ABCMdb

PMID: 16596262

Kolsch H, Lutjohann D, Jessen F, Von Bergmann K, Schmitz S, Urbach H, Maier W, Heun R
Polymorphism in ABCA1 influences CSF 24S-hydroxycholesterol levels but is not a major risk factor of Alzheimer's disease.
Int J Mol Med. 2006 May;17(5):791-4., [PubMed]

Sentences

No. Mutations Sentence Comment

2 ABCA1 p.Arg219Lys Since altered cholesterol metabolism is also involved in Alzheimer's disease (AD), the effects of two ABCA1 polymorphisms (G-395C promoter polymorphism (rs 2246293) and exonic R219K) on the risk of AD in 241 AD patients and 294 non-demented controls, and on CSF cholesterol and 24S-hydroxycholesterol in 74 AD patients and 42 non-demented controls were investigated. Login to comment 4 ABCA1 p.Arg219Lys However, the ABCA1 G-395C polymorphism influenced CSF levels of 24S-hydroxycholesterol, but not of cholesterol, whereas the R219K influenced neither CSF levels of 24S-hydroxycholesterol nor cholesterol. Login to comment 18 ABCA1 p.Arg219Lys Furthermore, an exonic non-synonymous (R219K) polymorphism influenced CSF cholesterol levels and risk of premature coronary heart disease in patients with hypercholesterolemia (17). Login to comment 21 ABCA1 p.Arg219Lys To further explore the effect of ABCA1 G-395C and R219K polymorphisms on AD risk and on the CSF levels of cholesterol and 24S-hydroxycholesterol, we investigated genotype distribution in a homogeneous age matched sample of German origin. Login to comment 32 ABCA1 p.Arg219Lys The G-395C promoter polymorphism [rs 2246293 (13)] and the R219K polymorphism in ABCA1 were determined by RFLP. Login to comment 33 ABCA1 p.Arg219Lys In brief, for the G-395C polymorphism the whole product was amplified using the following primers: 5'-TGAGGGAGAT TCAGCCTAGATC-3' (forward) and 5'-AGTGGAATTTGC TTCCTCTAGATC-3' (reverse), the forward primer contained a nucleotide change (underlined), to generate a control restriction site specific for BstY I. The amplification products of the Gand the C-alleles were 72, 24 and 18 bp or 96 and 18 bp. The R219K polymorphism was investigated by using the following primers: 5'- TCAGAAGAGATGATTCAACT TGG -3' (forward) and 5'-TTTCTACAAAACAAAGTCAT CCTG-3' (reverse), the reverse primer contained a nucleotide change (underlined), to generate a control restriction site specific for EcoN I. The amplification products of the Ror the K-alleles were 190 and 27 bp or 135, 55 and 27 bp. The APOE genotype was studied as described (24). Login to comment 45 ABCA1 p.Arg219Lys The power to detect a relative risk of 2.0 with &#b7;=0.05 was 98% for the R219K polymorphism and 92% for the G-395C polymorphism. Login to comment 50 ABCA1 p.Arg219Lys Genotype distribution and allele frequencies of both polymorphisms in AD patients and controls are given in Table I. Logistic regression analysis revealed that the two investigated ABCA1 polymorphisms did not influence the risk of AD (G-395C, presence of C-allele: c7;2 =0.31, d.f.=1, p=0.59; R219K, presence of K-allele: c7;2 =0.65, d.f.=1, p=0.42). Login to comment 51 ABCA1 p.Arg219Lys There was also no interaction between both ABCA1 polymorphisms on the risk of AD (c7;2 =0.81, d.f.=1, p=0.37), and no interaction between ABCA1 polymorphisms and the APOE4 allele (G-395C, presence of C-allele vs. presence of APOE4: c7;2 =1.61, d.f.=1, p=0.21; R219K, presence of K-allele vs. presence of APOE4: c7;2 =0.01, d.f.=1, p=0.95). Login to comment 55 ABCA1 p.Arg219Lys ----------------------------------------------------------------------------------------------------- ABCA1 G-395C Allele frequency Genotype &#af;2 test -------------- -------------- ----------------------------- --------------- n G C G/G (%) G/C (%) C/C (%) &#af; df p ----------------------------------------------------------------------------------------------------- AD patients 241 0.55 0.45 74 (30.7) 115 (47.7) 52 (21.6) 0.82 2 0.67 Controls 294 0.53 0.47 80 (27.2 149 (50.7) 65 (22.1) ----------------------------------------------------------------------------------------------------- ABCA1 R219K Allele frequency Genotype &#af;2 test ------------- -------------- ----------------------------- --------------- n R K R/R (%) R/K (%) K/K (%) &#af; df p ----------------------------------------------------------------------------------------------------- AD patients 241 0.72 0.28 130 (53.9) 88 (36.5) 23 (9.5) 1.89 2 0.39 Controls 294 0.72 0.28 149 (50.7) 123 (41.8) 22 (7.5) ----------------------------------------------------------------------------------------------------- 24S-hydroxycholesterol concentrations were lower in probands who were carriers of at least one C-allele of the ABCA1 G-395C polymorphism than in carriers of the GG-genotype (F=5.74, d.f.=1, p=0.018; Fig. 1); however, levels of cholesterol were not influenced by this polymorphism (F=0.87, d.f.=1, p=0.35). Login to comment 56 ABCA1 p.Arg219Lys We did not find any effect of the ABCA1 R219K polymorphism on the CSF levels of cholesterol (F=0.68, d.f.=1, p=0.41) or of 24S-hydroxycholesterol (F=0.01, d.f.=1, p=0.91) in our whole proband sample. Login to comment 61 ABCA1 p.Arg219Lys ABCA1 p.Arg219Lys Since a previous publication (19) reported altered levels of cholesterol depending on ABCA1 polymorphisms only in non-demented probands, statistical analysis assessed the interaction between ABCA1 polymorphisms and diagnosis: we did not find any significant interaction of ABCA1 polymorphisms and diagnosis either on cholesterol levels (G-395C, presence of C-allele vs. diagnosis: c7;2 =0.56, d.f.=1, p=0.45; R219K, presence of K-allele vs. diagnosis: c7;2 =0.07, d.f.=1, p=0.94) or on levels of 24S-hydroxycholesterol (G-395C, presence of C-allele vs. diagnosis: c7;2 =3.2, d.f.=1, p=0.08; R219K, presence of K-allele vs. diagnosis: c7;2 =0.27, d.f.=1, p=0.61). Login to comment 62 ABCA1 p.Arg219Lys Discussion We investigated the ABCA1 G-395C and R219K polymorphisms for their influence on the risk of AD and on CSF levels of cholesterol and 24S-hydroxycholesterol. Login to comment 65 ABCA1 p.Arg219Lys The exonic R219K polymorphism in ABCA1 has been shown to influence CSF cholesterol levels in healthy probands (19), while our study did not detect any effect. Login to comment 67 ABCA1 p.Arg219Lys We also did not find the exonic R219K or the promoter G-395C polymorphisms to influence the risk of AD; thus, we cannot support the suggestion that polymorphisms in ABCA1 might act as risk factors of AD. Login to comment