetus still was given by the discovery that mutations in the gene encoding the ATP-binding cassette transporter, class A1 (ABCA1) are the cause of Tangier disease, a rare recessive disorder with near-absent plasma HDL. The ABCA1 transmembrane protein is crucial for efficient efflux of cellular cholesterol and HDL maturation and has emerged as a promising therapeutic target for cardiovascular disease. The hope is that new drugs, regulating ABCA1 activity and HDL homeostasis, will accelerate cholesterol efflux from lipid-laden foam cells and thus promote regression of atherosclerotic lesions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
180 A single nucleotide polymorphism (SNP) in ABCA1, the Arg219Lys variant, which has a carrier frequency of over 40%, slows atherogenesis [85]. Login to comment

[hide] ABCA1 regulatory variants influence coronary arter... Clin Genet. 2002 Feb;61(2):115-25. Zwarts KY, Clee SM, Zwinderman AH, Engert JC, Singaraja R, Loubser O, James E, Roomp K, Hudson TJ, Jukema JW, Kastelein JJ, Hayden MR
ABCA1 regulatory variants influence coronary artery disease independent of effects on plasma lipid levels.
Clin Genet. 2002 Feb;61(2):115-25., [PMID:11940086]

Abstract [show]
The authors have previously shown that individuals heterozygous for ABCA1 mutations have decreased high density lipoprotein cholesterol, increased triglycerides and an increased frequency of coronary artery disease (CAD), and that single nucleotide polymorphisms (SNPs) in the coding region of the ABCA1 gene significantly impact plasma lipid levels and the severity of CAD in the general population. They have now identified several SNPs in non-coding regions of ABCA1 which may be important for the appropriate regulation of ABCA1 expression (i.e. in the promoter, intron 1 and the 5' untranslated region), and have examined the phenotypic effects of these SNPs in the REGRESS population. Out of 12 SNPs, four were associated with a clinical outcome. A threefold increase in coronary events with an increased family history of CAD was evident for the G-191C variant. Similarly, the C69T SNP was associated with a twofold increase in events. In contrast, the C-17G was associated with a decrease in coronary events and the InsG319 was associated with less atherosclerosis. For all these SNPs, the changes in atherosclerosis and CAD occurred without detectable changes in plasma lipid levels. These data suggest that common variation in non-coding regions of ABCA1 may significantly alter the severity of atherosclerosis, without necessarily influencing plasma lipid levels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 Interestingly, the R219K cSNP is associated with decreased TG, increased HDL-C and a decreased severity of CAD, which is compatible with a net increase in transporter function (16). Login to comment

[hide] Human and mouse ABCA1 comparative sequencing and t... Genomics. 2001 Apr 1;73(1):66-76. Qiu Y, Cavelier L, Chiu S, Yang X, Rubin E, Cheng JF
Human and mouse ABCA1 comparative sequencing and transgenesis studies revealing novel regulatory sequences.
Genomics. 2001 Apr 1;73(1):66-76., [PMID:11352567]

Abstract [show]
The expression of ABCA1, a major participant in apolipoprotein-mediated cholesterol efflux, is regulated by a variety of factors, including intracellular cholesterol concentration. To identify sequences involved in its regulation, we sequenced and compared approximately 200 kb of mouse and human DNA containing the ABCA1 gene. Furthermore, expression of the human gene containing different 5' ends was examined in transgenic mice. Sequence comparison revealed multiple conserved noncoding sequences. The two most highly conserved noncoding elements (CNS1, 88% identity over 498 bp; CNS2, 81% identity over 214 bp) were also highly conserved in other organisms. Mice containing the human ABCA1 gene, 70 kb of upstream DNA, and 35 kb of downstream DNA expressed the transgene similarly to endogenous Abca1. A second transgene beginning 3' to exon 1 was expressed only in liver, providing strong evidence of an unsuspected liver-specific promoter. The identified conserved noncoding sequences invite further investigation to elucidate ABCA1 regulation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
119 These included Arg219Lys, Tyr793Cys, Asp831Asn, Asp1005Lys, Thr1555Ile, Arg1974Lys, and Pro2168Leu. Login to comment

[hide] Common genetic variation in ABCA1 is associated wi... Circulation. 2001 Mar 6;103(9):1198-205. Clee SM, Zwinderman AH, Engert JC, Zwarts KY, Molhuizen HO, Roomp K, Jukema JW, van Wijland M, van Dam M, Hudson TJ, Brooks-Wilson A, Genest J Jr, Kastelein JJ, Hayden MR
Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease.
Circulation. 2001 Mar 6;103(9):1198-205., [PMID:11238261]

Abstract [show]
BACKGROUND: Low plasma HDL cholesterol (HDL-C) is associated with an increased risk of coronary artery disease (CAD). We recently identified the ATP-binding cassette transporter 1 (ABCA1) as the major gene underlying the HDL deficiency associated with reduced cholesterol efflux. Mutations within the ABCA1 gene are associated with decreased HDL-C, increased triglycerides, and an increased risk of CAD. However, the extent to which common variation within this gene influences plasma lipid levels and CAD in the general population is unknown. METHODS AND RESULTS: We examined the phenotypic effects of single nucleotide polymorphisms in the coding region of ABCA1. The R219K variant has a carrier frequency of 46% in Europeans. Carriers have a reduced severity of CAD, decreased focal (minimum obstruction diameter 1.81+/-0.35 versus 1.73+/-0.35 mm in noncarriers, P:=0.001) and diffuse atherosclerosis (mean segment diameter 2.77+/-0.37 versus 2.70+/-0.37 mm, P:=0.005), and fewer coronary events (50% versus 59%, P:=0.02). Atherosclerosis progresses more slowly in carriers of R219K than in noncarriers. Carriers have decreased triglyceride levels (1.42+/-0.49 versus 1.84+/-0.77 mmol/L, P:=0.001) and a trend toward increased HDL-C (0.91+/-0.22 versus 0.88+/-0.20 mmol/L, P:=0.12). Other single nucleotide polymorphisms in the coding region had milder effects on plasma lipids and atherosclerosis. CONCLUSIONS: These data suggest that common variation in ABCA1 significantly influences plasma lipid levels and the severity of CAD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 The R219K variant has a carrier frequency of 46% in Europeans. Login to comment
13 Atherosclerosis progresses more slowly in carriers of R219K than in noncarriers. Login to comment
29 We report here that a common ABCA1 cSNP, R219K, is associated with decreased TG, increased HDL-C and, importantly, a decreased progression of atherosclerosis and a reduced risk of coronary events, suggesting that common genetic variants in ABCA1 may influence these clinical outcomes in the general population. Login to comment
32 We studied the effects of these cSNPs on the baseline lipid parameters of the cohort of 804 Dutch men with proven CAD who participated in the Regression Growth Evaluation Statin Study (REGRESS); these subjects were described previously.11 For replication studies with the R219K variant, we genotyped 3 smaller cohorts. Login to comment
48 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5Ј33Ј)* Reverse Oligo (5Ј33Ј)* Annealing Temperature, °C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
61 The population-attributable risk for R219K is calculated from the sum of each genotype frequency multiplied by its risk (relative to KK). Login to comment
68 The R219K Polymorphism Is Associated With a Decreased Severity of CAD The G1051A polymorphism results in the substitution of a lysine for arginine at amino acid 219 of the ABCA1 protein (R219K; Table 2). Login to comment
71 The K allele of the R219K polymorphism was associated with a decreased severity of CAD (Table 3), as indicated by an increased MSD and MOD. Login to comment
78 For the R219K variant, the population-attributable risk is 5.3%, suggesting that the frequency of CAD events would be 5.3% lower if all individuals carried the KK genotype. Login to comment
79 If the K allele of the R219K variant is protective against CAD, we might expect its frequency to be reduced in this cohort, which was selected for CAD. Login to comment
81 Association of the R219K Polymorphism With Plasma Lipid Levels TG were significantly lower in the carriers of the K allele (Table 4). Login to comment
85 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587G† S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
92 In younger individuals, cholesterol efflux and HDL-C were increased in KK compared with RR individuals, which suggests that the R219K variant may be especially protective against premature CAD. Login to comment
93 Age Subgroup Analysis Indicates CAD Progresses More Slowly in R219K Carriers In the noncarriers, MOD and MSD decreased significantly with age, reflecting increased atherosclerosis in the older individuals (1.77Ϯ0.34 versus 1.69Ϯ0.35 mm, PϽ0.0001, and 2.75Ϯ0.36 versus 2.65Ϯ0.38 mm, Pϭ0.006 for MOD and MSD, respectively, in younger versus older noncarriers). Login to comment
94 In contrast, in carriers of the R219K variant, these measurements do not significantly change with age (1.83Ϯ0.36 versus 1.78Ϯ0.34 mm, Pϭ0.30, and 2.79Ϯ0.37 versus 2.75Ϯ0.37 mm, Pϭ0.18, for MOD and MSD, respectively, in younger versus older carriers). Login to comment
95 Thus, vascular disease progresses more slowly with age in carriers of R219K compared with noncarriers (Figure I; can be found Online at www.circulationaha.org). Login to comment
96 Replication Cohorts Show the R219K Variant Is Associated With Decreased TG and Increased HDL-C To confirm and replicate the relationship observed between the R219K variant and plasma lipid levels, we genotyped this variant in 3 small cohorts of European subjects. Login to comment
103 CAD in R219K Carriers Compared With Controls RR RK KK Carriers (RKϩKK) P RK vs RR KK vs RR RKϩKK vs RR n 424 330 36 366 MSD, mm 2.70Ϯ0.37 2.77Ϯ0.37 2.78Ϯ0.40 2.77Ϯ0.37 0.01 0.22 0.005 MOD, mm 1.73Ϯ0.35 1.81Ϯ0.35 1.85Ϯ0.35 1.81Ϯ0.35 0.002 0.05 0.001 MI before trial, % (n) 48.3 (205) 47.1 (155) 33.3 (12) 45.8 (167) 0.71 0.12 0.48 Events during trial, % (n) 17 (71) 13 (41) 11 (4) 12 (45) 0.10 0.49 0.09 Total events, % (n) 59 (248) 52 (170) 39 (14) 50 (184) 0.06* 0.03† 0.02‡ Values are meanϮSD or % (n). Login to comment
120 Event-free survival curves for R219K carriers (RKϩKK; thin line) and noncarriers (RR; thick line). Login to comment
122 Carriers of R219K had a 29% increased event-free survival compared with noncarriers. Login to comment
124 Baseline Demographics and Lipid Levels in the REGRESS Cohort by R219K Genotype RR RK KK RKϩKK P RK vs RR KK vs RR RKϩKK vs RR n 424 330 36 366 Age, y 57Ϯ8 55Ϯ8 57Ϯ7 55Ϯ8 0.0007 1 0.03 BMI, kg/m2 25.8Ϯ2.6 26.3Ϯ2.7 25.5Ϯ2.3 26.2Ϯ2.7 0.01 0.50 0.09 Total cholesterol, mmol/L 6.02Ϯ0.86 6.07Ϯ0.89 5.89Ϯ0.85 6.06Ϯ0.89 0.44 0.38 0.60 HDL-C, mmol/L 0.92Ϯ0.22 0.93Ϯ0.23 0.92Ϯ0.20 0.93Ϯ0.23 0.54 1 0.81 LDL-C, mmol/L 4.27Ϯ0.75 4.35Ϯ0.83 4.33Ϯ0.82 4.35Ϯ0.83 0.17 0.65 0.19 TG, mmol/L 1.84Ϯ0.77 1.78Ϯ0.78 1.42Ϯ0.49 1.74Ϯ0.76 0.29 0.001 0.08 Values are meanϮSD. Login to comment
126 Changes in HDL-C and efflux with age by R219K genotype. Login to comment
127 A depicts the relationship between HDL-C and age in R219K carriers (RKϩKK; dashed line) compared with noncarriers (RR; solid line). Login to comment
136 However, all but 2 carriers of V771M were also carriers of R219K. Login to comment
138 No carriers of S1731C were detected in the REGRESS population. Login to comment
140 The presence of this variant in individuals heterozygous for the R2144X ABCA1 mutation was associated with further significantly decreased HDL-C compared with R2144X carriers without this polymorphism (0.16Ϯ0.04 mmol/L, nϭ2, versus 0.64Ϯ0.14 mmol/L, nϭ10; Pϭ0.0009). Login to comment
141 In unaffected family members, although carriers of S1731C (nϭ6) had slightly lower HDL-C compared with noncarriers (nϭ14, 1.03Ϯ0.22 versus 1.09Ϯ0.23 mmol/L), the difference was not statistically significant. Login to comment
143 The Phenotypic Effects of R219K Are Independent of Other cSNPs There is linkage disequilibrium between cSNPs in the ABCA1 gene. Login to comment
144 Two rare cSNPs (V771M and K776N) are most commonly found in individuals carrying the R219K K allele. Login to comment
145 If all V771M and K776N carriers are excluded, the results are unaltered, with increased MOD (1.80Ϯ0.35 versus 1.73Ϯ0.35 mm, Pϭ0.006) and MSD (2.76Ϯ0.36 versus 2.70Ϯ0.37 mm, Pϭ0.02) and lower mean TG levels (1.71Ϯ0.75 versus 1.84Ϯ0.77 mmol/L, Pϭ0.02) in carriers of R219K (nϭ329) compared with noncarriers (nϭ422). Login to comment
146 The I883M and R1587K cSNPs are also often seen in carriers of R219K. Login to comment
147 We identified R219K carriers who do not also carry either the I883M or R1587K genotype (nϭ62) and compared them with the group of individuals who do not carry any of the 3 variants (nϭ116). Login to comment
148 MSD was still significantly increased in R219K carriers compared with noncarriers (2.81Ϯ0.37 versus 2.69Ϯ0.36 mm, Pϭ0.04); MOD was increased in carriers (1.78Ϯ0.39 versus 1.73Ϯ0.38 mm); and TG remained significantly decreased in carriers (1.67Ϯ0.76 versus 1.97Ϯ0.74 mmol/L, Pϭ0.02). Login to comment
149 Thus, the effects of the R219K variant described herein are not due to other cSNPs that are found in linkage disequilibrium with it. Login to comment
161 ABCA cSNPs in REGRESS MOD, mm MSD, mm HDL-C, mmol/L TG, mmol/L Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P V825I 1.74Ϯ0.37 (107) 1.77Ϯ0.35 (575) 0.39 2.70Ϯ0.38 2.75Ϯ0.38 0.21 0.91Ϯ0.23 0.93Ϯ0.22 0.42 1.86Ϯ0.84 1.80Ϯ0.76 0.49 I883M 1.74Ϯ0.38 (100) 1.75Ϯ0.36 (320) 0.71 2.69Ϯ0.38 2.73Ϯ0.36 0.41 0.91Ϯ0.22 0.91Ϯ0.21 0.97 1.75Ϯ0.77 1.82Ϯ0.75 0.42 R1587K 1.77Ϯ0.34 (346) 1.76Ϯ0.37 (433) 0.75 2.73Ϯ0.39 2.74Ϯ0.36 0.64 0.90Ϯ0.22 0.94Ϯ0.23 0.03 1.79Ϯ0.76 1.81Ϯ0.78 0.77 V399A 1.92Ϯ0.32 (9) 1.73Ϯ0.35 (540) 0.13 2.73Ϯ0.40 2.71Ϯ0.37 0.89 1.03Ϯ0.28 0.92Ϯ0.23 0.15 1.71Ϯ0.63 1.82Ϯ0.78 0.68 V771M 1.89Ϯ0.38 (37) 1.76Ϯ0.35 (598) 0.045 2.83Ϯ0.49 2.73Ϯ0.37 0.13 0.91Ϯ0.20 0.92Ϯ0.22 0.58 1.98Ϯ0.79 1.78Ϯ0.76 0.11 T774P 1.63Ϯ0.31 (4) 1.76Ϯ0.36 (621) 0.47 2.85Ϯ0.34 2.73Ϯ0.37 0.52 0.85Ϯ0.07 0.93Ϯ0.22 0.50 1.90Ϯ1.04 1.82Ϯ0.77 0.84 K776N 1.92Ϯ0.33 (3) 1.78Ϯ0.34 (546) 0.48 2.95Ϯ0.48 2.76Ϯ0.37 0.36 0.94Ϯ0.28 0.93Ϯ0.22 0.93 2.25Ϯ0.94 1.76Ϯ0.76 0.26 E117SD 1.80Ϯ0.39 (34) 1.77Ϯ0.36 (610) 0.67 2.78Ϯ0.35 2.74Ϯ0.37 0.42 0.93Ϯ0.23 0.94Ϯ0.23 0.89 1.80Ϯ0.90 1.77Ϯ0.76 0.80 Values are meanϮSD (n). Login to comment
164 The R219K variant, with a carrier frequency of 46% in European populations, is associated with a decreased severity of CAD, which manifests as decreased focal and diffuse atherosclerosis, with less progression and decreased coronary events. Login to comment
166 The phenotypic effects of the remaining cSNPs are less striking than those of R219K. Login to comment
168 Both the finding of decreased TG and of increased HDL-C in younger carriers of the R219K K allele is consistent with the decreased CAD observed in carriers of the variant.15,16 TG levels showed similar trends in our replication groups, and increased HDL-C levels in R219K carriers were observed in our independent populations. Login to comment
171 The lack of obvious differences in HDL-C in carriers of different cSNPs (R219K, V771M, and I883M), together with clear differences in CAD, suggests that stimulating the RCT pathway can increase the net flux of cholesterol toward the liver without altering steady-state plasma HDL-C levels. Login to comment
173 The mechanism underlying the decreased TG in carriers of the R219K variant is unknown. Login to comment
179 In heterozygotes, the phenotype is more pronounced in older individuals.9 This suggests that ABCA1 activity may normally increase with age but that this is blunted in R219K heterozygotes. Login to comment
180 Age-related increases in the expression and activity of P-glycoprotein, another ATP-binding cassette transporter, have been described.22,23 In the present study, we show that the R219K polymorphism was also associated with an altered relationship between age and HDL-C. Login to comment
192 We showed that common ABCA1 cSNPs are associated with altered plasma lipid levels and severity of atherosclerosis. Specifically, the frequent R219K variant is associated with a decreased severity of atherosclerosis, a decreased risk of coronary events, decreased TG, and increased HDL-C, which is consistent with a gain of function in ABCA1. Login to comment
193 These effects were independent of any other cSNPs found in association with R219K and were seen both in different measures of CAD and in multiple cohorts. Login to comment
5 The R219K variant has a carrier frequency of 46% in Europeans. Login to comment
7 Atherosclerosis progresses more slowly in carriers of R219K than in noncarriers. Login to comment
24 We report here that a common ABCA1 cSNP, R219K, is associated with decreased TG, increased HDL-C and, importantly, a decreased progression of atherosclerosis and a reduced risk of coronary events, suggesting that common genetic variants in ABCA1 may influence these clinical outcomes in the general population. Login to comment
27 We studied the effects of these cSNPs on the baseline lipid parameters of the cohort of 804 Dutch men with proven CAD who participated in the Regression Growth Evaluation Statin Study (REGRESS); these subjects were described previously.11 For replication studies with the R219K variant, we genotyped 3 smaller cohorts. Login to comment
43 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5b18;33b18;)* Reverse Oligo (5b18;33b18;)* Annealing Temperature, &#b0;C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
56 The population-attributable risk for R219K is calculated from the sum of each genotype frequency multiplied by its risk (relative to KK). Login to comment
63 The R219K Polymorphism Is Associated With a Decreased Severity of CAD The G1051A polymorphism results in the substitution of a lysine for arginine at amino acid 219 of the ABCA1 protein (R219K; Table 2). Login to comment
66 The K allele of the R219K polymorphism was associated with a decreased severity of CAD (Table 3), as indicated by an increased MSD and MOD. Login to comment
73 For the R219K variant, the population-attributable risk is 5.3%, suggesting that the frequency of CAD events would be 5.3% lower if all individuals carried the KK genotype. Login to comment
74 If the K allele of the R219K variant is protective against CAD, we might expect its frequency to be reduced in this cohort, which was selected for CAD. Login to comment
76 Association of the R219K Polymorphism With Plasma Lipid Levels TG were significantly lower in the carriers of the K allele (Table 4). Login to comment
80 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587Gߤ S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
87 In younger individuals, cholesterol efflux and HDL-C were increased in KK compared with RR individuals, which suggests that the R219K variant may be especially protective against premature CAD. Login to comment
88 Age Subgroup Analysis Indicates CAD Progresses More Slowly in R219K Carriers In the noncarriers, MOD and MSD decreased significantly with age, reflecting increased atherosclerosis in the older individuals (1.77afe;0.34 versus 1.69afe;0.35 mm, Pb0d;0.0001, and 2.75afe;0.36 versus 2.65afe;0.38 mm, Pafd;0.006 for MOD and MSD, respectively, in younger versus older noncarriers). Login to comment
89 In contrast, in carriers of the R219K variant, these measurements do not significantly change with age (1.83afe;0.36 versus 1.78afe;0.34 mm, Pafd;0.30, and 2.79afe;0.37 versus 2.75afe;0.37 mm, Pafd;0.18, for MOD and MSD, respectively, in younger versus older carriers). Login to comment
90 Thus, vascular disease progresses more slowly with age in carriers of R219K compared with noncarriers (Figure I; can be found Online at www.circulationaha.org). Login to comment
91 Replication Cohorts Show the R219K Variant Is Associated With Decreased TG and Increased HDL-C To confirm and replicate the relationship observed between the R219K variant and plasma lipid levels, we genotyped this variant in 3 small cohorts of European subjects. Login to comment
98 CAD in R219K Carriers Compared With Controls RR RK KK Carriers (RKaf9;KK) P RK vs RR KK vs RR RKaf9;KK vs RR n 424 330 36 366 MSD, mm 2.70afe;0.37 2.77afe;0.37 2.78afe;0.40 2.77afe;0.37 0.01 0.22 0.005 MOD, mm 1.73afe;0.35 1.81afe;0.35 1.85afe;0.35 1.81afe;0.35 0.002 0.05 0.001 MI before trial, % (n) 48.3 (205) 47.1 (155) 33.3 (12) 45.8 (167) 0.71 0.12 0.48 Events during trial, % (n) 17 (71) 13 (41) 11 (4) 12 (45) 0.10 0.49 0.09 Total events, % (n) 59 (248) 52 (170) 39 (14) 50 (184) 0.06* 0.03ߤ 0.02ߥ Values are meanafe;SD or % (n). Login to comment
115 Event-free survival curves for R219K carriers (RKaf9;KK; thin line) and noncarriers (RR; thick line). Login to comment
117 Carriers of R219K had a 29% increased event-free survival compared with noncarriers. Login to comment
119 Baseline Demographics and Lipid Levels in the REGRESS Cohort by R219K Genotype RR RK KK RKaf9;KK P RK vs RR KK vs RR RKaf9;KK vs RR n 424 330 36 366 Age, y 57afe;8 55afe;8 57afe;7 55afe;8 0.0007 1 0.03 BMI, kg/m2 25.8afe;2.6 26.3afe;2.7 25.5afe;2.3 26.2afe;2.7 0.01 0.50 0.09 Total cholesterol, mmol/L 6.02afe;0.86 6.07afe;0.89 5.89afe;0.85 6.06afe;0.89 0.44 0.38 0.60 HDL-C, mmol/L 0.92afe;0.22 0.93afe;0.23 0.92afe;0.20 0.93afe;0.23 0.54 1 0.81 LDL-C, mmol/L 4.27afe;0.75 4.35afe;0.83 4.33afe;0.82 4.35afe;0.83 0.17 0.65 0.19 TG, mmol/L 1.84afe;0.77 1.78afe;0.78 1.42afe;0.49 1.74afe;0.76 0.29 0.001 0.08 Values are meanafe;SD. Login to comment
121 Changes in HDL-C and efflux with age by R219K genotype. Login to comment
131 However, all but 2 carriers of V771M were also carriers of R219K. Login to comment
139 Two rare cSNPs (V771M and K776N) are most commonly found in individuals carrying the R219K K allele. Login to comment
142 We identified R219K carriers who do not also carry either the I883M or R1587K genotype (nafd;62) and compared them with the group of individuals who do not carry any of the 3 variants (nafd;116). Login to comment
159 The R219K variant, with a carrier frequency of 46% in European populations, is associated with a decreased severity of CAD, which manifests as decreased focal and diffuse atherosclerosis, with less progression and decreased coronary events. Login to comment
163 Both the finding of decreased TG and of increased HDL-C in younger carriers of the R219K K allele is consistent with the decreased CAD observed in carriers of the variant.15,16 TG levels showed similar trends in our replication groups, and increased HDL-C levels in R219K carriers were observed in our independent populations. Login to comment
174 In heterozygotes, the phenotype is more pronounced in older individuals.9 This suggests that ABCA1 activity may normally increase with age but that this is blunted in R219K heterozygotes. Login to comment
175 Age-related increases in the expression and activity of P-glycoprotein, another ATP-binding cassette transporter, have been described.22,23 In the present study, we show that the R219K polymorphism was also associated with an altered relationship between age and HDL-C. Login to comment
187 We showed that common ABCA1 cSNPs are associated with altered plasma lipid levels and severity of atherosclerosis. Specifically, the frequent R219K variant is associated with a decreased severity of atherosclerosis, a decreased risk of coronary events, decreased TG, and increased HDL-C, which is consistent with a gain of function in ABCA1. Login to comment
188 These effects were independent of any other cSNPs found in association with R219K and were seen both in different measures of CAD and in multiple cohorts. Login to comment

[hide] High-density single-nucleotide polymorphism (SNP) ... J Hum Genet. 2001;46(9):522-8. Iida A, Saito S, Sekine A, Kitamura Y, Kondo K, Mishima C, Osawa S, Harigae S, Nakamura Y
High-density single-nucleotide polymorphism (SNP) map of the 150-kb region corresponding to the human ATP-binding cassette transporter A1 (ABCA1) gene.
J Hum Genet. 2001;46(9):522-8., [PMID:11558901]

Abstract [show]
Highly dense catalogs of human genetic variations, in combination with high-throughput genotyping technologies, are expected to clarify individual genetic differences in pharmacological responsiveness and predispositions to common diseases. Here we report single-nucleotide polymorphisms (SNPs) present among 48 Japanese individuals at the locus for the human ATP-binding cassette transporter A1 (ABCA1) gene. ABCA1 plays a key role in apolipoprotein-mediated cholesterol transport, and mutations in this gene are responsible for Tangier disease and familial high-density lipoprotein deficiency associated with reduced cholesterol efflux. We identified a total of 162 SNPs, 149 of which were novel, within the 150-kb region encompassing the entire ABCA1 gene. Eight of the SNPs lie within coding elements, two in 5' flanking regions, 147 in introns, and five in 3' untranslated regions, but none were found in 5' untranslated or 3' flanking regions. The ratio of transitions to transversions was approximately 2.37 to 1. Our dense SNP map of this region could serve as a powerful resource for studies of complex genetic diseases that may be associated with ABCA1 and of individual responses to drug therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Therefore, information concerning naturally occurring genetic variants in human transporter genes such as ABCA1 Fig.1.Single-nucleotidepolymorphism(SNP)mapspanningthe150-kbregioncontainingtheABCA1gene.Exonsarerepresentedbyopenrectanglesandintronsbyhorizontallines.SNPs areindicatedabovethelinesaccordingtonumber(correspondingtothenumbersinthefar-leftcolumnofTable1);thepositionsofeightinsertion-deletionpolymorphismsareindicatedbelow thelines(seeTable2).Microsatellitesequencesarealsoshown Table 1. Characterization of 162 single-nucleotide polymorphisms (SNPs) within the ABCA1 locus Repetitive Identity Number Location Exon SNP (5Ј to 3Ј) Substituion sequence to dbSNP Reference 1 -278 G Ͼ C 5Ј flanking region gggcccgggcgggggaaggg G/C acgcagaccgcggaccctaa rs1800976 2 -99 G Ͼ C 5Ј flanking region acataaacagaggccgggaa G/C ggggcggggaggagggagag 3 159 G Ͼ T intron 1 gcggtgttaaatggggagac G/T atgtcctagtacgagctctg 4 506 G Ͼ C intron 1 gaattggctatatgctcccc G/C ggactggagcggcacagtcc 5 5897 T Ͼ G intron 1 gtacaaaaccctttagcttt T/G gcaaacctcctttaagaccc 6 5929 C Ͼ T intron 1 ttaagacccgatttaaatgc C/T tccctcctcatgaagctctt 7 5962 T Ͼ C intron 1 aagctcttctggatccactc T/C ttcccatcactaagttgaaa 8 5985 A Ͼ C intron 1 cccatcactaagttgaaagt A/C agatccccttctctttactt 9 11416 G Ͼ A intron 1 ttacagtgccctttatagga G/A agaaagaagaaattgtgtct 10 11935 G Ͼ A intron 1 tctctgtggagcaaatagag G/A gctgtctgacacttggttcc 11 12281 T Ͼ A intron 1 gaatgtttgatttgtgaaaa T/A cttaataacagtagtttttt 12 12924 T Ͼ C intron 1 gtgctgacaatcttatactc T/C aggttgaacctccggggaag 13 13002 C Ͼ G intron 1 gagcctcaatcacagattct C/G tctagctcacatgaagttaa 14 17715 C Ͼ T intron 1 ggagcatgactttgtggaag C/T ctctcctcttccacccagag 15 17848 T Ͼ C intron 1 gagggctgactgtcaccctt T/C gataggagcccagcactaaa 16 21384 G Ͼ C intron 1 gtgggtgggaggaattggag G/C aggaagcttgcctaagtgtg 17 22145 C Ͼ G intron 1 gtagcttctaaatcaacgaa C/G tgattcctggagagcagctt rs1340361 18 23063 G Ͼ A intron 1 ggaggcacctgtgacaccca G/A cggagtaggggggcggtgtg 19 23131 G Ͼ A intron 1 agtgtgcatatgtgctgacc G/A tgggagcttgtttgtcggtt 20 156 T Ͼ C intron 2 ggacacaggactgtgtggtc T/C ggatatggcatgtggcttat rs1078143 21 384 A Ͼ G intron 2 gctgtgggtgaagtgagtta A/G tggccccactcttagagatc rs1078144 22 1081 G Ͼ A intron 2 agtgcagccaaaattgcaaa G/A tcataccattcaaattaata rs752187 23 2801 A Ͼ G intron 2 aagaaaagtgatttatttca A/G gttgctgatgcttagattgt 24 2830 C Ͼ G intron 2 tgcttagattgttagagttg C/G aaagatctggcttgcatctt 25 2856 A Ͼ G intron 2 tctggcttgcatcttgtaca A/G ctgacagaactggggctcag 26 3187 A Ͼ G intron 2 tgatagctgttgcctgcagc A/G tacggacgttcattgcgcag 27 3190 C Ͼ T intron 2 tagctgttgcctgcagcata C/T ggacgttcattgcgcagttc 28 3194 C Ͼ T intron 2 tgttgcctgcagcatacgga C/T gttcattgcgcagttcctgt 29 3204 G Ͼ A intron 2 agcatacggacgttcattgc G/A cagttcctgtctcctgagat 30 3401 T Ͼ C intron 2 acataaagcctgtgtgctgc T/C gccaggaagactagaaacgc 31 13927 A Ͼ G intron 2 gtcaccacatacctggcact A/G tgctaaggctgggaatgcag L2 32 4163 G Ͼ A intron 3 ccagcccacttcatcttacc G/A tagttacctccttagagtat 33 4262 T Ͼ C intron 3 tgtcaaagaggaactaagga T/C gccagggactttctgcttag 34 4306 C Ͼ T intron 3 ccctctcatcacttctccaa C/T gctggtatcatgaaccccat 35 240 G Ͼ A intron 5 gacagaagaaaagtccccag G/A gaagaatactacagacttgg rs1107281 36 490 G Ͼ A intron 5 gatgggcatttgaacttgtt G/A tctttaaaaagtgaaatctt 37 583 T Ͼ G intron 5 tatctggggagtgggcattt T/G ctgactgaggcattggctgc 38 1051 C Ͼ T inton 5 ggctacaaaactgtgctttc C/T ttgggcagtaaaagaggcaa 39 3051 G Ͼ A intron 5 tagagaacaagtctaattct G/A ttttccttgaaatagtcgaa 40 3127 A Ͼ G intron 5 aagtccatgattttttaggc A/G aaatggcctcctttcctctt 41 5924 C Ͼ T intron 5 ctttctttcacaaaattgcc C/T cccagagctttctggaaggg 42 6831 T Ͼ C intron 5 ccagtccctcagccttgcca T/C tgcttatgctggtctggaaa 43 12678 G Ͼ C intron 5 gctcaccgctctgctcaccc G/C accctctggccatctcctct 44 14214 G Ͼ A intron 5 cagcttggtcccagaggcct G/A gacctgggtcccagaggtcc 45 14257 C Ͼ T intron 5 gctggttccccggcttggtc C/T cagaggcctggatgtgtggc 46 18078 C Ͼ T intron 5 cctaccacaccatgcacgtg C/T acagccaagggttgttgact 47 18795 G Ͼ A intron 5 ctgggctcttcctggacctg G/A ccagctaaaaggaaatctcc 48 18948 G Ͼ A intron 5 gcattggtggtactaagaac G/A catattccctatcctatagg L2 49 19053 T Ͼ C intron 5 ctcccccaacattaaaagtg T/C aagggatgcttattcaaatg MER5A 50 19148 C Ͼ A intron 5 ggcccaagaaactgcatttt C/A gcatgctccctaaatgaagc MER5A 51 19229 C Ͼ T intron 5 atgctaacagtgtagagtca C/T atgtgatgggaagcatcagg 52 19405 T Ͼ C intron 5 cttgctcaatttattctgtc T/C atataactcaatattactga 53 19534 G Ͼ A intron 5 catgtgaccctcttagctcc G/A cggattaactcctgtcctca 54 474 G Ͼ A coding region 6 gaaaccttctctgggttcct G/A tatcacaacctctctctccc Leu 158 Leu 55 210 A Ͼ C intron 6 gcaacctggcgtcatgggcc A/C gctggttaaaataaaattga 56 334 G Ͼ A intron 6 acagttctgaggcaataacc G/A tggttaagggttattgatct 57 2288 C Ͼ T intron 6 cttctttcaaagcttgtggt C/T cactggaccacgtatgaagt 58 2322 T Ͼ C intron 6 atgaagtagaatagtttagg T/C ccagaaaggcaattaagtaa 59 2820 T Ͼ G intron 6 gtgctttgatacattctgag T/G ttcagtaaagagacctgatg 60 656 G Ͼ A coding region 7 tgagctttgtggcctaccaa G/A ggagaaactggctgcagcag Arg 219 Lys Clee et al. 2001 61 416 G Ͼ A intron 7 catcataaagatgacattgt G/A ggctgtcacagttggaaggc 62 471 C Ͼ T intron 7 agaccacactatttagctta C/T ttagtaataacattgcaaag 63 504 G Ͼ A intron 7 ttgcaaagaaaaattccgac G/A aagttttttcagcctaggaa 64 679 G Ͼ C intron 7 gctctggtgaaattcctctc G/C ctaccccaaacatcatcatt 65 1740 C Ͼ T intron 7 acaaatgctcaccctttcag C/T tggaatgattgaaattttgg 66 2122 A Ͼ G intron 7 tgattaaggtggctactacc A/G ggtgctttctgcatatctcg 67 7753 T Ͼ C intrion 7 taggaattccaagctgtgaa T/C tttttactgaagctctttgg 68 8973 A Ͼ T intron 7 atggaaatttgtttatattg A/T ctacagattgccaatattat 69 8976 A Ͼ G intron 7 gaaatttgtttatattgact A/G cagattgccaatattattag Table 1. Continued Repetitive Identity Number Location Exon SNP (5Ј to 3Ј) Substituion sequence to dbSNP Reference 70 11327 G Ͼ C intron 7 ctaacaatcttatttccatt G/C agtccttataaaagaagtgg 71 11738 C Ͼ T intron 7 ctgacgtttaagggagaccg C/T gtaggtccctttgaggactg 72 12295 T Ͼ A intron 7 agtctgtaaattattgttct T/A ttttttctttagcttatgct 73 387 C Ͼ G intron 8 tagcaaggccaatcatttta C/G caacacacatgcttgctaac 74 697 A Ͼ T intron 8 ggaactgtctggtgtccccc A/T gcataggaagctgagccagg 75 1312 G Ͼ A intron 8 attgctctgcagatcccctc G/A cagccctctgtcccttgttc rs1175929 76 3036 T Ͼ G intron 8 ctttatgtgggaagaaattt T/G tttttttgattggggagtgg 77 3176 C Ͼ A intron 8 aaatggcctggttctctgtc C/A cctttctgtctgtatgcctc 78 3364 A Ͼ T intron 8 ggcagaaggcaaagcttagg A/T cctagagagtgctggaccac 79 3373 G Ͼ A intron 8 caaagcttaggacctagaga G/A tgctggaccacgccactcac 80 3561 C Ͼ A intron 8 cagggatttattaatgattt C/A ttgtgaaatgtttggaaata 81 3654 T Ͼ C intron 8 agtgccggaatacatttgca T/C gtaagacagaacgctgcctg 82 4715 C Ͼ T intron 8 ggcagaggggtctcagaatc C/T gcatttccaacaatgtctcc 83 936 C Ͼ T coding region 9 cgtattgtctgcgggcatcc C/T gagggaggggggctgaagat Pro 312 Pro 84 2309 A Ͼ G intron 9 cccctcaagagtcagtttaa A/G tgttggtcatgttagttgtc 85 2392 T Ͼ C intron 9 atgggagggcttgtgcttca T/C gaaaacatttttccagatca 86 228 A Ͼ G intron 10 tggggatggggaggactggc A/G cagggctgctgtgatggggt 87 319 C Ͼ T intron 10 ttctgcggtccctggctccc C/T acctgactccaggtgaacaa 88 377 A Ͼ C intron 11 gaaagaagtgtgggagcaaa A/C gcatgatgttacatgtagac 89 521 G Ͼ A intron 11 agtgctctagagacaattgg G/A ttcaaatgtggagcaggctg 90 2850 G Ͼ C intron 11 ctctatacaatcattatgct G/C ccattgaaataataaataca 91 2976 A Ͼ G intron 11 ctccaattcggtagaaccag A/G gcttcatcttctctgtcgaa 92 3056 C Ͼ T intron 11 gtttgcagctgctgtttttc C/T ggcagcacatctgtgcaggc 93 340 T Ͼ C intron 12 ggcattatttgtgaaactta T/C ctaaaatcgaattcgggtcc 94 381 A Ͼ G intron 12 aattaaatttttgaaatttt A/G tattaaaaattatattagta 95 1728 C Ͼ T intron 14 caggctcagaggccttggcc C/T atcaccctggctcacgtgtg 96 2040 C Ͼ A coding region 15 atgggcctggacaacagcat C/A ctctggtttagctggttcat Ile 680 Ile 97 1382 G Ͼ A intron 15 cttttagacagaaaagttac G/A tgggatattatctcccacag 98 1453 G Ͼ A intron 15 tatataaggagaaaccagtt G/A aaattacctattgaagaaac 99 1567 G Ͼ A intron 15 ttctgcgtagttttgggtaa G/A tcacttatcttctttaggat MIR 100 1617 T Ͼ A intron 15 cagttgcctcatcagaaaga T/A gaacagcattacgcctctgc MIR 101 95 T Ͼ A intron 16 agttgagaacagaagatgat T/A gtcttttccaatgggacatg 102 452 G Ͼ A intron 16 tggtgttttgcttgagtaat G/A ttttctgaactaagcacaac 103 657 T Ͼ C intron 16 ctgttgcctcagtctgggct T/C cataggcatcagcagcccca 104 2473 G Ͼ A coding region 17 gcttcaatctcaccacttcg G/A tctccatgatgctgtttgac Val 825 Ile Clee et al. 2001 105 2649 A Ͼ G coding region 18 ggttccaaccagaagagaat A/G tcagaaagtaagtgctgttg Ile 883 Met Clee et al. 2001 106 1730 C Ͼ G intron 18 tgaaagttcaagcgcagtgc C/G ctgtgtccttacactccact 107 426 A Ͼ G intron 19 aggaccttacagtgggtagt A/G tcaggaggggtcaggggctg 108 468 A Ͼ G intron 19 aaagcaccagcgttagcctc A/G gtggcttccagcacgattcc 109 876 C Ͼ T intron 20 ccctcctcatctaaagtgaa C/T acatggggctcatgtgcagg 110 118 T Ͼ G intron 22 catgggatactcttctgtta T/G cacagaagagataaagggca 111 560 G Ͼ A intron 22 aaagctttgccattctaggg G/A tcatagccatacagggtgaa 112 102 A Ͼ G intron 23 accccttttgccatgttgaa A/G ccaccatctccctgctctgt 113 287 C Ͼ T intron 23 gtcaaagaaaagagacttgt C/T aagaggtaagagccttggct 114 1063 G Ͼ A intron 23 acctttcaccctcaggaagc G/A aggctgttcacacggcacac 115 321 T Ͼ G intron 25 ctctttacttaagtacagtg T/G gaggaacagcggcatcagga MER5A 116 376 G Ͼ C intron 25 gttagaaattcagcaacttg G/C gcccagctcagacctactga MER5A 117 478 C Ͼ T intron 25 catacataggaaatgacaaa C/T gtttatggatggatagtcta 118 579 G Ͼ T intron 25 tcatttaattctcaaaaaaa G/T atgaaaaaatgaacactcag 119 153 C Ͼ T intron 27 aatggtaaaagccacttgtt C/T tttgcagcatcgtgcatgtg 120 1058 C Ͼ T intron 28 actatcatgggagataatga C/T tatggttgtccatgattgga 121 1317 C Ͼ T intron 28 caggacccagtgttctgagt C/T accctgaatgtgagcactat 122 372 T Ͼ C intron 30 tatatgatttttaggttttg T/C ttatcagcttcttcgctttt 123 506 A Ͼ G intron 30 ccttttaaaaagtaagcagt A/G gataaataaattcagtgaag 124 1033 G Ͼ C intron 30 ctggatttcatggtgccttt G/C attttccacatgaaggttgt 125 4281 G Ͼ A coding region 31 tcttccctttgcagagacac G/A ccctgccaggcaggggagga Thr 1427 Thr 126 626 C Ͼ T intron 33 ggctccttgttactgatttc C/T gtcttttctctctgcctttt 127 719 G Ͼ A intron 33 taatagccctcatgctagaa G/A ggagccggagcctgtgtata 128 726 G Ͼ A intron 33 cctcatgctagaagggagcc G/A gagcctgtgtataaggccag 129 889 A Ͼ G intron 33 ctttcctcaatgtctcagct A/G tctaactgtgtgtgtaatca 130 1097 G Ͼ C intron 33 ctgtgcaccccactgtctgg G/C ttttaatgtcaggctgttct 131 4760 G Ͼ A coding region 35 tatgacaggactggacacca G/A aaataatgtcaaggtaaacc Arg 1587 Lys Clee et al. 2001 132 234 T Ͼ C intron 35 aacctatctaaacctcagtt T/C cctcatctgtgaaatggaga MIR 133 411 C Ͼ T intron 37 aactctgtacattttatcag C/T agcttatccatccattgcaa 134 1224 A Ͼ G intron 37 caggcataggtgattcagag A/G tgaaaggtcaagtccctgaa L2 135 1720 G Ͼ T intron 37 aaattaaaattactctgact G/T ggaatccatcgttcagtaag 136 251 T Ͼ G intron 40 tgaaggtaaggaaaatagtg T/G tatttgcttggatccactgg 137 252 T Ͼ C intron 40 gaaggtaaggaaaatagtgt T/C atttgcttggatccactggc 138 319 A Ͼ G intron 40 agcactggaaaagtcaaacc A/G taactttgagaattaggtga Table 2. Characterization of insertion/deletion polymorphisms at the ABCA1 locus Number Location Variations (5Ј to 3Ј) 1 (-1033)-(-1032) ins AT 5Ј flanking region tgacttaaatatttagacat (AT/ϩ) ggtgtgtaggcctgcattcc 2 6368 del C intron 5 ttctgatggggttgttgctg (C/-) tgagaatcatgactgggtgg 3 9709 del T intron 5 cattttctgtctgaaccccc (T/-) cacccattcaggcagctgct 4 13816 del T intron 5 tccctacttctccttttttt (T/-) catttgcctcctccacccac 5 270-271 ins G intron 10 cttttcagggaggagccaaa (G/ϩ) cgctcattgtctgtgcttct 6 611-612 ins C intron 20 tttagcccatcctctccccc (C/ϩ) gccaccctccttattgaggc 7 391-392 ins T intron 32 gagtgccttgggtactctct (T/ϩ) gatgggggactccatgataa 8 847 del C intron 37 gctgtatattgtgaatgtcc (C/-) gttttcaaaagcaaagccaa Nucleotide numbering is according to the mutation nomenclature (den Dunnen and Antonarakis, 2000) (ϩ), insertion polymorphism; (-), deletion polymorphism Table 1. Continued Repetitive Identity Number Location Exon SNP (5Ј to 3Ј) Substituion sequence to dbSNP Reference 139 957 G Ͼ C intron 40 cttgttactcttttttcctt G/C tcatgggtgatagccatttg 140 146 C Ͼ T intron 41 tgatgtgggcatcccgcagc C/T ccctccctgcccatcctgga 141 239 A Ͼ C intron 42 cattggttttatatgcttac A/C tttatgtgttagttattaaa 142 321 T Ͼ A intron 42 aataaatggttgattttgag T/A ttgagtttcatagtccaaaa 143 322 T Ͼ C intron 42 ataaatggttgattttgagt T/C tgagtttcatagtccaaaaa 144 533 G Ͼ A intron 42 agatgaaaaattatgtagat G/A ataatgaatgatacggttct 145 546 A Ͼ G intron 42 tgtagatgataatgaatgat A/G cggttctaaaaagacaggtt 146 739 T Ͼ A intron 43 tacagccacacttaaaatgg T/A cccattatgaaatacatatt 147 18 T Ͼ C intron 44 taggtgagaaaagaagtggc T/C tgtattttgctgcaaagact 148 264 T Ͼ C intron 44 acaatataatttgcttgttt T/C ttaagagtataatttagtga L1MB8 149 279 T Ͼ C intron 44 tgttttttaagagtataatt T/C agtgatttttggtaaattga L1MB8 150 508 C Ͼ T intron 44 tttacattgctacataaaat C/T cccctatgtacatgtaccta 151 1477 A Ͼ T intron 44 gatctcctctcctgtctctt A/T catttttgcagtagcaatgt 152 1665 G Ͼ A intron 44 tggttgtaagaactgatttg G/A ttggtatagctgtgagggcc 153 1956 T Ͼ G intron 44 gtgttgctcacactcaaaat T/G tctgggccttctcatttggt 154 68 T Ͼ C intron 45 aatatataccttatggcttt T/C ccacacgcattgacttcagg 155 608 G Ͼ C intron 46 ttatactgacttcaatagag G/C tttcagacaaaaagttgttt 156 336 T Ͼ C intron 47 ttcacaattgtaaacaccac T/C acactgaacagcatcatccc L1MD2 157 55 G Ͼ C intron 49 agggtgtggattcctgcccc G/C acactcccgcccataggtcc rs1331924 158 7479 C Ͼ T 3Ј untranslated region 50 aacaaaaatgtgggtgtctc C/T aggcacgggaaacttggttc 159 8226 C Ͼ T 3Ј untranslated region 50 aggagcccactgtaacaata C/T tgggcagccttttttttttt 160 8682 G Ͼ A 3Ј untranslated region 50 aacttcttccactttttcca G/A aatttgaatattaacgctaa rs363717 161 8697 C Ͼ T 3Ј untranslated region 50 ttccagaatttgaatattaa C/T gctaaaggtgtaagacttca 162 9097 A Ͼ G 3Ј untranslated region 50 aactattttgaagaaaacac A/G acattttaatacagattgaa Nucleotide numbering is according to the mutation nomenclature (den Dunnen and Antonarakis, 2000) is an important resource for understanding not only the etiology and risk of some diseases, but also the pharmacokinetics or pharmacodyamics of drugs used to treat them. Login to comment
39 In fact, it is reported that the R219K substitution is associated with a decreased severity of atherosclerosis, a decreased risk of coronary events, decreased triglycerides, and a higher level of HDL cholesterol (HDL-C) in plasma (Clee et al. 2001). Login to comment
19 Microsatellite sequences are also shown Table 1. Characterization of 162 single-nucleotide polymorphisms (SNPs) within the ABCA1 locus Repetitive Identity Number Location Exon SNP (5b18; to 3b18;) Substituion sequence to dbSNP Reference 1 afa;278 G b0e; C 5b18; flanking region gggcccgggcgggggaaggg G/C acgcagaccgcggaccctaa rs1800976 2 afa;99 G b0e; C 5b18; flanking region acataaacagaggccgggaa G/C ggggcggggaggagggagag 3 159 G b0e; T intron 1 gcggtgttaaatggggagac G/T atgtcctagtacgagctctg 4 506 G b0e; C intron 1 gaattggctatatgctcccc G/C ggactggagcggcacagtcc 5 5897 T b0e; G intron 1 gtacaaaaccctttagcttt T/G gcaaacctcctttaagaccc 6 5929 C b0e; T intron 1 ttaagacccgatttaaatgc C/T tccctcctcatgaagctctt 7 5962 T b0e; C intron 1 aagctcttctggatccactc T/C ttcccatcactaagttgaaa 8 5985 A b0e; C intron 1 cccatcactaagttgaaagt A/C agatccccttctctttactt 9 11416 G b0e; A intron 1 ttacagtgccctttatagga G/A agaaagaagaaattgtgtct 10 11935 G b0e; A intron 1 tctctgtggagcaaatagag G/A gctgtctgacacttggttcc 11 12281 T b0e; A intron 1 gaatgtttgatttgtgaaaa T/A cttaataacagtagtttttt 12 12924 T b0e; C intron 1 gtgctgacaatcttatactc T/C aggttgaacctccggggaag 13 13002 C b0e; G intron 1 gagcctcaatcacagattct C/G tctagctcacatgaagttaa 14 17715 C b0e; T intron 1 ggagcatgactttgtggaag C/T ctctcctcttccacccagag 15 17848 T b0e; C intron 1 gagggctgactgtcaccctt T/C gataggagcccagcactaaa 16 21384 G b0e; C intron 1 gtgggtgggaggaattggag G/C aggaagcttgcctaagtgtg 17 22145 C b0e; G intron 1 gtagcttctaaatcaacgaa C/G tgattcctggagagcagctt rs1340361 18 23063 G b0e; A intron 1 ggaggcacctgtgacaccca G/A cggagtaggggggcggtgtg 19 23131 G b0e; A intron 1 agtgtgcatatgtgctgacc G/A tgggagcttgtttgtcggtt 20 156 T b0e; C intron 2 ggacacaggactgtgtggtc T/C ggatatggcatgtggcttat rs1078143 21 384 A b0e; G intron 2 gctgtgggtgaagtgagtta A/G tggccccactcttagagatc rs1078144 22 1081 G b0e; A intron 2 agtgcagccaaaattgcaaa G/A tcataccattcaaattaata rs752187 23 2801 A b0e; G intron 2 aagaaaagtgatttatttca A/G gttgctgatgcttagattgt 24 2830 C b0e; G intron 2 tgcttagattgttagagttg C/G aaagatctggcttgcatctt 25 2856 A b0e; G intron 2 tctggcttgcatcttgtaca A/G ctgacagaactggggctcag 26 3187 A b0e; G intron 2 tgatagctgttgcctgcagc A/G tacggacgttcattgcgcag 27 3190 C b0e; T intron 2 tagctgttgcctgcagcata C/T ggacgttcattgcgcagttc 28 3194 C b0e; T intron 2 tgttgcctgcagcatacgga C/T gttcattgcgcagttcctgt 29 3204 G b0e; A intron 2 agcatacggacgttcattgc G/A cagttcctgtctcctgagat 30 3401 T b0e; C intron 2 acataaagcctgtgtgctgc T/C gccaggaagactagaaacgc 31 13927 A b0e; G intron 2 gtcaccacatacctggcact A/G tgctaaggctgggaatgcag L2 32 4163 G b0e; A intron 3 ccagcccacttcatcttacc G/A tagttacctccttagagtat 33 4262 T b0e; C intron 3 tgtcaaagaggaactaagga T/C gccagggactttctgcttag 34 4306 C b0e; T intron 3 ccctctcatcacttctccaa C/T gctggtatcatgaaccccat 35 240 G b0e; A intron 5 gacagaagaaaagtccccag G/A gaagaatactacagacttgg rs1107281 36 490 G b0e; A intron 5 gatgggcatttgaacttgtt G/A tctttaaaaagtgaaatctt 37 583 T b0e; G intron 5 tatctggggagtgggcattt T/G ctgactgaggcattggctgc 38 1051 C b0e; T inton 5 ggctacaaaactgtgctttc C/T ttgggcagtaaaagaggcaa 39 3051 G b0e; A intron 5 tagagaacaagtctaattct G/A ttttccttgaaatagtcgaa 40 3127 A b0e; G intron 5 aagtccatgattttttaggc A/G aaatggcctcctttcctctt 41 5924 C b0e; T intron 5 ctttctttcacaaaattgcc C/T cccagagctttctggaaggg 42 6831 T b0e; C intron 5 ccagtccctcagccttgcca T/C tgcttatgctggtctggaaa 43 12678 G b0e; C intron 5 gctcaccgctctgctcaccc G/C accctctggccatctcctct 44 14214 G b0e; A intron 5 cagcttggtcccagaggcct G/A gacctgggtcccagaggtcc 45 14257 C b0e; T intron 5 gctggttccccggcttggtc C/T cagaggcctggatgtgtggc 46 18078 C b0e; T intron 5 cctaccacaccatgcacgtg C/T acagccaagggttgttgact 47 18795 G b0e; A intron 5 ctgggctcttcctggacctg G/A ccagctaaaaggaaatctcc 48 18948 G b0e; A intron 5 gcattggtggtactaagaac G/A catattccctatcctatagg L2 49 19053 T b0e; C intron 5 ctcccccaacattaaaagtg T/C aagggatgcttattcaaatg MER5A 50 19148 C b0e; A intron 5 ggcccaagaaactgcatttt C/A gcatgctccctaaatgaagc MER5A 51 19229 C b0e; T intron 5 atgctaacagtgtagagtca C/T atgtgatgggaagcatcagg 52 19405 T b0e; C intron 5 cttgctcaatttattctgtc T/C atataactcaatattactga 53 19534 G b0e; A intron 5 catgtgaccctcttagctcc G/A cggattaactcctgtcctca 54 474 G b0e; A coding region 6 gaaaccttctctgggttcct G/A tatcacaacctctctctccc Leu 158 Leu 55 210 A b0e; C intron 6 gcaacctggcgtcatgggcc A/C gctggttaaaataaaattga 56 334 G b0e; A intron 6 acagttctgaggcaataacc G/A tggttaagggttattgatct 57 2288 C b0e; T intron 6 cttctttcaaagcttgtggt C/T cactggaccacgtatgaagt 58 2322 T b0e; C intron 6 atgaagtagaatagtttagg T/C ccagaaaggcaattaagtaa 59 2820 T b0e; G intron 6 gtgctttgatacattctgag T/G ttcagtaaagagacctgatg 60 656 G b0e; A coding region 7 tgagctttgtggcctaccaa G/A ggagaaactggctgcagcag Arg 219 Lys Clee et al. 2001 61 416 G b0e; A intron 7 catcataaagatgacattgt G/A ggctgtcacagttggaaggc 62 471 C b0e; T intron 7 agaccacactatttagctta C/T ttagtaataacattgcaaag 63 504 G b0e; A intron 7 ttgcaaagaaaaattccgac G/A aagttttttcagcctaggaa 64 679 G b0e; C intron 7 gctctggtgaaattcctctc G/C ctaccccaaacatcatcatt 65 1740 C b0e; T intron 7 acaaatgctcaccctttcag C/T tggaatgattgaaattttgg 66 2122 A b0e; G intron 7 tgattaaggtggctactacc A/G ggtgctttctgcatatctcg 67 7753 T b0e; C intrion 7 taggaattccaagctgtgaa T/C tttttactgaagctctttgg 68 8973 A b0e; T intron 7 atggaaatttgtttatattg A/T ctacagattgccaatattat 69 8976 A b0e; G intron 7 gaaatttgtttatattgact A/G cagattgccaatattattag Table 1. Continued Repetitive Identity Number Location Exon SNP (5b18; to 3b18;) Substituion sequence to dbSNP Reference 70 11327 G b0e; C intron 7 ctaacaatcttatttccatt G/C agtccttataaaagaagtgg 71 11738 C b0e; T intron 7 ctgacgtttaagggagaccg C/T gtaggtccctttgaggactg 72 12295 T b0e; A intron 7 agtctgtaaattattgttct T/A ttttttctttagcttatgct 73 387 C b0e; G intron 8 tagcaaggccaatcatttta C/G caacacacatgcttgctaac 74 697 A b0e; T intron 8 ggaactgtctggtgtccccc A/T gcataggaagctgagccagg 75 1312 G b0e; A intron 8 attgctctgcagatcccctc G/A cagccctctgtcccttgttc rs1175929 76 3036 T b0e; G intron 8 ctttatgtgggaagaaattt T/G tttttttgattggggagtgg 77 3176 C b0e; A intron 8 aaatggcctggttctctgtc C/A cctttctgtctgtatgcctc 78 3364 A b0e; T intron 8 ggcagaaggcaaagcttagg A/T cctagagagtgctggaccac 79 3373 G b0e; A intron 8 caaagcttaggacctagaga G/A tgctggaccacgccactcac 80 3561 C b0e; A intron 8 cagggatttattaatgattt C/A ttgtgaaatgtttggaaata 81 3654 T b0e; C intron 8 agtgccggaatacatttgca T/C gtaagacagaacgctgcctg 82 4715 C b0e; T intron 8 ggcagaggggtctcagaatc C/T gcatttccaacaatgtctcc 83 936 C b0e; T coding region 9 cgtattgtctgcgggcatcc C/T gagggaggggggctgaagat Pro 312 Pro 84 2309 A b0e; G intron 9 cccctcaagagtcagtttaa A/G tgttggtcatgttagttgtc 85 2392 T b0e; C intron 9 atgggagggcttgtgcttca T/C gaaaacatttttccagatca 86 228 A b0e; G intron 10 tggggatggggaggactggc A/G cagggctgctgtgatggggt 87 319 C b0e; T intron 10 ttctgcggtccctggctccc C/T acctgactccaggtgaacaa 88 377 A b0e; C intron 11 gaaagaagtgtgggagcaaa A/C gcatgatgttacatgtagac 89 521 G b0e; A intron 11 agtgctctagagacaattgg G/A ttcaaatgtggagcaggctg 90 2850 G b0e; C intron 11 ctctatacaatcattatgct G/C ccattgaaataataaataca 91 2976 A b0e; G intron 11 ctccaattcggtagaaccag A/G gcttcatcttctctgtcgaa 92 3056 C b0e; T intron 11 gtttgcagctgctgtttttc C/T ggcagcacatctgtgcaggc 93 340 T b0e; C intron 12 ggcattatttgtgaaactta T/C ctaaaatcgaattcgggtcc 94 381 A b0e; G intron 12 aattaaatttttgaaatttt A/G tattaaaaattatattagta 95 1728 C b0e; T intron 14 caggctcagaggccttggcc C/T atcaccctggctcacgtgtg 96 2040 C b0e; A coding region 15 atgggcctggacaacagcat C/A ctctggtttagctggttcat Ile 680 Ile 97 1382 G b0e; A intron 15 cttttagacagaaaagttac G/A tgggatattatctcccacag 98 1453 G b0e; A intron 15 tatataaggagaaaccagtt G/A aaattacctattgaagaaac 99 1567 G b0e; A intron 15 ttctgcgtagttttgggtaa G/A tcacttatcttctttaggat MIR 100 1617 T b0e; A intron 15 cagttgcctcatcagaaaga T/A gaacagcattacgcctctgc MIR 101 95 T b0e; A intron 16 agttgagaacagaagatgat T/A gtcttttccaatgggacatg 102 452 G b0e; A intron 16 tggtgttttgcttgagtaat G/A ttttctgaactaagcacaac 103 657 T b0e; C intron 16 ctgttgcctcagtctgggct T/C cataggcatcagcagcccca 104 2473 G b0e; A coding region 17 gcttcaatctcaccacttcg G/A tctccatgatgctgtttgac Val 825 Ile Clee et al. 2001 105 2649 A b0e; G coding region 18 ggttccaaccagaagagaat A/G tcagaaagtaagtgctgttg Ile 883 Met Clee et al. 2001 106 1730 C b0e; G intron 18 tgaaagttcaagcgcagtgc C/G ctgtgtccttacactccact 107 426 A b0e; G intron 19 aggaccttacagtgggtagt A/G tcaggaggggtcaggggctg 108 468 A b0e; G intron 19 aaagcaccagcgttagcctc A/G gtggcttccagcacgattcc 109 876 C b0e; T intron 20 ccctcctcatctaaagtgaa C/T acatggggctcatgtgcagg 110 118 T b0e; G intron 22 catgggatactcttctgtta T/G cacagaagagataaagggca 111 560 G b0e; A intron 22 aaagctttgccattctaggg G/A tcatagccatacagggtgaa 112 102 A b0e; G intron 23 accccttttgccatgttgaa A/G ccaccatctccctgctctgt 113 287 C b0e; T intron 23 gtcaaagaaaagagacttgt C/T aagaggtaagagccttggct 114 1063 G b0e; A intron 23 acctttcaccctcaggaagc G/A aggctgttcacacggcacac 115 321 T b0e; G intron 25 ctctttacttaagtacagtg T/G gaggaacagcggcatcagga MER5A 116 376 G b0e; C intron 25 gttagaaattcagcaacttg G/C gcccagctcagacctactga MER5A 117 478 C b0e; T intron 25 catacataggaaatgacaaa C/T gtttatggatggatagtcta 118 579 G b0e; T intron 25 tcatttaattctcaaaaaaa G/T atgaaaaaatgaacactcag 119 153 C b0e; T intron 27 aatggtaaaagccacttgtt C/T tttgcagcatcgtgcatgtg 120 1058 C b0e; T intron 28 actatcatgggagataatga C/T tatggttgtccatgattgga 121 1317 C b0e; T intron 28 caggacccagtgttctgagt C/T accctgaatgtgagcactat 122 372 T b0e; C intron 30 tatatgatttttaggttttg T/C ttatcagcttcttcgctttt 123 506 A b0e; G intron 30 ccttttaaaaagtaagcagt A/G gataaataaattcagtgaag 124 1033 G b0e; C intron 30 ctggatttcatggtgccttt G/C attttccacatgaaggttgt 125 4281 G b0e; A coding region 31 tcttccctttgcagagacac G/A ccctgccaggcaggggagga Thr 1427 Thr 126 626 C b0e; T intron 33 ggctccttgttactgatttc C/T gtcttttctctctgcctttt 127 719 G b0e; A intron 33 taatagccctcatgctagaa G/A ggagccggagcctgtgtata 128 726 G b0e; A intron 33 cctcatgctagaagggagcc G/A gagcctgtgtataaggccag 129 889 A b0e; G intron 33 ctttcctcaatgtctcagct A/G tctaactgtgtgtgtaatca 130 1097 G b0e; C intron 33 ctgtgcaccccactgtctgg G/C ttttaatgtcaggctgttct 131 4760 G b0e; A coding region 35 tatgacaggactggacacca G/A aaataatgtcaaggtaaacc Arg 1587 Lys Clee et al. 2001 132 234 T b0e; C intron 35 aacctatctaaacctcagtt T/C cctcatctgtgaaatggaga MIR 133 411 C b0e; T intron 37 aactctgtacattttatcag C/T agcttatccatccattgcaa 134 1224 A b0e; G intron 37 caggcataggtgattcagag A/G tgaaaggtcaagtccctgaa L2 135 1720 G b0e; T intron 37 aaattaaaattactctgact G/T ggaatccatcgttcagtaag 136 251 T b0e; G intron 40 tgaaggtaaggaaaatagtg T/G tatttgcttggatccactgg 137 252 T b0e; C intron 40 gaaggtaaggaaaatagtgt T/C atttgcttggatccactggc 138 319 A b0e; G intron 40 agcactggaaaagtcaaacc A/G taactttgagaattaggtga Table 2. Characterization of insertion/deletion polymorphisms at the ABCA1 locus Number Location Variations (5b18; to 3b18;) 1 (afa;1033)-(afa;1032) ins AT 5b18; flanking region tgacttaaatatttagacat (AT/af9;) ggtgtgtaggcctgcattcc 2 6368 del C intron 5 ttctgatggggttgttgctg (C/afa;) tgagaatcatgactgggtgg 3 9709 del T intron 5 cattttctgtctgaaccccc (T/afa;) cacccattcaggcagctgct 4 13816 del T intron 5 tccctacttctccttttttt (T/afa;) catttgcctcctccacccac 5 270-271 ins G intron 10 cttttcagggaggagccaaa (G/af9;) cgctcattgtctgtgcttct 6 611-612 ins C intron 20 tttagcccatcctctccccc (C/af9;) gccaccctccttattgaggc 7 391-392 ins T intron 32 gagtgccttgggtactctct (T/af9;) gatgggggactccatgataa 8 847 del C intron 37 gctgtatattgtgaatgtcc (C/afa;) gttttcaaaagcaaagccaa Nucleotide numbering is according to the mutation nomenclature (den Dunnen and Antonarakis, 2000) (af9;), insertion polymorphism; (afa;), deletion polymorphism Table 1. Continued Repetitive Identity Number Location Exon SNP (5b18; to 3b18;) Substituion sequence to dbSNP Reference 139 957 G b0e; C intron 40 cttgttactcttttttcctt G/C tcatgggtgatagccatttg 140 146 C b0e; T intron 41 tgatgtgggcatcccgcagc C/T ccctccctgcccatcctgga 141 239 A b0e; C intron 42 cattggttttatatgcttac A/C tttatgtgttagttattaaa 142 321 T b0e; A intron 42 aataaatggttgattttgag T/A ttgagtttcatagtccaaaa 143 322 T b0e; C intron 42 ataaatggttgattttgagt T/C tgagtttcatagtccaaaaa 144 533 G b0e; A intron 42 agatgaaaaattatgtagat G/A ataatgaatgatacggttct 145 546 A b0e; G intron 42 tgtagatgataatgaatgat A/G cggttctaaaaagacaggtt 146 739 T b0e; A intron 43 tacagccacacttaaaatgg T/A cccattatgaaatacatatt 147 18 T b0e; C intron 44 taggtgagaaaagaagtggc T/C tgtattttgctgcaaagact 148 264 T b0e; C intron 44 acaatataatttgcttgttt T/C ttaagagtataatttagtga L1MB8 149 279 T b0e; C intron 44 tgttttttaagagtataatt T/C agtgatttttggtaaattga L1MB8 150 508 C b0e; T intron 44 tttacattgctacataaaat C/T cccctatgtacatgtaccta 151 1477 A b0e; T intron 44 gatctcctctcctgtctctt A/T catttttgcagtagcaatgt 152 1665 G b0e; A intron 44 tggttgtaagaactgatttg G/A ttggtatagctgtgagggcc 153 1956 T b0e; G intron 44 gtgttgctcacactcaaaat T/G tctgggccttctcatttggt 154 68 T b0e; C intron 45 aatatataccttatggcttt T/C ccacacgcattgacttcagg 155 608 G b0e; C intron 46 ttatactgacttcaatagag G/C tttcagacaaaaagttgttt 156 336 T b0e; C intron 47 ttcacaattgtaaacaccac T/C acactgaacagcatcatccc L1MD2 157 55 G b0e; C intron 49 agggtgtggattcctgcccc G/C acactcccgcccataggtcc rs1331924 158 7479 C b0e; T 3b18; untranslated region 50 aacaaaaatgtgggtgtctc C/T aggcacgggaaacttggttc 159 8226 C b0e; T 3b18; untranslated region 50 aggagcccactgtaacaata C/T tgggcagccttttttttttt 160 8682 G b0e; A 3b18; untranslated region 50 aacttcttccactttttcca G/A aatttgaatattaacgctaa rs363717 161 8697 C b0e; T 3b18; untranslated region 50 ttccagaatttgaatattaa C/T gctaaaggtgtaagacttca 162 9097 A b0e; G 3b18; untranslated region 50 aactattttgaagaaaacac A/G acattttaatacagattgaa Nucleotide numbering is according to the mutation nomenclature (den Dunnen and Antonarakis, 2000) is an important resource for understanding not only the etiology and risk of some diseases, but also the pharmacokinetics or pharmacodyamics of drugs used to treat them. Login to comment
43 In fact, it is reported that the R219K substitution is associated with a decreased severity of atherosclerosis, a decreased risk of coronary events, decreased triglycerides, and a higher level of HDL cholesterol (HDL-C) in plasma (Clee et al. 2001). Login to comment

[hide] Multiple drug resistance associated with function ... Infect Disord Drug Targets. 2008 Jun;8(2):109-18. Koehn J, Fountoulakis M, Krapfenbauer K
Multiple drug resistance associated with function of ABC-transporters in diabetes mellitus: molecular mechanism and clinical relevance.
Infect Disord Drug Targets. 2008 Jun;8(2):109-18., [PMID:18537706]

Abstract [show]
ATP-binding cassette (ABC) transporters are involved in a variety of physiological processes such as lipid metabolism, ion homeostasis and immune functions. A large number of these proteins have been causatively linked to rare and common human genetic diseases including familial high-density lipoprotein deficiency, retinopathies, cystic fibrosis, diabetes and cardiomyopathies. Furthermore, genetic variations in ABC transporter genes and deregulated expression patterns significantly contribute to drug resistance in human cancer and pancreatic beta cells and alter the pharmacokinetic properties of a variety of drugs. Up-to-date 15 ABC transporters have been identified in human pancreatic beta cells, however only a few of them are identified to date as proteins/genes associated with multidrug resistance (MDR) in diabetes mellitus. Prominent members include the multidrug resistance protein 1 (MRP1/ABCC1), sulfonylurea receptor 1 (SUR1/ABCC8), the multi drug transporter TAP2 and member of the ATP-binding cassette transporter subfamily A (ABCA1). ABCC8 is a subunit of the pancreatic beta-cell K(ATP) channel and plays a key role in the regulation of glucose-induced insulin secretion. Although the physiological role of these transporters to MDR is not yet fully understood, they play an important role in the blood-membrane barrier in pancreatic beta cells. The aim of this article is to provide an overview and to present few examples of drug treatment in MDR in diabetes mellitus associated with function of ABC-transporters.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
130 In humans various studies link variations in ABCA1 to T2D [62, 63, 64, 65, 66] and the ABCA1 variant R219K has been associated with reduced responsiveness to the thiazolidinedione drug rosiglitazone used as insulin sensitizer in T2D [67]. Login to comment

[hide] ATP-binding cassette transporter G4 is highly expr... Brain Res. 2008 Jun 27;1217:239-46. Epub 2008 Apr 27. Uehara Y, Yamada T, Baba Y, Miura S, Abe S, Kitajima K, Higuchi MA, Iwamoto T, Saku K
ATP-binding cassette transporter G4 is highly expressed in microglia in Alzheimer's brain.
Brain Res. 2008 Jun 27;1217:239-46. Epub 2008 Apr 27., [PMID:18508037]

Abstract [show]
Apolipoprotein E epsilon4 is an independent risk factor for Alzheimer's disease (AD) and is the main constituent of high-density lipoprotein (HDL) as a source of cholesterol in the brain. ATP-binding cassette transporter G4 (ABCG4) is one of the membrane cholesterol transporter which is implicated in HDL-mediated cholesterol efflux, but its precise localization and function in the brain has been unclear. In AD brain, ABCG4 protein was highly expressed in microglial cell that was closely located to senile plaques, whereas in non-neurological cases positive cells were not seen in cortical and nigral tissues. As well as the ABCG4 protein, ABCG4 mRNA signal was detected in microglial cell closely located to senile plaque of AD brain by in situ hybridization histochemistry. These results suggest that upregulated ABCG4 in microglia may accelerate the lipidation of apoE and HDL in the AD brain. This is the first report to show that ABCG4 is highly expressed in microglia on AD brain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
123 The genetic variant R219K of ABCA1 was found to be associated with increased HDL cholesterol, and it delayed the age of onset of AD (Wollmer et al., 2003). Login to comment

[hide] Polymorphism in ABCA1 influences CSF 24S-hydroxych... Int J Mol Med. 2006 May;17(5):791-4. Kolsch H, Lutjohann D, Jessen F, Von Bergmann K, Schmitz S, Urbach H, Maier W, Heun R
Polymorphism in ABCA1 influences CSF 24S-hydroxycholesterol levels but is not a major risk factor of Alzheimer's disease.
Int J Mol Med. 2006 May;17(5):791-4., [PMID:16596262]

Abstract [show]
The ATP-binding cassette transporter A1 (ABCA1) mediates reverse cholesterol transport, polymorphisms have been shown to influence the levels of cholesterol and of HDL and the risk of coronary artery disease. Since altered cholesterol metabolism is also involved in Alzheimer's disease (AD), the effects of two ABCA1 polymorphisms (G-395C promoter polymorphism (rs 2246293) and exonic R219K) on the risk of AD in 241 AD patients and 294 non-demented controls, and on CSF cholesterol and 24S-hydroxycholesterol in 74 AD patients and 42 non-demented controls were investigated. None of the investigated ABCA1 polymorphisms influenced the risk of AD. However, the ABCA1 G-395C polymorphism influenced CSF levels of 24S-hydroxycholesterol, but not of cholesterol, whereas the R219K influenced neither CSF levels of 24S-hydroxycholesterol nor cholesterol. Our data support the observation that ABCA1 polymorphisms influence cholesterol metabolism of the brain, but might not act as a major risk factor in AD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 Since altered cholesterol metabolism is also involved in Alzheimer's disease (AD), the effects of two ABCA1 polymorphisms (G-395C promoter polymorphism (rs 2246293) and exonic R219K) on the risk of AD in 241 AD patients and 294 non-demented controls, and on CSF cholesterol and 24S-hydroxycholesterol in 74 AD patients and 42 non-demented controls were investigated. Login to comment
4 However, the ABCA1 G-395C polymorphism influenced CSF levels of 24S-hydroxycholesterol, but not of cholesterol, whereas the R219K influenced neither CSF levels of 24S-hydroxycholesterol nor cholesterol. Login to comment
18 Furthermore, an exonic non-synonymous (R219K) polymorphism influenced CSF cholesterol levels and risk of premature coronary heart disease in patients with hypercholesterolemia (17). Login to comment
21 To further explore the effect of ABCA1 G-395C and R219K polymorphisms on AD risk and on the CSF levels of cholesterol and 24S-hydroxycholesterol, we investigated genotype distribution in a homogeneous age matched sample of German origin. Login to comment
32 The G-395C promoter polymorphism [rs 2246293 (13)] and the R219K polymorphism in ABCA1 were determined by RFLP. Login to comment
33 In brief, for the G-395C polymorphism the whole product was amplified using the following primers: 5'-TGAGGGAGAT TCAGCCTAGATC-3' (forward) and 5'-AGTGGAATTTGC TTCCTCTAGATC-3' (reverse), the forward primer contained a nucleotide change (underlined), to generate a control restriction site specific for BstY I. The amplification products of the Gand the C-alleles were 72, 24 and 18 bp or 96 and 18 bp. The R219K polymorphism was investigated by using the following primers: 5'- TCAGAAGAGATGATTCAACT TGG -3' (forward) and 5'-TTTCTACAAAACAAAGTCAT CCTG-3' (reverse), the reverse primer contained a nucleotide change (underlined), to generate a control restriction site specific for EcoN I. The amplification products of the Ror the K-alleles were 190 and 27 bp or 135, 55 and 27 bp. The APOE genotype was studied as described (24). Login to comment
45 The power to detect a relative risk of 2.0 with &#b7;=0.05 was 98% for the R219K polymorphism and 92% for the G-395C polymorphism. Login to comment
50 Genotype distribution and allele frequencies of both polymorphisms in AD patients and controls are given in Table I. Logistic regression analysis revealed that the two investigated ABCA1 polymorphisms did not influence the risk of AD (G-395C, presence of C-allele: c7;2 =0.31, d.f.=1, p=0.59; R219K, presence of K-allele: c7;2 =0.65, d.f.=1, p=0.42). Login to comment
51 There was also no interaction between both ABCA1 polymorphisms on the risk of AD (c7;2 =0.81, d.f.=1, p=0.37), and no interaction between ABCA1 polymorphisms and the APOE4 allele (G-395C, presence of C-allele vs. presence of APOE4: c7;2 =1.61, d.f.=1, p=0.21; R219K, presence of K-allele vs. presence of APOE4: c7;2 =0.01, d.f.=1, p=0.95). Login to comment
55 ----------------------------------------------------------------------------------------------------- ABCA1 G-395C Allele frequency Genotype &#af;2 test -------------- -------------- ----------------------------- --------------- n G C G/G (%) G/C (%) C/C (%) &#af; df p ----------------------------------------------------------------------------------------------------- AD patients 241 0.55 0.45 74 (30.7) 115 (47.7) 52 (21.6) 0.82 2 0.67 Controls 294 0.53 0.47 80 (27.2 149 (50.7) 65 (22.1) ----------------------------------------------------------------------------------------------------- ABCA1 R219K Allele frequency Genotype &#af;2 test ------------- -------------- ----------------------------- --------------- n R K R/R (%) R/K (%) K/K (%) &#af; df p ----------------------------------------------------------------------------------------------------- AD patients 241 0.72 0.28 130 (53.9) 88 (36.5) 23 (9.5) 1.89 2 0.39 Controls 294 0.72 0.28 149 (50.7) 123 (41.8) 22 (7.5) ----------------------------------------------------------------------------------------------------- 24S-hydroxycholesterol concentrations were lower in probands who were carriers of at least one C-allele of the ABCA1 G-395C polymorphism than in carriers of the GG-genotype (F=5.74, d.f.=1, p=0.018; Fig. 1); however, levels of cholesterol were not influenced by this polymorphism (F=0.87, d.f.=1, p=0.35). Login to comment
56 We did not find any effect of the ABCA1 R219K polymorphism on the CSF levels of cholesterol (F=0.68, d.f.=1, p=0.41) or of 24S-hydroxycholesterol (F=0.01, d.f.=1, p=0.91) in our whole proband sample. Login to comment
61 Since a previous publication (19) reported altered levels of cholesterol depending on ABCA1 polymorphisms only in non-demented probands, statistical analysis assessed the interaction between ABCA1 polymorphisms and diagnosis: we did not find any significant interaction of ABCA1 polymorphisms and diagnosis either on cholesterol levels (G-395C, presence of C-allele vs. diagnosis: c7;2 =0.56, d.f.=1, p=0.45; R219K, presence of K-allele vs. diagnosis: c7;2 =0.07, d.f.=1, p=0.94) or on levels of 24S-hydroxycholesterol (G-395C, presence of C-allele vs. diagnosis: c7;2 =3.2, d.f.=1, p=0.08; R219K, presence of K-allele vs. diagnosis: c7;2 =0.27, d.f.=1, p=0.61). Login to comment
62 Discussion We investigated the ABCA1 G-395C and R219K polymorphisms for their influence on the risk of AD and on CSF levels of cholesterol and 24S-hydroxycholesterol. Login to comment
65 The exonic R219K polymorphism in ABCA1 has been shown to influence CSF cholesterol levels in healthy probands (19), while our study did not detect any effect. Login to comment
67 We also did not find the exonic R219K or the promoter G-395C polymorphisms to influence the risk of AD; thus, we cannot support the suggestion that polymorphisms in ABCA1 might act as risk factors of AD. Login to comment

[hide] Protective effect of R allele of PON1 gene on the ... Dis Markers. 2008;24(2):81-8. Balcerzyk A, Zak I, Krauze J
Protective effect of R allele of PON1 gene on the coronary artery disease in the presence of specific genetic background.
Dis Markers. 2008;24(2):81-8., [PMID:18219093]

Abstract [show]
BACKGROUND: Genetic susceptibility to CAD may be determined by polymorphic variants of genes encoding isoforms involved in the processes important in the pathogenesis of atherosclerosis, including lipids disorders. Participation of single polymorphic variants is relatively small, however its significance may increase in the presence of specific genetic or environmental background. AIM: The aim of the study was an evaluation a possible association between single polymorphic variants of PON1, APOE, ABCA1 and PPARA genes and CAD and looking for specific multigene genotype patterns which differentiate study groups. MATERIALS AND METHODS: We studied 358 subjects:178 patients with angiographically confirmed CAD and 180 blood donors without history of CAD. Polymorphisms were genotyped using PCR-RFLP method. RESULTS: We observed statistically significant differences in the frequencies of R allele and R allele carriers of PON1 gene between CAD and controls. The distribution of genotypes and alleles of other analyzed genes did not differentiate the study groups, however the presence of specific genotypes (APOE& ndash; epsilon3epsilon3, epsilon3epsilon2, ABCA1 - AG, PPARA - GG) increased the protective effect of R allele. CONCLUSION: The present study revealed an independent protective association between carrier-state of PON1 R allele and CAD. This protective effect was especially strong in the presence of specific genotype arrangements of other analyzed genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 ABCA1 R219K polymorphism was genotyped using a method described by Clee et al. [8], with some modifications. Login to comment

[hide] A-Subclass ATP-Binding Cassette Proteins in Brain ... Front Psychiatry. 2012 Mar 5;3:17. doi: 10.3389/fpsyt.2012.00017. eCollection 2012. Piehler AP, Ozcurumez M, Kaminski WE
A-Subclass ATP-Binding Cassette Proteins in Brain Lipid Homeostasis and Neurodegeneration.
Front Psychiatry. 2012 Mar 5;3:17. doi: 10.3389/fpsyt.2012.00017. eCollection 2012., [PMID:22403555]

Abstract [show]
The A-subclass of ATP-binding cassette (ABC) transporters comprises 12 structurally related members of the evolutionarily highly conserved superfamily of ABC transporters. ABCA transporters represent a subgroup of "full-size" multispan transporters of which several members have been shown to mediate the transport of a variety of physiologic lipid compounds across membrane barriers. The importance of ABCA transporters in human disease is documented by the observations that so far four members of this protein family (ABCA1, ABCA3, ABCA4, ABCA12) have been causatively linked to monogenetic disorders including familial high-density lipoprotein deficiency, neonatal surfactant deficiency, degenerative retinopathies, and congenital keratinization disorders. Recent research also point to a significant contribution of several A-subfamily ABC transporters to neurodegenerative diseases, in particular Alzheimer's disease (AD). This review will give a summary of our current knowledge of the A-subclass of ABC transporters with a special focus on brain lipid homeostasis and their involvement in AD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Among the allelic variants identified in the ABCA1 gene, the SNPs rs2230806 (R219K), rs4149313 (I883M), and rs2230808 (R1587K) have been most extensively studied. Login to comment
96 Among the allelic variants identified in the ABCA1 gene, the SNPs rs2230806 (R219K), rs4149313 (I883M), and rs2230808 (R1587K) have been most extensively studied. Login to comment

[hide] ABCA1 gene promoter DNA methylation is associated ... Epigenetics. 2012 May;7(5):464-72. doi: 10.4161/epi.19633. Epub 2012 May 1. Guay SP, Brisson D, Munger J, Lamarche B, Gaudet D, Bouchard L
ABCA1 gene promoter DNA methylation is associated with HDL particle profile and coronary artery disease in familial hypercholesterolemia.
Epigenetics. 2012 May;7(5):464-72. doi: 10.4161/epi.19633. Epub 2012 May 1., [PMID:22419126]

Abstract [show]
High-density lipoproteins cholesterol (HDL-C) level, a strong coronary artery disease (CAD) clinical biomarker, shows significant interindividual variability. However, the molecular mechanisms involved remain mostly unknown. ATP-binding cassette A1 (ABCA1) catalyzes the cholesterol transfer from peripheral cells to nascent HDL particles. Recently, a differentially methylation region was identified in ABCA1 gene promoter locus, near the first exon. Therefore, we hypothesized that DNA methylation changes at ABCA1 gene locus is one of the molecular mechanisms involved in HDL-C interindividual variability. The study was conducted in familial hypercholesterolemia (FH), a monogenic disorder associated with a high risk of CAD . Ninety-seven FH patients (all p.W66G for the LDLR gene mutation and not under lipid-lowering treatment) were recruited and finely phenotyped for DNA methylation analyses at ABCA1 gene locus. ABCA1 DNA methylation levels were found negatively correlated with circulating HDL-C (r = -0.20; p = 0.05), HDL2-phospholipid levels (r = -0.43; p = 0.04), and with a trend for association with HDL peak particle size (r = -0.38; p = 0.08). ABCA1 DNA methylation levels were also found associated with prior history of CAD (CAD = 40.2% vs. without CAD = 34.3%; p = 0.003). These results suggest that epigenetic changes within the ABCA1 gene promoter contribute to the interindividual variability in plasma HDL-C concentrations and are associated with CAD expression. These findings could change our understanding of the molecular mechanisms involved in the pathophysiological processes leading to CAD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
211 Associations of the ATP-binding cassette transporter A1 R219K polymorphism with HDL-C level and coronary artery disease risk: a meta-analysis. Login to comment

[hide] ATP-binding cassette transporter A1 R219K polymorp... Mol Biol Rep. 2012 Dec;39(12):11031-9. doi: 10.1007/s11033-012-2006-0. Epub 2012 Oct 9. Li YY, Zhang H, Qin XY, Lu XZ, Yang B, Chen ML
ATP-binding cassette transporter A1 R219K polymorphism and coronary artery disease in Chinese population: a meta-analysis of 5,388 participants.
Mol Biol Rep. 2012 Dec;39(12):11031-9. doi: 10.1007/s11033-012-2006-0. Epub 2012 Oct 9., [PMID:23053993]

Abstract [show]
The ATP-binding cassette transporter A1 (ABCA1) R219K gene polymorphism has been suggested to lower the risk of coronary artery disease (CAD). However, research results remain debatable. Meta-analysis involving 2,730 CAD patients and 2,658 controls was performed to investigate the relationship between ABCA1 R219K gene polymorphism and CAD in Chinese population. A total of 14 studies which were obtained from electronic databases were analyzed. The pooled odds ratios (ORs) and their corresponding 95 % confidence intervals (95 % CIs) were estimated by a random effect model. A significant association between ABCA1 R219K gene polymorphism and CAD was found in the Chinese population under the following genetic models: an allelic genetic model (OR 0.70, 95 % CI 0.62-0.78, P < 0.00001), a recessive genetic model (OR 0.51, 95 % CI 0.41-0.64, P < 0.00001), an additive genetic model (OR 0.816, 95 % CI 0780-0.855, P = 0), a dominant genetic model (OR 1.326, 95 % CI 1.232-1.427, P = 0), a homozygote genetic model (OR 0.640, 95 % CI 0.575-0.712, P = 0), and a heterozygote genetic model (OR 0.640, 95 % CI 0.575-0.712, P = 0). The K allele of the ABCA1 R219K gene has a protective role for CAD risk in Chinese population and is possibly associated with decreased CAD susceptibility.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 ATP-binding cassette transporter A1 R219K polymorphism and coronary artery disease in Chinese population: a meta-analysis of 5,388 participants Yan-yan Li ߦ Hui Zhang ߦ Xiao-yi Qin ߦ Xin-zheng Lu ߦ Bing Yang ߦ Ming-long Chen Received: 16 January 2012 / Accepted: 1 October 2012 / Published online: 9 October 2012 &#d3; Springer Science+Business Media Dordrecht 2012 Abstract The ATP-binding cassette transporter A1 (ABCA1) R219K gene polymorphism has been suggested to lower the risk of coronary artery disease (CAD). Login to comment
2 Meta-analysis involving 2,730 CAD patients and 2,658 controls was performed to investigate the relationship between ABCA1 R219K gene polymorphism and CAD in Chinese population. Login to comment
5 A significant association between ABCA1 R219K gene polymorphism and CAD was found in the Chinese population under the following genetic models: an allelic genetic model (OR 0.70, 95 % CI 0.62-0.78, P \ 0.00001), a recessive genetic model (OR 0.51, 95 % CI 0.41-0.64, P \ 0.00001), an additive genetic model (OR 0.816, 95 % CI 0780-0.855, P = 0), a dominant genetic model (OR 1.326, 95 % CI 1.232-1.427, P = 0), a homozygote genetic model (OR 0.640, 95 % CI 0.575-0.712, P = 0), and a heterozygote genetic model (OR 0.640, 95 % CI 0.575-0.712, P = 0). Login to comment
6 The K allele of the ABCA1 R219K gene has a protective role for CAD risk in Chinese population and is possibly associated with decreased CAD susceptibility. Login to comment
7 Keywords ATP-binding cassette transporter A1 R219K Gene polymorphism Coronary artery disease Chinese Introduction Coronary artery disease (CAD) is one of the leading causes of death. Login to comment
20 R219K is a common variation in the ABCA1 gene-coding region. Login to comment
24 [7] found that ABCA1 R219K polymorphism was associated with a higher HDL-C level in Asians and performed a protective role for CAD in both Asians and Caucasians. Login to comment
26 They reported that the K allele of ABCA1 R219K polymorphism was a protective factor associated with decreased CAD susceptibility worldwide [8]. Login to comment
29 Domestically, results of the widely researched topics of ABCA1 R219K gene polymorphism and CAD are still debatable [10, 11]. Login to comment
30 Hence, the current meta-analysis on 2,730 CAD patients and 2,658 subjects was conducted to arrive at a decisive conclusion on the associations between ABCA1 R219K gene polymorphism and CAD in the Chinese population. Login to comment
33 The studies had to comply with the following major criteria: (a) Evaluation of the ABCA1 R219K gene polymorphism and CAD in Chinese population; (b) CAD was diagnosed by coronary arteriography and clinical symptoms combined with electrocardiogram, echocardiography, treadmill exercise test, and myocardial perfusion imaging in emission computed tomography (ECT); (c) The individual study should be a case-control or cohort study published in an official journal; and (d) The individual study should agree with the Hardy-Weinberg equilibrium (HWE). Login to comment
45 The odds ratios (ORs) corresponding to 95 % confidence intervals (CIs) were used to examine the association between ABCA1 R219K gene polymorphism and CAD. Login to comment
59 Out of the 17 excluded studies, two were repeated publications, seven were of review character, and six were not associated with ABCA1 R219K gene polymorphism. Login to comment
63 Pooled analyses A significant association between ABCA1 R219K gene polymorphism and CAD was found in the Chinese population under the following genetic models: an allelic genetic model (OR 0.70, 95 % CI 0.62-0.78, P \ 0.00001), a recessive genetic model (OR 0.51, 95 % CI 0.41-0.64, P \ 0.00001), an additive genetic model (OR 0.816, 95 % CI 0780-0.855, P = 0), a dominant genetic model (OR 1.326, 95 % CI 1.232-1.427, P = 0), a homozygote genetic model (OR 0.640, 95 % CI 0.575-0.712, P = 0) and a heterozygote genetic model (OR 0.640, 95 % CI 0.575-0.712, P = 0). Login to comment
66 The CAD group sample size (allelic genetic model, P = 0.015), KK genotype sample size of CAD group (KK1) (recessive genetic Fig. 1 Flow diagram of articles selection process for ABCA1 R219K gene polymorphism and CAD risk meta-analysis model, P = 0.014; homozygote genetic model, P = 0.014), RR genotype sample size of CAD group (RR1) (dominant genetic model, P = 0.004), and RK genotype sample size of CAD group (RK1) (heterozygote genetic model, P = 0.004) (additive genetic model, P = 0.013) possibly explained the heterogeneity. Login to comment
70 No significant association was detected between ABCA1 R219K gene polymorphism and CAD in subgroup 1 (OR 0.85, 95 % CI 0.70-1.03, Pheterogeneity = 0.09, I2 = 58.4 %, P = 0.10. Login to comment
76 No positive association was detected between ABCA1 R219K gene polymorphism and CAD in subgroup 1 (recessive genetic model, OR 0.78, 95 % CI 0.56-1.10, Pheterogeneity = 0.12, I2 = 53.4 %, P = 0.16) (homozygote genetic model, OR 0.812, 95 % CI 0.696-0.948, Pheterogeneity = 0.126, I2 = 51.7 %, P = 0.008). Login to comment
81 A significant association was found between ABCA1 R219K gene polymorphism and CAD in the three subgroups (subgroup 1, OR 1.337, 95 % CI 1.199-1.491, Pheterogeneity = 0.005, I2 = 76.9 %, P = 0) (subgroup 2, OR 1.257, 95 % CI 1.081-1.462, Pheterogeneity = 0.760, I2 = 0 %, P = 0.003) (subgroup 3, OR 1.369, 95 % CI 1.198-1.564, Pheterogeneity = 0.215, I2 = 27.9 %, P = 0). Login to comment
86 A significant association was found between ABCA1 R219K gene polymorphism Table 1 Characteristics of the investigated studies of the association between ABCA1 R291K gene polymorphism and coronary artery disease Author Year Region Ethnicity CAD Control Matching criteria Sample size (CAD/ control) P value of HWE RR RK KK RR RK KK Zhaoa 2004 Hunan Han 96 111 29 80 123 48 Age, sex, ethnicity, BMI 236/251 0.95 Lib 2005 Sichuan Han 158 174 64 124 198 95 Age, sex, ethnicity 396/417 0.35 Sunc 2005 Jiangsu Han 105 85 34 62 129 57 Ethnicity, BMI 224/248 0.52 Wangd 2006 Hebei Han 108 105 21 67 101 30 Age, sex, ethnicity, BMI 234/198 0.42 Zhae 2006 Guangdong Han 47 53 12 34 52 22 Age, sex, ethnicity 112/108 0.80 Lif 2008 Heilongjiang Han 140 170 55 92 116 38 Age, sex, ethnicity 365/246 0.89 Liug 2008 Gansu Han 29 39 3 57 60 28 Ethnicity 71/145 0.10 Wangh 2008 Zhejiang Han 85 161 75 67 155 72 Ethnicity 321/294 0.35 Yui 2008 Shanghai Han 29 18 2 24 35 13 Sex, ethnicity 49/72 0.97 Zhangj 2008 Zhejiang Han 71 65 26 49 93 44 Sex, ethnicity 162/186 0.99 Shik 2009 Hunan Han 49 60 23 53 66 38 Age, sex, ethnicity, BMI 132/157 0.54 Xial 2011 Guangxi Han 96 107 24 51 78 33 Age, sex, ethnicity, BMI 227/162 0.75 Xum 2011 Beijing Han 63 63 15 31 53 25 Ethnicity 141/109 0.80 Yuann 2011 Neimenggu Mongolian 22 28 10 16 21 18 Age, ethnicity 60/55 0.08 The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) geno-typing method and case-control study design were adopted in all of the above studies BMI body mass index a Ref. [10], b Ref. [16], c Ref. [17], d Ref. [18], e Ref. [19], f Ref. [20], g Ref. [21], h Ref. [11], i Ref. [22], j Ref. [23], k Ref. [24], l Ref. [25], m Ref. [26], n Ref. [27] and CAD in the three subgroups (heterozygote genetic model, subgroup 1, OR 0.916, 95 % CI 0.846-0.992, Pheterogeneity = 0.365, I2 = 0.8 %, P = 0.032; subgroup 2, OR 0.804, 95 % CI 0.734-0.881, Pheterogeneity = 0.105, I2 = 51.2 %, P = 0; subgroup 3, OR 0.863, 95 % CI 0.781-0.953, Pheterogeneity = 0.119, I2 = 40.8 %, P = 0.004) (additive genetic model, subgroup 1, OR 0.906, 95 % CI 0.844-0.971, Pheterogeneity = 0.085, I2 = 59.4 %, P = 0.006; subgroup 2, OR 0.762, 95 % CI 0.702-0.829, Pheterogeneity = 0.545, I2 = 0 %, P = 0; subgroup 3, OR 0.759, 95 % CI 0.695-0.829, Pheterogeneity = 0.398, I2 = 3.7 %, P = 0) (Table 2; Figs. Login to comment
91 Discussion In the current meta-analysis of 2,730 CAD patients and 2,658 control subjects in Chinese population, the K allele of ABCA1 R219K was significantly associated with decreased CAD risk under allelic (OR 0.70), recessive (OR 0.51), additive (OR 0.816), dominant (OR 1.326), homozygote (OR 0.640), and heterozygote genetic model (OR 0.863). Login to comment
94 The association of ABCA1 R219K gene polymorphism and Table 2 Summary of meta-analysis of association of ABCA1 R219K polymorphism and CAD risk Genetic model Group analysis Pooled OR (95 % CI) P value Literature number CAD size Control size Pheterogeneity Allelic genetic model Whole population 0.70 (0.62-0.78) \0.00001* 14 2,730 2,658 0.030* Subgroup1: T1 [ 300 0.85 (0.70-1.03) 0.100 3 1,082 957 0.090 Subgroup2: 300 [ T1 [ 200 0.65 (0.57-0.75) \0.00001* 4 921 859 0.400 Subgroup3: T1 \ 200 0.63 (0.54-0.73) \0.00001* 7 727 842 0.470 Recessive genetic model Whole population 0.51 (0.41-0.64) \0.00001* 14 2,730 2,658 0.020* Subgroup1: KK1 [ 40 0.78 (0.56-1.10) 0.160 3 1,082 957 0.120 Subgroup2: 20 \ KK1 \ 40 0.50 (0.40-0.63) \0.00001* 6 1,215 1,202 0.970 Subgroup3: KK1 \ 20 0.29 (0.19-0.43) \0.00001* 5 433 489 0.630 Dominant genetic model Whole population 1.326 (1.232-1.427) 0.000* 14 2,730 2,658 0.049* Subgroup1: RR1 [ 100 1.337 (1.199-1.491) 0.000* 4 784 707 0.005* Subgroup2: 80 \ RR1 \ 100 1.257 (1.081-1.462) 0.003* 3 1,219 1,109 0.760 Subgroup3: RR1 \ 80 1.369 (1.198-1.564) 0.000* 7 727 842 0.215 Homo genetic model Whole population 0.640 (0.575-0.712) 0.000* 14 2,730 2,658 0.016* Subgroup1: KK1 [ 40 0.812 (0.696-0.948) 0.008* 3 1,082 957 0.126 Subgroup2: 20 \ KK1 \ 40 0.575 (0.487-0.678) 0.000* 6 1,215 1,202 0.728 Subgroup3: KK1 \ 20 0.426 (0.310-0.587) 0.000* 5 433 489 0.495 Hetero genetic model Whole population 0.863 (0.819-0.908) 0.000* 14 2,730 2,658 0.046* Subgroup1: RK1 [ 150 0.916 (0.846-0.992) 0.032* 3 1,082 957 0.365 Subgroup2: 150 [ RK1 [ 70 0.804 (0.734-0.881) 0.000* 4 921 859 0.105 Subgroup3: RK1 \ 70 0.863 (0.781-0.953) 0.004* 7 727 842 0.119* Additive genetic model Whole population 0.816 (0.780-0.855) 0.000* 14 2,730 2,658 0.013* Subgroup1: RK1 [ 150 0.906 (0.844-0.971) 0.006* 3 1,082 957 0.085 Subgroup2: 150 [ RK1 [ 70 0.762 (0.702-0.829) 0.000* 4 921 859 0.545 Subgroup3: RK1 \ 70 0.759 (0.695-0.829) 0.000* 7 727 842 0.398 CI confidence interval; OR odds ratio; MI size the total number of MI cases; control size the total number of control group; homo genetic model homozygote genetic model; hetero genetic model heterozygote genetic model; T1 total CAD group sample size; KK1 KK1 genotype sample size of CAD group; RR1 RR1 genotype sample size of CAD group; RK1 RK1genotype sample size of CAD group *P \ 0.05 CAD distinctly weakened in the three studies with T1 [ 300. Login to comment
97 The association of ABCA1 R219K gene polymorphism with CAD was also distinctly impaired in the three studies with KK1 [ 40. Login to comment
100 Results of the current meta-analysis indicated that the K allele of ABCA1 R219K gene has a protective effect on CAD risk in the Chinese population. Login to comment
112 Recent studies have Fig. 2 Forest plot of coronary artery disease associated with ATP-binding cassette transporter A1 (ABCA1) R219K polymorphism under an allelic genetic model (distribution of K allelic frequency of ABCA1 R219K gene) stratified by CAD sample size (T1) Fig. 3 Forest plot of coronary artery disease associated with ATP-binding cassette transporter A1 (ABCA1) R219K polymorphism under a recessive genetic model (KK vs. RK ? Login to comment
113 RR) stratified by KK1 genotype sample size Fig. 4 Funnel plot for studies of the association of coronary artery disease and ATP-binding cassette transporter A1 (ABCA1) R219K polymorphism under the allelic genetic model (distribution of K allelic frequency of ABCA1 R219K gene). Login to comment
118 R219K is the familiar variation of ABCA1 gene. Login to comment
119 Studies on the gene polymorphism of R219K focused on the association between atherosclerosis and lipid metabolism. Login to comment
120 The R219K mutation correlated with increased HDL-C, alleviated atherosclerosis, and decreased CAD risk [30, 31]. Login to comment
122 The association of the K allele of the ABCA1 R219K gene with decreased CAD susceptibility was further verified in the current meta-analysis. Login to comment
123 In addition, the study suggests that the distribution of K allele of the ABCA1 R219K gene indicated a protective factor for CAD risk. Login to comment
127 The R219K genotype distribution, K allele frequency, and carriers were confirmed to be different among different ethnicities [32]. Login to comment
133 Thus, the relationship between ABCA1 R219K gene polymorphism and CAD in the Chinese population cannot be elucidated clearly as that in the current meta-analysis even if they obtained a positive conclusion. Login to comment
135 Large-scale research on arteriosclerosis protection of R219K remains inadequate. Login to comment
137 Finally, the current meta-analysis suggested that the distribution of the K allele frequency of the ABCA1 R219K gene may protect the Chinese population from CAD risks. Login to comment

[hide] Association studies of several cholesterol-related... Lipids Health Dis. 2012 Nov 26;11:163. doi: 10.1186/1476-511X-11-163. Xiao Z, Wang J, Chen W, Wang P, Zeng H, Chen W
Association studies of several cholesterol-related genes (ABCA1, CETP and LIPC) with serum lipids and risk of Alzheimer's disease.
Lipids Health Dis. 2012 Nov 26;11:163. doi: 10.1186/1476-511X-11-163., [PMID:23181436]

Abstract [show]
OBJECTIVES: Accumulating evidence suggested that dysregulation of cholesterol homeostasis might be a major etiologic factor in initiating and promoting neurodegeneration in Alzheimer's disease (AD). ATP-binding cassette transporter A1 (ABCA1), hepatic lipase (HL, coding genes named LIPC) and cholesteryl ester transfer protein (CETP) are important components of high-density lipoprotein (HDL) metabolism and reverse cholesterol transport (RCT) implicated in atherosclerosis and neurodegenerative diseases. In the present study, we will investigate the possible association of several common polymorphisms (ABCA1R219K, CETPTaqIB and LIPC-250 G/A) with susceptibility to AD and plasma lipid levels. METHODS: Case-control study of 208 Han Chinese (104 AD patients and 104 non-demented controls) from Changsha area in Hunan Province was performed using the PCR-RFLP analysis. Cognitive decline was assessed using Mini Mental State Examination (MMSE) as a standardized method. Additionally, fasting lipid profile and the cognitive testing scores including Wechsler Memory Scale (WMS) and Wisconsin Card Sorting Test (WCST) were recorded. RESULTS AND CONCLUSIONS: We found significant differences among the genotype distributions of these three genes in AD patients when compared with controls. But after adjusting other factors, multivariate logistic regression analysis showed only ABCA1R219K (B=-0.903, P=0.005, OR=0.405, 95%CI:0.217-0.758) and LIPC-250 G/A variants(B=-0.905, P=0.018, OR=0.405, 95%CI:0.191-0.858) were associated with decreased AD risk. There were significantly higher levels of high-density lipoprotein cholesterol (HDL-C) and apolipoproteinA-I in the carriers of KK genotype and K allele (P < 0.05), and B2B2 genotype of CETP Taq1B showed significant association with higher HDL-C levels than other genotypes (F=5.598, P=0.004), while -250 G/A polymorphisms had no significant effect on HDL-C. In total population, subjects carrying ABCA1219K allele or LIPC-250A allele obtained higher MMSE or WMS scores than non-carriers, however, no significant association was observed in AD group or controls. Therefore, this preliminary study showed that the gene variants of ABCA1R219K and LIPC-250 G/A might influence AD susceptibility in South Chinese Han population, but the polymorphism of CETPTaq1B didn't show any association in despite of being a significant determinant of HDL-C.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 One of the most studied ABCA1 variants is R219K (rs2230806) in exon region. Login to comment
36 Previous researches indicated the common R219K variant was associated with CSF cholesterol levels [38]. Login to comment
74 The ABCA1 R219K polymorphism was investigated by using the following primers: 5'-GTA TTT TTG CAA GGC TAC CAG TTA CAT TTG ACAA-3'(forward) and 5'-GAT TGG CTT CAG GAT GTCC-3'(reverse), according to previous literure [65]. Login to comment
114 For ABCA1 R219K polymorphism, there were significantly higher levels of HDL-C and apoA-I in the carriers of KK genotype and K allele (P < 0.05). Login to comment
126 There existed evident combined genotype effect of the ABCA1 R219K and the LIPC-250 G/A polymorphisms on HDL-C levels in total subjects: the carriers of the KK/AA genotype showed the highest levels of HDL-C (2.07 +/- 0.11 mmol/L), whereas those carrying the RR/GG genotype showed the lowest (1.07+/- 0.22 mmol/L) (Table 4). Login to comment
162 performed in 281 AD patients indicated that serum TC and LDL levels were clearly positively correlated with densities of neuritic plaques in both neocortex and hippocampal Table 4 Combination of ABCA1 R219K and LIPC -250 G/A variants and serum HDL-C levels(mmol/L) LIPC-250 G/A genotypes GG GA AA ABCA1 R219 K genotypes RR 1.07&#b1;0.22 1.33&#b1;0.82 1.19&#b1;0.26 RK 1.40&#b1;0.26 1.36&#b1;0.24 1.52&#b1;0.19 KK 2.02&#b1;0.66 1.70&#b1;0.40 2.07&#b1;0.11 F = 3.930 P = 0.004 Table 5 Logistic regression analysis:risk factors for AD Variable B P OR 95%CI age 0.963 0.003 2.620 1.381-4.972 education -1.052 0.004 0.349 0.172-0.710 219K allele -0.903 0.005 0.405 0.217-0.758 -250A allele -0.905 0.018 0.405 0.191-0.858 regions [77]. Login to comment
164 In this pilot study we determined an apparent association between the polymorphism of ABCA1 R219K and AD. Login to comment
169 The minor allele frequency of R219K was reported 25% in Caucasian populations [79], 46% in Europeans [65]. Login to comment
181 Many conflicting results from previous studies have evaluated the associations of R219K polymorphism with level of HDL-C and risk of developing CAD [82,84,85]. Login to comment
183 In this pilot study, we first reported the association of R219K gene variants with lipids in AD patients, suggesting the possible involvement of cholesterol with AD. Login to comment
188 However, other studies failed to find any significant influence of R219K variation on HDL-C or other lipid parameters levels [85,89-91]. Login to comment
220 We found a significant interaction of ABCA1 R219K and LIPC-250 G/A polymorphisms on HDL-C levels in the total subjects (F = 3.930, P = 0.004). Login to comment
267 Conclusion In summary, for the first time we reported a significant association of the ABCA1 R219K and LIPC-250A polymorphisms with sporadic AD risk and cognitive and memorial scores in Southern Chinese Han population, but no pronounced effect in CETP TaqIB SNP. Login to comment
514 Ma XY, Liu JP, Song ZY: Associations of the ATP-binding cassette transporter A1 R219K polymorphism with HDL-C level and coronary artery disease risk: a meta-analysis. Login to comment
549 Zhao SP, Xiao ZJ, Li QZ, et al: Relationship between ATP-binding cassette transporter 1 R219K genetic variation and blood lipids. Login to comment
560 Huang Y, Wu Y, Liu R, et al: Differential effect of ATP binding cassette transporter A1 R219K and cholesteryl ester transfer protein TaqIB genotypes on HDL-C levels in overweight/obese and non-obese Chinese subjects. Login to comment
566 Li J, Wang LF, Li ZQ, et al: Effect of R219K polymorphism of the ABCA1 gene on the lipid-lowering effect of pravastatin in Chinese patients with coronary heart disease. Login to comment

[hide] Genetic determination of plasma cholesterol efflux... Arterioscler Thromb Vasc Biol. 2013 Apr;33(4):822-8. doi: 10.1161/ATVBAHA.112.300979. Epub 2013 Jan 31. Villard EF, EI Khoury P, Frisdal E, Bruckert E, Clement K, Bonnefont-Rousselot D, Bittar R, Le Goff W, Guerin M
Genetic determination of plasma cholesterol efflux capacity is gender-specific and independent of HDL-cholesterol levels.
Arterioscler Thromb Vasc Biol. 2013 Apr;33(4):822-8. doi: 10.1161/ATVBAHA.112.300979. Epub 2013 Jan 31., [PMID:23372063]

Abstract [show]
OBJECTIVE: We investigated the impact of several genetic variants located in genes encoding for proteins involved in biogenesis, maturation, and intravascular remodeling of high density lipoprotein (HDL) particles on plasma efflux capacity. APPROACH AND RESULTS: The capacity of whole-plasma to mediate cholesterol efflux from cholesterol-loaded human THP-1 macrophages was measured in 846 individuals (450 men and 396 women). We demonstrated that rs17231506 (CETP c.-1337 C>T), rs2230806 (ABCA1 p.R219K), rs1799837 (APOA1 c.-75 G>A), rs5086 (APOAII c.-265 T>C), and rs1800588 (LIPC c.-514 C>T) single nucleotide polymorphisms (SNPs) significantly modulate the capacity of whole-plasma to mediate cholesterol efflux from human macrophages in a sex-dependent manner. Such associations were independent of circulating plasma lipid levels (HDL-cholesterol, triglyceride, low density lipoprotein-cholesterol). In women, we identified the APOA1 c.-75 G>A and the LIPC c.-514 C>T variants as major contributors of interindividual variability of plasma efflux capacity, whereas the ABCA1 p.R219K and the APOAII c.-265 T>C SNPs mostly contribute to total variance of plasma efflux capacity in men. Multiple regression analyses revealed that the 7 SNPs tested accounted together for approximately 6% of total plasma efflux capacity. We demonstrated that genetically determined plasma efflux capacity represents a better predictor of macrophage cholesterol removal, as compared with plasma HDL-cholesterol levels. CONCLUSIONS: Genetic variants located within genes encoding proteins involved in HDL metabolism significantly impact plasma efflux capacity independently of variation in plasma HDL-cholesterol levels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 The rs2230806 (ABCA1 p.R219K) SNP has been reported to be associated with HDL-C and the severity of atherosclerosis.12 The K219 allele is associated with higher plasma HDL-C and small HDL particle levels, and is proposed to be an antiatherogenic allele.13 The functional rs5082 (APOAII c.-265 T>C) SNP has been shown to be associated with coronary artery disease risk.14 Moreover, the rs1378577 (ABCG1 c.-134 T>G) SNP has been shown to modulate transcriptional activity of the human ABCG1 gene and was reported to be associated with plasma HDL-C levels in some studies, but not in others.15 The rs708272 (CETP TaqIB) SNP identified in the first intron of the CETP gene is associated with plasma CETP concentration, Received on: October 8, 2012; final version accepted on: January 10, 2013. Login to comment
10 We demonstrated that rs17231506 (CETP c.- 1337 C>T), rs2230806 (ABCA1 p.R219K), rs1799837 (APOA1 c.-75 G>A), rs5086 (APOAII c.-265 T>C), and rs1800588 (LIPC c.-514 C>T) single nucleotide polymorphisms (SNPs) significantly modulate the capacity of whole-plasma to mediate cholesterol efflux from human macrophages in a sex-dependent manner. Login to comment
12 In women, we identified the APOA1 c.-75 G>A and the LIPC c.-514 C>T variants as major contributors of interindividual variability of plasma efflux capacity, whereas the ABCA1 p.R219K and the APOAII c.-265 T>C SNPs mostly contribute to total variance of plasma efflux capacity in men. Login to comment
44 Table 2.ߓ Impact of Genetic Variants on Overall Capacity of Plasma to Mediate Cholesterol Efflux From Human THP-1 Macrophages Additive Model Recessive or Dominant Model Model 1 Model 2 Model 1 Model 2 Mean Difference r2 P Valueߤ Mean Difference r2 P Valueߤ Mean Difference r2 P Valueߤ Mean Difference r2 P Valueߤ CETP TaqIB Women 1.2 ns 1.3 ns 0.7 ns 0.8 ns Men -0.9 ns -0.9 ns -2.9 ns -3.0 ns CETP c. -1337 C>T Women -0.9 ns -0.8 ns 0.8 ns 0.8 ns Men -2.6 ns -2.6 ns -8.9 1.01 0.03 -9.8 0.90 0.03 LIPC c. -514 C>T Women 4.0 1.50 0.02 4.1 1.47 0.03 9.9 2.08 0.004ߤ 10.4 2.06 0.003ߤ Men 0.8 ns 0.6 ns 3.4 ns 3.1 ns APOA1 c. -75 G>A Women 6.0 1.77 0.003ߤ 5.8 2.22 0.004ߤ 15.1 1.67 0.005ߤ 15.3 1.91 0.004ߤ Men -4.1 ns -4.0 ns -0.5 ns -0.8 ns ABCA1 p.R219K Women -0.9 ns -0.9 ns -2.5 ns -2.7 ns Men 4.3 1.22 0.002ߤ 4.5 1.18 0.002ߤ 13.2 2.39 0.001ߤ 13.6 2.38 0.001ߤ ABCG1 c. -134 T>G Women -2.6 ns -2.7 ns -6.0 ns -6.6 ns Men 2.2 ns 2.0 ns 3.4 ns 3.6 ns APOAII c. -265 T>C Women -0.4 ns -0.4 ns -0.1# ns -0.6# ns Men 4.8 1.41 0.01 4.6* 1.37 0.03 7.4# 1.93 0.005ߤ 7.4# 1.92 0.005ߤ For each SNP, 1 indicates the most frequent allele and 2 indicates the less frequent allele. Login to comment
82 Multiple linear regression analyses including rs708272 (CETP TaqIB), rs17231506 (CETP c. -1337 C>T), rs1800588 (LIPC c. -514 C>T), rs1799837 (APOAI c. -75 G>A), rs2230806 (ABCA1 p.R219K), rs1378577 (ABCG1 c. -134 T>G), and rs5082 (APOAII c. -265 T>C) SNPs as predictive variables were performed to explain variance of plasma efflux capacity in men (left) and women (right). Login to comment

[hide] Genetic variants from lipid-related pathways and r... PLoS One. 2013;8(3):e60454. doi: 10.1371/journal.pone.0060454. Epub 2013 Mar 29. Song C, Pedersen NL, Reynolds CA, Sabater-Lleal M, Kanoni S, Willenborg C, Syvanen AC, Watkins H, Hamsten A, Prince JA, Ingelsson E
Genetic variants from lipid-related pathways and risk for incident myocardial infarction.
PLoS One. 2013;8(3):e60454. doi: 10.1371/journal.pone.0060454. Epub 2013 Mar 29., [PMID:23555974]

Abstract [show]
BACKGROUND: Circulating lipids levels, as well as several familial lipid metabolism disorders, are strongly associated with initiation and progression of atherosclerosis and incidence of myocardial infarction (MI). OBJECTIVES: We hypothesized that genetic variants associated with circulating lipid levels would also be associated with MI incidence, and have tested this in three independent samples. SETTING AND SUBJECTS: Using age- and sex-adjusted additive genetic models, we analyzed 554 single nucleotide polymorphisms (SNPs) in 41 candidate gene regions proposed to be involved in lipid-related pathways potentially predisposing to incidence of MI in 2,602 participants of the Swedish Twin Register (STR; 57% women). All associations with nominal P<0.01 were further investigated in the Uppsala Longitudinal Study of Adult Men (ULSAM; N = 1,142). RESULTS: In the present study, we report associations of lipid-related SNPs with incident MI in two community-based longitudinal studies with in silico replication in a meta-analysis of genome-wide association studies. Overall, there were 9 SNPs in STR with nominal P-value <0.01 that were successfully genotyped in ULSAM. rs4149313 located in ABCA1 was associated with MI incidence in both longitudinal study samples with nominal significance (hazard ratio, 1.36 and 1.40; P-value, 0.004 and 0.015 in STR and ULSAM, respectively). In silico replication supported the association of rs4149313 with coronary artery disease in an independent meta-analysis including 173,975 individuals of European descent from the CARDIoGRAMplusC4D consortium (odds ratio, 1.03; P-value, 0.048). CONCLUSIONS: rs4149313 is one of the few amino acid changing variants in ABCA1 known to associate with reduced cholesterol efflux. Our results are suggestive of a weak association between this variant and the development of atherosclerosis and MI.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
225 Andrikovics H, Pongracz E, Kalina E, Szilvasi A, Aslanidis C, et al. (2006) Decreased frequencies of ABCA1 polymorphisms R219K and V771M in Hungarian patients with cerebrovascular and cardiovascular diseases. Login to comment

[hide] Gender specific association of ABCA1 gene R219K va... Anadolu Kardiyol Derg. 2014 Feb;14(1):18-25. doi: 10.5152/akd.2013.234. Epub 2013 Sep 26. Coban N, Onat A, Komurcu Bayrak E, Gulec C, Can G, Erginel Unaltuna N
Gender specific association of ABCA1 gene R219K variant in coronary disease risk through interactions with serum triglyceride elevation in Turkish adults.
Anadolu Kardiyol Derg. 2014 Feb;14(1):18-25. doi: 10.5152/akd.2013.234. Epub 2013 Sep 26., [PMID:24084154]

Abstract [show]
OBJECTIVE: ATP binding cassette transporter A1 (ABCA1) controls the reverse cholesterol transport. Some ABCA1 variants are correlated with serum high-density lipoprotein cholesterol (HDL-C) and other lipid concentrations. We aimed to explore the relationship of ABCA1 gene with both the lipid profile and coronary heart disease (CHD) risk. METHODS: Selected 627 individuals of the Turkish Adult Risk Factor Study were genotyped for ABCA1 R219K polymorphism using PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method. Student's t-test, one-way ANOVA, Chi-square test, linear and logistic regression was used for statistical analysis. RESULTS: We demonstrated a gender-specific effect of the R219K polymorphism on plasma lipids and CHD. In men, while homozygosity of the K allele was associated with increased plasma low-density lipoprotein cholesterol (LDL-C) (p<0.05) and total cholesterol concentrations (p<0.05), carriage of this allele was associated with higher HDL-C concentrations (p<0.05) after adjustment for associated risk factors, but not with CHD. In women, however, without being related to HDL-C levels, each 219K allele was associated with 10% higher triglycerides (TG) concentrations (p<0.05). R219K heterozygosity in women independently doubled (95% CI 1.00; 3.80) the odds ratio for CHD risk in regression models, after adjustment for several variables. Interaction of TG elevation (>140 mg/dL) with CHD was demonstrated in female 219RK genotype carriers. CONCLUSION: R219 allele of the ABCA1 gene independently confers CHD risk in heterozygote Turkish women, not via reduced HDL-C, but interacting with elevated TG expressed by the 219K allele, but not in men.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Gender specific association of ABCA1 gene R219K variant in coronary disease risk through interactions with serum triglyceride elevation in Turkish adults AddressforCorrespondence:Dr.NihanErginel-&#dc;naltuna,stanbul&#dc;niversitesiDeneyselTpAraf;trmaEnstit&#fc;s&#fc;,GenetikB&#f6;l&#fc;m&#fc;, VakfGurebaCad.e;ehremini,stanbul-T&#fc;rkiye Phone:+902124142200-33324 Fax:+902125324171 E-mail:nihanerginel@yahoo.com Accepted Date: 16.07.2013 Available Online Date: 26.09.2013 (c)Copyright 2014 by AVES - Available online at www.anakarder.com doi:10.5152/akd.2013.234 Neslihan &#c7;oban, Altan Onat1, Evrim K&#f6;m&#fc;rc&#fc;-Bayrak, &#c7;af;r G&#fc;le&#e7;, G&#fc;nay Can2, Nihan Erginel-&#dc;naltuna Department of Genetics, Institute for Experimental Medical Research, stanbul University; stanbul-Turkey Departments of 1Cardiology and 2Public Health, Cerrahpaf;a Medical Faculty, stanbul University; stanbul-Turkey ABSTRACT Objective: ATP binding cassette transporter A1 (ABCA1) controls the reverse cholesterol transport. Login to comment
3 Methods: Selected 627 individuals of the Turkish Adult Risk Factor Study were genotyped for ABCA1 R219K polymorphism using PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method. Login to comment
5 Results: We demonstrated a gender-specific effect of the R219K polymorphism on plasma lipids and CHD. Login to comment
8 R219K heterozygosity in women independently doubled (95% CI 1.00; 3.80) the odds ratio for CHD risk in regression models, after adjustment for several variables. Login to comment
18 The K allele of the R219K polymorphism (Arg219Lys, rs2230806) has been associated with decreased triglyceride (TG) concentrations (11, 13) and increased HDL-C concentrations (9, 11, 12), consistent with a net increase in transporter function; the rare allele of the R219K, on the other hand, was found to be associated with increased risk of CHD (14). Login to comment
19 Because findings on the relationship between ABCA1 R219K polymorphism and CHD have been inconclusive, a meta-analysis was recently conducted comprising over 9400 cases and over 16.000 controls (12, 15). Login to comment
21 Among other ABCA1 polymorphisms, R219K variant`s association with HDL-C was examined by Hodof;lugil et al. (10) on a large sample of Turkish adults, and an association was lacking in men. Login to comment
22 The KK genotype of R219K polymorphism alone showed no association with elevated HDL-C but an association was observed in combination with TT genotype of C-14T polymorphism. Login to comment
26 We, therefore, explored the role of ABCA1 gene in predisposing Turkish adults to CHD in a nested case-control study comprising 627 genotyped individuals for the R219K polymorphism. Login to comment
28 The specific aim of this study was to examine the relation of the R219K polymorphism with both the lipid concentrations and CHD in a randomly selected sample of the Turkish Adult Risk Factor Study (TARF) cohort, representative of Turkish adults (20). Login to comment
54 Genetics analysis The detection of R219K polymorphism using RFLP (restriction fragment length polymorphism) DNA was extracted from peripheral blood leukocytes using a QIAmpR DNA Maxi KIT (Qiagen, Hilden, Germany). Login to comment
55 A 243-bp fragment of exon 7 of the ABCA1 gene involving nucleotide 1051 of the DNA sequence was amplified by polymerase chain reac- tion (PCR), using the following primers: R219K Forward: 5`-tca taa tcc tct tct gct ag-3` and R219K Reverse: 5`-cag tta gca agt cta cgc a-3`. Login to comment
81 Allele and genotype distributions of ABCA1 R219K polymorphism The genotype frequencies of the ABCA1 R219K polymorphism, determined for 627 participants, disclosed the following distribution: 36.4% (n=228), 50.4% (n=316) and 13.2% (n=83) for the RR, RK and KK genotypes, respectively. Login to comment
83 Genotype distribution of the ABCA1 R219K polymorphism was in Hardy-Weinberg equilibrium for our study population. Login to comment
84 Association of the ABCA1 R219K variant with biochemical variables We examined the relationship between concentrations of biochemical variables and the R219K polymorphism of the ABCA1 gene in a total of 627 individuals (men=282, women=345). Login to comment
87 Determination of the R219K genotype by PCR amplification and restriction analysis. Login to comment
95 In relation to TG concentration, but not to LDL-C and total cholesterol, the ABCA1 R219K polymorphism had significant gender-by-genotype interaction (p=0.049). Login to comment
102 Associations of ABCA1 R219K polymorphism with CHD risk We investigated the distribution of the clinical and biochemical characteristics of genotypes of R219K polymorphism in the CHD and there were no significant associations (data not shown). Login to comment
103 The allele and genotype frequencies of R219K polymorphism were examined in 220 cases of CHD and 407 without CHD. Login to comment
106 Frequencies of ABCA1 R219K genotypes (RR, RK and KK) were 25.5% (n=27), 64.1% (n=68) and 10.4% (n=11) in women with CHD (p=0.012) and 40.4% (n=46), 44.7% (n=51) and 14.9% (n=17) in men with CHD (p=0.53), respectively. Login to comment
107 In relation to CHD, the ABCA1 R219K polymorphism had significant gender-by-genotype interaction (p=0.009). Login to comment
108 The R219K polymorphism was found to be associated with CHD only in women using the chi-square test. Login to comment
110 Further analyses adjusted by genetic models of R219K polymor- Variables Males (n) Females (n) **P Age, years 58.9&#b1;12.8 (282) 56.7&#b1;12.3 (345) 0.03 Body mass index, kg/m2 27.7&#b1;4.4 (213) 30.6&#b1;5.9 (361) <0.001 Waist circumference, cm 96.3&#b1;11.9 (267) 94&#b1;13.7 (330) 0.037 Total cholesterol, mg/dL 184&#b1;43.8 (272) 194.5&#b1;42.5 (335) 0.003 HDL-C, mg/dL 43.3&#b1;12.7 (272) 49.7&#b1;12 (337) <0.001 LDL-C, mg/dL 107.2&#b1;34.5 (259) 111.6&#b1;34.2 (307) 0.132 Fasting triglycerides, mg/dL* 136.1&#b1;1.75 (270) 135.8&#b1;1.71 (332) 0.966 Fasting glucose, mg/dL 109.6&#b1;44.4 (259) 105.2&#b1;40.8 (330) 0.218 Apolipoprotein A-I, mg/dL 133.8&#b1;24.1 (156) 145.4&#b1;27.4 (200) <0.001 Apolipoprotein B, mg/dL 97.1&#b1;27.5 (157) 101.7&#b1;26 (204) 0.105 Systolic blood pressure, mmHg 121.0&#b1;21.9 (267) 128.2&#b1;23.6 (332) 0.01 Diastolic blood pressure, mmHg 76.6&#b1;11.7 (267) 78.8&#b1;11.9 (332) 0.026 Diabetes mellitus, %(n) 19.9 (56) 17.7 (61) 0.486 Obesity, %(n) 27.2 (58) 52.1 (136) <0.001 Coronary heart disease, %(n) 40.4 (114) 30.7 (106) 0.011 Cigarette smoking, %(n) 28.9 (77) 14.2 (47) <0.001 Alcohol usage, %(n) 10.2 (27) 1.2 (4) <0.001 Lipid-lowering medication, %(n) 9.9 (28) 10.7 (37) 0.745 Antihypertensive medication, %(n) 30.1 (85) 38.3 (132) 0.034 Medication for diabetes, %(n) 13.1 (37) 12.8 (44) 0.892 Continuous variables are presented as mean&#b1;SD and dichotomous variables as percentages. Login to comment
114 In logistic regression analysis, after adjusting for age, current smoking, alcohol usage, waist circumference, TG, systolic blood pressure and diabetes, the overdominant genetic model (RK genotype vs the RR+KK genotypes) of R219K polymorphism showed significantly higher odd ratios for CHD in women [OR 1.95 (95%CI 1.003.80, p=0.059)] (Table 4, model 1). Login to comment
117 The analysis after adjustment for the same covariates by a recessive genetic model for R219K polymorphism showed no association with CHD in women (OR=0.57, 95%CI; 0.21-1.55, p= 0.27). Login to comment
118 Discussion The ABCA1 gene R219K polymorphism, shown to be related to serum lipids, displayed a sex interaction in a nested case-control sample of Turkish adults with respect to both lipid levels and the CHD risk. Login to comment
121 Female R219K heterozygosity constituted a significant independent factor doubling the CHD risk which could be demonstrated to an interaction of the R219 allele with triglyceride elevation induced by the 219K allele. Login to comment
123 Among other ABCA1 polymorphisms, R219K variant`s association with HDL-C was examined by Hodoglugil at el. (10) on a large sample of Turkish adults, and an association was lacking in men (as well as in women in whom this was confirmed herein). Login to comment
126 p values obtained by ANCOVA for comparisons p* among R219K genotypes, p** RR genotype versus K allele carriers (RK+KK genotypes). Login to comment
127 In relation to TG (not to LDL-C and total cholesterol) concentrations; the ABCA1 R219K polymorphism had gender-by-genotype interaction (p=0.049). Login to comment
135 Interaction between ABCA1 R219K, elevated TG and sex The finding of 219K allele carriage being independently associated with higher TG concentration in women can be accounted for by serum TG being strong independent covariate of total phospholipids (30) and the knowledge that dietary long-chain polyunsaturated fatty acids arachidonic acid and docosahexaenoic acid contribute to plasma phospholipids more in women than men, and mainly in populations with low dietary n-3 fatty acid intake (30, 31) to which Turks belong. Login to comment
142 On the other hand, Villard et al. (35) reported that R219K polymorphism significantly modulates the capacity of whole-plasma to mediate cholesterol efflux from human macrophages in a sex-dependent manner. Login to comment
143 Furthermore, Villard et al. (35) demonstrated impact of the R219K on plasma total cholesterol, LDL-C and Apo A-I concentrations but not HDL-C and TG concentrations in men or women subjects. Login to comment
146 A recent meta-analysis demonstrated ethnic differences in the protective and risk conferring alleles of the ABCA1 R219K polymorphism for CHD (12). Login to comment
151 In relation to CHD, the ABCA1 R219K polymorphism had significant gender-by-genotype interaction (p=0.009). Login to comment
155 Multiple logistic regression analysis for the adjusted association of ABCA1 R219K variant with CHD in men and women According to a proposed a novel hypothesis on systemic inflammation, oxidized phospholipids and fatty acids metabolized from arachidonic acid affect endothelial and small intestinal cells to induce cytokines that influence macrophages or hepatocytes (37). Login to comment
158 Thus, inflammation and oxidized phospholipids are closely linked to ABCA1 R219K polymorphism, gender and CHD risk. Login to comment
160 Focusing on the effect of ABCA1 R219K polymorphism, without assessing the combined effect of other interacting genetic factors on analyses might limit the interpretation of our study. Login to comment
167 Genotyping for the ABCA1 R219K polymorphism might yield practical benefit in prevention. Login to comment
168 Conclusion In conclusion, R219K polymorphism as a common ABCA1 variant influences lipid concentrations and the CHD risk gender-specifically among Turkish adults. Login to comment

[hide] ATP-binding cassette transporter A1 R219K polymorp... J Neurol Sci. 2014 Jan 15;336(1-2):57-61. doi: 10.1016/j.jns.2013.10.006. Epub 2013 Oct 12. Hou R, Zhu X, Pan X, Guo R, Ma T, Xu X
ATP-binding cassette transporter A1 R219K polymorphism and ischemic stroke risk in the Chinese population: a meta-analysis.
J Neurol Sci. 2014 Jan 15;336(1-2):57-61. doi: 10.1016/j.jns.2013.10.006. Epub 2013 Oct 12., [PMID:24157307]

Abstract [show]
Recently, many studies have been focused on the association between the ATP-binding cassette transporter A1 (ABCA1) gene R219K polymorphism and ischemic stroke (IS). However, the study results have been inconsistent, especially in the Chinese population. Therefore, we performed a meta-analysis to better clarify the association between the ABCA1 gene and IS. All of the relevant studies used in our meta-analysis were identified using PubMed, OVID, Cochrane Library, Chinese Wan Fang database, Chinese VIP database, China National Knowledge Infrastructure (CNKI), and China Biological Medicine Database (CBM) up to May 2013. Statistical analysis was conducted with STATA software version 11.0. Odds ratios with 95% confidence intervals were applied to evaluate the strength of the association between ABCA1 gene R219K polymorphism and IS. Heterogeneity was evaluated using the Q-test and I(2) statistic. The funnel plots, Begg's and Egger's regression tests were used to assess the publication bias. Our meta-analysis showed the dominant genetic model (OR=0.92, 95% CI: 0.88-0.96), the recessive genetic model (OR=0.73, 95% CI: 0.51-1.05), the homozygote genetic model (OR=0.64, 95% CI: 0.44-0.94), the heterozygote genetic model (OR=0.81, 95% CI: 0.69-0.95), and the allelic genetic model (OR=0.83, 95% CI: 0.69-0.99). For R219K in IS, there were significant associations with these genetic models, but not with the recessive genetic model. Our meta-analysis indicated that the ABCA1 gene R219K polymorphism might be associated with IS and the K allele might be a protective factor in the Chinese population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 ATP-binding cassette transporter A1 R219K polymorphism and ischemic stroke risk in the Chinese population: A meta-analysis Rongyao Hou a,1,2 , Xiaoyan Zhu b,1,2 , Xudong Pan c, Ìe;,2 , Ruiyou Guo a , Teng Ma a , Xiang Xu c a Department of Neurology, The Affiliated Hiser Hospital of Qingdao University, Qingdao, China b Department of Critical Care Medicine, The Affiliated Hiser Hospital of Qingdao University, Qingdao, China c Department of Neurology, The Affiliated Hospital of Qingdao University, Qingdao, China a b s t r a c t a r t i c l e i n f o Article history: Received 16 July 2013 Received in revised form 13 September 2013 Accepted 3 October 2013 Available online 12 October 2013 Keywords: ATP-binding cassette transporter A1 (ABCA1) Gene polymorphism The Chinese population Ischemic stroke Meta analysis R219K Recently, many studies have been focused on the association between the ATP-binding cassette transporter A1 (ABCA1) gene R219K polymorphism and ischemic stroke (IS). Login to comment
4 Odds ratios with 95% confidence intervals were applied to evaluate the strength of the association between ABCA1 gene R219K polymorphism and IS. Login to comment
7 For R219K in IS, there were significant associations with these genetic models, but not with the recessive genetic model. Login to comment
8 Our meta-analysis indicated that the ABCA1 gene R219K polymorphism might be associated with IS and the K allele might be a protective factor in the Chinese population. Login to comment
30 R219K is a common variation in the ABCA1 gene-coding region. Login to comment
38 One study found that the ABCA1 R219K polymorphism cloud modulate the association between HDL-C and age in whites [17]. Login to comment
39 Another study also found that the ABCA1 R219K polymorphism was associated with a higher HDL-C level in Caucasians and Asians [14]. Login to comment
40 Domestically, results of the widely researched studies of ABCA1 R219K gene polymorphism and IS are still debatable. Login to comment
43 To illustrate inconsistencies, we collected the data from the relevant published literature to quantify the ABCA1 R219K polymorphism effect on the risk of IS in the Chinese population. Login to comment
47 The following medical subject heading (MeSH) terms were used: "cerebrovascular accident," "cerebrovascular disease," "stroke," "cerebral infarct," "polymorphism,""ABCA1,""R219K"and "the Chinese population". Login to comment
50 Selection criteria The included studies were all selected according to the following criteria: (1) studies that related the R219K polymorphism to susceptibility to IS; (2) studies restricted to the Chinese population; (3) a clear diagnosis for IS; (4) applied case-control studies and (5) full-text articles. Login to comment
77 Meta-regression testing can explain Records identified through database searching (n = 38) Articles excluded: Obvious irrelevance (n = 12) Articles screened ( n = 26) Articles excluded: Without Chinese population included (n = 3) Without SNP R219K (n = 6) No case-control studies (n = 2) Duplicated publications (n = 2) No genotype frequency (n = 1) Other not according with standards of research (n = 3) Full-text articles assessed for eligibility (n = 9) No full-text articles excluded Studies included in the meta-analysis (n=9) Fig. 1. Login to comment
90 Discussion The association remains controversial between the R219K polymorphism of ABCA1 and IS in many studies, especially in the Chinese population. Therefore, this meta-analysis was very necessary to evaluate the association. Login to comment
94 It showed that the dominant genetic model (OR = 0.92, 95% CI: 0.88-0.96, P = 0.000), the homozygote genetic model (OR = 0.64, 95% CI: 0.44-0.94, P = 0.02), the heterozygote genetic model (OR = 0.81, 95% CI: 0.69-0.95, P = 0.009) and the allelic genetic model (OR = 0.83,95% CI:0.69-0.99, P = 0.036) indicated a significant association between R219K polymorphism and IS. Login to comment
102 Results of the current meta-analysis indicated the R219K polymorphism of ABCA1 gene might be associated with IS and that the K allele might be a protective factor for IS in the Chinese populations. Login to comment
107 Studies on the polymorphism of R219K have focused on the association between AS and lipid metabolism. Login to comment
108 Many of those studies focused on the association about R219K gene polymorphism in AS, coronary heart disease (CHD) and IS [14,15,24]. Login to comment
109 The R219K gene polymorphism correlated with increasing HDL-C, alleviating atherosclerosis and decreasing CHD risk, and described the protective effect against AS and CHD [31,32]. Login to comment
111 Other studies also showed that R219K polymorphism of the ABCA1 gene had a protective effect against IS [18,24]. Login to comment
115 Another study didn't support the ABCA1 R219K polymorphism played a major role among the risk factors of IS [35]. Login to comment
117 In our meta-analysis, the ABCA1 R219K polymorphism might be associated with IS and the K allele maybe a protective factor against IS in the Chinese population. Login to comment
119 Table 2 Summary of meta-analysis of association of ABCA1 R219K polymorphism and IS risk. Login to comment
131 [25] 2012 Ningxia Chinese (Hui) Age, sex, ethnicity PCR-RFLP 105/257 30 63 12 63 125 69 0.669 The reasons for the ABCA1 R219K polymorphism reducing the risk of IS might be the reduction in the incidence of AS. Login to comment
133 The studies of R219K gene polymorphism associated with CHD also found that the R219K polymorphism and CHD were closely related, and that the K allele might be a genetic protective factor [31,32]. Login to comment
134 The R219K polymorphism was significantly associated with HDL-C metabolism and CHD risk [36]. Login to comment
136 R219K polymorphism of the ABCA1 gene is associated with susceptibility to IS. Login to comment
137 The above literature was not consistent regarding the risk of the ABCA1 gene R219K polymorphism in the development of IS. Login to comment
154 In conclusion, our meta-analysis indicated that the ABCA1 gene R219K polymorphism might be associated with IS and that the K allele might be a protective factor for IS in the Chinese population. Login to comment
156 In the future, more well-designed research is needed to evaluate the association between the ABCA1 R219K polymorphism and IS. Login to comment

[hide] Influence of ATP-binding cassette transporter 1 R2... PLoS One. 2014 Jan 23;9(1):e86480. doi: 10.1371/journal.pone.0086480. eCollection 2014. Yin YW, Li JC, Gao D, Chen YX, Li BH, Wang JZ, Liu Y, Liao SQ, Zhang MJ, Gao CY, Zhang LL
Influence of ATP-binding cassette transporter 1 R219K and M883I polymorphisms on development of atherosclerosis: a meta-analysis of 58 studies.
PLoS One. 2014 Jan 23;9(1):e86480. doi: 10.1371/journal.pone.0086480. eCollection 2014., [PMID:24466114]

Abstract [show]
BACKGROUND: Numerous epidemiological studies have evaluated the associations between ATP-binding cassette transporter 1 (ABCA1) R219K (rs2230806) and M883I (rs4149313) polymorphisms and atherosclerosis (AS), but results remain controversial. The purpose of the present study is to investigate whether these two polymorphisms facilitate the susceptibility to AS using a meta-analysis. METHODS: PubMed, Embase, Web of Science, Medline, Cochrane database, Clinicaltrials.gov, Current Controlled Trials, Chinese Clinical Trial Registry, CBMdisc, CNKI, Google Scholar and Baidu Library were searched to get the genetic association studies. All statistical analyses were done with Stata 11.0. RESULTS: Forty-seven articles involving 58 studies were included in the final meta-analysis. For the ABCA1 R219K polymorphism, 42 studies involving 12,551 AS cases and 19,548 controls were combined showing significant association between this variant and AS risk (for K allele vs. R allele: OR = 0.77, 95% CI = 0.71-0.84, P<0.01; for K/K vs. R/R: OR = 0.60, 95% CI = 0.51-0.71, P<0.01; for K/K vs. R/K+R/R: OR = 0.69, 95% CI = 0.60-0.80, P<0.01; for K/K+R/K vs. R/R: OR = 0.74, 95% CI = 0.66-0.83, P<0.01). For the ABCA1 M883I polymorphism, 16 studies involving 4,224 AS cases and 3,462 controls were combined. There was also significant association between the variant and AS risk (for I allele vs. M allele: OR = 0.85, 95% CI = 0.77-0.95, P<0.01). CONCLUSIONS: The present meta-analysis suggested that the ABCA1 R219K and M883I polymorphisms were associated with the susceptibility to AS. However, due to the high heterogeneity in the meta-analysis, the results should be interpreted with caution.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 , Dong Gao1 , Yan-Xiu Chen2 , Bing-Hu Li1 , Jing-Zhou Wang1 , Yun Liu1 , Shao-Qiong Liao1 , Ming-Jie Zhang1 , Chang-Yue Gao1 , Li-Li Zhang1 * 1 Department of Neurology, Institute of Surgery Research, Daping Hospital, Third Military Medical University, Yuzhong District, Chongqing, PR China, 2 Department of Neurology, The brain hospital of Liaocheng Hospital, Liaocheng, Shandong, PR China Abstract Background: Numerous epidemiological studies have evaluated the associations between ATP-binding cassette transporter 1 (ABCA1) R219K (rs2230806) and M883I (rs4149313) polymorphisms and atherosclerosis (AS), but results remain controversial. Login to comment
6 For the ABCA1 R219K polymorphism, 42 studies involving 12,551 AS cases and 19,548 controls were combined showing significant association between this variant and AS risk (for K allele vs. R allele: OR = 0.77, 95% CI = 0.71-0.84, P,0.01; for K/K vs. R/R: OR = 0.60, 95% CI = 0.51-0.71, P,0.01; for K/K vs. R/K+R/R: OR = 0.69, 95% CI = 0.60-0.80, P,0.01; for K/K+R/K vs. R/R: OR = 0.74, 95% CI = 0.66-0.83, P,0.01). Login to comment
9 Conclusions: The present meta-analysis suggested that the ABCA1 R219K and M883I polymorphisms were associated with the susceptibility to AS. Login to comment
11 Citation: Yin Y-W, Li J-C, Gao D, Chen Y-X, Li B-H, et al. (2014) Influence of ATP-Binding Cassette Transporter 1 R219K and M883I Polymorphisms on Development of Atherosclerosis: A Meta-Analysis of 58 Studies. Login to comment
28 Recently, a number of molecular epidemiological studies have been done to evaluate the associations between the ABCA1 gene polymorphisms (such as R219K, M883I, C69T, V825I, R1587K, V771M and 2565C/T) and the risk of atherosclerotic diseases [248]. Login to comment
30 In 2011, Ma et al. performed a meta-analysis to evaluate the association between the ABCA1 R219K polymorphism and coronary artery disease (CAD), and demonstrated that the ABCA1 R219K polymorphism was a protective role for CAD both in Asians and Caucasians [53]. Login to comment
32 However, they just found the ABCA1 R219K polymorphism was a protective factor in Asians, but not in Caucasians. Login to comment
33 Considering the above two meta-analyses only focused on the association of ABCA1 R219K polymorphism with the single atherosclerotic disease, we therefore performed this meta-analysis of all the studies available now to derive a more precise estimation of the associations between the ABCA1 R219K and M883I polymorphisms and overall AS risk. Login to comment
41 Inclusion and Exclusion Criteria To be included in the present meta-analysis, the studies had to comply with the following major criteria: (1) case-control or cohort studies evaluating the associations between the ABCA1 R219K and M883I polymorphisms and AS risk; (2) published studies with full text articles; (3) Diagnosises of atherosclerotic diseases were made according to the internationally recognized diagnostic criterion. Login to comment
54 The strength of associations between the ABCA1 R219K and M883I polymorphisms and AS risk were assessed by ORs with 95% CIs. Login to comment
55 The pooled ORs were performed for allelic model (K allele vs. R allele for R219K; I allele vs. M allele for M883I), additive model (K/K vs. R/R for R219K; I/I vs. M/M for M883I), recessive model (K/K vs. R/K+R/R for R219K; I/I vs. M/I+M/M for M883I), and dominant model (K/K+R/K vs. R/R for R219K; I/I+M/I vs. M/M for M883I). Login to comment
66 After careful review, 47 articles involving 58 studies (42 studies for R219K polymorphism and 16 studies for M883I polymorphism) met the inclusion criteria and were selected in this meta-analysis [2-48]. Login to comment
67 For the ABCA1 R219K polymorphism, 12551 AS cases and 19548 controls were included to assess the association between the variant and AS risk [2-41]. Login to comment
76 Quantitative Synthesis For the ABCA1 R219K polymorphism, 42 studies were combined. Login to comment
77 The overall results showed evidence of significant association between the ABCA1 R219K polymorphism and the susceptibility to AS, suggesting that the ABCA1 R219K polymorphism was a protective role for AS (for K allele vs. R allele: OR = 0.77, 95% CI = 0.71-0.84, P,0.01; for K/K vs. R/R: OR = 0.60, 95% CI = 0.51-0.71, P,0.01; for K/K vs. R/K+R/ R: OR = 0.69, 95% CI = 0.60-0.80, P,0.01; for K/K+R/K vs. R/R: OR = 0.74, 95% CI = 0.66-0.83, P,0.01). Login to comment
88 Overall, the corresponding pooled ORs were not materially altered, either for the ABCA1 R219K polymorphism or for M883I polymorphism. Login to comment
91 Heterogeneity Analysis For the ABCA1 R219K polymorphism, significant heterogeneity existed in the overall comparisons (for allelic model: PQ,0.01, I2 = 77.4%; for additive model: PQ,0.01, I2 = 67.9%; for recessive model: PQ,0.01, I2 = 64.2%; for dominant model: PQ,0.01, I2 = 69.7%). Login to comment
95 For the ABCA1 R219K polymorphism, heterogeneity can be explained by the subtype of atherosclerotic diseases (allelic model: PT2 = 0.013, additive model: PT2 = 0.034, and recessive model: PT2 = 0.017) and study type (dominant model: PT4 = 0.037). Login to comment
101 For the ABCA1 R219K polymorphism, visual inspection of the funnel plot (Fig. 4: K allele vs. R allele) displays asymmetrical distribution of OR estimations, suggesting significant publication bias. Login to comment
105 In addition to the above analyses, we also calculated the Nfs (for the ABCA1 R219K polymorphism, Nfs = 133 for allelic model, Nfs = 146 for additive model, Nfs = 75 for recessive model, and Nfs = 49 for dominant model; for the ABCA1 M883I polymorphism, Nfs = 50 for allelic model), which reflected the minimum number of non-significant studies that would lead to the P-value to non-significant (P.0.05). Login to comment
106 Discussion To the best of our knowledge, this is the first comprehensive meta-analysis to date investigating the associations between the ABCA1 R219K and M883I polymorphisms and AS risk. Login to comment
107 Forty-two studies investigating the association between the ABCA1 R219K polymorphism and AS risk were combined [241], and 16 studies investigating the association between the ABCA1 M883I polymorphism and AS risk were combined Figure 1. Login to comment
111 Study Source of Sample size HWE Position First author Year Country Ethnicity type Disease controls (case/ control) Genotypes distribution (case/control) Y/N(P) Score R219K R/R R/K K/K R K Clee 2001 Canada Caucasians CS CAD HB 432/358 248/176 170/160 14/22 666/512 198/204 Y(0.067) 6 Brousseau 2001 USA Caucasians CCS CAD PB 1014/1013 454/543 484/402 76/68 1392/1488 636/538 Y(0.580) 7 Cenarro 2003 Spain Caucasians CCS CAD HB 216/158 123/72 78/71 15/15 324/215 108/101 Y(0.676) 6 Evans 2003 Germany Caucasians CCS CAD HB 114/629 72/337 35/245 7/47 179/919 49/339 Y(0.789) 7 Harada 2003 Japan Asian CCS CAD HB 273/137 73/31 139/73 61/33 285/135 261/139 Y(0.440) 6 Wang 2004 China Asian CCS CAD PB 222/278 79/76 94/125 49/77 252/277 192/279 Y(0.093) 7 Zhao 2004 China Asian CCS CAD PB 236/251 96/80 111/123 29/48 303/283 169/219 Y(0.953) 8 Wang-a 2004 China Asian CCS IS PB 58/60 23/21 27/34 8/5 73/76 43/44 Y(0.088) 7 Wang-b 2004 China Asian CCS IS PB 58/60 19/14 35/36 4/10 73/64 43/56 Y(0.112) 7 Xiao 2004 China Asian CCS IS PB 379/351 149/112 172/172 58/67 470/396 288/306 Y(0.947) 8 Woll 2005 USA Caucasians CCS CAD PB 838/257 450/115 327/112 61/30 1227/342 449/172 Y(0.732) 6 Cui 2005 China Asian CCS IS PB 96/90 15/21 35/45 46/24 65/87 127/93 Y(0.992) 7 Whiting 2005 USA Mixed CS CAD HB 2468/834 1298/449 975/318 195/67 3571/1216 1365/452 Y(0.313) 6 Sun 2005 China Asian CCS CAD PB 224/248 105/62 85/129 34/57 295/253 153/243 Y(0.521) 8 Li 2005 China Asian CCS CAD PB 264/278 104/83 116/132 44/63 324/298 204/258 Y(0.449) 7 Chang 2005 China Asian CCS CAD PB 178/83 66/17 75/22 37/44 207/56 149/110 N(0.000) 7 Wang 2006 China Asian CCS CAD PB 396/417 158/124 174/198 64/95 490/446 302/388 Y(0.350) Wang 2006 China Asian CCS CAD HB 150/139 61/47 69/53 20/39 191/147 109/131 N(0.006) 6 Wang 2006 China Asian CCS CAD PB 234/198 108/67 105/101 21/30 321/235 147/161 Y(0.422) 8 Cha 2006 China Asian CCS CAD PB 112/108 47/34 53/52 12/22 147/120 77/96 Y(0.795) 7 Wu 2006 China Asian CCS CAD PB 67/20 26/2 30/7 11/11 82/11 52/29 Y(0.585) 6 Mart &#b4;n 2006 Spain Caucasians CS MI HB 100/100 48/49 42/40 10/11 138/138 62/62 Y(0.516) 6 Andrikovics -a 2006 Hungary Caucasians CCS IS PB 244/193 131/97 84/73 29/23 346/267 142/119 Y(0.116) 7 Andrikovics -b 2006 Hungary Caucasians CCS CAD PB 150/193 84/97 55/73 11/23 223/267 77/119 Y(0.116) 7 Yu 2008 China Asian CCS MI PB 49/72 29/24 18/35 2/13 76/83 22/61 Y(0.969) 7 Zhang 2008 China Asian CCS IS PB 177/234 43/40 87/129 47/65 173/209 181/259 Y(0.078) 7 Wang 2008 China Asian CCS CAD HB 111/75 30/17 54/41 27/17 114/75 108/75 Y(0.419) 6 Zhang 2008 China Asian CCS MI PB 162/186 71/49 65/93 26/44 207/191 117/181 Y(0.992) 8 Balcerzyk 2008 Poland Caucasians CCS CAD PB 178/180 90/91 68/78 20/11 248/260 108/100 Y(0.283) 6 Frikke-Schmidt 2008 Denmark Caucasians CS CAD PB 1107/7858 603/4260 429/3032 75/566 1635/ 11552 579/4164 Y(0.405) 7 Porchay-Balde &#b4;relli 2009 France Caucasians CS CAD HB 223/2906 106/1491 102/1183 15/232 314/4165 132/1647 Y(0.901) 6 Li 2009 China Asian CCS CAD PB 365/246 140/92 170/116 55/38 450/300 280/192 Y(0.886) 8 Shi 2009 China Asian CCS CAD HB 132/157 49/53 60/66 23/38 158/172 106/142 Y(0.058) 7 Doosti 2009 Iran Asian CCS CAD HB 207/94 71/17 77/38 59/39 219/72 195/116 Y(0.161) 6 Guo 2010 China Asian CCS CAD PB 71/83 30/29 37/38 4/16 97/96 45/70 Y(0.576) 7 Xu 2011 China Asian CCS CAD PB 246/109 95/31 128/53 23/25 318/115 174/103 Y(0.798) 8 Yuan 2011 China Asian CCS CAD PB 60/55 22/16 28/21 10/18 72/53 48/57 Y(0.081) 7 Yi 2011 China Asian CCS IS PB 240/240 36/45 97/109 107/86 169/199 311/281 Y(0.319) 7 Xue 2012 China Asian CCS CAA, IS PB 182/229 70/62 91/118 21/49 231/242 133/216 Y(0.608) 8 Wang 2012 China Asian CCS CAD PB 141/109 63/31 63/53 15/25 189/115 93/103 Y(0.798) 7 Li 2012 China Asian CCS MI PB 150/100 52/30 74/48 24/22 178/108 122/92 Y(0.735) 7 Xia 2012 China Asian CCS CAD HB 227/162 96/51 107/78 24/33 299/180 155/144 Y(0.750) 6 [14,15,22,23,29,30,42-48]. Login to comment
112 According to the GRADE approach, the quality of the evidence was very low in the ABCA1 R219K polymorphism. Login to comment
114 The overall findings showed that the ABCA1 R219K and M883I polymorphisms may exert an reduced risk effect on AS. Login to comment
115 For the ABCA1 R219K polymorphism, the risk of developing AS in R allele carriers was 1.30-fold higher than those without R allele. Login to comment
118 Therefore, it is reasonable to assume that the ABCA1 R219K K allele and M883I I allele are the protective factors for the development of AS. Login to comment
120 For the ABCA1 R219K polymorphism, significant associations were found between this variant and the susceptibility to AS in the Asians group, CAD group, population-based group, hospital-based group and the subgroup of case-control study, respectively. Login to comment
121 These results further strengthened the conclusion that the ABCA1 R219K K allele was a protective factor for AS. Login to comment
137 For Caucasians, we did not find significant association between the ABCA1 R219K and M883I polymorphisms and AS risk. Login to comment
138 In fact, the minor allele frequencies (MAF) of ABCA1 R219K and M883I are low among utah residents with Northern and Western European ancestry (CEU) (MAF = 0.210 and 0.133 in HapMap CEU) [64]. Login to comment
139 However, the ABCA1 R219K and M883I polymorphisms are common among Han Chinese in Beijing, China (CHB) and Japanese in Tokyo, Japan (JPT) (MAF = 0.453/0.434 and 0.255/0.438, respectively) [64]. Login to comment
145 As for the ABCA1 R219K polymorphism, the corresponding pooled ORs were not materially altered in all comparisons. Login to comment
147 Meta-analyses of ABCA1 R219K and M883I polymorphisms and risk of AS in each subgroup. Login to comment
148 Allelic model Additive model Recessive model Dominant model Position SS (case/control) OR (95% CI) P value OR (95% CI) P value OR (95% CI) P value OR (95%CI) P value Overall analysis R219K 12551/19548 0.77[0.71,0.84] ,0.01 0.60[0.51,0.71] ,0.01 0.69[0.60,0.80] ,0.01 0.74[0.66,0.83] ,0.01 M883I 4224/13462 0.85[0.77,0.95] ,0.01 0.79 [0.61,1.01] 0.06 0.92[0.74,1.13] 0.42 0.86[0.72,1.02] 0.08 Subgroup analysis based on ethnicity R219K (C) 4616/13845 0.91[0.80,1.04] 0.16 0.83[0.65,1.06] 0.14 0.87[0.72,1.05] 0.14 0.90[0.76,1.07] 0.23 R219K (A) 7935/5703 0.71[0.64,0.79] ,0.01 0.52[0.42,0.63] ,0.01 0.62[0.52,0.75] ,0.01 0.66[0.59,0.74] ,0.01 M883I (C) 2067/11556 0.94[0.78,1.12] 0.48 1.24[0.67,2.29] 0.50 1.29[0.70,2.38] 0.41 1.05[0.86,1.28] 0.66 M883I (A) 2157/1906 0.82[0.72,0.93] ,0.01 0.72[0.54,0.95] 0.02 0.88[0.70,1.09] 0.25 0.75[0.61,0.91] ,0.01 Subgroup analysis based on type of diseases R219K (CAD) 11117/18091 0.74[0.67,0.82] ,0.01 0.56[0.47,0.67] ,0.01 0.64[0.55,0.74] ,0.01 0.72[0.64,0.82] ,0.01 R219K (IS) 1434/1457 0.94[0.75,1.17] 0.58 0.86[0.55,1.35] 0.51 1.00[0.69,1.45] 1.00 0.82[0.65,1.02] 0.08 M883I (CAD) 3890/13257 0.82[0.74,0.90] ,0.01 0.73[0.57,0.94] 0.01 0.88[0.71,1.09] 0.24 0.81[0.68,0.97] 0.02 M883I (IS) 334/205 1.43[1.02,2.02] 0.04 2.79[0.95,8.21] 0.06 2.51[0.86,7.29] 0.09 1.40[0.94,2.07] 0.10 Subgroup analysis based on source of controls R219K (PB) 7898/13799 0.76[0.67,0.85] ,0.01 0.58[0.47,0.72] ,0.01 0.68[0.56,0.82] ,0.01 0.72[0.62,0.83] ,0.01 R219K (HB) 4653/5749 0.81[0.71,0.92] ,0.01 0.65[0.51,0.82] ,0.01 0.72[0.59,0.87] ,0.01 0.80[0.68,0.94] ,0.01 M883I (PB) 3612/10285 0.87[0.78,0.97] 0.01 0.77[0.58,1.04] 0.09 0.91[0.73,1.13] 0.39 0.86[0.72,1.04] 0.11 M883I (HB) 612/3177 0.75[0.52,1.08]a 0.13 0.93[0.45,1.90] 0.84 1.02[0.50,2.09] 0.95 0.88[0.51,1.55] 0.67 Subgroup analysis based on study type R219K (CS) 4330/12056 0.97[0.88,1.07] 0.55 0.91[0.75,1.10] 0.32 0.91[0.76,1.07] 0.25 0.99[0.87,1.12] 0.84 R219K (CCS) 8221/7492 0.74[0.67,0.82] ,0.01 0.57[0.47,0.68] ,0.01 0.67[0.57,0.78] ,0.01 0.70[0.62,0.79] ,0.01 M883I (CS) 1673/11346 0.87[0.71,1.08] 0.21 1.05[0.54,2.04] 0.89 1.10[0.56,2.14] 0.78 1.04[0.80,1.36] 0.77 M883I (CCS) 2551/2116 0.85[0.75,0.97] 0.01 0.75[0.56,1.02] 0.06 0.90[0.72,1.12] 0.34 0.79[0.65,0.95] 0.01 Sensitivity analysis R219K (BS) 7061/14128 0.76[0.68,0.85] ,0.01 0.60[0.49,0.73] ,0.01 0.69[0.58,0.82] ,0.01 0.72[0.62,0.83] ,0.01 R219K (BH) 12223/19326 0.79[0.72,0.86] ,0.01 0.62[0.53,0.74] ,0.01 0.73[0.64,0.83] ,0.01 0.75[0.67,0.84] ,0.01 R219K (BT) 11647/18669 0.78[0.71,0.85] ,0.01 0.60[0.51,0.71] ,0.01 0.70[0.61,0.80] ,0.01 0.74[0.66,0.83] ,0.01 M883I (BS) 3255/10125 0.87[0.77,0.99] 0.03 0.77[0.54,1.10] 0.16 0.90[0.71,1.16] 0.42 0.87[0.71,1.05] 0.15 M883I (BH) 3571/13041 0.88[0.79,0.98] 0.02 0.80[0.58,1.10] 0.17 0.92[0.73,1.15] 0.44 0.84[0.71,0.98] 0.03 M883I (BT) 3870/13084 0.84[0.76,0.92] ,0.01 0.75[0.58,0.95] 0.02 0.89[0.72,1.10] 0.29 0.85[0.71,1.01] 0.07 A: Asians, C: Caucasians, PB: population-based, HB: hospital-based. Login to comment
156 Significant heterogeneity existed in the present meta-analysis, either for the ABCA1 R219K polymorphism or for the ABCA1 M883I polymorphism. Login to comment
158 For the ABCA1 R219K polymorphism, the heterogeneity can be explained by the subtype of atherosclerotic diseases (CAD and IS) and study type (case-control and cohort study). Login to comment
168 Forest plot for ABCA1 R219K polymorphism and AS risk in the allelic model (K allele vs. R allele). Login to comment
172 Funnel plots for ABCA1 R219K and M883I polymorphisms and AS risk. Login to comment
173 K allele vs. R allele for ABCA1 R219K polymorphism. Login to comment
179 In conclusion, the present meta-analysis suggested that the ABCA1 R219K and M883I polymorphisms were associated with the susceptibility to AS, especially in Asians. Login to comment
182 Supporting Information Figure S1 Forest plot for ABCA1 R219K polymorphism and AS risk in the additive model (K/K vs. R/R). Login to comment
183 (TIF) Figure S2 Forest plot for ABCA1 R219K polymorphism and AS risk in the rssive model (K/K vs. R/K+R/R). Login to comment
184 (TIF) Figure S3 Forest plot for ABCA1 R219K polymorphism and AS risk in the dominant model (K/K+R/K vs. R/R). Login to comment
190 (DOC) Table S3 The meta-regression results for the association of the ABCA1 R219K polymorphism and AS. Login to comment

[hide] Involvement of ATP-binding cassette, subfamily A p... Biomed Rep. 2013 Nov;1(6):883-888. Epub 2013 Sep 2. Zargar S, Wakil S, Mobeirek AF, Al-Jafari AA
Involvement of ATP-binding cassette, subfamily A polymorphism with susceptibility to coronary artery disease.
Biomed Rep. 2013 Nov;1(6):883-888. Epub 2013 Sep 2., [PMID:24649047]

Abstract [show]
Coronary artery disease (CAD) is one of the leading causes of mortality in developed countries. Adenosine triphosphate (ATP)-binding cassette A1 (ABCA1) belongs to the superfamily of membrane proteins that function as a key factor in the regulation of plasma high-density lipoprotein cholesterol (HDL-C) and the metabolism of apolipoprotein A-I (Apo AI). The role of this gene in CAD remains controversial. The aim of this study was to investigate the frequency of single-nucleotide polymorphism (SNP) rs2230806 in the ABCA1 gene of 120 CAD patients and 100 age-matched, healthy controls using restriction fragment length polymorphism and direct sequencing. Total serum cholesterol, HDL-C and serum triglyceride levels were also assayed. Low-density lipoprotein cholesterol (LDL-C) was calculated using the Friedewald formula. When compared, the G allele occurred significantly more frequently in CAD patients compared to the control subjects. The odds ratio (OR) for CAD conferred by carrying the ABCA1 G allele was 2.362 [95% confidence interval (CI) 0.9055-6.161] (P<0.08). The K variant of SNP rs2230806 in the G allele was associated with a decrease in HDL-C levels, but an increased frequency of CAD. In conclusion, the results showed that SNP rs2230806 in the ABCA1 gene is significantly associated with the incidence of CAD. Homozygosity for the G allelic variant in CAD patients may be associated with an increased risk of CAD/MI.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 The presence of SNP rs2230806 (R219K variant) in exon 7 of the ABCA1 gene (c.969A࢐G) was determined for each sample. Login to comment
40 The presence of the missense mutation at nucleotide 969 (AGG to AAG), which leads to the replacement of arginine with lysine at codon 219, was evaluated in genomic DNA by polymerase chain reaction (PCR)ߛRFLP analysis, according to methods described by Cook et al (17). Login to comment
75 There was no significant difference in the correlation between age and HDL and triglyceride levels in individuals carrying different rs2230806 (R219K) genotypes (data not shown). Login to comment
108 In a subset of the samples, sequencing was used to validate the GG, AA and GA genotypes of the R219K polymorphism that were identified by RFLP (Fig. 1). Login to comment
112 We also observed an association between triglyceride levels and the R219K polymorphism, but no significant associations were observed for other lipid parameters. Login to comment
113 The most common missense polymorphism in the coding region of the ABCA1 gene is R219K, with an allelic frequency of 25ߛ46% in the Caucasian population. Login to comment
114 Two large studies including 2,028 and 794 individuals resulted in contradictory conclusions regarding the possible role of rs2230806 (R219K) in arteriosclerosis. Login to comment
115 One study reported an elevated R219K allelic frequency in patients with CHD and a low HDL level compared to diseaseߛfree individuals, suggesting that the mutant allele is likely associated with decreased HDL levels, the promotion of arteriosclerosis and the subsequent development of CHD (11). Login to comment
116 The other study reported a decreased R219K allelic frequency in patients with CHD in conjunction with high observed levels of HDL, suggesting that the mutant allele conferred a protective effect (22). Login to comment
122 In this study, we observed a correlation between the R219K allele and lipid parameters, although the observed associations were not very significant, except for the associations with HDLߛC levels (P=0.02). Login to comment

[hide] ATP-binding cassette transporter A1: from metaboli... Neurobiol Dis. 2014 Dec;72 Pt A:13-21. doi: 10.1016/j.nbd.2014.05.007. Epub 2014 May 17. Koldamova R, Fitz NF, Lefterov I
ATP-binding cassette transporter A1: from metabolism to neurodegeneration.
Neurobiol Dis. 2014 Dec;72 Pt A:13-21. doi: 10.1016/j.nbd.2014.05.007. Epub 2014 May 17., [PMID:24844148]

Abstract [show]
ATP-binding cassette transporter A1 (ABCA1) mediates cholesterol efflux to lipid-free apolipoprotein A-I (apoA-I) and apolipoprotein E (apoE). ABCA1 is an essential regulator of high density lipoproteins (HDL) and reverse cholesterol transport - a role that determines its importance for atherosclerosis. Over the last 10 years studies have provided convincing evidence that ABCA1, via its control of apoE lipidation, also has a role in Alzheimer's disease (AD). A series of reports have revealed a significant impact of ABCA1 on Abeta deposition and clearance in AD model mice, as well as an association of common and rare ABCA1 gene variants with the risk for AD. Since APOE is the major genetic risk factor for late onset AD, the regulation of apoE level or its functionality by ABCA1 may prove significant for AD pathogenesis. ABCA1 is transcriptionally regulated by Liver X Receptors (LXR) and Retinoic X Receptors (RXR) which provides a starting point for drug discovery and development of synthetic LXR and RXR agonists for treatment of metabolic and neurodegenerative disorders. This review summarizes the recent results of research on ABCA1, particularly relevant to atherosclerosis and AD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
978 R219K (rs2230806), I883M (rs4149313), and R1587K (rs2230808) are the non-synonymous variants most extensively investigated since they translate into amino acid changes and have been shown to associate with the risk for CAD. Login to comment

[hide] ABCA1 gene variation and heart disease risk reduct... Atherosclerosis. 2014 Jul;235(1):176-81. doi: 10.1016/j.atherosclerosis.2014.04.030. Epub 2014 May 8. Akao H, Polisecki E, Schaefer EJ, Trompet S, Robertson M, Ford I, Jukema JW, de Craen AJ, Packard C, Buckley BM, Kajinami K
ABCA1 gene variation and heart disease risk reduction in the elderly during pravastatin treatment.
Atherosclerosis. 2014 Jul;235(1):176-81. doi: 10.1016/j.atherosclerosis.2014.04.030. Epub 2014 May 8., [PMID:24854628]

Abstract [show]
AIMS: Our goals were to examine the relationships of a specific ATP-binding cassette transporter A1 (ABCA1) variant, rs2230806 (R219K), on baseline lipids, low-density lipoprotein cholesterol (LDL-C) lowering due to pravastatin, baseline heart disease, and cardiac endpoints on trial. METHODS AND RESULTS: The ABCA1 R219K variant was assessed in 5414 participants in PROSPER (PROspective Study of Pravastatin in the Elderly at Risk) (mean age 75.3 years), who had been randomized to pravastatin 40 mg/day or placebo and followed for a mean of 3.2 years. Of these subjects 47.6% carried the variant, with 40.0% carrying one allele, and 7.6% carrying both alleles. No effects on baseline LDL-C levels were noted, but mean HDL-C increased modestly according to the number of variant alleles being present (1.27 vs 1.28 vs 1.30 mmol/L, p = 0.024). No relationships between the presence or absence of this variant and statin induced LDL-C lowering response or CHD at baseline were noted. However within trial those with the variant as compared to those without the variant, the overall adjusted hazard ratio for new cardiovascular disease (fatal CHD, non-fatal myocardial infarction, or fatal or non-fatal stroke) was 1.22 (95% CI 1.06-1.40, p = 0.006), while for those in the pravastatin group it was 1.41 (1.15-1.73, p = 0.001), and for those in the placebo group it was 1.08 (0.89-1.30, p = 0.447) (p for interaction 0.058). CONCLUSION: Our data indicate that subjects with the ABCA1 R219K variant may get significantly less heart disease risk reduction from pravastatin treatment than those without the variant.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 ABCA1 gene variation and heart disease risk reduction in the elderly during pravastatin treatmentq Hironobu Akao a,b,1 , Eliana Polisecki a,c,1 , Ernst J. Schaefer a,c , Stella Trompet d,e , Michele Robertson f , Ian Ford f , J. Wouter Jukema d,e , Anton J.M. de Craen d,e , Christopher Packard g , Brendan M. Buckley h , Kouji Kajinami b,*, on behalf of the PROspective Study of Pravastatin in the Elderly at Risk (PROSPER) Investigator a Lipid Metabolism Laboratory, Jean Mayer USDA Human Nutrition Research Center on Aging at Tufts University and Tufts University School of Medicine, Boston, MA, USA b Department of Cardiology, Kanazawa Medical University, Uchinada, Japan c Boston Heart Diagnostics, Framingham, MA, USA d Department of Cardiology, Leiden University Medical Centre, Leiden, The Netherlands e Department of Gerontology, and Geriatrics, Leiden University Medical Centre, Leiden, The Netherlands f Robertson Centre of Biostatistics, University of Glasgow, Glasgow, Scotland, UK g Department of Vascular Biochemistry, University of Glasgow, Glasgow, Scotland, UK h Department of Pharmacology and Therapeutics, University College Cork, Cork, Ireland a r t i c l e i n f o Article history: Received 17 January 2014 Received in revised form 17 April 2014 Accepted 25 April 2014 Available online 8 May 2014 Keywords: ABCA1 gene Statins Low-density lipoprotein cholesterol lowering response Heart disease risk reduction a b s t r a c t Aims: Our goals were to examine the relationships of a specific ATP-binding cassette transporter A1 (ABCA1) variant, rs2230806 (R219K), on baseline lipids, low-density lipoprotein cholesterol (LDL-C) lowering due to pravastatin, baseline heart disease, and cardiac endpoints on trial. Login to comment
1 Methods and results: The ABCA1 R219K variant was assessed in 5414 participants in PROSPER (PROspective Study of Pravastatin in the Elderly at Risk) (mean age 75.3 years), who had been randomized to pravastatin 40 mg/day or placebo and followed for a mean of 3.2 years. Login to comment
6 Conclusion: Our data indicate that subjects with the ABCA1 R219K variant may get significantly less heart disease risk reduction from pravastatin treatment than those without the variant. Login to comment
29 The most studied variant at the ABCA1 gene locus is the R219K variant which causes an amino substitution in which an arginine is replaced by a lysine at amino acid position 219 in the ABCA1 protein [11]. Login to comment
30 It has been previously reported that individuals carrying the R219K variant (found in 46% of a population of 790 subjects) had significantly lower triglyceride levels, slightly higher HDL-C levels, and significantly reduced severity of CHD as compared to non-carriers [12]. Login to comment
32 Subsequently it was reported that the presence of the R219K ABCA1 variant in patients with familial hypercholesterolemia (n &#bc; 374) was associated with a markedly reduced risk of CHD (hazards ratio 0.32, p < 0.001) as compared to non-carriers [13]. Login to comment
33 A recent meta-analysis based on an examination of 6597 CHD cases and 15,369 controls concluded that the presence of the R219K ABCA1 variant was associated with a lower risk of CHD (hazards ratio 0.76, p < 0.0001), and modestly higher HDL-C levels [14]. Login to comment
34 However, there are no studies to our knowledge that have assessed whether the R219K ABCA1 genetic variant affects responses to statin treatment in terms of lipid modification or CHD risk reduction. Login to comment
35 Our goals in this study were to determine whether the ABCA1 variant rs2230806 or R219K in PROSPER participants would affect baseline lipids, CHD prevalence at baseline, pravastatin induced LDL-C lowering, and pravastatin mediated CHD risk reduction. Login to comment
48 For DNA analysis the single nucleotide polymorphism (SNP), R219K (rs2230806) of the ABCA1 gene was genotyped using Taq Man&#d2; SNPs genotyping assays (Applied Biosystems, Foster City, CA). Login to comment
63 There was no interaction between R219K and apoE phenotype. Login to comment
78 Associations with lipid response to treatment To determine whether the R219K variant affected lipid responses to pravastatin, the association between the R219K variant under study and 6 month and 12 month changes in TC, LDL-C, HDL-C, and triglyceride levels in individuals treated with pravastatin or placebo were examined. Login to comment
81 Associations with history and within trial incidence of cardiovascular disease There were no significant associations between the prevalence of various forms of vascular disease at baseline and the presence of the R219K variant (data not shown). Login to comment
85 For all subjects, there was a significantly increased risk of new cardiovascular disease (fatal CHD, non-fatal myocardial infarction, or fatal or non-fatal stroke) on trial for those who carried the ABCA1 R219K variant as compared to those who did not. Login to comment
89 ABCA1 SNP rs2230806 R219K pa GG GA AA All (n) 2834 2167 413 TC (mmol/L) 5.69 0.91 5.68 0.89 5.75 0.93 0.463 LDL-C (mmol/L) 3.81 0.80 3.79 0.80 3.80 0.80 0.655 HDL-C (mmol/L) 1.27 0.34 1.28 0.35 1.30 0.34 0.024 TG (mmol/L) 1.56 0.72 1.53 0.69 1.52 0.64 0.140 apoA-I (g/L) 1.32 0.24 1.33 0.25 1.35 0.23 0.066 apoB (g/L) 1.15 0.23 1.15 0.23 1.15 0.22 0.222 Men (n) 1395 1040 184 TC (mmol/L) 5.36 0.80 5.36 0.80 5.31 0.71 0.819 LDL-C (mmol/L) 3.59 0.72 3.58 0.73 3.54 0.62 0.820 HDL-C (mmol/L) 1.17 0.31 1.18 0.33 1.21 0.30 0.133 TG (mmol/L) 1.50 0.74 1.50 0.74 1.44 0.59 0.568 apoA-I (g/L) 1.24 0.21 1.25 0.24 1.26 0.22 0.166 apoB (g/L) 1.11 0.22 1.10 0.21 1.09 0.19 0.227 Women (n) 1439 1127 229 TC (mmol/L) 6.00 0.89 5.97 0.88 6.11 0.93 0.110 LDL-C (mmol/L) 4.01 0.81 3.99 0.81 4.07 0.82 0.281 HDL-C (mmol/L) 1.36 0.35 1.38 0.35 1.40 0.34 0.091 TG (mmol/L) 1.61 0.69 1.55 0.64 1.60 0.68 0.127 apoA-I (g/L) 1.39 0.25 1.40 0.24 1.42 0.21 0.221 apoB (g/L) 1.20 0.23 1.18 0.22 1.20 0.23 0.577 a p values using the three genotypes, men and women combined; adjusted for gender, body mass index, age, alcohol, smoking, diabetes, apoE phenotype, and country. As for Bonferroni correction of multiple testing, p-value threshold divided by independent tests would be 0.05/12 &#bc; 0.004. Login to comment
98 Discussion We examined the association of a prevalent genetic polymorphism, R219K, at the ABCA1 gene locus with baseline lipids and vascular disease, pravastatin induced LDL-C lowering response, and cardiovascular endpoints on trial in PROSPER, in which participants who had been randomized to pravastatin 40 mg/day or placebo and were followed for a mean of 3.2 years [8]. Login to comment
104 To date, the association between ABCA1 R219K variant and increased HDL-C level remains controversial. Login to comment
105 To our knowledge, only one small study examined potential effects of the R219K variant on statin induced lipid responses [28]. Login to comment
108 Our study did not provide direct evidence for the mechanism by which the R219K variant affect the statin effects in cardiovascular event reduction. Login to comment
111 Another possible mechanism is that R219K variant plays a novel role in lipid metabolism. Login to comment
112 Supporting this is a recent study suggesting that the R219K variant not only affects apoA-I and HDL metabolism, but may also significant influence postprandial lipid metabolism [29]. Login to comment
115 As for R219K variant, a meta-analysis including 5388 participants reported opposite genotype effects, K-variant as a protective allele, in Chinese population [30]. Login to comment
117 Another meta-analysis including 42 studies for R219K variant reported a potential protective role of K-allele, but again suggested limited interpretation of results because of significant heterogeneity among enrolled studies [31]. Login to comment
119 This pharmacogenetic study enrolled 1686 patients with familial hypercholesterolemia without history of coronary heart disease and analyzed statin-ABCA1 C69T, not R219K, polymorphism interaction by comparing treated and untreated patients. Login to comment
130 In conclusion, ABCA1 R219K variant might be a novel genetic determinant for pravastatin treatment response in heart disease risk reduction in the elderly. Login to comment

[hide] Effects of R219K polymorphism of ATP-binding casse... Biol Res. 2014 Mar 26;47:4. doi: 10.1186/0717-6287-47-4. Liu H, Lin J, Zhu X, Li Y, Fan M, Zhang R, Fang D
Effects of R219K polymorphism of ATP-binding cassette transporter 1 gene on serum lipids ratios induced by a high-carbohydrate and low-fat diet in healthy youth.
Biol Res. 2014 Mar 26;47:4. doi: 10.1186/0717-6287-47-4., [PMID:25027185]

Abstract [show]
BACKGROUND: Diets are the important players in regulating plasma lipid profiles. And the R219K polymorphism at the gene of ATP-binding cassette transporter 1(ABCA1) was reported to be associated with the profiles. However, no efforts have been made to investigate the changes of lipid profiles after a high-carbohydrate and low-fat diet in different subjects with different genotypes of this polymorphism. This study was to evaluate the effects of ABCA1 R219K polymorphism on serum lipid and apolipoprotein (apo) ratios induced by a high-carbohydrate/low-fat (high-CHO) diet. After a washout diet of 54.1% carbohydrate for 7 days, 56 healthy young subjects (22.89 +/- 1.80 years old) were given a high-CHO diet of 70.1% carbohydrate for 6 days. Height, weight, waist circumference, hip circumference, glucose (Glu), triglyceride (TG), total cholesterol (TC), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), apoA-1 and apoB-100 were measured on the 1st, 8th and 14th days of this study. Body mass index (BMI), waist-to-hip ratios (WHR), log(TG/HDL-C), TC/HDL-C, LDL-C/HDL-C and apoA-1/apoB-100 were calculated. ABCA1 R219K was analyzed by a PCR-RFLP method. RESULTS: The results indicate that the male subjects of all the genotypes had higher WHR than their female counterparts on the 1st, 8th and 14th days of this study. The male K carriers had higher log(TG/HDL-C) and TC/HDL-C than the female carriers on the 1st and 14th days, and higher LDL-C/HDL-C on the 14th day. When compared with that on the 8th day, TC/HDL-C was decreased regardless of the genotypes and genders on the 14th day. Log(TG/HDL-C) was increased in the males with the RR genotype and the female K carriers. Lowered BMI, Glu and LDL-C/HDL-C were found in the male K carriers, but only lowered BMI in the female K carriers and only lowered LDL-C/HDL-C in the females with the RR genotype. CONCLUSIONS: These results suggest that ABCA1 R219K polymorphism is associated differently in males and females with elevated log(TG/HDL-C) and decreased LDL-C/HDL-C induced by the high-CHO diet.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 And the R219K polymorphism at the gene of ATP-binding cassette transporter 1(ABCA1) was reported to be associated with the profiles. Login to comment
3 This study was to evaluate the effects of ABCA1 R219K polymorphism on serum lipid and apolipoprotein (apo) ratios induced by a high-carbohydrate/low-fat (high-CHO) diet. Login to comment
7 ABCA1 R219K was analyzed by a PCR-RFLP method. Login to comment
12 Conclusions: These results suggest that ABCA1 R219K polymorphism is associated differently in males and females with elevated log(TG/HDL-C) and decreased LDL-C/HDL-C induced by the high-CHO diet. Login to comment
30 One of the most common missense polymorphisms in the coding region of the ABCA1 is R219K polymorphism with an allele frequency of the K allele of 46% in the European population [24]. Login to comment
32 It is believed that the K allele of R219K polymorphism alone is an independent protective factor against CVD. Login to comment
33 However, little is known about the interactions between the R219K polymorphism of ABCA1 and the high-CHO diet and their effects on serum lipids and apolipoproteins in health youth. Login to comment
34 In this study, we investigated the effects of R219K polymorphism of ABCA1 on the anthropometric parameters and plasma lipid and apolipoprotein ratios after the high-CHO diet in healthy young Chinese, a population well characterized with diets containing high carbohydrate and low incidence of CVD. Login to comment
36 Results The frequencies of genotypes and alleles of R219K polymorphism of ABCA1 The fragment contained R219K polymorphism site of ABCA1 was 177 bp. Login to comment
38 The genotype and allele frequencies of R219K polymorphism of ABCA1 in this study population are shown in Table 1. Login to comment
41 The characteristics of the subjects on the 1st day of this study according to R219K genotypes of ABCA1 Due to the small number of the subjects with the KK genotype, the subjects with the RK genotype and the subjects with the KK genotype were combined and defined as the K allele carriers. Login to comment
55 R219K polymorphism is located on the first intracellular region of ABCA1 protein, where glycosylation sites can be found. Login to comment
64 However, the males with the K allele might be more susceptible than the female counterparts to the favorable effect of R219K polymorphism on serum TG (Table 3), which may be induced by the steroids or other sex hormones [28]. Login to comment
70 To our knowledge, this is the first attempt to investigate the effects of the high-CHO diet on serum lipid ratios and apoA-1/apoB-100 in young subjects with different genotypes of R219K polymorphisms of ABCA1 in a Chinese young population well characterized with a diet of higher carbohydrate and lower fat and a lower incidence of CVD. Login to comment
77 Moreover, unchanged levels of these lipids, or even decreased TG and increased HDL-C and LDL-C, Table 1 Frequencies of the genotype and allele of ABCA1 R219K polymorphism Genotype Allele frequency N RR [case (%)] RK [case (%)] KK [case (%)] R allele K allele Total 56 20 (35.7) 22 (39.3) 14 (25.0) 0.55 0.45 Male 27 8 (14.3) 11 (19.6) 8 (14.3) 0.50 0.50 Female 29 12 (21.4) 11 (19.6) 6 (10.7) 0.60 0.40 were reported after the high-CHO diet [34]. Login to comment
89 Once confirmed by bigger population and multi-center trials, the findings could provide a new point of view for personalized dietary intervention for the subjects with different genotypes of the R219K polymorphism of ABCA1 to reduce the risks of CVD, especially in a country with a quarter of the world's population. Login to comment
110 The primers for the amplification of the DNA fragments containing the R219K polymorphism of ABCA1 by polymerase chain reactions (PCR) were designed according to Clee [24]. Login to comment
113 The genotype of R219K polymorphism of ABCA1 was analyzed by XagI enzyme digestion. Login to comment
189 Li YY, Zhang H, Qin XY, Lu XZ, Yang B, Chen ML: ATP-binding cassette transporter A1 R219K polymorphism and coronary artery disease in Chinese population: a meta-analysis of 5,388 participants. Login to comment
207 Evans D, Beil FU: The association of the R219K polymorphism in the ATP-binding cassette transporter 1 (ABCA1) gene with coronary heart disease and hyperlipidaemia. Login to comment
238 Biosci Trends 2011, 5:198-204. doi:10.1186/0717-6287-47-4 Cite this article as: Liu et al.: Effects of R219K polymorphism of ATP-binding cassette transporter 1 gene on serum lipids ratios induced by a high-carbohydrate and low-fat diet in healthy youth. Login to comment

[hide] The R219K polymorphism on ATP-binding cassette tra... Cell Biochem Biophys. 2015 Jan;71(1):49-55. doi: 10.1007/s12013-014-0161-8. Liu N, Hou M, Ren W, Cao J, Wu H, Zhou W
The R219K polymorphism on ATP-binding cassette transporter A1 gene is associated with coronary heart disease risk in Asia population: evidence from a meta-analysis.
Cell Biochem Biophys. 2015 Jan;71(1):49-55. doi: 10.1007/s12013-014-0161-8., [PMID:25104170]

Abstract [show]
A number of case-control studies have been conducted to investigate the relationship between the ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms and risk of coronary heart disease (CHD). However, the results have been inconclusive. The purpose of the present study is to investigate whether this polymorphism confers significant susceptibility to CHD using a meta-analysis. We conducted searches of the published literature in PubMed, Embase, and CBM databases. 13 studies were included in our meta-analysis, involving a total of 11,678 individuals. Subgroup analyses were performed by ethnicity and cancer type. Statistically significant association between ABCA1 gene R219K polymorphism and increased CHD risk was found in total population analyses in all four genetic comparison models (OR(C vs. T) 1.19, 95% CI 1.07-1.31; P = 0.001; OR(Homozygote model) 1.28, 95% CI 1.07-1.52; P = 0.007; OR(Recessive genetic model) 1.22, 95% CI 1.04-1.44, P = 0.015; OR(Dominant model) 1.21, 95% CI 1.07-1.35; P = 0.001). In subgroup analyses based on ethnicity, the association was still significant in Asians (All P values < 0.001), but not in Caucasians (All P values > 0.05). ABCA1 R219K polymorphism is associated with CHD susceptibility, and individuals with ABCA1 have a significantly higher risk of cancer particularly in Asians.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 ORIGINAL PAPER The R219K Polymorphism on ATP-Binding Cassette Transporter A1 Gene is Associated with Coronary Heart Disease Risk in Asia Population: Evidence from a Meta-Analysis Nannan Liu ߦ Mingxiao Hou ߦ Weidong Ren ߦ Junying Cao ߦ Hongli Wu ߦ Weiwei Zhou Published online: 8 August 2014 &#d3; Springer Science+Business Media New York 2014 Abstract A number of case-control studies have been conducted to investigate the relationship between the ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms and risk of coronary heart disease (CHD). Login to comment
6 Statistically significant association between ABCA1 gene R219K polymorphism and increased CHD risk was found in total population analyses in all four genetic comparison models (ORC vs. T 1.19, 95 % CI 1.07-1.31; P = 0.001; ORHomozygote model 1.28, 95 % CI 1.07-1.52; P = 0.007; ORRecessive genetic model 1.22, 95 % CI 1.04-1.44, P = 0.015; ORDominant model 1.21, 95 % CI 1.07-1.35; P = 0.001). Login to comment
8 ABCA1 R219K polymorphism is associated with CHD susceptibility, and individuals with ABCA1 have a significantly higher risk of cancer particularly in Asians. Login to comment
9 Keywords ABCA1 R219K CHD Asians Introduction Coronary heart disease (CHD) is one of the major causes of mortality, being responsible for approximately 30 % of deaths worldwide [34]. Login to comment
23 lysine substitution at exon 7 (R219K, rs2230806) and isoleucine ? Login to comment
25 To date, many case-control studies have been carried out to investigate the relationship between ABCA1 R219K polymorphism and the risk of developing CHD, but the results were conflicting or inconclusive. Login to comment
27 Therefore, there is a role for meta-analysis in pooling these studies, particularly to clarify the effect of R219K polymorphism on ABCA1 gene with the risk of CHD. Login to comment
32 The inclusion criteria were (1) case-control studies which evaluated the association of R219K polymorphism on ABCA1 with CHD risk; (2) based on unrelated cancer individuals; (3) sufficient published genotype data for estimating an odds ratio (OR) with 95 % confidence interval (CI); and (4) genotype distribution of the control population reported was in Hardy-Weinberg equilibrium (HWE). Login to comment
53 Subgroup analyses based on cancer type showed ABCA1-R219K variant was significantly associated with increased risk of CHD and cardiovascular disease (Table 3). Login to comment
55 Table 1 Characteristics of studies included in this meta-analysis References Ethnicity (country) Characteristics of cases Characteristics of controls HWE&#e0; Qi et al. [24] Asians 109 histologically confirmed malignant mesothelioma cases 252 population controls Yes Shi et al. [25] Asians 995 histologically confirmed breast cancer cases 1,004 cancer-free controls Yes Sun et al. [27] Asians 234 bladder cancer patients 253 cancer-free controls Yes Tsai et al. [30] Asians 43 histologically confirmed breast cancer cases 31 healthy volunteers Yes Harada et al. [14] Asians 456 histologically confirmed gastric cancer patients 507 healthy controls Yes Tan et al. [28] Asians 294 histologically confirmed lung cancer cases 288 cancer-free controls Yes Zhang et al. [35] Asians 350 histologically confirmed lung cancer cases 350 cancer-free controls Yes Mart &#b4;n et al. [19] Caucasians 109 histologically confirmed lung cancer cases 110 cancer-free controls Yes Andrikovics et al. [1] Caucasians 530 bladder cancer patients 556 healthy controls Yes Jensen et al. [15] Caucasians 247 breast cancer cases 380 healthy controls Yes Nebel et al. [20] Caucasians 1,024 histologically confirmed lung cancer cases 1,118 cancer-free controls Yes Evans and Beil [11] Caucasians 710 lung cancer patients 710 cancer-free controls Yes Frikke-Schmidt et al. [12] Caucasians 405 histologically confirmed ESCC cases 478 cancer-free controls Yes ESCC esophageal squamous cell carcinoma; &#e0; HWE Hardy-Weinberg equilibrium Table 2 Distribution of ABCA1 and R219K genotypes and alleles among cancer cases and controls in the meta-analysis References Genotype Allele PHWE T/T (n) T/C (n) C/C (n) T (n) C (n) Case Control Case Control Case Control Case Control Case Control Mart &#b4;n et al. [19] 75 104 99 144 27 47 249 352 153 238 0.81 Qi et al. [24] 766 817 210 179 19 8 1,742 1,813 248 195 0.60 Frikke-Schmidt et al. [12] 174 178 56 73 4 2 404 429 64 77 0.06 Andrikovics et al. [1] 20 15 19 13 4 3 59 43 27 19 0.94 Shi et al. [25] 155 188 219 238 82 81 529 614 383 400 0.70 Tsai et al. [30] 251 250 40 37 3 1 542 537 46 39 0.76 Sun et al. [27] 264 291 75 55 11 4 603 637 97 63 0.45 Jensen et al. [15] 37 40 53 52 19 18 127 132 91 88 0.87 Zak and co-authors [2] 174 187 266 275 90 94 614 649 446 463 0.68 Nebel et al. [20] 90 134 107 187 50 59 287 455 207 305 0.64 Harada et al. [14] 783 924 223 182 18 12 1,789 2,030 259 206 0.37 Tan et al. [28] 500 558 198 148 12 4 1,198 1,264 222 156 0.08 Zhang et al. [35] 305 384 94 89 6 5 704 857 106 99 0.95 Caucasians 551 668 763 909 272 302 1,865 2,245 1,307 1,513 0.81 Asians 3,043 3,402 896 763 73 36 6,982 7,567 1,042 835 0.34 Total 3,594 4,070 1,659 1,672 345 338 8,847 9,812 2,349 2,348 \0.01 PHWE P values for Hardy-Weinberg equilibrium The between-study heterogeneity was not obvious in most comparisons except the Allele gene model (R vs. K) comparison analysis based on total studies (I2 = 50.4 %). Login to comment
63 The present meta-analysis of 13 case-control studies, involving a total of 5,898 cancer cases and 6,080 controls, provides the most comprehensive assessment so far of the association between ABCA1-R219K polymorphism and cancer risk. Login to comment
64 The findings of this meta-analysis indicate that variant homozygote CC of ABCA1-R219K is significantly associated with increased cancer risk (OR = 1.28, 95 % CI 1.07-1.52; P = 0.007). Login to comment
71 Therefore, we first stratified studies Fig. 1 Flow chart of selection of studies for inclusion in the meta-analysis Fig. 2 Forest plots of pooled OR with 95 % CI for associations between ABCA1 and R219K polymorphism and CHD risk (The size of the data markers is inversely proportional to the variance of the log ORs; horizontal lines represent the 95 % CIs. Login to comment
74 One explanation about how ABCA1 R219K polymorphism modifies the risk of CHD is that ABCA1 may influence the plasma lipid levels. Login to comment
76 Only the R219K was significantly associated with HDL-C concentration and CAD risk. Login to comment
79 It is probable that the protective function of R219K polymorphism is not only explained by increased plasma HDL-C level, but also by ABCA1 polymorphism. Login to comment
82 Another probable mechanism is that R219K polymorphism induces the activity of ABCA1 protein, which mediates cholesterol efflux from peripheral cells back to liver independent of plasma HDL-C levels. Login to comment
91 In additional, Cenaro et al. reported that R219K variant appeared to be more protective for smokers and exsmokers than non-smokers in the premature CHD group. Login to comment
96 Our meta-analysis supports an association of ABCA1 R219K polymorphism with CHD in Asians. Login to comment
99 In subgroup analyses, evidence was obtained to suggest different risk effects of R219K between populations of Caucasians and Asians. Login to comment

[hide] Increased risk of premature coronary artery diseas... J Clin Lipidol. 2014 Jul-Aug;8(4):381-9. doi: 10.1016/j.jacl.2014.06.001. Epub 2014 Jun 11. Abd El-Aziz TA, Mohamed RH, Hagrass HA
Increased risk of premature coronary artery disease in Egyptians with ABCA1 (R219K), CETP (TaqIB), and LCAT (4886C/T) genes polymorphism.
J Clin Lipidol. 2014 Jul-Aug;8(4):381-9. doi: 10.1016/j.jacl.2014.06.001. Epub 2014 Jun 11., [PMID:25110219]

Abstract [show]
BACKGROUND: Epidemiological studies have shown a strong inverse relationship between high-density lipoprotein (HDL) cholesterol (HDLc) levels and coronary artery disease (CAD), and a low concentration of plasma HDLc is considered an independent risk factor for premature atherosclerosis. Mutations in ATP-binding cassette A1 transporter (ABCA1), cholesteryl ester transfer protein (CETP), and lecithin: cholesterol acyltransferase (LCAT) reduce HDLc in humans. OBJECTIVE: To date, no study had tested the association between these polymorphisms and premature CAD (PCAD) in the Egyptian population. Here we searched for ABCA1 (rs2230806), CETP (rs708272), and LCAT (rs5923) mutations in the Egyptian population and investigated the possible association between these gene polymorphisms and PCAD. We aimed to investigate the association between ABCA1, CETP, and LCAT gene polymorphisms and PCAD in Egyptians. METHODS: A total of 235 Egyptians-116 with documented PCAD (PCAD group) and 119 controls-were enrolled in the study. RESULTS: Mutation carriers with low HDLc had an elevated risk of PCAD (odds ratio [OR] = 11.38 for ABCA1 mutation carriers, P = .000; OR = 5.41 for CETP mutation carriers, P = .000; OR = 5.92 for LCAT mutation carriers, P = .000). Moreover, mutations in ABCA1, CETP, and LCAT were significantly associated with hyperlipidemia in this study. CONCLUSION: These observations show that the R allele of ABCA1, the B1 allele of CETP, and the T allele LCAT genes are associated with PCAD in Egyptians. They have more considerable effect on patients with low HDLc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Increased risk of premature coronary artery disease in Egyptians with ABCA1 (R219K), CETP (TaqIB), and LCAT (4886C/T) genes polymorphism Tarek A. Abd El-Aziz, MD, Rasha H. Mohamed, PhD*, Hoda A. Hagrass, MD Department of Cardiology, Faculty of Medicine, Zagazig University, Zagazig, Egypt (Dr Abd El-Aziz); Department of Biochemistry, Faculty of Pharmacy, Zagazig University, Zagazig, Egypt (Dr Mohamed); and Department of Clinical Pathology, Faculty of Medicine, Zagazig University, Zagazig, Egypt (Dr Hagrass) KEYWORDS: PCAD; HDLc; ABCA1; CETP; LCAT BACKGROUND: Epidemiological studies have shown a strong inverse relationship between high-density lipoprotein (HDL) cholesterol (HDLc) levels and coronary artery disease (CAD), and a low concentration of plasma HDLc is considered an independent risk factor for premature atherosclerosis. Login to comment
20 The common polymorphism in the coding region is R219K (rs2230806), which lead to an arginine/lysine substitution at exon 7.6 CETP facilitates the uptake of cholesterol from peripheral tissues to the liver in an antiatherogenic process known as reverse cholesterol transport. Login to comment
34 Amplification of ABCA1 gene R219K (rs2230806) polymorphism The ABCA1 gene polymorphism R219K was detected using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP) as previously described.21 The oligonucleotide primers used were 50 -AAA GAC TTC AAG GACCCAGCTT-30 and 50 - CCTCACATTCCGAAAGCATTA-30 .22 PCR was subjected to 95 C for 5 minutes, 30 cycles of 95 C for 30 seconds, 55 C for 30 seconds, 72 C for 30 seconds, and final extension to 72 C for 7 minutes, producing a fragment of 309 bp. Login to comment
36 Amplification of CETP gene TaqIB (rs708272) polymorphism The ABCA1 gene polymorphism R219K was detected using PCR and RFLP as previously described.23 Briefly, a 535-bp fragment in intron 1 of the CETP gene was amplified by PCR, with use of the following oligonucleotide primers: F-50 -CAC TAG CCC AGA GAGAGAGGAGTGCC-30 and R-50 -CTG AGC CCA GCC GCA CAC TAAC-30 at 95 C for 3 minutes followed by 30 cycles of 95 C for 30 seconds, 60 C for 30 seconds, 72 C for 45 seconds, and, last, by 1 cycle at 72 C for 5 minutes. Login to comment
58 For R219K polymorphism, we observed a higher frequency of the R allele (46.6% vs 37.8%, OR 1.43; 95% CI 0.99-2.07; P 5 .03) in PCAD patients compared with control group. Login to comment
67 Table 2 Genotype and allele frequencies in the study population Polymorphism Case (n 5 116) Control (n 5 119) OR 95% CI P ABCA1 (R219K) KK n (%) 36 (31.1) 50 (42.0) KR n (%) 52 (44.8) 48 (40.3) 1.50 0.84-2.69 .11 RR n (%) 28 (24.1) 21 (17.6) 1.85 0.91-3.76 .06 R allele n (%) 108 (46.6) 90 (37.8) 1.43 0.99-2.07 .03 CETP (Taq1B) B2B2 n (%) 18 (15.5) 32 (26.9) B1B2 n (%) 60 (51.7) 57 (47.9) 1.87 0.95-3.70 .05 B1B1 n (%) 38 (32.8) 30 (25.2) 2.25 1.06-4.77 .02 B1allele n (%) 136 (58.6) 117 (49.16) 1.46 1.01-2.11 .02 LCAT (4886C/T) CC n (%) 26 (22.4) 49 (41.2) CT n (%) 56 (48.3) 55 (46.2) 1.92 1.05-3.51 .02 TT n (%) 34 (29.3) 15 (12.6) 4.27 1.97-9.24 .000 T allele n (%) 124 (53.5) 85 (35.7) 2.07 1.43-2.99 .000 ABCA1, ATP-binding cassette A1 transporter; CETP, cholesteryl ester transfer protein; LCAT, lecithin: cholesterol acyltransferase. Login to comment
72 The frequency of the B1 allele was also significantly increased in the combined hyperlipidemic group compared with the control group (61.1% vs Table 3 Genotypes distribution and correlation with HDLc levels Polymorphism PCAD with low HDLc (n 5 70) PCAD with normal HDLc (n 5 46) OR 95% CI P ABCA1 (R219K) K allele n (%) 46 (32.9) 78 (84.8) R allele n (%) 94 (67.1) 14 (15.2) 11.38 5.83-22.23 .000 CETP (Taq1B) B2 allele n (%) 36 (25.7) 60 (65.2) B1allele n (%) 104 (74.3) 32 (34.8) 5.41 3.05-9.60 .000 LCAT (4886C/T) C allele n (%) 42 (30.0) 66 (71.7) T allele n (%) 98 (70.0) 26 (28.3) 5.92 3.31-10.58 .000 ABCA1, ATP-binding cassette A1 transporter; CETP, cholesteryl ester transfer protein; HDLc, high-density lipoprotein cholesterol; LCAT, lecithin: cholesterol acyltransferase; PCAD, premature coronary artery disease. Login to comment
73 Table 4 Genotypes distribution across different phenotypes Polymorphism Control (n 5 119) PCAD with high TGs (phenotype I, IV) (n 5 24) OR 95% CI P ABCA1 (R219K) K allele n (%) 148 (62.2) 24 (50.0) R allele n (%) 90 (37.8) 24 (50.0) 3.64 1.22-10.85 .009 CETP (Taq1B) B2 allele n (%) 121 (50.8) 16 (33.3) B1allele n (%) 117 (49.2) 32 (66.7) 2.06 1.07-3.96 .019 LCAT (4886C/T) C allele n (%) 153 (64.3) 24 (50.0) T allele n (%) 85 (35.7) 24 (50.0) 3.33 1.11-9.92 .016 Polymorphism Control (n 5 119) PCAD with high LDL (phenotype IIa) (n 5 2) OR 95% Cl P ABCA1 (R219K) K allele n (%) 148 (62.2) 3 (75.0) R allele n (%) 90 (37.8) 1 (25.0) 0.54 0.05-5.35 .52 CETP (Taq1B) B2 allele n (%) 121 (50.8) 2 (50.0) B1 allele n (%) 117 (49.2) 2 (50.0) 0.96 0.13-6.97 .67 LCAT (4886C/T) C allele n (%) 153 (64.3) 3 (75.0) T allele n (%) 85 (35.7) 1 (25.0) 0.60 0.06-5.85 .55 Polymorphism Control (n 5 119) PCAD with high TG 1 LDL (phenotype IIb) (n 5 72) OR 95% CI P ABCA1 (R219K) K allele n (%) 148 (62.2) 72 (50.0) R allele n (%) 90 (37.8) 72 (50.0) 1.64 1.08-2.50 .013 CETP (Taq1B) B2 allele n (%) 121 (50.8) 56 (38.9) B1 allele n (%) 117 (49.2) 88 (61.1) 1.62 1.06-2.47 .015 LCAT (4886C/T) C allele n (%) 153 (64.3) 60 (41.7) T allele n (%) 85 (35.7) 84 (58.3) 2.52 1.64-3.85 .000 ABCA1, ATP-binding cassette A1 transporter; CETP, cholesteryl ester transfer protein; HDLc, high-density lipoprotein cholesterol; LDLc, low-density lipoprotein cholesterol; LCAT, lecithin: cholesterol acyltransferase; PCAD, premature coronary artery disease; TC, total cholesterol; TG, triglyceride. Login to comment
84 These factors may vary depending on race and ethnic group.25 HDL Table 5 Lipid profile distribution across genotypes TC (mg/dL) TG (mg/dL) LDLc (mg/dL) HDLc (mg/dL) ABCA1 (R219K) KK 196.96 6 65.86 187.39 6 65.19 104.19 6 59.94 55.12 6 7.55 RK 215.14 6 67.66* 217.91 6 49.10** 130.88 6 70.27** 40.72 6 7.94# RR 242.14 6 55.68# 223.48 6 72.15** 168.05 6 60.54# 29.28 6 2.66# CETP (Taq1B) B2B2 197.68 6 66.84 184.22 6 74.77 110.19 6 70.34 58.90 6 7.52 B2B1 224.62 6 64.66 215.67 6 54.72** 128.87 6 57.02 44.20 6 8.18# B1B1 234.69 6 60.53* 211.95 6 61.13* 160.98 6 61.58** 31.32 6 4.19# LCAT (4886C/T) CC 200.15 6 72.52 205.07 6 62.86 104.52 6 66.62 54.43 6 8.55 CT 216.37 6 67.38 201.41 6 58.20 133.86 6 72.16** 42.23 6 9.46# TT 230.40 6 49.52* 226.95 6 67.67* 154.80 6 49.31# 30.14 6 3.45# HDLc, high-density lipoprotein cholesterol; LDLc, low-density lipoprotein cholesterol; TC, total cholesterol; TG, triglyceride. Login to comment
92 R219K is the most common polymorphism of ABCA1 and the allele frequency of the K allele is 26-46% in the Caucasian population.29,30 To date, several studies have reported controversial results about the possible role of R219K in arteriosclerosis. Login to comment
94 This is in line with recent meta-analysis31 involving 2730 CAD patients and 2658 controls and found that the K allele of the ABCA1 R219K gene has a protective role for CAD risk in Chinese population and is possibly associated with decreased CAD susceptibility. Login to comment
96 Also, Takagi et al. concluded that the polymorphism does not seem to influence coronary atherosclerosis.35 HDLc is a major independent factor involved in the development of premature CAD The antiatherogenic function of HDL has been attributed to its role in reverse cholesterol transport, and the protein ABCA1 plays a crucial role in its initial step.36 Several studies have showed that the R allele in the R219K ABCA1gene polymorphism causes low HDLc levels, increased triglycerides, depressed levels of cholesterol efflux, and an increased risk of CAD.37,38 In agreement of this finding, we found that the frequency of the R allele of ABCA1 was significantly increased in PCAD with low HDLc levels compared with PCAD with normal HDLc levels (67.1% vs 15.2%). Login to comment

[hide] Impact of 3 Common ABCA1 Gene Polymorphisms on Opt... Open Cardiovasc Med J. 2014 Sep 25;8:83-7. doi: 10.2174/1874192401408010083. eCollection 2014. Marvaki A, Kolovou V, Katsiki N, Boutsikou M, Kotanidou A, Orfanos S, Filippatos G, Marvaki K, Koumoulidis A, Mavrogeni S, Kolovou G
Impact of 3 Common ABCA1 Gene Polymorphisms on Optimal vs Non-Optimal Lipid Profile in Greek Young Nurses.
Open Cardiovasc Med J. 2014 Sep 25;8:83-7. doi: 10.2174/1874192401408010083. eCollection 2014., [PMID:25279016]

Abstract [show]
OBJECTIVE: This study is in line with two previous ones from our group. They evaluated the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms [such as rs2230806 (R219K), rs2230808 (R1587K) and rs4149313 (I883M)] on the human lipid profile (defined as Optimal and Non-Optimal). METHODS: The present study included 447 unrelated young women and men self-reported as being healthy and that attended the University of Nursing of Technological and Educational Institution. All subjects were genotyped and the ABCA1 polymorphisms (R219K, R1587K and I883M) were recorded. According to lipid profile [total cholesterol, triglyceride, high-density lipoprotein cholesterol and low-density lipoprotein cholesterol (LDL-C)] the subjects were separated into those with optimal lipid profile (Optimal Group, n=209) and Non-Optimal Group (n=238). RESULTS: No statistical differences were observed in the distribution of R219K, R1587K and I883M polymorphisms according to the lipid profile (p>0.05 in all cases). No statistical differences were observed in the distribution of R219K, R1587K and I883M polymorphisms according to sex (p>0.05 in all cases). However, Logistic Regression revealed that subjects with RK (R1587K polymorphism) genotype had 69% increased risk on average of having LDL-C above normal limits as compared with those with RR genotype. Similarly, subjects with K allele (R1587K polymorphism) had 59% increased risk on average of having LDL-C above normal limits compared with those with R allele. CONCLUSION: These findings suggest that R1587K polymorphism of ABCA1 gene may influence the lipid profile. However, this needs to be confirmed by larger studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 They evaluated the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms [such as rs2230806 (R219K), rs2230808 (R1587K) and rs4149313 (I883M)] on the human lipid profile (defined as Optimal and Non-Optimal). Login to comment
3 All subjects were genotyped and the ABCA1 polymorphisms (R219K, R1587K and I883M) were recorded. Login to comment
5 Results: No statistical differences were observed in the distribution of R219K, R1587K and I883M polymorphisms according to the lipid profile (p>0.05 in all cases). Login to comment
6 No statistical differences were observed in the distribution of R219K, R1587K and I883M polymorphisms according to sex (p>0.05 in all cases). Login to comment
15 Several ABCA1 gene polymorphisms have been identified, such as rs2230806 (R219K) in the chromosomal position 107620867, rs2230808 (R1587K) in the chromosomal position 106602625 and rs4149313 (I883M) in the chromosomal position 106626574. Login to comment
17 The aim of the study, in line with our previous work [57], was to evaluate the R219K, R1587K and I883M of ABCA1 gene polymorphisms according to lipid profile. Login to comment
26 According to Genotypes We evaluated single nucleotide polymorphisms (SNPs) in chromosome 9 such as rs2230806 (R219K) in the position 107620867, rs2230808 (R1587K) in the position 106602625 and rs4149313 (I883M) in the position 106626574 according to lipid profile by using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP`s) (see below). Login to comment
29 DNA Analysis and Determination of Blood Lipids The ABCA1 gene polymorphisms (R219K, R1587K and I883M) were detected using PCR and RFLP`s. Login to comment
31 For R219K polymorphism the oligonucleotide primers which were used were AAAGACTTCAAGGACCCAGCTT and CCTCACATTCCGAAAGCATTA [9]. Login to comment
45 There was no difference in R219K, R1587K and I883M polymorphisms frequency according to Optimal and Non-Optimal lipid profile (p = 0.49, 0.29 and 0.42, respectively). Login to comment
48 DISCUSSION We examined the impact of the R219K, R1587K and I883M of ABCA1 polymorphisms as a genetic influence on the lipid profile in Greek subjects. Login to comment
49 In this context, the possible effects of the ABCA1 polymorphisms on lipids or cardiovascular disease were recently evaluated in various populations such as Japanese [11] in which correlation with HDL-C concentrations was found, Saudi [12] in which the ABCA1 C69T gene frequency was higher in healthy subjects compared with diabetic patients, Chinese [13], in which ABCA1 gene R219K polymorphism was associated with ischemic stroke, Greek [5-7] in which a gender-specific effect of the R219K polymorphism on plasma lipids was demonstrated, Turkish [14] in which a gender-specific effect of the R219K polymorphism on plasma lipids and CHD was shown and Mexican [15] in which several European loci as well as a novel one for high TG and low HDL-C levels were identified. Login to comment
52 The relationship between ABCA1 R219K, R1587K and I883M and Alzheimer disease has been reported in various ethnic groups with contradictory results. Login to comment
54 With regard to subgroups with low HDL-C, Hodof;lugil et al. [17] reported that R219K and I883M polymorphisms were related to higher HDL-C levels, Slatter et al. [18] found that R1587K was overexpressed in low HDL-C individuals, whereas Frikke-Schmidt et al. [19] did not observe any association with R219K but reported that R1587K polymorphism was overexpressed in individuals with low HDL-C concentrations. Login to comment
55 In subgroups with high HDL-C, Kakko et al. [20] found a minor association between ABCA1 polymorphisms and HDL-C levels in women, whereas Clee et al. [4] reported a non-significant trend towards higher HDL-C levels in carriers of R219K. Login to comment
58 R219K R1587K I883M n (%) n (%) n (%) RR 225 (50.2) RR 211 (47.1) II 309 (69.0) RK 191 (42.6) RK 193 (43.1) IM 131 (29.2) KK 32 (7.1) KK 44 (9.8) MM 8 (1.8) R 71.5 R 68.6 I 83.6 K 28.5 K 31.4 M 16.4 Table 1. Login to comment
63 For example, Clee et al. [4] reported that carriers of K allele of R219K polymorphism had significantly lower TG levels in relation to carriers of the R allele, whereas others did not find any associations. Login to comment
65 Delgado-Lista et al. [21] reported a trend for lower fasting TG and large TG-rich lipoproteins in minor allele carriers compared with major allele homozygotes of R219K polymorphism. Login to comment
66 In our study with young Greek nurses (living and working in similar conditions) we did not observe any association of R219K polymorphism with HDL-C or other lipid levels, although we found that individuals with RK genotype of R1587K polymorphism had significantly higher TC, LDL-C and TG levels compared with the RR genotype [7]. Login to comment
68 Sandhofer et al. [22] found that K allele of R219K gene displayed a lower intima media thickness and a reduced risk of advanced plaque extent compared with non-carriers only in non-smokers and concluded that smoking abrogates the protective effect of the R219K. Login to comment
69 Cenarro et al. [23] reported that the K allele of the R219K gene was significantly more frequent in familial hypercholesterolemia subjects without premature CHD than in familial hypercholesterolemia subjects with premature CHD and it appears to be more protective for smokers than non-smokers. Login to comment

[hide] Genetic association with low concentrations of hig... Atherosclerosis. 2014 Nov;237(1):273-8. doi: 10.1016/j.atherosclerosis.2014.08.043. Epub 2014 Sep 23. Kelishadi R, Haghjooy Javanmard S, Tajadini MH, Mansourian M, Motlagh ME, Ardalan G, Ban M
Genetic association with low concentrations of high density lipoprotein-cholesterol in a pediatric population of the Middle East and North Africa: the CASPIAN-III study.
Atherosclerosis. 2014 Nov;237(1):273-8. doi: 10.1016/j.atherosclerosis.2014.08.043. Epub 2014 Sep 23., [PMID:25286446]

Abstract [show]
OBJECTIVE: Depressed high-density lipoprotein cholesterol (HDL-C) is prevalent the Middle East and North Africa. Some studies have documented associations between HDL-C and several single nucleotide polymorphisms (SNPs) in candidate gene polymorphisms. METHODS: We investigated the associations between SNP genotypes and HDL-C levels in Iranian students, aged 10-18 years. Genotyping was performed in 750 randomly selected participants among those with low HDL-C levels (below 5th percentile), intermediate HDL-C levels (5-95th) and high HDL-C levels (above the 95th percentile). Minor allele frequencies (MAFs) of the SNPs of interest were compared between the three HDL-C groups. RESULTS: The vast majority of pairwise comparisons of MAFs between HDL-C groups were significant. Pairwise comparisons between low and high HDL-C groups showed significant between-group differences in MAFs for all SNPs, except for APOC3 rs5128. Pairwise comparisons between low and intermediate HDL-C groups showed significant between-group differences in MAFs for all SNPs, except for APOC3 rs5128 and APOA1 rs2893157. Pairwise comparisons between intermediate and high HDL-C groups showed significant between-group differences in MAFs for all SNPs, except for ABCA1 APOC3 rs5128 and APOA1 rs2893157. After adjustment for confounding factors, including age, sex, body mass index, low physical activity, consumption of saturated fats, and socioeconomic status, ABCA1 r1587K and CETP A373P significantly increased the risk of depressed HDL-C, and CETP Taq1 had a protective role. CONCLUSION: This study replicated several associations between HDL-C levels and candidate gene SNPs from genome-wide associations with HDL-C in Iranians from the pediatric age group.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 A study in Iranian adults showed that R219K SNP could affect HDL-C levels and could influence the risk of atherosclerosis in Iranian population [46]. Login to comment
123 In a meta-analysis with 6597 cases and 15,369 controls for investigation of the association between the ABCA1 R219K polymorphism and ACVD risk; the R219K SNP was associated with a higher HDL-C level in Asians and protective for ACVD risk both in Asians and Caucasians. Login to comment
124 A recent meta-analysis involving 2730 ACVD patients and 2658 controls showed that K allele of the ABCA1 R219K gene has a protective role for ACVD risk in the Chinese population [48]. Login to comment

[hide] ATP-binding cassette transporter 1 C69T and V825I ... Thromb Res. 2015 Jan;135(1):130-6. doi: 10.1016/j.thromres.2014.10.022. Epub 2014 Nov 4. Yin YW, Wang Q, Sun QQ, Hu AM, Liu HL
ATP-binding cassette transporter 1 C69T and V825I polymorphisms in the development of atherosclerosis: a meta-analysis of 18,320 subjects.
Thromb Res. 2015 Jan;135(1):130-6. doi: 10.1016/j.thromres.2014.10.022. Epub 2014 Nov 4., [PMID:25527331]

Abstract [show]
INTRODUCTION: ATP-binding cassette transporter 1 (ABCA1), a member of the ATP-binding cassette family, plays a critical role in the development of atherosclerosis (AS). This meta-analysis was performed to assess the associations of ABCA1 C69T and V825I polymorphisms with AS susceptibility. MATERIALS AND METHODS: A comprehensive search was conducted to identify all eligible studies from PubMed, Embase, Web of Science, Cochrane database, CBMdisc, CNKI and Google Scholar. Additionally, hand searching of the references of identified articles was performed. All statistical analyses were done with Review Manager 5.1.4 and Stata 11.0. RESULTS: Eleven articles involving 14 studies were included in the final meta-analysis. For the ABCA1 C69T polymorphism, six studies involving 1854 AS cases and 5744 controls were combined showing significant association between this variant and AS risk (for T allele vs. C allele: OR =1.44, 95% CI =1.04-1.24, p =0.005; for T/T vs. C/C: OR =1.39, 95% CI =1.12-1.73, p =0.003; for T/T vs. C/T+C/C: OR =1.34, 95% CI =1.09-1.65, p =0.006; for T/T+C/T vs. C/C: OR =1.13, 95% CI =1.01-1.27, p =0.040). For the ABCA1 V825I polymorphism, eight studies involving 2026 AS cases and 8696 controls were combined. There was no significant association between the variant and AS risk (for I allele vs. V allele: OR =1.18, 95% CI =0.90-1.53, p =0.230; for I/I vs. V/V: OR =1.29, 95% CI =0.75-2.23, p =0.360; for I/I vs. V/I+V/V: OR =1.40, 95% CI =0.87-2.26, p =0.160; for I/I+V/I vs. V/V: OR =1.15, 95% CI =1.00-1.33, p =0.060). CONCLUSIONS: This meta-analysis suggested that the ABCA1 C69T polymorphism was associated with an increased AS risk. Furthermore, there was no significant association between the ABCA1 V825I polymorphism and AS risk.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 Previously, we performed a meta-analysis to evaluate the associations between the ABCA1 R219K and I883M polymorphisms and AS risk, and demonstrated the above variants were the protective roles for AS [17]. Login to comment
122 So far, at least seven single-nucleotide polymorphisms at the ABCA1 gene promoter have been studied to investigate the associations between these variants and the susceptibility of atherosclerotic diseases, such as R219K, M883I, C69T, V825I, R1587K, V771M and -565C/T. Login to comment
123 In our previous study, we have demonstrated that the ABCA1 R219K and M883I polymorphisms are the protective factors for AS [17]. Login to comment

[hide] Up-regulated miR-93 contributes to coronary athero... Int J Clin Exp Med. 2015 Jan 15;8(1):674-81. eCollection 2015. He Y, Lin L, Cao J, Mao X, Qu Y, Xi B
Up-regulated miR-93 contributes to coronary atherosclerosis pathogenesis through targeting ABCA1.
Int J Clin Exp Med. 2015 Jan 15;8(1):674-81. eCollection 2015., [PMID:25785043]

Abstract [show]
Atherosclerosis is a chronic inflammatory disease, starting with the accumulation of white blood cells and fatty materials in the arterial wall. ABCA1, a gene promotes phospholipid and cholesterol transfer from cells to poorly lapidated ApoA1, is considered to be related to the pathogenesis of coronary atherosclerosis. Meanwhile, disturbed miRNAs were reported to be related to coronary atherosclerosis. To understand the relationship between miRNA, ABCA1 and coronary atherosclerosis pathogenesis, we first screened the miRNAs that may directly target 3'UTR of ABCA1 and miR-33a was used as positive control. Through dual luciferase assay and western blot, we confirmed that miR-93 and miR-17 repress ABCA1 expression through directly targeting 3'UTR. The serum miR-33a, miR-93 and miR-17 levels in participants were detected by qRT-PCR and a significant reduction of miR-33a and miR-93 was found in the coronary patients. After statistical analysis we identified that a negative correlation was existed in the serum miR-93 and ABCA1 levels in coronary atherosclerosis patients. Meanwhile, our results indicate that the serum miR-93 positively correlates with the serum cholesterol level. This research may give insight into understanding of coronary atherosclerosis pathogenesis and create an opportunity to the diagnosis of coronary atherosclerosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
128 [4] Abd ET, Mohamed RH and Hagrass HA. Increased risk of premature coronary artery disease in Egyptians with ABCA1 (R219K), CETP (TaqIB), and LCAT (4886C/T) genes polymorphism. Login to comment

[hide] ATP-binding cassette transporter A1 (ABCA1) R219K ... Endocr J. 2015;62(6):543-9. doi: 10.1507/endocrj.EJ14-0577. Epub 2015 Apr 15. Mokuno J, Hishida A, Morita E, Sasakabe T, Hattori Y, Suma S, Okada R, Kawai S, Naito M, Wakai K
ATP-binding cassette transporter A1 (ABCA1) R219K (G1051A, rs2230806) polymorphism and serum high-density lipoprotein cholesterol levels in a large Japanese population: cross-sectional data from the Daiko Study.
Endocr J. 2015;62(6):543-9. doi: 10.1507/endocrj.EJ14-0577. Epub 2015 Apr 15., [PMID:25877294]

Abstract [show]
Among polymorphisms in ATP-binding cassette transporter A1 (ABCA1) gene, the available evidence demonstrates that the ABCA1 R219K polymorphism (G1051A, rs2230806) K allele is associated with a higher high-density lipoprotein cholesterol (HDL- C) level and may play a protective role against coronary artery disease (CAD) risk in Asians and Caucasians. The findings from many underpowered studies from Asian countries (n=71-597), however, still remain inconsistent. The objective of this study was to overcome the limitations of previous studies in Asia and provide solid epidemiologic evidence. Subjects were participants of a cohort study, who visited the Daiko Medical Center in Nagoya, Japan. The cohort study belongs to the Japan Multi-Institutional Collaborative Cohort Study (J-MICC Study). In the Daiko Study, 5,133 participants (1,458 men and 3,675 women) aged 35-69 years enrolled from 2008 through 2010 were eligible for the analyses. The ABCA1 polymorphism was genotyped by the polymerase chain reaction with confronting two-pair primers (PCR-CTPP) method. Among all the subjects, the genotype frequencies were 23.9% (n=1,225) for RR, 49.3% (n=2,532) for RK, and 26.8% (n=1,376) for KK, which was in Hardy-Weinberg's equilibrium (P =0.36). Background characteristics did not significantly differ among the genotypes including alcohol and tobacco use. The mean +/- SD of HDL-C concentration was higher in men and women with RK or KK genotype than those with RR, although the difference between these genotypes was not statistically significant in both sexes (P =0.31 in men and 0.26 in women by ANOVA). In the multiple linear regression analysis to estimate the independent effects of the R219K polymorphism on HDL-C level, however, the number of K allele was significantly correlated with an increased level of HDL-C (trend P=0.033). Those with the KK genotype showed a significantly higher HDL-C concentration compared with those with the RR genotype by a mean of 1.18 mg/dL. The R219K polymorphism of ABCA1 independently associated with serum level of HDL-C in a large Japanese population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 The rate is lower in East Asian countries compared with Western countries. For example, the age-adjusted mortality rate (per 100,000 in 2004) was 32.1 in Japan, 40.3 in Korea, and 62.8 in China whereas it was ATP-binding cassette transporter A1 (ABCA1) R219K (G1051A, rs2230806) polymorphism and serum high-density lipoprotein cholesterol levels in a large Japanese population: cross-sectional data from the Daiko Study Junichiro Mokuno, Asahi Hishida, Emi Morita, Tae Sasakabe, Yuta Hattori, Shino Suma, Rieko Okada, Sayo Kawai, Mariko Naito and Kenji Wakai Department of Preventive Medicine, Nagoya University Graduate School of Medicine, Nagoya 466-8550, Japan Abstract. Login to comment
3 Among polymorphisms in ATP-binding cassette transporter A1 (ABCA1) gene, the available evidence demonstrates that the ABCA1 R219K polymorphism (G1051A, rs2230806) K allele is associated with a higher high-density lipoprotein cholesterol (HDL-C) level and may play a protective role against coronary artery disease (CAD) risk in Asians and Caucasians. Login to comment
13 In the multiple linear regression analysis to estimate the independent effects of the R219K polymorphism on HDL-C level, however, the number of K allele was significantly correlated with an increased level of HDL-C (trend P=0.033). Login to comment
15 The R219K polymorphism of ABCA1 independently associated with serum level of HDL-C in a large Japanese population. Login to comment
53 Therefore, to clarify the association of ABCA1 R219K polymorphism with serum HDL-C levels in a large Japanese population, we examined this associa- tive combined; to explain in detail, we first defined the 5 categories of drinking status as follows: nonhabitual drinker, former habitual drinker, or habitual drinker of ethanol at < 23, 23 - < 46, and > 46 g per day (equivalent to < 1 gou, 1-2 gou and > 2 gou of Japanese sake, respectively; where 1 gou [a unit for Japanese sake] = 180mL) per day, and then converted each category into indicator variables. Login to comment
56 Genotyping of ABCA1 R219K polymorphism DNA was extracted from buffy coat kept at -80&#b0;C using a Biorobot M48 (QIAGEN Group, Tokyo). Login to comment
65 The difference in the serum HDL-C level between the ABCA1 R219K genotypes by sex was tested by the analysis of variance (ANOVA). Login to comment
71 The logic of PCR-CTPP for R219K polymorphism (corresponding base change from A to G) can be explained as follows: as described in elsewhere [14], confronting pairs of primers are used; one pair is for the K allele and the other is for the R allele. Login to comment
77 In the multiple linear regression analysis to estimate the independent effects of the R219K polymorphism on HDL-C level (Table 3), the number of K allele was significantly associated with an increased level of HDL-C (trend P=0.033). Login to comment
80 Results Clinical profiles of subjects by ABCA1 R219K genotype were shown in Table 1. Login to comment
83 The mean HDL-C concentration was higher in men and women with RK or KK genotype than those with RR, although the difference between Table 1 Clinical Profiles of subjects by ABCA1 R219K (rs2230806) genotype (n =5,133) KK RK RR P (26.8%, n = 1,376) (49.3%, n = 2,532) (23.9%, n = 1,225) Female 988 (71.8%) 1,818 (71.8%) 869 (70.9%) 0.84 Age (years) 52.6 &#b1; 10.4 52.5 &#b1; 10.3 52.5 &#b1; 10.3 0.98 Body mass index (kg/m2 ) 21.8 &#b1; 3.3 21.7 &#b1; 3.1 21.7 &#b1; 3.1 0.65 Current smokers 163 (11.8%) 298 (11.8%) 146 (11.9%) 0.99 Current drinkers 757 (55.0%) 1,357 (53.6%) 663 (54.1%) 0.70 Hypertension 226 (16.4%) 363 (14.3%) 192 (15.7%) 0.19 Diabetes mellitus 54 (3.9%) 89 (3.5%) 42 (3.4%) 0.75 Values are expressed as means &#b1; standard deviation, or n (%). Login to comment
84 Table 2 Mean &#b1; standard deviation of HDL-C level (mg/dL) by sex and ABCA1 R219K (rs2230806) genotype and sex KK RK RR P* (n = 1,376) (n = 2,532) (n = 1,225) Male (n =1,458) 57.3 &#b1;15.0 56.4 &#b1; 13.7 55.7 &#b1; 14.0 0.31 Female (n =3,675) 68.7&#b1; 14.5 68.7 &#b1; 14.9 67.7 &#b1; 14.9 0.26 * By analysis of variance (ANOVA). Login to comment
88 Concerning ABCA1 R219K polymorphism, the frequency of K allele was reported to be 0.488 in Japanese [22] while that in the Caucasian population ranged between 0.25 and 0.46 [21]. Login to comment
90 Moreover, there is a great variation and diversity in the effects of dietary and other lifestyle factors on lipid levels between ethnicities or study populations, which may also lead to the different interaction with the effect of this ABCA1 R219K polymorphism. Login to comment
97 R219K polymorphism is located in the two major extracellular loops of ABCA1 protein, which is important for the interaction with apoA-I and for cholesterol efflux. Login to comment
98 Therefore, it is likely that the R219K variant is a functional mutation to modulate HDL-C level. Login to comment
101 Either way, given that based on the functional analysis using SIFT and PolyPhen, this R219K variation of ABCA1 is suggested not to be functional in itself, it could rather be causal The analysis results of the association between ABCA1 R219K polymorphism and HDL-C level adjusted by drinking status and in males were substantially in the same direction compared to that of overall, with the b2;-coefficient of 0.840 for RK genotype, 1.818 for KK genotype, 0.911 with the number of K allele, with the P-values of 0.321, 0.058 and 0.057, respectively. Login to comment
102 The association between R219K of ABCA1 and triglyceride (TG) levels was neither statistically significant (data not shown). Login to comment
103 Discussion We found a significant association between the R219K polymorphism K allele of ABCA1 and a higher serum HDL-C level in a large Japanese population. Login to comment
104 Previous studies have reported that the R219K polymorphism was associated with increased circulating HDL-C. Login to comment
106 It was reported by Clee et al. that the R219K K allelle was associated with a higher level of HDL-C and a lower level of TG [15]. Login to comment
107 Additional studies in Caucasian, Asian and multi-ethnic populations have also shown the association between the ABCA1 R219K polymorphism and the HDL-C level [6]. Login to comment
108 Our data based on a Japanese population revealed consistent elevations in blood HDL-C levels associated with the K allele of ABCA1 R219K polymorphism. Login to comment
116 Given the considerably large sample size, the present study may have a significant impact by providing the first robust evidence for the protective effect of the K variant in the ABCA1 R219K polymorphism in Japanese. Login to comment
117 However, because we focused on ABCA1 R219K polymorphism, we could not evaluate the influence of other polymorphisms of ABCA1 gene. Login to comment
119 In summary, the R219K polymorphism of ABCA1 was independently associated with serum level of HDL-C in a large Japanese population. Login to comment
128 The effect of the K variant in the ABCA1 R219K polymorphism examined was in the same direction compared to that in the recent meta-analysis in the Asian populations [29], and in the opposite direction to that in the Japanese subjects [22]. Login to comment
129 The forementioned recent meta-analysis of HDL-C and ABCA1 R219K consisted of mixture of cohort studies and hospital-based case-control studies; the population of which consisted of Caucasians, Chinese, Japanese and Iraqis, most of the Asian populations of which were Chinese. Login to comment
143 Ma XY, Liu JP, Song ZY (2011) Associations of the ATP-binding cassette transporter A1 R219K polymorphism with HDL-C level and coronary artery disease risk: a meta-analysis. Login to comment
176 Liu N, Hou M, Ren W, Cao J, Wu H, Zhou W (2015) The R219K polymorphism on ATP-binding cassette transporter A1 gene is associated with coronary heart disease risk in Asia population: evidence from a meta-analysis. Login to comment
185 Yin YW, Li JC, Gao D, Chen YX, Li BH et al. (2014) Influence of ATP-binding cassette transporter 1 R219K and M883I polymorphisms on development of atherosclerosis: a meta-analysis of 58 studies. Login to comment
211 Li J, Wang LF, Li ZQ, Pan W (2009) Effect of R219K polymorphism of the ABCA1 gene on the lipid-lowering effect of pravastatin in Chinese patients with coronary heart disease. Login to comment
214 Li Y, Zhang SZ, Ma YX, He Y, Dong JT, et al. (2005) Relationship between the R219K polymorphism of ATP-binding cassette transporter 1 gene and coronary heart disease. Login to comment
217 Zhao S, Xiao Z (2004) The study on ABCA1 R219K Login to comment

[hide] Functional and Structural Impact of ATP-Binding Ca... Mol Diagn Ther. 2015 Aug;19(4):221-34. doi: 10.1007/s40291-015-0150-7. Fawzy MS, Alhadramy O, Hussein MH, Ismail HM, Ismail NM, Biomy NM, Toraih EA
Functional and Structural Impact of ATP-Binding Cassette Transporter A1 R219K and I883M Gene Polymorphisms in Obese Children and Adolescents.
Mol Diagn Ther. 2015 Aug;19(4):221-34. doi: 10.1007/s40291-015-0150-7., [PMID:26243156]

Abstract [show]
INTRODUCTION: Obesity is a serious medical condition that affects children and adolescents. ATP-binding cassette transporter A1 (ABCA1) protein is known to mediate the transport of intracellular cholesterol and phospholipids across the cell membranes. Thus, we aimed to investigate the association between ABCA1 gene polymorphisms and overweight/obesity risk, and to evaluate their relation to the lipid profile. MATERIALS AND METHODS: The study included in silico analysis of ABCA1 gene and protein. Two genetic variants in ABCA1 gene-R219K (rs2230806; G/A) and I883M (rs2066714; A/G)-were genotyped in 128 normal weight and 128 overweight/obese subjects using polymerase chain reaction-restriction fragment length polymorphism technology. Anthropometric and biochemical assessments were performed. RESULTS: Our findings suggest that the heterozygote GA genotype of R219K polymorphism increased susceptibility to obesity under the heterozygous model (odds ratio 2.75, 95 % CI 1.01-6.12; p = 0.014) compared with the control group. This susceptibility could be gender-specific, with higher risk among females. In addition, the A variant was associated with a higher degree of obesity (p < 0.001). On the other hand, individuals with the G variant of I883M polymorphism showed lower susceptibility to obesity under all genetic models (allelic, homozygote, heterozygote, dominant, and recessive models; p < 0.05), with no observed association with body mass index or degree of obesity. However, both single nucleotide polymorphisms (SNPs) showed significant differences in lipid levels among patients with different genotypes. CONCLUSIONS: The study results suggest that R219K and I883M SNPs of the ABCA1 gene may play a role in susceptibility to obesity in our Egyptian population; the former increases susceptibility and phenotype severity, and the latter is protective. Larger epidemiological studies are needed for validation of the results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 Two genetic variants in ABCA1 gene-R219K (rs2230806; G/A) and I883M (rs2066714; A/G)-were genotyped in 128 normal weight and 128 overweight/obese subjects using polymerase chain reaction-restriction fragment length polymorphism technology. Login to comment
6 Results Our findings suggest that the heterozygote GA genotype of R219K polymorphism increased susceptibility to obesity under the heterozygous model (odds ratio 2.75, 95 % CI 1.01-6.12; p = 0.014) compared with the control group. Login to comment
11 Conclusions The study results suggest that R219K and I883M SNPs of the ABCA1 gene may play a role in susceptibility to obesity in our Egyptian population; the former increases susceptibility and phenotype severity, and the latter is protective. Login to comment
14 & Manal S. Fawzy manal2_khashana@ymail.com & Eman A. Toraih emantoraih@gmail.com 1 Department of Medical Biochemistry, Faculty of Medicine, Suez Canal University, Ismailia, Egypt 2 Department of Medicine, Faculty of Medicine, Taibah University, Almadinah Almunawwarah, Kingdom of Saudi Arabia 3 Department of Chest Diseases, Faculty of Medicine, Cairo University, Giza, Egypt 4 Department of Cardiology, Faculty of Medicine, Suez Canal University, Ismailia, Egypt 5 Department of Rheumatology and Rehabilitation, Faculty of Medicine, Suez Canal University, Ismailia, Egypt 6 Department of Pediatrics, Faculty of Medicine, Suez Canal University, Ismailia, Egypt 7 Department of Histology and Cell Biology (Genetics Unit), Faculty of Medicine, Suez Canal University, Ismailia, Egypt Mol Diagn Ther (2015) 19:221-234 DOI 10.1007/s40291-015-0150-7 Key Points ABCA1 R219K and M883I polymorphisms may play a role in susceptibility to obesity in the Egyptian population. Login to comment
15 ABCA1 R219K and M883I polymorphisms showed significant association with lipid levels among different genotype carriers. Login to comment
16 The GA genotype of R219K polymorphism increased susceptibility to obesity under the heterozygous model, the A variant was associated with a higher degree of obesity, the G variant of I883M polymorphism significantly decreased the risk of obesity under all genetic models. Login to comment
37 One of the most common single nucleotide polymorphisms (SNPs) affecting the amino acid sequence is the R219K (rs2230806) that results from nucleotide change G[A in exon 7 at position 1060, causing substitution of lysine for arginine at amino acid 219 (electronic supplementary Table S1). Login to comment
39 Despite the high number of case-control studies conducted to investigate the functionality of R219K variant, the results have been inconclusive [10, 20-22]. Login to comment
43 In this study, we investigated the prevalence of these frequently occurring variants of the ABCA1 gene, R219K and I883M polymorphisms, in association with anthropometric parameters and lipid profile in Egyptian overweight/obese children and adolescents. Login to comment
60 The most frequent endocrine diseases causing obesity (such as Cushing syndrome, hypothyroidism, and pseudohypoparathyroidism), or genetic syndromes associated with obesity (such as Prader- Fig. 3 Workflow for PCR genotyping of R219K and I883M polymorphisms in the study population. Login to comment
80 Genotyping of ABCA1 R219K and I883M variations were conducted by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Login to comment
102 In R219K rs2230806, 174 bp- amplified fragment includes the genetic variant (AGG/AAG) existing in exon 7 (coordinates: 104,858,698-104,858,522) of two protein-coding transcripts (ABCA1-001 and ABCA1-002). Login to comment
111 R219K (rs2230806): M, DNA marker 50 bp each; Lanes 1, 6 AA genotype with two bands at 109 and 65 bp; Lanes 2, 5,7,9 GG genotype with only one band at 174 bp; Lanes 3, 4, 8 GA genotype with three bands at 174, 109, and 65 bp. Login to comment
124 Experimentally-genotyped polymorphisms (R219K and I883M) in the study population are shown in electronic supplementary Fig. 5. Login to comment
127 However, R219K (rs2230806) and I883M (rs2066714) are in linkage disequilibrium with other nearby intronic SNPs which might have deleterious effects on the protein function. Login to comment
129 Both ABCA1 R219K (g.1060G[A) and I883M (g.3044A[G) genotypes were in agreement with those expected by the HWE (p [ 0.05). Login to comment
130 In R219K polymorphism, there was a significant difference in genotype frequencies between overweight/obese and control groups (p = 0.042). Login to comment
135 R219K and I883M polymorphisms are far apart, existing in different haplotype blocks in the ABCA1 gene. Login to comment
138 3.3 ABCA1 Gene Polymorphisms in Relation to Clinical Characteristics AA-R219K genotype was associated with more BMI (p = 0.03) and showed a higher degree of obesity (p \ 0.001) (Table 3 and Fig. 6). Login to comment
142 However, overweight/obese subjects with AA-R219K had significantly higher levels of TC, LDL-c, and TC/HDL-c ratio, and lower HDL-c compared with non-carriers, while GG-I883M carriers had decreased levels of TC, HDL-c and LDL-c levels compared with those with other genotypes (p \ 0.05) (Table 3 and electronic supplementary Fig. 7). Login to comment
148 To the best of our knowledge, there are no published data on the screening of the ABCA1 R219K and I883M polymorphisms in association with obesity and lipid profile among the Egyptian population. Login to comment
153 In silico data analysis predicted our cSNPs (R219K and I883M) to be functionally neutral using the PolyPhen and MutPred web-based programs. Login to comment
155 In our study population, the R219K variant showed increased risk of developing obesity among GA heterozygote carriers, especially in children and females, whereas in I883M SNP analysis, carriers of the M allele (GA and GG genotypes) displayed reduced susceptibility to obesity in children and adolescents and in both genders compared with those with the AA genotype (I allele). Login to comment
156 This was consistent with others who reported that the presence of ABCA1 polymorphisms could be a risk Table 2 Genotype and allele frequencies of ABCA1 gene polymorphisms in the study groups Polymorphism Controls (n = 128) OW/OB (n = 128) Chi-square p value Crude OR (95 % CI) Adjusted OR (95 % CI) R219K (G/A) Genotypes GG 21 (16.4) 10 (7.8) 6.306 0.042 Reference Reference GA 51 (39.8) 67 (52.4) 2.75 (1.19-6.36) 2.75 (1.01-6.12) AA 56 (43.8) 51 (39.8) 1.91 (0.82-44.0) 1.04 (0.76-42.5) GA ? Login to comment
158 GG 91 (71.1) 62 (48.4) 0.38 (0.22-0.63) 0.37 (0.20-0.58) HWE-P 0.208 0.956 Alleles A 144 (56.2) 184 (71.9) 13.57 <0.001 Reference Reference G 112 (43.8) 72 (28.1) 0.50 (0.34-0.72) 0.49 (0.31-0.77) Data are expressed as n (%) Bold values indicate statistically significant at p \ 0.05 ABCA1 ATP-binding cassette transporter A1, OW/OB overweight/obese group, R219K c.656G[A, I883M c.2649A[G, adjusted OR (95 % CI) odds ratio for confidence interval adjusted for confounding variables (age, gender, degree of obesity, and dyslipidemia) Fig. 5 Linkage disequilibrium between R219K and I883M. Login to comment
159 Experimentally-tested SNPs in ABCA1 gene: I883M (rs2066714) and R219K (rs2230806) are noted. Login to comment
169 Consistent with our results, Villard et al. reported R219K SNP to be associated with a significant modification of cholesterol efflux capacity in a sex-dependent manner [53]. Login to comment
175 Intracellular ABCA1 domains could interact and hydrolyze ATP, generating energy for Table 3 Anthropometric measurements and lipid profile in overweight/obese subjects according to R219K and I883M genotypesa R219K (G/A) genotypes p value I883M (A/G) genotypes p value GG (n = 10) GA (n = 67) AA (n = 51) AA (n = 66) AG (n = 52) GG (n = 10) Age, years 11.3 &#b1; 3.1 12.5 &#b1; 3.8 12.5 &#b1; 3.5 0.61 12.9 &#b1; 3.3 12.1 &#b1; 3.6 14.8 &#b1; 2.5 0.05 Anthropometric data BMI, kg/m2 29.8 &#b1; 2.7 33.6 &#b1; 6.7 35.6 &#b1; 7.0b 0.03b 34.7 &#b1; 6.3 33.7 &#b1; 6.4 33.7 &#b1; 5.4 0.67 WHR 0.84 &#b1; 0.1 0.86 &#b1; 0.1 0.89 &#b1; 0.1 0.17 0.88 &#b1; 0.1 0.87 &#b1; 0.1 0.89 &#b1; 0.1 0.84 WHtR 0.63 &#b1; 0.1 0.64 &#b1; 0.1 0.68 &#b1; 0.2 0.30 0.70 &#b1; 0.2 0.66 &#b1; 0.1 0.68 &#b1; 0.2 0.43 Lipid profile TC, mg/dl 196.0 &#b1; 70.4 221.0 &#b1; 38.0 235.9 &#b1; 38.6b 0.02b 209.4 &#b1; 44.7 232.9 &#b1; 35.5b 166.0 &#b1; 38.4c <0.001b TG, mg/dl 74.7 &#b1; 18.2 92.9 &#b1; 30.4 99.8 &#b1; 34.4 0.07 94.1 &#b1; 35.6 96.6 &#b1; 30.2 100.0 &#b1; 33.0 0.84 HDL-c, mg/dl 67.0 &#b1;26.9 67.9 &#b1; 20.5 57.5 &#b1; 19.9c 0.03b 56.5 &#b1;18.0 69.4 &#b1; 19.6b 39.7 &#b1; 9.6b,c <0.001b LDL-c, mg/dl 114.0 &#b1; 43.0 132.2 &#b1; 30.6 158.0 &#b1; 37.2b,c <0.001b 134.2 &#b1; 39.8 140.9 &#b1; 31.6 106.7 &#b1; 25.6b,c 0.02b Values are expressed as mean &#b1; SD or n (%) Comparisons between genotypes of each polymorphism were performed by one-way ANOVA followed by Newman-Keuls multiple comparisons test Bold values indicate statistically significant at p \ 0.05 BMI body mass index, WHR waist/hip ratio, WHtR waist/height ratio, TC total cholesterol, TG triglycerides, HDL-c high-density lipoprotein cholesterol, LDL-c low-density lipoprotein cholesterol, ANOVA analysis of variance a Age and sex were used as covariates in the analysis to adjust for the genotyping effect. Login to comment
176 Degree of obesity was classified according to the BMI z score b Indicates significant difference from homozygous carriers of the wild allele in the same group at p \ 0.05 c Indicates significant difference from heterozygous carriers in the same group at p \ 0.05 0% 20% 40% 60% 80% 100% OW OB1 OB2 Degree of obesity R219K genotype GG (n=10) GA (n=67) AA (n=51) p<0.001* 0% 20% 40% 60% 80% 100% OW OB1 OB2 Degree of obesity I883M genotype AA (n=66) AG (n=52) GG (n=10) p=0.098 (b) (a) Fig. 6 Genotype frequencies according to the degree of obesity. Login to comment
181 Thus, we could propose the hypothesis that homo- or heterodimerization could have differential effects on the function of the protein, and this could provide a possible explanation for the increased obesity risk in our study among GA heterozygotes of R219K polymorphism compared with homozygotes. Login to comment
189 However, patients with GA and AA genotypes of R219K SNP exhibited higher frequency of severe obesity and more BMI levels compared with other genotypes. Login to comment
192 R219K polymorphism is located at the binding site of the lipid acceptor ApoA-1, and thus is strongly associated with protein activity and stabilization against ABCA1 degradation [6]. Login to comment
198 In the current study, overweight/obese subjects with the AA-R219K genotype had an unfavorable lipid profile; mainly higher levels of TC, LDL-c, TG/HDL-c ratio, and TC/HDL-c ratio, and lower HDL-c compared with other genotypes. Login to comment
206 In healthy-weight subjects, R219K SNP was shown to be associated with altered HDL-c phenotype [65, 66]. Login to comment
207 Homozygotes of the A allele of R219K were associated with increased LDL-C and TC and decreased HDL-c concentrations in Turkish population [54]. Login to comment
209 In obesity, the K allele of the R219K polymorphism was also associated with lower HDL-c levels than controls among overweight/ obese Thai males, with no difference in HDL-c concentrations among genotypes of I883M polymorphism [10]. Login to comment
212 The AA genotype of the R219K polymorphism was significantly associated with increased concentrations of HDL-C in the Tunisian population [47], and the GG genotype had lower HDL-c levels than those with the AA genotype in the Chinese population [69]. Login to comment
220 Moreover, in the ABCA1 gene, a strong linkage disequilibrium exists between R219K/V771M and M825I/I883M (D0 [ 0.9) [21]. Login to comment
221 The two SNPs (V771M and M825I) were previously found to be associated with increased plasma HDL-c and cholesterol concentration, respectively, thus speculating the probability that R219K and I883M may not be the true associated variants, but could instead reflect the functional impact of other nearby linked gene polymorphisms. Login to comment
228 5 Conclusions The present study suggested that the R219K (rs2230806) polymorphism of the ABCA1 gene is associated with higher susceptibility to obesity and unfavorable outcome in the Egyptian population, while I883M (rs2066714) polymorphism is associated with a reduced risk of obesity in childhood and adolescence. Login to comment

[hide] Dietary fat and carbohydrate modulate the effect o... Nutr Metab (Lond). 2015 Nov 16;12:45. doi: 10.1186/s12986-015-0040-3. eCollection 2015. Jacobo-Albavera L, Posadas-Romero C, Vargas-Alarcon G, Romero-Hidalgo S, Posadas-Sanchez R, Gonzalez-Salazar Mdel C, Carnevale A, Canizales-Quinteros S, Medina-Urrutia A, Antunez-Arguelles E, Villarreal-Molina T
Dietary fat and carbohydrate modulate the effect of the ATP-binding cassette A1 (ABCA1) R230C variant on metabolic risk parameters in premenopausal women from the Genetics of Atherosclerotic Disease (GEA) Study.
Nutr Metab (Lond). 2015 Nov 16;12:45. doi: 10.1186/s12986-015-0040-3. eCollection 2015., [PMID:26579206]

Abstract [show]
BACKGROUND: Although the R230C-ATP-binding cassette A1 (ABCA1) variant has been consistently associated with HDL-C levels, its association with diabetes and other metabolic parameters is unclear. Estrogen and dietary factors are known to regulate ABCA1 expression in different tissues. Thus, we aimed to explore whether gender, menopausal status and macronutrient proportions of diet modulate the effect of this variant on various metabolic parameters. METHODS: One thousand five hundred ninety-eight controls from the GEA study were included (787 men, 363 premenopausal women and 448 menopausal women), previously assessed for anthropometric and biochemical measurements and visceral to subcutaneous abdominal fat (VAT/SAT) ratio on computed tomography. Taqman assays were performed for genotyping. Diet macronutrient proportions were assessed using a food frequency questionnaire validated for the Mexican population. Multivariate regression models were constructed to assess the interaction between the proportion of dietary macronutrients and the R230C polymorphism on metabolic parameters. RESULTS: All significant interactions were observed in premenopausal women. Those carrying the risk allele and consuming higher carbohydrate/lower fat diets showed an unfavorable metabolic pattern [lower HDL-C and adiponectin levels, higher VAT/SAT ratio, homeostasis model assessment for insulin resistance (HOMA-IR) and higher gamma-glutamyl transpeptidase (GGT) and alkaline phosphatase (ALP) levels]. Conversely, premenopausal women carrying the risk allele and consuming lower carbohydrate/higher fat diets showed a more favorable metabolic pattern (higher HDL-C and adiponectin levels, and lower VAT/SAT ratio, HOMA-IR, GGT and ALP levels). CONCLUSION: This is the first study reporting a gender-specific interaction between ABCA1/R230C variant and dietary carbohydrate and fat percentages affecting VAT/SAT ratio, GGT, ALP, adiponectin levels and HOMA index. Our study confirmed the previously reported gender-specific ABCA1-diet interaction affecting HDL-C levels observed in an independent study. Our results show how gene-environment interactions may help further understand how certain gene variants confer metabolic risk, and may provide information useful to design diet intervention studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 A larger study using food frequency questionnaires reported that high saturated fat intake was associated with higher triacylglycerol serum levels in Inuit individuals bearing the CC genotype of ABCA1/R219K (rs2230806), with no gender effect reported [36]. Login to comment
291 Liu H, Lin J, Zhu X, Li Y, Fan M, Zhang R, et al. Effects of R219K polymorphism of ATP-binding cassette transporter 1 gene on serum lipids ratios induced by a high-carbohydrate and low-fat diet in healthy youth. Login to comment