ABCMdb

PMID: 21489276

Kolovou V, Kolovou G, Marvaki A, Karakosta A, Vasilopoulos G, Kalogiani A, Degiannis D, Marvaki C, Demopoulos CA
ATP-binding cassette transporter A1 gene polymorphisms and serum lipid levels in young Greek nurses.
Lipids Health Dis. 2011 Apr 13;10:56., [PubMed]

Sentences

No. Mutations Sentence Comment

1 ABCA1 p.Arg219Lys The present study was undertaken to detect the possible association of polymorphisms in the ABCA1 gene [rs2230806 (R219K) and rs2230808 (R1587K)] and lipid profile in Greek young nurses. Login to comment 4 ABCA1 p.Arg219Lys Results: There was no difference in the genotypic and allelic frequencies of the R219K polymorphism according to lipid profile. Login to comment 16 ABCA1 p.Arg219Lys This gene encodes a protein which is expressed in many tissues such as liver, macrophages, intestines, lungs etc. Several ABCA1 gene polymorphisms were identified, including rs2230806 (R219K) and rs2230808 (R1587K), which are mainly associated with the HDL cholesterol (HDL-C) concentration. Login to comment 17 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys The R219K results in a single amino acid change in codon 219 from arginine to lysine. Login to comment 18 ABCA1 p.Arg219Lys The K allele of the R219K polymorphism has been related to low coronary artery disease (CAD) risk [4] and to lower triglycerides (TGs) concentration [5]. Login to comment 38 ABCA1 p.Arg219Lys DNA analysis and determination of blood lipids The ABCA1 gene polymorphisms (R219K and R1587K) were detected using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP`s). Login to comment 39 ABCA1 p.Arg219Lys DNA analysis and determination of blood lipids The ABCA1 gene polymorphisms (R219K and R1587K) were detected using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP`s). Login to comment 40 ABCA1 p.Arg219Lys For R219K polymorphism the oligonucleotide primers which were used are AAAGACTTCAAGGACCCAGCTT and CCTCACATTCCGAAAGCATTA [9]. Login to comment 41 ABCA1 p.Arg219Lys For R219K polymorphism the oligonucleotide primers which were used are AAAGACTTCAAG- GACCCAGCTT and CCTCACATTCCGAAAGCATTA [9]. Login to comment 57 ABCA1 p.Arg219Lys The frequencies of R219K genotypes were 50.97% for RR, 40.91% for RK and 8.12% for KK, whereas the frequencies of R1587K genotypes were 47.08% for RR, 41.56% for RK and 11.36% for KK. Login to comment 58 ABCA1 p.Arg219Lys The frequencies of R219K genotypes were 50.97% for RR, 40.91% for RK and 8.12% for KK, whereas the frequencies of R1587K genotypes were 47.08% for RR, 41.56% for RK and 11.36% for KK. Login to comment 59 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys R219K and R1587K polymorphisms The distribution of R219K and R1587K polymorphisms was investigated according to Low HDL-C (n = 46) and High HDL-C concentration (n = 104). Login to comment 60 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys R219K and R1587K polymorphisms The distribution of R219K and R1587K polymorphisms was investigated according to Low HDL-C (n = 46) and High HDL-C concentration (n = 104). Login to comment 61 ABCA1 p.Arg219Lys Moreover, no difference in the distribution of the R219K genotypes was detected according to lipid profile (Table 2). Login to comment 62 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Moreover, no difference in the distribution of the R219K genotypes was detected according to lipid profile (Table 2). Login to comment 63 ABCA1 p.Arg219Lys Also, no differences in the distribution of K and R carriers of R219K polymorphism was detected according to lipid profile (p = 0.87). Login to comment 66 ABCA1 p.Arg219Lys Total cholesterol levels was higher in women with the RK compared to women with the RR genotype of the R1587K polymorphism (207.41 mg/dl vs 187.69 mg/dl, p Figure 2 R219K gene polymorphism. Login to comment 67 ABCA1 p.Arg219Lys Total cholesterol levels was higher in women with the RK compared to women with the RR genotype of the R1587K polymorphism (207.41 mg/dl vs 187.69 mg/dl, p Figure 2 R219K gene polymorphism. Login to comment 70 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Table 2 R and K allele frequencies according to R219K and R1587K polymorphisms ABCA1 R allele frequency K allele frequency p value* R219K 0.72 0.28 0.11 R1587K 0.68 0.32 Fisher`s exact test = 0.006), whereas total cholesterol levels did not differ between women with RK and KK genotypes (207.41 mg/dl vs 193.66 mg/dl, p = 0.22). Login to comment 71 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Table 2 R and K allele frequencies according to R219K and R1587K polymorphisms ABCA1 R allele frequency K allele frequency p value* R219K 0.72 0.28 0.11 R1587K 0.68 0.32 Fisher`s exact test = 0.006), whereas total cholesterol levels did not differ between women with RK and KK genotypes (207.41 mg/dl vs 193.66 mg/dl, p = 0.22). Login to comment 76 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys R219K gene polymorphism The frequency of R allele of R219K polymorphism in our study was 72% similar to Pasdar et al [10] who reported 73.2% in controls (68% in patients with ischemic stroke) and Porchay et al [11] [D.E.S.I.R participants (Data from an Epidemiological Study on the Insulin Resistance)] who reported 71.7%. Login to comment 77 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys R219K gene polymorphism The frequency of R allele of R219K polymorphism in our study was 72% similar to Pasdar et al [10] who reported 73.2% in controls (68% in patients with ischemic stroke) and Porchay et al [11] [D.E.S.I.R participants (Data from an Epidemiological Study on the Insulin Resistance)] who reported 71.7%. Login to comment 78 ABCA1 p.Arg219Lys Concerning lipid profile, the possibly influence of the R219K polymorphism is still evaluated. Login to comment 79 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Concerning lipid profile, the possibly influence of the R219K polymorphism is still evaluated. Login to comment 80 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys For example, Hodoğlugil et al in Turks individuals with low HDL-C concentration found the association of R219K polymorphism with HDL-C concentration [12]. Login to comment 81 ABCA1 p.Arg219Lys Frikke-Schmidt et al in Danish population did not found any association between R219K polymorphism and individuals with Low or High HDL-C concentration [7]. Login to comment 84 ABCA1 p.Arg219Lys Sandhofer et al [14] studied male population and did not find any association of R219K polymorphism and lipid profile. Login to comment 85 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Sandhofer et al [14] studied male population and did not find any association of R219K polymorphism and lipid profile. Login to comment 86 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Also, Cenarro et al [15] evaluated the R219K polymorphism in patients with familial hypercholesterolemia with and without premature CAD and reported that K allele was more frequent in subjects without premature CAD compared to individuals with premature CAD [15]. Login to comment 87 ABCA1 p.Arg219Lys Li et al [16] investigated the relation of R219K polymorphism with the manifestation of CAD in Chinese patients and did not report any significant correlation. Login to comment 88 ABCA1 p.Arg219Lys Similarly, Delgado-Lista J et al [17] did not find association of R219K polymorphism and lipid profile. Login to comment 89 ABCA1 p.Arg219Lys Similarly, Delgado-Lista J et al [17] did not find association of R219K polymorphism and lipid profile. Login to comment 90 ABCA1 p.Arg219Lys Also, no association between R219K polymorphism and Low or High HDL-C subgroups was found although small number involved in these groups may be a limitation. Login to comment 91 ABCA1 p.Arg219Lys Also, no association between R219K polymorphism and Low or High HDL-C subgroups was found although small number involved in these groups may be a limitation. Login to comment 116 ABCA1 p.Arg219Lys Thus the influence of diet or physical activities were unlikely, which may partially explain the lack of association of R219K or R1587K polymorphisms and HDL-C concentration. Login to comment 117 ABCA1 p.Arg219Lys Thus the influence of diet or physical activities were unlikely, which may partially explain the lack of association of R219K or R1587K polymorphisms and HDL-C concentration. Login to comment 174 ABCA1 p.Arg219Lys Li J, Wang LF, Li ZQ, Pan W: Effect of R219K polymorphism of the ABCA1 gene on the lipid-lowering effect of pravastatin in Chinese patients with coronary heart disease. Login to comment 175 ABCA1 p.Arg219Lys Li J, Wang LF, Li ZQ, Pan W: Effect of R219K polymorphism of the ABCA1 gene on the lipid-lowering effect of pravastatin in Chinese patients with coronary heart disease. Login to comment