ABCMdb

PMID: 19059534

Porchay-Balderelli I, Pean F, Emery N, Maimaitiming S, Bellili N, Travert F, Mohammedi K, Roussel R, Marre M, Fumeron F
Relationships between common polymorphisms of adenosine triphosphate-binding cassette transporter A1 and high-density lipoprotein cholesterol and coronary heart disease in a population with type 2 diabetes mellitus.
Metabolism. 2009 Jan;58(1):74-9., [PubMed]

Sentences

No. Mutations Sentence Comment

3 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys We studied 5 SNPs: +69CNT, +378GNC, R219K, I883M, and R1587K. Login to comment 4 ABCA1 p.Ile883Met The C allele of +378GNC was significantly associated with lower HDL-C concentrations (P = .04); and the M allele of I883M, with higher HDL-C concentrations (P = .03). Login to comment 27 ABCA1 p.Ile883Met ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys We chose to study 2 noncoding SNPs located in 5' untranslated regions- +69CNT and +378GNC-and 3 nonsynonymous SNPs- R219K, I883M, and R1587K-based on their potential regulatory role or their influence on lipid levels or CHD, as described in other population studies [5]. Login to comment 45 ABCA1 p.Arg219Lys Genotyping The +69CNT (rs1800977), +378GNC (rs1800978), and R219K (+1051GNA, rs2230806) SNPs were genotyped using a polymerase chain reaction-molecular beacon technique [10]. Login to comment 46 ABCA1 p.Ile883Met The I883M (rs4149313) and the R1587K (rs2230808) SNPs were genotyped using Taqman LNA probes (Applied Table 1 Baseline characteristics of subjects in the DIABHYCAR study as a function of the prevalence and incidence of CHD events Prevalent CHD (at entry) Incident CHD (during follow-up) Without With Without With n = 2647 n = 482 n = 2906 n = 223 % Male 71.8 79.7*** 72.8 75.8 Age (y) 65.2 ± 8.3 68.0 ± 8.0*** 65.4 ± 8.2 68.6 ± 9.1*** BMI (kg/m2 ) 29.4 ± 4.7 29.1 ± 4.4 29.4 ± 4.6 28.9 ± 4.6 % Smokers 15.1 10.4** 14.5 12.6 HbA1c (%) 7.87 ± 1.79 7.86 ± 1.64 7.85 ± 1.76 8.06 ± 1.83 Diabetes duration (y) 10.0 ± 7.6 11.8 ± 8.1*** 10.2 ± 7.7 11.5 ± 8.1** SBP (mm Hg) 145.0 ± 14.1 144.9 ± 14.0 144.8 ± 14.1 147.7 ± 13.2** DBP (mm Hg) 82.2 ± 8.4 81.7 ± 8.7 82.1 ± 8.5 82.7 ± 8.0 % Hypertension 54.4 66.0*** 55.5 65.0* Total cholesterol (mmol/L) 5.79 ± 1.08 5.83 ± 1.06 5.78 ± 1.06 5.98 ± 1.06** LDL-C (mmol/L) 3.52 ± 0.89 3.57 ± 0.86 3.51 ± 0.88 3.67 ± 0.94* HDL-C (mmol/L) 1.32 ± 0.36 1.28 ± 0.34* 1.32 ± 0.36 1.25 ± 0.29** TG (mmol/L) 1.89 (1.85-1.93) 2.00 (1.91-2.10)* 1.90 (1.86-1.93) 2.03 (1.90-2.17)* Serum creatinine (μmol/L) 86.5 (85.7-87.2) 90.1 (88.2-92.0)*** 86.7 (86.0-87.4) 91.9 (89.4-94.5)*** Urinary albumin (mg/L) 94.8 (90.9-99.0) 118.7 (106.5-132.4)*** 95.8 (91.9-99.8) 135.6 (113.7-161.7)*** Serum CRP (mg/L) 3.12 (2.99-3.25) 3.33 (3.02-3.67) 3.11 (2.99-3.24) 3.76 (3.27-4.34)** % Previous MI - - 5.0 11.7*** % Ramipril - - 49.6 49.5 % Lipid-lowering treatment 33.8 39.2⁎ 34.6 34.5 Data are presented as mean ± SD, geometric mean (95 % CI), or percentages, as appropriate. Login to comment 62 ABCA1 p.Ile883Met The M allele of the I883M SNP was associated with higher HDL-C levels (Table 3) (P b.05). Login to comment 65 ABCA1 p.Arg219Lys A cross-sectional analysis of data for the patients on entry into the DIABHYCAR study showed that the prevalence of previous CHD depended on R219K genotype (Tables 4 and 5). Login to comment 77 ABCA1 p.Ile883Met ABCA1 p.Arg219Lys The influence of +378GNC on HDL-C is consistent with the results we previously obtained for a sample from the French general population in the Data From an Epidemio- Table 2 Sequences of primers and probes used for genotyping ABCA1 SNPs SNP Primers (5'-3') Allele-specific probes (5'-3') +69CNT (rs1800977) a U: GAGGAGGGAGAGCACAGG Fam-GCGACAACTAGTCCCGGCAAAAGTCGC-dabcyl L: CTCACTCTCGCTCGCAATTA Tamra-GCGACAACTAGTCTCGGCAAAAGTCGC-dabcyl +378GNC (rs1800978) a U: CCTGCTGTGAGCTCTGG Fam-GCGACACGCTGGGGGTGCTGGCGTCGC-dabcyl L: AGGTTCTTCCACAGCAGCA Tamra-GCGACACGCTGGGCGTGCTGGCGTCGC-dabcyl R219K (rs2230806)a U: GATTCAACTTGGTGACCAAG Fam-GCGACCCTACCAAAGGAGAAACGTCGC-dabcyl L: GAACGAAGTACTCGCTCTGC Tamra-GCGACCCTACCAAGGGAGAAACGTCGC-dabcyl I883M (rs4149313)b U: CTACTGGTTTGGCGAGGAAA Fam-CTTTCTGATATTCTCTTC-Bhq L: AGCAGGAGGTCAACAGCACT Hex-CTTTCTGACATTCTCTTC-Bhq R1587K (rs2230808)b U: CCCTGCCAACTTTACCATGA Fam-CATTATTTTTGGTGTCC-Bhq L: CGATTTCTCAACAGCTTGGG Hex-CATTATTTCTGGTGTCC-Bhq a Molecular beacon. Login to comment 79 ABCA1 p.Ile883Met ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Table 3 High-density lipoprotein cholesterol levels (mean ± SD; in millimoles per liter) as a function of ABCA1 SNPs +69CNT +378GNC R219K I883M R1587K 0 1.30 ± 0.35 1.32 ± 0.36 1.31 ± 0.36 1.31 ± 0.35 1.33 ± 0.35 1 1.33 ± 0.37 1.30 ± 0.35 1.32 ± 0.35 1.34 ± 0.36 1.31 ± 0.36 2 1.31 ± 0.33 1.26 ± 0.24 1.33 ± 0.36 1.35 ± 0.33 1.29 ± 034 P .18 .04 .69 .03 .06 Trend test (multiple linear regression) with genotypes coded 0, 1, or 2 according to the number of minor alleles, adjusted for sex, age, BMI, smoking, HbA1c, and lipid-lowering treatment. Login to comment 81 ABCA1 p.Arg219Lys The lack of association between +69CNT and R219K and HDL ( Systat Software Inc, San Jose, CA, USA). Login to comment 83 ABCA1 p.Ile883Met The effects of I883M and R1587K on HDL-C levels are consistent with the results of various studies [14-19]. Login to comment 91 ABCA1 p.Arg219Lys Associations between R219K and lipid levels or atherosclerosis progression and atherosclerosis have been widely reported [16,21-25]. Login to comment 96 ABCA1 p.Ile883Met ABCA1 p.Ile883Met ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys The cholesterol efflux from cells in the arterial wall that have the potential to transform into foam cells, primarily macrophages, Table 4 Genotype distribution (percentage) of ABCA1 SNPs as a function of CHD, with P values for χ2 tests CHD history MI history Angina history Incident CHD Without With Without With Without With Without With n = 2647 n = 482 n = 2957 n = 172 n = 2750 n = 379 n = 2906 n = 223 CC 41.7 40.5 41.2 47.1 41.9 38.3 41.5 40.8 +69CNT CT 45.4 48.9 45.7 48.8 45.5 48.7 45.8 47.5 TT 13.0 10.6 13.1 4.1 12.5 13.0 12.7 11.7 P .23 .002 .40 .85 GG 75.3 74.6 75.3 73.5 75.2 74.8 75.2 74.9 +378GNC GC 22.9 23.5 22.8 25.3 23.0 22.8 22.9 23.3 CC 1.9 1.9 1.9 1.2 1.8 2.4 1.9 1.8 P .95 .63 .72 .99 RR 50.1 56.1 50.6 56.6 50.4 55.9 51.3 47.3 R219K RK 41.9 36.3 41.6 33.9 41.6 37.2 40.7 45.9 KK 8.0 7.6 7.8 9.5 8.1 7.0 8.0 6.8 P .05 .15 .13 .29 II 70.7 73.0 70.9 72.8 70.8 73.1 70.8 74.2 I883M IM 26.9 25.2 26.7 25.4 27.0 24.5 26.9 23.1 MM 2.4 1.9 2.3 1.8 2.3 2.4 2.3 2.7 P .56 .82 .61 .44 RR 54.8 51.2 54.3 53.5 54.8 50.4 54.0 57.5 R1587K RK 37.8 42.9 38.4 41.9 38.0 43.2 38.9 34.8 KK 7.3 5.9 7.3 4.7 7.2 6.4 7.1 7.7 P .09 .36 .16 .49 Table 5 Logistic regression analysis for CHD history (odds ratio with 95% CI) CHD MI Angina +69CNT Codominant 0.98 (0.84-1.14) P = .79 0.71 (0.56-0.91) P = .006 1.11 (0.94-1.30) P = .21 Recessive (TT vs C+) 0.83 (0.60-1.14) P = .26 0.28 (0.13-0.61) P = .001 1.10 (0.79-1.53) P = .57 R219K Codominant 0.86 (0.74-1.02) P = .08 0.92 (0.71-1.18) P = .50 0.86 (0.72-1.03) P = .10 Dominant (K+ vs RR) 0.80 (0.65-0.98) P = .03 0.81 (0.59-1.11) P = .19 0.82 (0.65-1.02) P = .08 R1587K Dominant (K+ vs RR) 1.22 (1.00-1.49) P = .06 1.04 (0.76-1.43) P = .79 1.27 (1.01-1.58) P = .04 Odds ratios (95% CI) for minor alleles of ABCA1 SNPs adjusted for age, sex, smoking, BMI, diabetes duration, hypertension, lipid-lowering treatment, serum creatinine, plasma triglyceride, and urinary albumin concentrations. Login to comment